>Feature sequence001 32 907 gene locus_tag LOCUS_0010 32 907 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_0010 2164 965 gene locus_tag LOCUS_0020 2164 965 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_0020 2622 8924 gene locus_tag LOCUS_0030 2622 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 9227 9838 gene locus_tag LOCUS_0040 9227 9838 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_0040 10031 12898 gene locus_tag LOCUS_0050 10031 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 13193 14008 gene locus_tag LOCUS_0060 13193 14008 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_0060 14033 14746 gene locus_tag LOCUS_0070 14033 14746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_0070 14740 16338 gene locus_tag LOCUS_0080 14740 16338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_0080 17125 17200 gene locus_tag LOCUS_t0010 17125 17200 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17735 18037 gene locus_tag LOCUS_0090 17735 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 19897 18161 gene locus_tag LOCUS_0100 19897 18161 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_0100 21726 19891 gene locus_tag LOCUS_0110 21726 19891 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_0110 22129 22887 gene locus_tag LOCUS_0120 gene spo0A 22129 22887 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_0120 23713 23006 gene locus_tag LOCUS_0130 23713 23006 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_0130 24998 23859 gene locus_tag LOCUS_0140 24998 23859 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_0140 25946 25122 gene locus_tag LOCUS_0150 25946 25122 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_0150 26566 25943 gene locus_tag LOCUS_0160 26566 25943 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_0160 27967 26954 gene locus_tag LOCUS_0170 gene tsaD 27967 26954 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_0170 >Feature sequence002 2140 314 gene locus_tag LOCUS_0180 2140 314 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_0180 2751 2137 gene locus_tag LOCUS_0190 2751 2137 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_0190 4057 2762 gene locus_tag LOCUS_0200 4057 2762 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_0200 5798 4071 gene locus_tag LOCUS_0210 5798 4071 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_0210 6338 5817 gene locus_tag LOCUS_0220 6338 5817 CDS product DUF2764 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678963.1 protein_id gnl|my_center|LOCUS_0220 6910 6350 gene locus_tag LOCUS_0230 6910 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 9143 7092 gene locus_tag LOCUS_0240 9143 7092 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_0240 10221 9253 gene locus_tag LOCUS_0250 10221 9253 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_0250 10981 13614 gene locus_tag LOCUS_0260 10981 13614 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_0260 14020 13796 gene locus_tag LOCUS_0270 14020 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 14274 14594 gene locus_tag LOCUS_0280 gene spoIIAA 14274 14594 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_0280 14584 15027 gene locus_tag LOCUS_0290 gene spoIIAB 14584 15027 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_0290 15024 15731 gene locus_tag LOCUS_0300 gene sigF 15024 15731 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_0300 16485 15619 gene locus_tag LOCUS_0310 16485 15619 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_0310 17759 16491 gene locus_tag LOCUS_0320 17759 16491 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_0320 18039 20492 gene locus_tag LOCUS_0330 gene pcrA 18039 20492 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_0330 20503 21369 gene locus_tag LOCUS_0340 gene ylqF 20503 21369 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_0340 21370 22005 gene locus_tag LOCUS_0350 gene rnhB 21370 22005 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 protein_id gnl|my_center|LOCUS_0350 22002 22367 gene locus_tag LOCUS_0360 22002 22367 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_0360 22364 23353 gene locus_tag LOCUS_0370 22364 23353 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_0370 >Feature sequence003 881 117 gene locus_tag LOCUS_0380 881 117 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102216.1 protein_id gnl|my_center|LOCUS_0380 1409 906 gene locus_tag LOCUS_0390 1409 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 2144 1476 gene locus_tag LOCUS_0400 2144 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 2566 2228 gene locus_tag LOCUS_0410 2566 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 4335 2806 gene locus_tag LOCUS_0420 gene xylB 4335 2806 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_0420 4967 5431 gene locus_tag LOCUS_0430 4967 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_0430 5432 5911 gene locus_tag LOCUS_0440 5432 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_0440 5904 6773 gene locus_tag LOCUS_0450 5904 6773 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_0450 6877 7890 gene locus_tag LOCUS_0460 6877 7890 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_0460 8184 9701 gene locus_tag LOCUS_0470 8184 9701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_0470 9719 10711 gene locus_tag LOCUS_0480 9719 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 10802 12157 gene locus_tag LOCUS_0490 10802 12157 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_0490 12184 12810 gene locus_tag LOCUS_0500 12184 12810 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424384.1 protein_id gnl|my_center|LOCUS_0500 12822 13802 gene locus_tag LOCUS_0510 gene mch 12822 13802 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_0510 13799 14440 gene locus_tag LOCUS_0520 13799 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 14586 15314 gene locus_tag LOCUS_0530 14586 15314 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067058.1 protein_id gnl|my_center|LOCUS_0530 >Feature sequence004 1989 997 gene locus_tag LOCUS_0540 1989 997 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_0540 2886 2002 gene locus_tag LOCUS_0550 2886 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 3173 3490 gene locus_tag LOCUS_0560 3173 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 3496 5559 gene locus_tag LOCUS_0570 3496 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 5697 6146 gene locus_tag LOCUS_0580 gene dut 5697 6146 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 protein_id gnl|my_center|LOCUS_0580 6153 6731 gene locus_tag LOCUS_0590 6153 6731 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_0590 6736 7569 gene locus_tag LOCUS_0600 gene mreC 6736 7569 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_0600 7580 8086 gene locus_tag LOCUS_0610 7580 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 8124 10157 gene locus_tag LOCUS_0620 8124 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 10204 12018 gene locus_tag LOCUS_0630 10204 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 12265 13035 gene locus_tag LOCUS_0640 12265 13035 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_0640 13042 13914 gene locus_tag LOCUS_0650 13042 13914 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_0650 >Feature sequence005 817 1539 gene locus_tag LOCUS_0660 817 1539 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_0660 2279 3505 gene locus_tag LOCUS_0670 gene tyrS 2279 3505 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_0670 3858 4322 gene locus_tag LOCUS_0680 gene smpB 3858 4322 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_0680 4335 4877 gene locus_tag LOCUS_0690 4335 4877 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_0690 5142 5488 gene locus_tag LOCUS_tm0010 5142 5488 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5646 7475 gene locus_tag LOCUS_0700 gene ftsH 5646 7475 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_0700 7472 8023 gene locus_tag LOCUS_0710 7472 8023 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476518.1 protein_id gnl|my_center|LOCUS_0710 9248 8199 gene locus_tag LOCUS_0720 gene glmD 9248 8199 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147071.1 protein_id gnl|my_center|LOCUS_0720 9744 10748 gene locus_tag LOCUS_0730 gene aroF 9744 10748 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_0730 10745 11806 gene locus_tag LOCUS_0740 gene aroB 10745 11806 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_0740 11803 13092 gene locus_tag LOCUS_0750 gene aroA 11803 13092 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_0750 13059 14138 gene locus_tag LOCUS_0760 gene aroC 13059 14138 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_0760 14125 14400 gene locus_tag LOCUS_0770 14125 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 >Feature sequence006 <1 942 gene locus_tag LOCUS_0780 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107207.1:alpha-xylosidase 936 1781 gene locus_tag LOCUS_0790 gene fba 936 1781 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_0790 1817 2980 gene locus_tag LOCUS_0800 1817 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 2994 4412 gene locus_tag LOCUS_0810 2994 4412 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_0810 4423 5655 gene locus_tag LOCUS_0820 4423 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 5677 6837 gene locus_tag LOCUS_0830 5677 6837 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_0830 7002 7280 gene locus_tag LOCUS_0840 7002 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 7857 7621 gene locus_tag LOCUS_0850 7857 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 8473 7859 gene locus_tag LOCUS_0860 gene yedF 8473 7859 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_0860 9615 8587 gene locus_tag LOCUS_0870 gene selD 9615 8587 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_0870 9826 10752 gene locus_tag LOCUS_0880 9826 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 11531 10875 gene locus_tag LOCUS_0890 11531 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 13178 11664 gene locus_tag LOCUS_0900 gene gpmI 13178 11664 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_0900 13978 13205 gene locus_tag LOCUS_0910 gene tpiA 13978 13205 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_0910 14182 14033 gene locus_tag LOCUS_0920 14182 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 14597 14313 gene locus_tag LOCUS_0930 14597 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 >Feature sequence007 1461 1036 gene locus_tag LOCUS_0940 1461 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 1749 2162 gene locus_tag LOCUS_0950 1749 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 2543 2235 gene locus_tag LOCUS_0960 2543 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 3871 2642 gene locus_tag LOCUS_0970 3871 2642 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_0970 3976 4719 gene locus_tag LOCUS_0980 3976 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 4894 6444 gene locus_tag LOCUS_0990 gene rny 4894 6444 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_0990 6621 7397 gene locus_tag LOCUS_1000 6621 7397 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_1000 7413 7907 gene locus_tag LOCUS_1010 7413 7907 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_1010 7904 8983 gene locus_tag LOCUS_1020 7904 8983 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233258.1 protein_id gnl|my_center|LOCUS_1020 9184 10179 gene locus_tag LOCUS_1030 gene ansA 9184 10179 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_1030 10311 11750 gene locus_tag LOCUS_1040 gene proS 10311 11750 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_1040 12128 12009 gene locus_tag LOCUS_1050 12128 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 12285 12130 gene locus_tag LOCUS_1060 12285 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 12914 12477 gene locus_tag LOCUS_1070 12914 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 13055 13315 gene locus_tag LOCUS_1080 13055 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 13334 13555 gene locus_tag LOCUS_1090 13334 13555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 >Feature sequence008 <1 1301 gene locus_tag LOCUS_1100 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986285.1:NADPH-dependent glutamate synthase 2635 1379 gene locus_tag LOCUS_1110 2635 1379 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_1110 3422 2640 gene locus_tag LOCUS_1120 gene proB 3422 2640 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_1120 3533 3682 gene locus_tag LOCUS_1130 3533 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 3702 4610 gene locus_tag LOCUS_1140 3702 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 5623 7161 gene locus_tag LOCUS_1150 5623 7161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_1150 7158 8318 gene locus_tag LOCUS_1160 7158 8318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_1160 8318 9259 gene locus_tag LOCUS_1170 8318 9259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_1170 9365 9625 gene locus_tag LOCUS_1180 9365 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 10850 9660 gene locus_tag LOCUS_1190 10850 9660 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_1190 11786 10872 gene locus_tag LOCUS_1200 11786 10872 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 protein_id gnl|my_center|LOCUS_1200 11993 13099 gene locus_tag LOCUS_1210 11993 13099 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 protein_id gnl|my_center|LOCUS_1210 13691 13074 gene locus_tag LOCUS_1220 13691 13074 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_1220 >Feature sequence009 1477 578 gene locus_tag LOCUS_1230 1477 578 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_1230 2729 1506 gene locus_tag LOCUS_1240 2729 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 3839 3114 gene locus_tag LOCUS_1250 3839 3114 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_1250 4061 5245 gene locus_tag LOCUS_1260 4061 5245 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_1260 5238 6029 gene locus_tag LOCUS_1270 5238 6029 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_1270 6893 6087 gene locus_tag LOCUS_1280 gene proC 6893 6087 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_1280 7020 7763 gene locus_tag LOCUS_1290 7020 7763 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940908.1 protein_id gnl|my_center|LOCUS_1290 8481 7804 gene locus_tag LOCUS_1300 8481 7804 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_1300 9200 8478 gene locus_tag LOCUS_1310 9200 8478 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_1310 10848 9298 gene locus_tag LOCUS_1320 10848 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 11403 11573 gene locus_tag LOCUS_1330 11403 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 11870 11583 gene locus_tag LOCUS_1340 11870 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 >Feature sequence010 468 731 gene locus_tag LOCUS_1350 468 731 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_1350 990 1445 gene locus_tag LOCUS_1360 gene rimP 990 1445 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_1360 1561 2631 gene locus_tag LOCUS_1370 gene nusA 1561 2631 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_1370 2887 3153 gene locus_tag LOCUS_1380 2887 3153 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_1380 3156 3791 gene locus_tag LOCUS_1390 3156 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 4010 6364 gene locus_tag LOCUS_1400 4010 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 6780 7166 gene locus_tag LOCUS_1410 gene rbfA 6780 7166 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_1410 7163 8107 gene locus_tag LOCUS_1420 7163 8107 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_1420 8108 8977 gene locus_tag LOCUS_1430 gene truB 8108 8977 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 protein_id gnl|my_center|LOCUS_1430 8984 9889 gene locus_tag LOCUS_1440 8984 9889 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_1440 10001 11980 gene locus_tag LOCUS_1450 10001 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 12157 12429 gene locus_tag LOCUS_1460 12157 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 12563 13531 gene locus_tag LOCUS_1470 gene dusB 12563 13531 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_1470 >Feature sequence011 503 2581 gene locus_tag LOCUS_1480 gene recJ 503 2581 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_1480 2593 4800 gene locus_tag LOCUS_1490 gene relA 2593 4800 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_1490 5143 5589 gene locus_tag LOCUS_1500 gene dtd 5143 5589 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_1500 5602 6225 gene locus_tag LOCUS_1510 5602 6225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_1510 6222 7700 gene locus_tag LOCUS_1520 6222 7700 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 protein_id gnl|my_center|LOCUS_1520 7729 9315 gene locus_tag LOCUS_1530 7729 9315 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_1530 9351 10133 gene locus_tag LOCUS_1540 9351 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 10202 10477 gene locus_tag LOCUS_1550 10202 10477 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_1550 10543 10800 gene locus_tag LOCUS_1560 10543 10800 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 protein_id gnl|my_center|LOCUS_1560 10855 11139 gene locus_tag LOCUS_1570 10855 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 11143 11619 gene locus_tag LOCUS_1580 11143 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 11616 11906 gene locus_tag LOCUS_1590 11616 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 11943 12377 gene locus_tag LOCUS_1600 11943 12377 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021445.1 protein_id gnl|my_center|LOCUS_1600 13225 12749 gene locus_tag LOCUS_1610 13225 12749 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_1610 >Feature sequence012 81 1367 gene locus_tag LOCUS_1620 81 1367 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_1620 2237 2695 gene locus_tag LOCUS_1630 2237 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 2692 4431 gene locus_tag LOCUS_1640 2692 4431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_1640 4424 6310 gene locus_tag LOCUS_1650 4424 6310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_1650 6443 6832 gene locus_tag LOCUS_1660 6443 6832 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_1660 6891 7124 gene locus_tag LOCUS_1670 6891 7124 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_1670 7729 7226 gene locus_tag LOCUS_1680 7729 7226 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_1680 8048 8344 gene locus_tag LOCUS_1690 gene rpsF 8048 8344 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_1690 8358 8792 gene locus_tag LOCUS_1700 gene ssbA 8358 8792 CDS product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609606.1 protein_id gnl|my_center|LOCUS_1700 8839 9090 gene locus_tag LOCUS_1710 gene rpsR 8839 9090 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_1710 9302 9604 gene locus_tag LOCUS_1720 9302 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 10068 9844 gene locus_tag LOCUS_1730 10068 9844 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_1730 11897 10239 gene locus_tag LOCUS_1740 11897 10239 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_1740 12123 12320 gene locus_tag LOCUS_1750 12123 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 >Feature sequence013 2905 737 gene locus_tag LOCUS_1760 2905 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 3586 2960 gene locus_tag LOCUS_1770 3586 2960 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_1770 4905 3610 gene locus_tag LOCUS_1780 4905 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 6483 4978 gene locus_tag LOCUS_1790 6483 4978 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775020.1 protein_id gnl|my_center|LOCUS_1790 7581 6526 gene locus_tag LOCUS_1800 7581 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 8199 7627 gene locus_tag LOCUS_1810 8199 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 8380 8832 gene locus_tag LOCUS_1820 8380 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 9392 8802 gene locus_tag LOCUS_1830 9392 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 9548 10258 gene locus_tag LOCUS_1840 9548 10258 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_1840 12762 10474 gene locus_tag LOCUS_1850 12762 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 >Feature sequence014 945 1580 gene locus_tag LOCUS_1860 945 1580 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_1860 1602 3083 gene locus_tag LOCUS_1870 1602 3083 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_1870 3306 3139 gene locus_tag LOCUS_1880 3306 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 3457 3630 gene locus_tag LOCUS_1890 3457 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 3660 4901 gene locus_tag LOCUS_1900 3660 4901 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_1900 5969 5082 gene locus_tag LOCUS_1910 5969 5082 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_1910 6126 6689 gene locus_tag LOCUS_1920 6126 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 6694 7260 gene locus_tag LOCUS_1930 gene eutD 6694 7260 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_1930 8007 7327 gene locus_tag LOCUS_1940 8007 7327 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_1940 9424 8063 gene locus_tag LOCUS_1950 9424 8063 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_1950 9508 9867 gene locus_tag LOCUS_1960 9508 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 9864 10553 gene locus_tag LOCUS_1970 gene walR 9864 10553 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 protein_id gnl|my_center|LOCUS_1970 10543 11949 gene locus_tag LOCUS_1980 10543 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 >Feature sequence015 1730 318 gene locus_tag LOCUS_1990 gene miaB 1730 318 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_1990 1894 2394 gene locus_tag LOCUS_2000 gene lspA 1894 2394 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_2000 2363 3280 gene locus_tag LOCUS_2010 2363 3280 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_2010 3708 3337 gene locus_tag LOCUS_2020 3708 3337 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_2020 3879 5066 gene locus_tag LOCUS_2030 gene nifS 3879 5066 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_2030 5083 5517 gene locus_tag LOCUS_2040 gene nifU 5083 5517 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_2040 5781 6194 gene locus_tag LOCUS_2050 5781 6194 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_2050 8543 6369 gene locus_tag LOCUS_2060 8543 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 9326 8553 gene locus_tag LOCUS_2070 gene rlmB 9326 8553 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_2070 9614 11773 gene locus_tag LOCUS_2080 gene ftsH 9614 11773 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_2080 >Feature sequence016 1923 760 gene locus_tag LOCUS_2090 1923 760 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_2090 2619 2203 gene locus_tag LOCUS_2100 2619 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_2100 3221 2655 gene locus_tag LOCUS_2110 gene efp 3221 2655 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_2110 4446 3373 gene locus_tag LOCUS_2120 4446 3373 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_2120 4955 4443 gene locus_tag LOCUS_2130 4955 4443 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_2130 5036 5776 gene locus_tag LOCUS_2140 5036 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 6255 6070 gene locus_tag LOCUS_2150 gene rpsU 6255 6070 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_2150 9190 6680 gene locus_tag LOCUS_2160 gene leuS 9190 6680 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_2160 9951 10532 gene locus_tag LOCUS_2170 9951 10532 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_2170 10529 12061 gene locus_tag LOCUS_2180 gene guaA 10529 12061 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_2180 12401 12192 gene locus_tag LOCUS_2190 12401 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 >Feature sequence017 <1 1721 gene locus_tag LOCUS_2200 <1 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891588.1:selenium-dependent xanthine dehydrogenase 1995 2534 gene locus_tag LOCUS_2210 1995 2534 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880824.1 protein_id gnl|my_center|LOCUS_2210 2778 2590 gene locus_tag LOCUS_2220 gene rpmB 2778 2590 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_2220 3017 3979 gene locus_tag LOCUS_2230 gene hprK 3017 3979 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_2230 3976 4938 gene locus_tag LOCUS_2240 gene glcK 3976 4938 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_2240 4950 5864 gene locus_tag LOCUS_2250 gene murB 4950 5864 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905790.1 protein_id gnl|my_center|LOCUS_2250 5877 6734 gene locus_tag LOCUS_2260 gene rapZ 5877 6734 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_2260 6746 7792 gene locus_tag LOCUS_2270 6746 7792 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_2270 7801 8709 gene locus_tag LOCUS_2280 gene whiA 7801 8709 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_2280 8706 9155 gene locus_tag LOCUS_2290 8706 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 >Feature sequence018 2055 568 gene locus_tag LOCUS_2300 2055 568 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 protein_id gnl|my_center|LOCUS_2300 3636 2086 gene locus_tag LOCUS_2310 3636 2086 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_2310 4445 3633 gene locus_tag LOCUS_2320 gene pgeF 4445 3633 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_2320 7486 4748 gene locus_tag LOCUS_2330 gene secA 7486 4748 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_2330 9309 7786 gene locus_tag LOCUS_2340 9309 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 10755 9766 gene locus_tag LOCUS_2350 10755 9766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_2350 11567 10752 gene locus_tag LOCUS_2360 11567 10752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_2360 >Feature sequence019 102 839 gene locus_tag LOCUS_2370 gene rpsB 102 839 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_2370 925 1851 gene locus_tag LOCUS_2380 gene tsf 925 1851 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_2380 2568 2002 gene locus_tag LOCUS_2390 2568 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 2937 5078 gene locus_tag LOCUS_2400 2937 5078 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869185.1 protein_id gnl|my_center|LOCUS_2400 5071 5553 gene locus_tag LOCUS_2410 5071 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 5541 6410 gene locus_tag LOCUS_2420 5541 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_2420 6426 7118 gene locus_tag LOCUS_2430 6426 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 7124 10003 gene locus_tag LOCUS_2440 7124 10003 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_2440 11298 10114 gene locus_tag LOCUS_2450 11298 10114 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_2450 >Feature sequence020 521 847 gene locus_tag LOCUS_2460 521 847 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214419.1 protein_id gnl|my_center|LOCUS_2460 849 2912 gene locus_tag LOCUS_2470 gene recG 849 2912 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_2470 2970 4802 gene locus_tag LOCUS_2480 gene uvrC 2970 4802 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_2480 6274 4916 gene locus_tag LOCUS_2490 6274 4916 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_2490 6821 6591 gene locus_tag LOCUS_2500 6821 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 8651 6891 gene locus_tag LOCUS_2510 8651 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 9335 8664 gene locus_tag LOCUS_2520 9335 8664 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_2520 10091 9420 gene locus_tag LOCUS_2530 10091 9420 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_2530 <11073 10412 gene locus_tag LOCUS_2540 <11073 10412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262036.1:oleate hydratase >Feature sequence021 <1 847 gene locus_tag LOCUS_2550 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209876.1:tagatose-bisphosphate aldolase subunit KbaZ 889 1815 gene locus_tag LOCUS_2560 889 1815 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_2560 1872 3200 gene locus_tag LOCUS_2570 1872 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 3279 4157 gene locus_tag LOCUS_2580 3279 4157 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_2580 4150 4980 gene locus_tag LOCUS_2590 4150 4980 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_2590 5015 6235 gene locus_tag LOCUS_2600 5015 6235 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_2600 6517 6368 gene locus_tag LOCUS_2610 6517 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2610 6793 6605 gene locus_tag LOCUS_2620 6793 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2620 6998 7558 gene locus_tag LOCUS_2630 6998 7558 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_2630 7694 7603 gene locus_tag LOCUS_t0020 7694 7603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8003 7827 gene locus_tag LOCUS_2640 8003 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 8140 8907 gene locus_tag LOCUS_2650 8140 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 8918 9946 gene locus_tag LOCUS_2660 8918 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 >Feature sequence022 503 1309 gene locus_tag LOCUS_2670 503 1309 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_2670 1364 2236 gene locus_tag LOCUS_2680 gene pstC 1364 2236 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_2680 2238 3080 gene locus_tag LOCUS_2690 gene pstA 2238 3080 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_2690 3077 3832 gene locus_tag LOCUS_2700 gene pstB 3077 3832 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_2700 3825 4490 gene locus_tag LOCUS_2710 gene phoU 3825 4490 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_2710 4664 5188 gene locus_tag LOCUS_2720 4664 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 5422 5216 gene locus_tag LOCUS_2730 5422 5216 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_2730 5632 6915 gene locus_tag LOCUS_2740 5632 6915 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_2740 7002 7364 gene locus_tag LOCUS_2750 7002 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 7361 8212 gene locus_tag LOCUS_2760 gene ispE 7361 8212 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_2760 8268 8900 gene locus_tag LOCUS_2770 gene spoIIR 8268 8900 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_2770 >Feature sequence023 <1 610 gene locus_tag LOCUS_2780 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249659.1:ABC transporter ATP-binding protein 1636 647 gene locus_tag LOCUS_2790 1636 647 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_2790 2304 1633 gene locus_tag LOCUS_2800 2304 1633 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_2800 4615 2543 gene locus_tag LOCUS_2810 4615 2543 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_2810 5376 4612 gene locus_tag LOCUS_2820 5376 4612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_2820 6443 5745 gene locus_tag LOCUS_2830 6443 5745 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_2830 8249 6474 gene locus_tag LOCUS_2840 8249 6474 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460241.1 protein_id gnl|my_center|LOCUS_2840 9117 8242 gene locus_tag LOCUS_2850 9117 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 <10502 9765 gene locus_tag LOCUS_2860 <10502 9765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462263.1:asparagine--tRNA ligase >Feature sequence024 106 32 gene locus_tag LOCUS_t0030 106 32 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 236 160 gene locus_tag LOCUS_t0040 236 160 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 534 866 gene locus_tag LOCUS_2870 534 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 2551 917 gene locus_tag LOCUS_2880 gene groL 2551 917 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_2880 2998 2714 gene locus_tag LOCUS_2890 2998 2714 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_2890 4059 3133 gene locus_tag LOCUS_2900 4059 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 5370 4255 gene locus_tag LOCUS_2910 5370 4255 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_2910 5847 6644 gene locus_tag LOCUS_2920 5847 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 6683 7603 gene locus_tag LOCUS_2930 6683 7603 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_2930 7610 7816 gene locus_tag LOCUS_2940 7610 7816 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_2940 7832 8152 gene locus_tag LOCUS_2950 7832 8152 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 protein_id gnl|my_center|LOCUS_2950 9616 8345 gene locus_tag LOCUS_2960 9616 8345 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_2960 10352 9861 gene locus_tag LOCUS_2970 10352 9861 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_2970 >Feature sequence025 2165 936 gene locus_tag LOCUS_2980 2165 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_2980 6931 2162 gene locus_tag LOCUS_2990 6931 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_2990 8364 7108 gene locus_tag LOCUS_3000 8364 7108 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_3000 9346 8450 gene locus_tag LOCUS_3010 9346 8450 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_3010 <10045 9475 gene locus_tag LOCUS_3020 <10045 9475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667252.1:aminopeptidase >Feature sequence026 193 666 gene locus_tag LOCUS_3030 193 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 1036 1416 gene locus_tag LOCUS_3040 1036 1416 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_3040 4080 1582 gene locus_tag LOCUS_3050 4080 1582 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_3050 4572 4126 gene locus_tag LOCUS_3060 4572 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 5045 4596 gene locus_tag LOCUS_3070 5045 4596 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701965.1 protein_id gnl|my_center|LOCUS_3070 5283 5456 gene locus_tag LOCUS_3080 5283 5456 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_3080 5626 6351 gene locus_tag LOCUS_3090 5626 6351 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457100.1 protein_id gnl|my_center|LOCUS_3090 6358 7191 gene locus_tag LOCUS_3100 gene rsmI 6358 7191 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_3100 7523 7278 gene locus_tag LOCUS_3110 7523 7278 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_3110 7665 8240 gene locus_tag LOCUS_3120 7665 8240 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_3120 8237 8764 gene locus_tag LOCUS_3130 8237 8764 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_3130 <10041 9167 gene locus_tag LOCUS_3140 <10041 9167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393887.1:arginine--tRNA ligase >Feature sequence027 15 218 gene locus_tag LOCUS_3150 gene rpmE 15 218 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_3150 828 628 gene locus_tag LOCUS_3160 828 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 1107 1718 gene locus_tag LOCUS_3170 1107 1718 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_3170 1732 2505 gene locus_tag LOCUS_3180 1732 2505 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_3180 2517 3098 gene locus_tag LOCUS_3190 gene scpB 2517 3098 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_3190 3129 3854 gene locus_tag LOCUS_3200 3129 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 3775 4170 gene locus_tag LOCUS_3210 gene ytfJ 3775 4170 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_3210 4214 5029 gene locus_tag LOCUS_3220 4214 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 5117 5764 gene locus_tag LOCUS_3230 5117 5764 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_3230 5761 6624 gene locus_tag LOCUS_3240 5761 6624 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_3240 6617 7867 gene locus_tag LOCUS_3250 6617 7867 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_3250 7864 8538 gene locus_tag LOCUS_3260 gene cmk 7864 8538 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_3260 8538 9143 gene locus_tag LOCUS_3270 8538 9143 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583517.1 protein_id gnl|my_center|LOCUS_3270 >Feature sequence028 <1 583 gene locus_tag LOCUS_3280 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986205.1:magnesium transporter 779 967 gene locus_tag LOCUS_3290 779 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 1013 1366 gene locus_tag LOCUS_3300 1013 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 1363 1734 gene locus_tag LOCUS_3310 1363 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 3183 1885 gene locus_tag LOCUS_3320 3183 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 4652 3180 gene locus_tag LOCUS_3330 4652 3180 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_3330 5332 4652 gene locus_tag LOCUS_3340 5332 4652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_3340 6437 5448 gene locus_tag LOCUS_3350 gene spoIID 6437 5448 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_3350 7209 6760 gene locus_tag LOCUS_3360 gene tadA 7209 6760 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_3360 7316 7621 gene locus_tag LOCUS_3370 7316 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 7609 7875 gene locus_tag LOCUS_3380 7609 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 8813 8088 gene locus_tag LOCUS_3390 8813 8088 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_3390 9053 9478 gene locus_tag LOCUS_3400 gene rplM 9053 9478 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_3400 9493 9897 gene locus_tag LOCUS_3410 gene rpsI 9493 9897 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_3410 >Feature sequence029 1556 972 gene locus_tag LOCUS_3420 1556 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 3082 1871 gene locus_tag LOCUS_3430 3082 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 3654 3079 gene locus_tag LOCUS_3440 3654 3079 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_3440 4771 3914 gene locus_tag LOCUS_3450 4771 3914 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_3450 4899 5591 gene locus_tag LOCUS_3460 4899 5591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_3460 5578 6639 gene locus_tag LOCUS_3470 5578 6639 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_3470 6735 7391 gene locus_tag LOCUS_3480 6735 7391 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964798.1 protein_id gnl|my_center|LOCUS_3480 7424 8185 gene locus_tag LOCUS_3490 7424 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 >Feature sequence030 1358 846 gene locus_tag LOCUS_3500 1358 846 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316661.1 protein_id gnl|my_center|LOCUS_3500 1926 1348 gene locus_tag LOCUS_3510 gene rnmV 1926 1348 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305490.1 protein_id gnl|my_center|LOCUS_3510 2975 1923 gene locus_tag LOCUS_3520 2975 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 5282 2994 gene locus_tag LOCUS_3530 5282 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 6142 5531 gene locus_tag LOCUS_3540 6142 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 6395 7105 gene locus_tag LOCUS_3550 gene sigK 6395 7105 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_3550 7211 8752 gene locus_tag LOCUS_3560 7211 8752 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_3560 >Feature sequence031 <1 1706 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcccgccccgcatggggcgggtggattgaaat 2811 1792 gene locus_tag LOCUS_3570 2811 1792 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_3570 2941 3471 gene locus_tag LOCUS_3580 2941 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 3608 4318 gene locus_tag LOCUS_3590 3608 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 4337 5497 gene locus_tag LOCUS_3600 4337 5497 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_3600 5523 6017 gene locus_tag LOCUS_3610 5523 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 6857 6099 gene locus_tag LOCUS_3620 6857 6099 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_3620 8566 6854 gene locus_tag LOCUS_3630 8566 6854 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_3630 >Feature sequence032 3021 706 gene locus_tag LOCUS_3640 gene topA 3021 706 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_3640 4245 3031 gene locus_tag LOCUS_3650 4245 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 5015 4233 gene locus_tag LOCUS_3660 5015 4233 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_3660 5898 5512 gene locus_tag LOCUS_3670 5898 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 6105 6341 gene locus_tag LOCUS_3680 6105 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 6313 7173 gene locus_tag LOCUS_3690 6313 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 7356 7796 gene locus_tag LOCUS_3700 7356 7796 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_3700 7807 8274 gene locus_tag LOCUS_3710 7807 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 8449 9114 gene locus_tag LOCUS_3720 8449 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 >Feature sequence033 1592 234 gene locus_tag LOCUS_3730 1592 234 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_3730 3596 1866 gene locus_tag LOCUS_3740 3596 1866 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264938.1 protein_id gnl|my_center|LOCUS_3740 4011 3631 gene locus_tag LOCUS_3750 4011 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 4522 4040 gene locus_tag LOCUS_3760 gene rlmH 4522 4040 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_3760 5310 4510 gene locus_tag LOCUS_3770 5310 4510 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_3770 6765 5467 gene locus_tag LOCUS_3780 6765 5467 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_3780 7229 7591 gene locus_tag LOCUS_3790 7229 7591 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_3790 7611 7829 gene locus_tag LOCUS_3800 7611 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 >Feature sequence034 177 1595 gene locus_tag LOCUS_3810 gene lpdA 177 1595 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_3810 1678 2688 gene locus_tag LOCUS_3820 1678 2688 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948422.1 protein_id gnl|my_center|LOCUS_3820 3687 2944 gene locus_tag LOCUS_3830 3687 2944 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_3830 4378 3677 gene locus_tag LOCUS_3840 4378 3677 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_3840 5570 4704 gene locus_tag LOCUS_3850 5570 4704 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_3850 7106 5955 gene locus_tag LOCUS_3860 7106 5955 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986546.1 protein_id gnl|my_center|LOCUS_3860 8406 7096 gene locus_tag LOCUS_3870 gene larA 8406 7096 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_3870 9092 8706 gene locus_tag LOCUS_3880 9092 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 >Feature sequence035 <1 525 gene locus_tag LOCUS_3890 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541505.1:PolC-type DNA polymerase III 1482 577 gene locus_tag LOCUS_3900 1482 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 2783 1506 gene locus_tag LOCUS_3910 2783 1506 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_3910 3022 2780 gene locus_tag LOCUS_3920 3022 2780 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461313.1 protein_id gnl|my_center|LOCUS_3920 3912 3154 gene locus_tag LOCUS_3930 3912 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 4011 4943 gene locus_tag LOCUS_3940 4011 4943 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_3940 6129 4993 gene locus_tag LOCUS_3950 6129 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 6488 6994 gene locus_tag LOCUS_3960 gene rimM 6488 6994 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_3960 6984 7757 gene locus_tag LOCUS_3970 gene trmD 6984 7757 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_3970 8205 8570 gene locus_tag LOCUS_3980 8205 8570 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_3980 >Feature sequence036 <1 657 gene locus_tag LOCUS_3990 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002303623.1:iron-containing alcohol dehydrogenase family protein 842 3010 gene locus_tag LOCUS_4000 842 3010 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_4000 3256 3450 gene locus_tag LOCUS_4010 3256 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 3695 4708 gene locus_tag LOCUS_4020 3695 4708 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_4020 4761 6062 gene locus_tag LOCUS_4030 4761 6062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_4030 6197 7111 gene locus_tag LOCUS_4040 6197 7111 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_4040 7111 8010 gene locus_tag LOCUS_4050 7111 8010 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_4050 >Feature sequence037 2600 948 gene locus_tag LOCUS_4060 2600 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 4492 2615 gene locus_tag LOCUS_4070 4492 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 4758 5036 gene locus_tag LOCUS_4080 4758 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 5030 6589 gene locus_tag LOCUS_4090 5030 6589 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_4090 6586 7260 gene locus_tag LOCUS_4100 6586 7260 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_4100 >Feature sequence038 2177 1101 gene locus_tag LOCUS_4110 2177 1101 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_4110 2348 3637 gene locus_tag LOCUS_4120 gene mtaB 2348 3637 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_4120 3634 4206 gene locus_tag LOCUS_4130 gene yfbR 3634 4206 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 protein_id gnl|my_center|LOCUS_4130 4214 4483 gene locus_tag LOCUS_4140 4214 4483 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_4140 4496 5854 gene locus_tag LOCUS_4150 4496 5854 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_4150 7586 6168 gene locus_tag LOCUS_4160 7586 6168 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_4160 8536 8057 gene locus_tag LOCUS_4170 8536 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 >Feature sequence039 1302 628 gene locus_tag LOCUS_4180 1302 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 1859 1299 gene locus_tag LOCUS_4190 1859 1299 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930688.1 protein_id gnl|my_center|LOCUS_4190 3673 2063 gene locus_tag LOCUS_4200 3673 2063 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_4200 5641 3851 gene locus_tag LOCUS_4210 5641 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 6515 5616 gene locus_tag LOCUS_4220 6515 5616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_4220 6874 6512 gene locus_tag LOCUS_4230 6874 6512 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_4230 7431 7619 gene locus_tag LOCUS_4240 7431 7619 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966884.1 protein_id gnl|my_center|LOCUS_4240 7789 8055 gene locus_tag LOCUS_4250 gene rpsO 7789 8055 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_4250 >Feature sequence040 731 141 gene locus_tag LOCUS_4260 gene rdgB 731 141 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_4260 1461 745 gene locus_tag LOCUS_4270 1461 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4270 2345 1476 gene locus_tag LOCUS_4280 2345 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 6131 2553 gene locus_tag LOCUS_4290 gene smc 6131 2553 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_4290 6397 6966 gene locus_tag LOCUS_4300 6397 6966 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295844.1 protein_id gnl|my_center|LOCUS_4300 6980 7753 gene locus_tag LOCUS_4310 6980 7753 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_4310 >Feature sequence041 1234 98 gene locus_tag LOCUS_4320 1234 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 1908 1231 gene locus_tag LOCUS_4330 1908 1231 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_4330 2187 3116 gene locus_tag LOCUS_4340 2187 3116 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_4340 3113 3619 gene locus_tag LOCUS_4350 3113 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 3644 4063 gene locus_tag LOCUS_4360 3644 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 4233 4970 gene locus_tag LOCUS_4370 4233 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 5062 5766 gene locus_tag LOCUS_4380 5062 5766 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_4380 5763 6983 gene locus_tag LOCUS_4390 5763 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 7651 7148 gene locus_tag LOCUS_4400 7651 7148 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_4400 7833 7669 gene locus_tag LOCUS_4410 7833 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 8273 7830 gene locus_tag LOCUS_4420 8273 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800831.1 protein_id gnl|my_center|LOCUS_4420 >Feature sequence042 <1 1099 gene locus_tag LOCUS_4430 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812452.1:ATP-binding cassette domain-containing protein 1096 1821 gene locus_tag LOCUS_4440 1096 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 1826 2710 gene locus_tag LOCUS_4450 1826 2710 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_4450 2789 3298 gene locus_tag LOCUS_4460 2789 3298 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_4460 3376 4482 gene locus_tag LOCUS_4470 3376 4482 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_4470 5291 5503 gene locus_tag LOCUS_4480 5291 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 5519 5740 gene locus_tag LOCUS_4490 5519 5740 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_4490 >Feature sequence043 104 385 gene locus_tag LOCUS_4500 gene rpmA 104 385 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_4500 677 1012 gene locus_tag LOCUS_4510 677 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 1840 1283 gene locus_tag LOCUS_4520 1840 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 2179 2712 gene locus_tag LOCUS_4530 2179 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4530 2750 4819 gene locus_tag LOCUS_4540 2750 4819 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4540 5454 5044 gene locus_tag LOCUS_4550 5454 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 6894 5551 gene locus_tag LOCUS_4560 6894 5551 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_4560 8104 6974 gene locus_tag LOCUS_4570 8104 6974 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_4570 >Feature sequence044 1395 796 gene locus_tag LOCUS_4580 gene recR 1395 796 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_4580 2044 1400 gene locus_tag LOCUS_4590 gene rpe 2044 1400 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_4590 3556 2321 gene locus_tag LOCUS_4600 3556 2321 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_4600 4948 3590 gene locus_tag LOCUS_4610 gene trkA 4948 3590 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_4610 5853 4945 gene locus_tag LOCUS_4620 5853 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 6202 6636 gene locus_tag LOCUS_4630 6202 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 6651 7310 gene locus_tag LOCUS_4640 6651 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 7948 7595 gene locus_tag LOCUS_4650 7948 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 7943 8164 gene locus_tag LOCUS_4660 7943 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 >Feature sequence045 34 2022 gene locus_tag LOCUS_4670 34 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 2938 2036 gene locus_tag LOCUS_4680 2938 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 3296 3577 gene locus_tag LOCUS_4690 3296 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 3582 4781 gene locus_tag LOCUS_4700 3582 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 4793 5752 gene locus_tag LOCUS_4710 4793 5752 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_4710 5749 6243 gene locus_tag LOCUS_4720 gene ybeY 5749 6243 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_4720 6348 6998 gene locus_tag LOCUS_4730 6348 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 7014 7343 gene locus_tag LOCUS_4740 7014 7343 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_4740 >Feature sequence046 1670 2992 gene locus_tag LOCUS_4750 1670 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 4580 3453 gene locus_tag LOCUS_4760 4580 3453 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_4760 5458 4577 gene locus_tag LOCUS_4770 5458 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 6202 5468 gene locus_tag LOCUS_4780 6202 5468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_4780 7018 6212 gene locus_tag LOCUS_4790 7018 6212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_4790 <7837 7036 gene locus_tag LOCUS_4800 <7837 7036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457241.1:alpha-L-glutamate ligase-like protein >Feature sequence047 2146 977 gene locus_tag LOCUS_4810 2146 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_4810 2367 3398 gene locus_tag LOCUS_4820 2367 3398 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_4820 3530 4438 gene locus_tag LOCUS_4830 3530 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 4637 5317 gene locus_tag LOCUS_4840 4637 5317 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_4840 5314 6540 gene locus_tag LOCUS_4850 5314 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 6534 7493 gene locus_tag LOCUS_4860 6534 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4860 >Feature sequence048 2374 1544 gene locus_tag LOCUS_4870 2374 1544 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898776.1 protein_id gnl|my_center|LOCUS_4870 3278 2379 gene locus_tag LOCUS_4880 3278 2379 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969228.1 protein_id gnl|my_center|LOCUS_4880 4621 3350 gene locus_tag LOCUS_4890 4621 3350 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_4890 5152 4664 gene locus_tag LOCUS_4900 5152 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 5395 6762 gene locus_tag LOCUS_4910 5395 6762 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_4910 >Feature sequence049 1335 145 gene locus_tag LOCUS_4920 gene porA 1335 145 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_4920 1607 1335 gene locus_tag LOCUS_4930 gene porD 1607 1335 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_4930 2169 1624 gene locus_tag LOCUS_4940 2169 1624 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_4940 2881 2201 gene locus_tag LOCUS_4950 2881 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 4322 2886 gene locus_tag LOCUS_4960 4322 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4960 4646 4362 gene locus_tag LOCUS_4970 4646 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 6367 4772 gene locus_tag LOCUS_4980 6367 4772 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079489562.1 protein_id gnl|my_center|LOCUS_4980 <7236 6364 gene locus_tag LOCUS_4990 <7236 6364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527984.1:HpcH/HpaI aldolase/citrate lyase family protein >Feature sequence050 1008 376 gene locus_tag LOCUS_5000 1008 376 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_5000 2309 1005 gene locus_tag LOCUS_5010 gene hflX 2309 1005 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_5010 3434 2562 gene locus_tag LOCUS_5020 3434 2562 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_5020 3585 4202 gene locus_tag LOCUS_5030 3585 4202 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_5030 5520 4240 gene locus_tag LOCUS_5040 gene obgE 5520 4240 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_5040 6757 5879 gene locus_tag LOCUS_5050 6757 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 >Feature sequence051 1332 658 gene locus_tag LOCUS_5060 gene tsaA 1332 658 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_5060 1670 1335 gene locus_tag LOCUS_5070 1670 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 4160 1674 gene locus_tag LOCUS_5080 gene gyrA 4160 1674 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 protein_id gnl|my_center|LOCUS_5080 6441 4501 gene locus_tag LOCUS_5090 gene gyrB 6441 4501 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_5090 >Feature sequence052 1652 27 gene locus_tag LOCUS_5100 1652 27 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_5100 2323 1649 gene locus_tag LOCUS_5110 2323 1649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_5110 2538 4295 gene locus_tag LOCUS_5120 2538 4295 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_5120 4850 4347 gene locus_tag LOCUS_5130 4850 4347 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208110.1 protein_id gnl|my_center|LOCUS_5130 5042 5953 gene locus_tag LOCUS_5140 5042 5953 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072362001.1 protein_id gnl|my_center|LOCUS_5140 6906 6007 gene locus_tag LOCUS_5150 6906 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 >Feature sequence053 1276 830 gene locus_tag LOCUS_5160 1276 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 1840 1544 gene locus_tag LOCUS_5170 1840 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 2202 1957 gene locus_tag LOCUS_5180 2202 1957 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_5180 2409 2759 gene locus_tag LOCUS_5190 2409 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 2782 4455 gene locus_tag LOCUS_5200 2782 4455 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_5200 5471 4761 gene locus_tag LOCUS_5210 5471 4761 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_5210 <6425 5626 gene locus_tag LOCUS_5220 <6425 5626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082494.1:DUF362 domain-containing protein >Feature sequence054 1620 208 gene locus_tag LOCUS_5230 1620 208 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_5230 2717 2073 gene locus_tag LOCUS_5240 2717 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 4905 3256 gene locus_tag LOCUS_5250 4905 3256 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_5250 5640 5056 gene locus_tag LOCUS_5260 5640 5056 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_5260 <6366 5679 gene locus_tag LOCUS_5270 <6366 5679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392808.1:type I glutamate--ammonia ligase >Feature sequence055 2 511 gene locus_tag LOCUS_5280 2 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 1373 795 gene locus_tag LOCUS_5290 1373 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 2313 1363 gene locus_tag LOCUS_5300 2313 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 3155 2310 gene locus_tag LOCUS_5310 3155 2310 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775508.1 protein_id gnl|my_center|LOCUS_5310 4750 3335 gene locus_tag LOCUS_5320 4750 3335 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_5320 >Feature sequence056 1826 570 gene locus_tag LOCUS_5330 1826 570 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_5330 3129 2026 gene locus_tag LOCUS_5340 3129 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 <6333 3300 gene locus_tag LOCUS_5350 <6333 3300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391629.1:transcription-repair coupling factor >Feature sequence057 114 1382 gene locus_tag LOCUS_5360 114 1382 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_5360 1379 2650 gene locus_tag LOCUS_5370 1379 2650 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 protein_id gnl|my_center|LOCUS_5370 2658 3620 gene locus_tag LOCUS_5380 gene lgt 2658 3620 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_5380 3622 4467 gene locus_tag LOCUS_5390 gene folD 3622 4467 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_5390 4482 6149 gene locus_tag LOCUS_5400 4482 6149 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225668.1 protein_id gnl|my_center|LOCUS_5400 >Feature sequence058 <1 735 gene locus_tag LOCUS_5410 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256344.1:GTPase HflX 1228 821 gene locus_tag LOCUS_5420 1228 821 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362768.1 protein_id gnl|my_center|LOCUS_5420 2843 1521 gene locus_tag LOCUS_5430 gene dnaA 2843 1521 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_5430 3260 3394 gene locus_tag LOCUS_5440 3260 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 3517 3867 gene locus_tag LOCUS_5450 gene rnpA 3517 3867 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_5450 3864 4073 gene locus_tag LOCUS_5460 gene yidD 3864 4073 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_5460 4113 5219 gene locus_tag LOCUS_5470 4113 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 5231 6064 gene locus_tag LOCUS_5480 5231 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 >Feature sequence059 1079 51 gene locus_tag LOCUS_5490 1079 51 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_5490 1375 1220 gene locus_tag LOCUS_5500 1375 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 1949 1548 gene locus_tag LOCUS_5510 1949 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 2326 1946 gene locus_tag LOCUS_5520 2326 1946 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_5520 2570 3916 gene locus_tag LOCUS_5530 2570 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 3984 4868 gene locus_tag LOCUS_5540 3984 4868 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829684.1 protein_id gnl|my_center|LOCUS_5540 4886 6028 gene locus_tag LOCUS_5550 4886 6028 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_5550 >Feature sequence060 1793 1203 gene locus_tag LOCUS_5560 gene yihA 1793 1203 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_5560 4199 1803 gene locus_tag LOCUS_5570 gene lon 4199 1803 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_5570 5577 4282 gene locus_tag LOCUS_5580 gene clpX 5577 4282 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_5580 <6159 5580 gene locus_tag LOCUS_5590 <6159 5580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417102.1:ATP-dependent Clp endopeptidase proteolytic subunit ClpP >Feature sequence061 923 1474 gene locus_tag LOCUS_5600 923 1474 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_5600 1529 1798 gene locus_tag LOCUS_5610 1529 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 1873 2400 gene locus_tag LOCUS_5620 1873 2400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_5620 2662 3024 gene locus_tag LOCUS_5630 2662 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 3402 3566 gene locus_tag LOCUS_5640 3402 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 3563 3934 gene locus_tag LOCUS_5650 3563 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 3922 5286 gene locus_tag LOCUS_5660 3922 5286 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_5660 >Feature sequence062 2 940 gene locus_tag LOCUS_5670 2 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 1092 1331 gene locus_tag LOCUS_5680 gene rpsP 1092 1331 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_5680 1347 1577 gene locus_tag LOCUS_5690 1347 1577 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_5690 1960 3156 gene locus_tag LOCUS_5700 gene ilvA 1960 3156 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_5700 3170 3553 gene locus_tag LOCUS_5710 3170 3553 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_5710 3888 3688 gene locus_tag LOCUS_5720 3888 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 4783 3905 gene locus_tag LOCUS_5730 4783 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 5729 4794 gene locus_tag LOCUS_5740 5729 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 >Feature sequence063 2337 946 gene locus_tag LOCUS_5750 2337 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 2735 3271 gene locus_tag LOCUS_5760 gene raiA 2735 3271 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_5760 3520 4713 gene locus_tag LOCUS_5770 3520 4713 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_5770 5802 4963 gene locus_tag LOCUS_5780 5802 4963 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_5780 >Feature sequence064 608 63 gene locus_tag LOCUS_5790 608 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 794 1423 gene locus_tag LOCUS_5800 794 1423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_5800 1466 2032 gene locus_tag LOCUS_5810 1466 2032 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_5810 5284 2225 gene locus_tag LOCUS_5820 5284 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 5605 5417 gene locus_tag LOCUS_5830 5605 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 >Feature sequence065 954 127 gene locus_tag LOCUS_5840 954 127 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_5840 1368 967 gene locus_tag LOCUS_5850 1368 967 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_5850 3284 1824 gene locus_tag LOCUS_5860 3284 1824 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_5860 4216 3281 gene locus_tag LOCUS_5870 4216 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_5870 5379 4975 gene locus_tag LOCUS_5880 5379 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 <5989 5392 gene locus_tag LOCUS_5890 <5989 5392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432446.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence066 16 573 gene locus_tag LOCUS_5900 16 573 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287272.1 protein_id gnl|my_center|LOCUS_5900 724 1482 gene locus_tag LOCUS_5910 724 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 1479 2570 gene locus_tag LOCUS_5920 gene cobT 1479 2570 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_5920 2572 3111 gene locus_tag LOCUS_5930 2572 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 3108 3848 gene locus_tag LOCUS_5940 gene cobS 3108 3848 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_5940 3861 4217 gene locus_tag LOCUS_5950 3861 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 4629 4856 gene locus_tag LOCUS_5960 4629 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 >Feature sequence067 2 172 gene locus_tag LOCUS_5970 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 300 1013 gene locus_tag LOCUS_5980 300 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 1589 1176 gene locus_tag LOCUS_5990 1589 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 2602 1778 gene locus_tag LOCUS_6000 2602 1778 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_6000 3468 2650 gene locus_tag LOCUS_6010 3468 2650 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_6010 3376 3561 gene locus_tag LOCUS_6020 3376 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 5602 3563 gene locus_tag LOCUS_6030 5602 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 >Feature sequence068 338 1303 gene locus_tag LOCUS_6040 338 1303 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_6040 3824 1383 gene locus_tag LOCUS_6050 gene pheT 3824 1383 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_6050 4880 3843 gene locus_tag LOCUS_6060 gene pheS 4880 3843 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_6060 >Feature sequence069 980 132 gene locus_tag LOCUS_6070 980 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 3123 1189 gene locus_tag LOCUS_6080 3123 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 3608 4945 gene locus_tag LOCUS_6090 3608 4945 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_6090 >Feature sequence070 561 124 gene locus_tag LOCUS_6100 561 124 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_6100 663 1730 gene locus_tag LOCUS_6110 gene ytvI 663 1730 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198961.1 protein_id gnl|my_center|LOCUS_6110 3044 1737 gene locus_tag LOCUS_6120 3044 1737 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_6120 3160 4548 gene locus_tag LOCUS_6130 gene murC 3160 4548 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_6130 4552 5088 gene locus_tag LOCUS_6140 4552 5088 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_6140 >Feature sequence071 1061 390 gene locus_tag LOCUS_6150 gene radC 1061 390 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_6150 1338 1826 gene locus_tag LOCUS_6160 gene nuoE 1338 1826 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_6160 1823 3718 gene locus_tag LOCUS_6170 gene nuoF 1823 3718 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_6170 3722 5425 gene locus_tag LOCUS_6180 3722 5425 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_6180 >Feature sequence072 1548 769 gene locus_tag LOCUS_6190 1548 769 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_6190 1909 2583 gene locus_tag LOCUS_6200 gene trmB 1909 2583 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_6200 3294 2638 gene locus_tag LOCUS_6210 3294 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 5130 3784 gene locus_tag LOCUS_6220 5130 3784 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_6220 >Feature sequence073 1155 1991 gene locus_tag LOCUS_6230 1155 1991 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_6230 2157 4574 gene locus_tag LOCUS_6240 2157 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 4596 5015 gene locus_tag LOCUS_6250 4596 5015 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_6250 5138 5063 gene locus_tag LOCUS_t0050 5138 5063 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 2330 1854 gene locus_tag LOCUS_6260 gene greA 2330 1854 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082222.1 protein_id gnl|my_center|LOCUS_6260 3123 2431 gene locus_tag LOCUS_6270 3123 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 4520 3378 gene locus_tag LOCUS_6280 4520 3378 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_6280 5020 4532 gene locus_tag LOCUS_6290 5020 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 >Feature sequence075 1435 155 gene locus_tag LOCUS_6300 1435 155 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_6300 3186 1456 gene locus_tag LOCUS_6310 3186 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 3729 3193 gene locus_tag LOCUS_6320 3729 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 >Feature sequence076 75 800 gene locus_tag LOCUS_6330 75 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 800 2266 gene locus_tag LOCUS_6340 800 2266 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_6340 2343 3296 gene locus_tag LOCUS_6350 2343 3296 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_6350 3543 4409 gene locus_tag LOCUS_6360 gene prmC 3543 4409 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970073.1 protein_id gnl|my_center|LOCUS_6360 >Feature sequence077 1103 396 gene locus_tag LOCUS_6370 1103 396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_6370 2230 1115 gene locus_tag LOCUS_6380 2230 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 2465 3907 gene locus_tag LOCUS_6390 2465 3907 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_6390 >Feature sequence078 120 653 gene locus_tag LOCUS_6400 120 653 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_6400 1687 749 gene locus_tag LOCUS_6410 gene glcK 1687 749 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_6410 2907 1690 gene locus_tag LOCUS_6420 gene ugpC 2907 1690 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_6420 3368 4399 gene locus_tag LOCUS_6430 3368 4399 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_6430 4823 4509 gene locus_tag LOCUS_6440 4823 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 >Feature sequence079 <1 617 gene locus_tag LOCUS_6450 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964596.1:50S ribosomal protein L11 methyltransferase 4046 789 gene locus_tag LOCUS_6460 4046 789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_6460 4750 4046 gene locus_tag LOCUS_6470 4750 4046 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_6470 >Feature sequence080 627 1643 gene locus_tag LOCUS_6480 627 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 1783 3306 gene locus_tag LOCUS_6490 1783 3306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_6490 3303 4367 gene locus_tag LOCUS_6500 3303 4367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_6500 >Feature sequence081 1252 374 gene locus_tag LOCUS_6510 1252 374 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_6510 2513 1341 gene locus_tag LOCUS_6520 2513 1341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_6520 2844 2632 gene locus_tag LOCUS_6530 2844 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 3273 4004 gene locus_tag LOCUS_6540 3273 4004 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893548.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence082 974 735 gene locus_tag LOCUS_6550 974 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 3768 1297 gene locus_tag LOCUS_6560 3768 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 3986 4270 gene locus_tag LOCUS_6570 3986 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 4309 4524 gene locus_tag LOCUS_6580 4309 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 >Feature sequence083 442 594 gene locus_tag LOCUS_6590 442 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 555 1313 gene locus_tag LOCUS_6600 555 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 1768 3987 gene locus_tag LOCUS_6610 1768 3987 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_6610 >Feature sequence084 487 1419 gene locus_tag LOCUS_6620 487 1419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_6620 1406 2194 gene locus_tag LOCUS_6630 1406 2194 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_6630 >Feature sequence085 289 4242 gene locus_tag LOCUS_6640 289 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 >Feature sequence086 1465 974 gene locus_tag LOCUS_6650 gene trmL 1465 974 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_6650 1957 2916 gene locus_tag LOCUS_6660 1957 2916 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_6660 3019 3603 gene locus_tag LOCUS_6670 gene pth 3019 3603 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_6670 >Feature sequence087 1557 2240 gene locus_tag LOCUS_6680 1557 2240 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_6680 2237 2617 gene locus_tag LOCUS_6690 2237 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 3070 2618 gene locus_tag LOCUS_6700 gene nrdR 3070 2618 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_6700 >Feature sequence088 3 722 gene locus_tag LOCUS_6710 3 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 726 1721 gene locus_tag LOCUS_6720 726 1721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_6720 1789 3144 gene locus_tag LOCUS_6730 1789 3144 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_6730 4189 3212 gene locus_tag LOCUS_6740 gene pfkA 4189 3212 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_6740 >Feature sequence089 <1 642 gene locus_tag LOCUS_6750 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549578.1:aspartate--ammonia ligase 1375 701 gene locus_tag LOCUS_6760 gene sfsA 1375 701 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_6760 1583 1855 gene locus_tag LOCUS_6770 1583 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 1870 2223 gene locus_tag LOCUS_6780 1870 2223 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_6780 2239 3663 gene locus_tag LOCUS_6790 2239 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 >Feature sequence090 1381 197 gene locus_tag LOCUS_6800 1381 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 2129 1362 gene locus_tag LOCUS_6810 gene truA 2129 1362 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_6810 2959 2153 gene locus_tag LOCUS_6820 2959 2153 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_6820 3819 2953 gene locus_tag LOCUS_6830 3819 2953 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_6830 >Feature sequence091 711 223 gene locus_tag LOCUS_6840 711 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 996 733 gene locus_tag LOCUS_6850 996 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 1238 975 gene locus_tag LOCUS_6860 1238 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 2240 1353 gene locus_tag LOCUS_6870 2240 1353 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 protein_id gnl|my_center|LOCUS_6870 2508 2422 gene locus_tag LOCUS_t0060 2508 2422 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2672 3985 gene locus_tag LOCUS_6880 2672 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 >Feature sequence092 1919 1032 gene locus_tag LOCUS_6890 gene cdaA 1919 1032 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_6890 3141 1999 gene locus_tag LOCUS_6900 3141 1999 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_6900 3389 3138 gene locus_tag LOCUS_6910 3389 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 <4042 3505 gene locus_tag LOCUS_6920 <4042 3505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392842.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 >Feature sequence093 1676 534 gene locus_tag LOCUS_6930 1676 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 >Feature sequence094 <1 742 gene locus_tag LOCUS_6940 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547047.1:sugar-phosphatase 890 1954 gene locus_tag LOCUS_6950 gene buk 890 1954 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_6950 2767 2285 gene locus_tag LOCUS_6960 2767 2285 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_6960 <3962 3378 gene locus_tag LOCUS_6970 <3962 3378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357725.1:translation elongation factor 4 >Feature sequence095 776 72 gene locus_tag LOCUS_6980 776 72 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391034.1 protein_id gnl|my_center|LOCUS_6980 2417 945 gene locus_tag LOCUS_6990 2417 945 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462118.1 protein_id gnl|my_center|LOCUS_6990 3213 3085 gene locus_tag LOCUS_7000 3213 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 3839 3210 gene locus_tag LOCUS_7010 3839 3210 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_7010 >Feature sequence096 962 558 gene locus_tag LOCUS_7020 962 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 2467 977 gene locus_tag LOCUS_7030 2467 977 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_7030 3019 2600 gene locus_tag LOCUS_7040 3019 2600 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_7040 3200 3514 gene locus_tag LOCUS_7050 3200 3514 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_7050 >Feature sequence097 697 1773 gene locus_tag LOCUS_7060 697 1773 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_7060 1826 2755 gene locus_tag LOCUS_7070 1826 2755 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_7070 2752 3030 gene locus_tag LOCUS_7080 2752 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 3725 3354 gene locus_tag LOCUS_7090 gene rplL 3725 3354 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124382.1 protein_id gnl|my_center|LOCUS_7090 >Feature sequence098 436 260 gene locus_tag LOCUS_7100 436 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 414 1292 gene locus_tag LOCUS_7110 414 1292 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_7110 2173 1352 gene locus_tag LOCUS_7120 2173 1352 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_7120 2685 2194 gene locus_tag LOCUS_7130 2685 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 3214 3002 gene locus_tag LOCUS_7140 3214 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 3350 3228 gene locus_tag LOCUS_7150 3350 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 3745 3392 gene locus_tag LOCUS_7160 3745 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 >Feature sequence099 223 726 gene locus_tag LOCUS_7170 gene greA 223 726 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_7170 743 1357 gene locus_tag LOCUS_7180 743 1357 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_7180 1457 2479 gene locus_tag LOCUS_7190 gene spoVAD 1457 2479 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_7190 2481 2837 gene locus_tag LOCUS_7200 gene spoVAE 2481 2837 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_7200 2902 3201 gene locus_tag LOCUS_7210 2902 3201 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence100 92 529 gene locus_tag LOCUS_7220 92 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 678 830 gene locus_tag LOCUS_7230 678 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 953 1204 gene locus_tag LOCUS_7240 953 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 1256 1618 gene locus_tag LOCUS_7250 1256 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 1667 2284 gene locus_tag LOCUS_7260 1667 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 >Feature sequence101 <1 866 gene locus_tag LOCUS_7270 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020719.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1363 1022 gene locus_tag LOCUS_7280 1363 1022 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_7280 1551 1378 gene locus_tag LOCUS_7290 1551 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 <3600 1553 gene locus_tag LOCUS_7300 <3600 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889064.1:alanine--tRNA ligase >Feature sequence102 <1 3377 gene locus_tag LOCUS_7310 <1 3377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572274.1:helicase-exonuclease AddAB subunit AddA >Feature sequence103 1216 215 gene locus_tag LOCUS_7320 1216 215 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_7320 2553 1234 gene locus_tag LOCUS_7330 2553 1234 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_7330 >Feature sequence104 979 1539 gene locus_tag LOCUS_7340 979 1539 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_7340 1701 3428 gene locus_tag LOCUS_7350 gene ade 1701 3428 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence105 241 165 gene locus_tag LOCUS_t0070 241 165 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 438 1034 gene locus_tag LOCUS_7360 438 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 <3382 1331 gene locus_tag LOCUS_7370 <3382 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence106 2 1141 gene locus_tag LOCUS_7380 2 1141 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_7380 1565 1233 gene locus_tag LOCUS_7390 1565 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 1658 2080 gene locus_tag LOCUS_7400 1658 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 <3329 2140 gene locus_tag LOCUS_7410 <3329 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387142.1:putative selenate reductase subunit YgfK >Feature sequence107 901 1737 gene locus_tag LOCUS_7420 901 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 1734 3026 gene locus_tag LOCUS_7430 1734 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 >Feature sequence108 842 711 gene locus_tag LOCUS_7440 842 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 867 1208 gene locus_tag LOCUS_7450 867 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 1822 2523 gene locus_tag LOCUS_7460 1822 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 >Feature sequence109 13 89 gene locus_tag LOCUS_t0080 13 89 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1248 400 gene locus_tag LOCUS_7470 1248 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_7470 1578 2942 gene locus_tag LOCUS_7480 1578 2942 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_7480 >Feature sequence110 322 1185 gene locus_tag LOCUS_7490 gene rsmA 322 1185 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_7490 2703 1480 gene locus_tag LOCUS_7500 2703 1480 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_7500 <3241 2700 gene locus_tag LOCUS_7510 <3241 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004617473.1:endolytic transglycosylase MltG >Feature sequence111 304 1119 gene locus_tag LOCUS_7520 gene noc 304 1119 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_7520 2470 1403 gene locus_tag LOCUS_7530 2470 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7530 2598 2807 gene locus_tag LOCUS_7540 2598 2807 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_7540 2979 2857 gene locus_tag LOCUS_7550 2979 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 >Feature sequence112 1183 59 gene locus_tag LOCUS_7560 1183 59 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_7560 >Feature sequence113 452 204 gene locus_tag LOCUS_7570 452 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 1389 457 gene locus_tag LOCUS_7580 1389 457 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_7580 2083 1424 gene locus_tag LOCUS_7590 gene plsY 2083 1424 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811145.1 protein_id gnl|my_center|LOCUS_7590 <3176 2073 gene locus_tag LOCUS_7600 <3176 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460200.1:ribosome biogenesis GTPase Der >Feature sequence114 681 1889 gene locus_tag LOCUS_7610 681 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 >Feature sequence115 1551 958 gene locus_tag LOCUS_7620 gene ruvA 1551 958 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_7620 2077 1565 gene locus_tag LOCUS_7630 gene ruvC 2077 1565 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_7630 >Feature sequence116 344 1453 gene locus_tag LOCUS_7640 gene dnaN 344 1453 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_7640 1466 1684 gene locus_tag LOCUS_7650 1466 1684 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325922.1 protein_id gnl|my_center|LOCUS_7650 1671 2777 gene locus_tag LOCUS_7660 gene recF 1671 2777 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_7660 >Feature sequence117 1533 1162 gene locus_tag LOCUS_7670 gene rsfS 1533 1162 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_7670 2732 1530 gene locus_tag LOCUS_7680 2732 1530 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_7680 >Feature sequence118 <1 1133 gene locus_tag LOCUS_7690 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723002.1:PBP1A family penicillin-binding protein 1292 1873 gene locus_tag LOCUS_7700 1292 1873 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_7700 1900 2715 gene locus_tag LOCUS_7710 1900 2715 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_7710 >Feature sequence119 1 657 gene locus_tag LOCUS_7720 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 647 1264 gene locus_tag LOCUS_7730 gene recX 647 1264 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_7730 1280 2605 gene locus_tag LOCUS_7740 gene rimO 1280 2605 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_7740 >Feature sequence120 729 82 gene locus_tag LOCUS_7750 729 82 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_7750 1165 1839 gene locus_tag LOCUS_7760 1165 1839 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086256.1 protein_id gnl|my_center|LOCUS_7760 >Feature sequence121 581 36 gene locus_tag LOCUS_7770 gene yfcE 581 36 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_7770 1852 578 gene locus_tag LOCUS_7780 1852 578 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_7780 2763 1936 gene locus_tag LOCUS_7790 2763 1936 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_7790 >Feature sequence122 623 1711 gene locus_tag LOCUS_7800 gene serC 623 1711 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_7800 1856 2761 gene locus_tag LOCUS_7810 1856 2761 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_7810 >Feature sequence123 235 753 gene locus_tag LOCUS_7820 235 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 770 2077 gene locus_tag LOCUS_7830 770 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 <2804 2155 gene locus_tag LOCUS_7840 <2804 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812114.1:D-aminoacylase >Feature sequence124 41 1369 gene locus_tag LOCUS_7850 gene rsxC 41 1369 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_7850 >Feature sequence125 485 255 gene locus_tag LOCUS_7860 gene atpE 485 255 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142903.1 protein_id gnl|my_center|LOCUS_7860 1218 547 gene locus_tag LOCUS_7870 1218 547 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_7870 1568 1236 gene locus_tag LOCUS_7880 1568 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 2391 1852 gene locus_tag LOCUS_7890 2391 1852 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_7890 >Feature sequence126 2447 639 gene locus_tag LOCUS_7900 2447 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7900 >Feature sequence127 431 685 gene locus_tag LOCUS_7910 431 685 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_7910 785 1225 gene locus_tag LOCUS_7920 785 1225 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_7920 1285 1725 gene locus_tag LOCUS_7930 1285 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 2316 1786 gene locus_tag LOCUS_7940 gene nrdG 2316 1786 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_7940 >Feature sequence128 1324 86 gene locus_tag LOCUS_7950 1324 86 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901956.1 protein_id gnl|my_center|LOCUS_7950 1544 2317 gene locus_tag LOCUS_7960 1544 2317 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_7960 >Feature sequence129 3 854 gene locus_tag LOCUS_7970 gene plsX 3 854 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_7970 934 1182 gene locus_tag LOCUS_7980 gene acpP 934 1182 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_7980 1503 2189 gene locus_tag LOCUS_7990 gene rnc 1503 2189 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_7990 2567 2262 gene locus_tag LOCUS_8000 2567 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 >Feature sequence130 910 2022 gene locus_tag LOCUS_8010 gene ftsZ 910 2022 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_8010