>Feature sequence001 3493 2666 gene locus_tag LOCUS_00010 3493 2666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727031.1 protein_id gnl|my_center|LOCUS_00010 4554 3493 gene locus_tag LOCUS_00020 4554 3493 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743398.1 protein_id gnl|my_center|LOCUS_00020 5482 4673 gene locus_tag LOCUS_00030 5482 4673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727032.1 protein_id gnl|my_center|LOCUS_00030 5982 7409 gene locus_tag LOCUS_00040 5982 7409 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 protein_id gnl|my_center|LOCUS_00040 7579 7959 gene locus_tag LOCUS_00050 7579 7959 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_00050 8811 8062 gene locus_tag LOCUS_00060 8811 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9461 8814 gene locus_tag LOCUS_00070 9461 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11089 9641 gene locus_tag LOCUS_00080 11089 9641 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 protein_id gnl|my_center|LOCUS_00080 12895 11429 gene locus_tag LOCUS_00090 12895 11429 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_00090 13282 15222 gene locus_tag LOCUS_00100 13282 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15232 15978 gene locus_tag LOCUS_00110 15232 15978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 protein_id gnl|my_center|LOCUS_00110 15975 16424 gene locus_tag LOCUS_00120 15975 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16604 16969 gene locus_tag LOCUS_00130 16604 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17319 17924 gene locus_tag LOCUS_00140 17319 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18249 19652 gene locus_tag LOCUS_00150 18249 19652 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804380.1 protein_id gnl|my_center|LOCUS_00150 20687 20836 gene locus_tag LOCUS_00160 20687 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21154 21227 gene locus_tag LOCUS_t00010 21154 21227 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21296 21370 gene locus_tag LOCUS_t00020 21296 21370 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 21443 21516 gene locus_tag LOCUS_t00030 21443 21516 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21765 22700 gene locus_tag LOCUS_00170 21765 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22697 23422 gene locus_tag LOCUS_00180 22697 23422 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_00180 23428 24120 gene locus_tag LOCUS_00190 23428 24120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_00190 24117 25070 gene locus_tag LOCUS_00200 24117 25070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_00200 27012 25204 gene locus_tag LOCUS_00210 gene treC 27012 25204 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100943.1 protein_id gnl|my_center|LOCUS_00210 27404 29248 gene locus_tag LOCUS_00220 gene ilvD 27404 29248 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775910.1 protein_id gnl|my_center|LOCUS_00220 29532 30554 gene locus_tag LOCUS_00230 29532 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30922 30644 gene locus_tag LOCUS_00240 30922 30644 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583804.1 protein_id gnl|my_center|LOCUS_00240 31215 32375 gene locus_tag LOCUS_00250 31215 32375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33266 32709 gene locus_tag LOCUS_00260 33266 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 34805 33327 gene locus_tag LOCUS_00270 34805 33327 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 protein_id gnl|my_center|LOCUS_00270 34973 35650 gene locus_tag LOCUS_00280 34973 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35922 37610 gene locus_tag LOCUS_00290 35922 37610 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 protein_id gnl|my_center|LOCUS_00290 38136 39131 gene locus_tag LOCUS_00300 38136 39131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812438.1 protein_id gnl|my_center|LOCUS_00300 39128 40105 gene locus_tag LOCUS_00310 39128 40105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_00310 40105 42198 gene locus_tag LOCUS_00320 40105 42198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_00320 42626 44323 gene locus_tag LOCUS_00330 42626 44323 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_00330 44702 46435 gene locus_tag LOCUS_00340 44702 46435 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_00340 46814 48514 gene locus_tag LOCUS_00350 46814 48514 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_00350 48976 50685 gene locus_tag LOCUS_00360 48976 50685 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 protein_id gnl|my_center|LOCUS_00360 51094 52794 gene locus_tag LOCUS_00370 51094 52794 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_00370 53053 54756 gene locus_tag LOCUS_00380 53053 54756 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_00380 55872 54934 gene locus_tag LOCUS_00390 55872 54934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 58229 56148 gene locus_tag LOCUS_00400 58229 56148 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014304.1 protein_id gnl|my_center|LOCUS_00400 61317 58741 gene locus_tag LOCUS_00410 61317 58741 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_00410 63928 61610 gene locus_tag LOCUS_00420 gene purL 63928 61610 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_00420 64766 63954 gene locus_tag LOCUS_00430 gene purQ 64766 63954 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_00430 65023 64772 gene locus_tag LOCUS_00440 gene purS 65023 64772 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_00440 66072 65146 gene locus_tag LOCUS_00450 66072 65146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_00450 66797 66153 gene locus_tag LOCUS_00460 66797 66153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 67261 66791 gene locus_tag LOCUS_00470 67261 66791 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194559634.1 protein_id gnl|my_center|LOCUS_00470 68784 67489 gene locus_tag LOCUS_00480 68784 67489 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_00480 70099 68942 gene locus_tag LOCUS_00490 70099 68942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 73028 70323 gene locus_tag LOCUS_00500 73028 70323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 73686 73774 gene locus_tag LOCUS_t00040 73686 73774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73892 74221 gene locus_tag LOCUS_00510 73892 74221 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895874.1 protein_id gnl|my_center|LOCUS_00510 75087 74389 gene locus_tag LOCUS_00520 75087 74389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230202.1 protein_id gnl|my_center|LOCUS_00520 76231 75251 gene locus_tag LOCUS_00530 76231 75251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 76513 77241 gene locus_tag LOCUS_00540 76513 77241 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_00540 77352 78806 gene locus_tag LOCUS_00550 77352 78806 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 protein_id gnl|my_center|LOCUS_00550 79035 80540 gene locus_tag LOCUS_00560 79035 80540 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 protein_id gnl|my_center|LOCUS_00560 80863 81393 gene locus_tag LOCUS_00570 80863 81393 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_00570 81616 82299 gene locus_tag LOCUS_00580 81616 82299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 82935 82426 gene locus_tag LOCUS_00590 82935 82426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 84298 82988 gene locus_tag LOCUS_00600 gene tgt 84298 82988 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 protein_id gnl|my_center|LOCUS_00600 85286 84405 gene locus_tag LOCUS_00610 85286 84405 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107658.1 protein_id gnl|my_center|LOCUS_00610 86683 85409 gene locus_tag LOCUS_00620 86683 85409 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_00620 87948 86770 gene locus_tag LOCUS_00630 87948 86770 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence002 647 144 gene locus_tag LOCUS_00640 647 144 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027232.1 protein_id gnl|my_center|LOCUS_00640 1499 837 gene locus_tag LOCUS_00650 1499 837 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816035.1 protein_id gnl|my_center|LOCUS_00650 2201 1518 gene locus_tag LOCUS_00660 2201 1518 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285367.1 protein_id gnl|my_center|LOCUS_00660 2226 2423 gene locus_tag LOCUS_00670 2226 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3784 2456 gene locus_tag LOCUS_00680 3784 2456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014299.1 protein_id gnl|my_center|LOCUS_00680 4306 3863 gene locus_tag LOCUS_00690 4306 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5186 4323 gene locus_tag LOCUS_00700 5186 4323 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015500.1 protein_id gnl|my_center|LOCUS_00700 5461 8070 gene locus_tag LOCUS_00710 gene clpB 5461 8070 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389508.1 protein_id gnl|my_center|LOCUS_00710 8239 9207 gene locus_tag LOCUS_00720 8239 9207 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 protein_id gnl|my_center|LOCUS_00720 9320 10576 gene locus_tag LOCUS_00730 9320 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 10915 11955 gene locus_tag LOCUS_00740 10915 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12277 12894 gene locus_tag LOCUS_00750 12277 12894 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_00750 13093 14013 gene locus_tag LOCUS_00760 13093 14013 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_00760 14240 15931 gene locus_tag LOCUS_00770 14240 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16295 16504 gene locus_tag LOCUS_00780 16295 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 16810 17868 gene locus_tag LOCUS_00790 16810 17868 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_00790 17865 19145 gene locus_tag LOCUS_00800 17865 19145 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_00800 21105 19393 gene locus_tag LOCUS_00810 21105 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 21813 23720 gene locus_tag LOCUS_00820 21813 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 25793 23826 gene locus_tag LOCUS_00830 25793 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 27565 26420 gene locus_tag LOCUS_00840 gene purM 27565 26420 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_00840 29316 27565 gene locus_tag LOCUS_00850 gene purF 29316 27565 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_00850 29967 29542 gene locus_tag LOCUS_00860 29967 29542 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804521.1 protein_id gnl|my_center|LOCUS_00860 31079 29970 gene locus_tag LOCUS_00870 31079 29970 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_00870 31507 31845 gene locus_tag LOCUS_00880 31507 31845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 32000 33283 gene locus_tag LOCUS_00890 gene purD 32000 33283 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_00890 33449 34375 gene locus_tag LOCUS_00900 33449 34375 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_00900 34696 35598 gene locus_tag LOCUS_00910 34696 35598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 35742 36956 gene locus_tag LOCUS_00920 35742 36956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 36958 37734 gene locus_tag LOCUS_00930 gene lolD 36958 37734 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_00930 37735 38892 gene locus_tag LOCUS_00940 37735 38892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 protein_id gnl|my_center|LOCUS_00940 39903 39001 gene locus_tag LOCUS_00950 39903 39001 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_00950 41810 40137 gene locus_tag LOCUS_00960 41810 40137 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 protein_id gnl|my_center|LOCUS_00960 42614 43408 gene locus_tag LOCUS_00970 42614 43408 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_00970 43425 45065 gene locus_tag LOCUS_00980 43425 45065 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_00980 45065 45712 gene locus_tag LOCUS_00990 45065 45712 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_00990 47667 46108 gene locus_tag LOCUS_01000 47667 46108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 49760 48258 gene locus_tag LOCUS_01010 49760 48258 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 protein_id gnl|my_center|LOCUS_01010 50051 51184 gene locus_tag LOCUS_01020 50051 51184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 51391 51317 gene locus_tag LOCUS_t00050 51391 51317 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 53369 51501 gene locus_tag LOCUS_01030 53369 51501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803869.1 protein_id gnl|my_center|LOCUS_01030 55396 53369 gene locus_tag LOCUS_01040 55396 53369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 protein_id gnl|my_center|LOCUS_01040 56415 55396 gene locus_tag LOCUS_01050 56415 55396 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776608.1 protein_id gnl|my_center|LOCUS_01050 58598 56442 gene locus_tag LOCUS_01060 58598 56442 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_01060 58787 58990 gene locus_tag LOCUS_01070 58787 58990 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_01070 59226 59708 gene locus_tag LOCUS_01080 59226 59708 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_01080 59701 60909 gene locus_tag LOCUS_01090 59701 60909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence003 2486 987 gene locus_tag LOCUS_01100 2486 987 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_01100 3618 2632 gene locus_tag LOCUS_01110 3618 2632 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776524.1 protein_id gnl|my_center|LOCUS_01110 4787 3621 gene locus_tag LOCUS_01120 gene pdhA 4787 3621 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_01120 6290 5163 gene locus_tag LOCUS_01130 gene hisC 6290 5163 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_01130 8691 6409 gene locus_tag LOCUS_01140 8691 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9336 8731 gene locus_tag LOCUS_01150 9336 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9743 11176 gene locus_tag LOCUS_01160 gene purB 9743 11176 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_01160 12165 11287 gene locus_tag LOCUS_01170 12165 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 protein_id gnl|my_center|LOCUS_01170 12437 13498 gene locus_tag LOCUS_01180 12437 13498 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013759.1 protein_id gnl|my_center|LOCUS_01180 13662 14636 gene locus_tag LOCUS_01190 13662 14636 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 protein_id gnl|my_center|LOCUS_01190 15545 14757 gene locus_tag LOCUS_01200 15545 14757 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804823.1 protein_id gnl|my_center|LOCUS_01200 16309 15545 gene locus_tag LOCUS_01210 16309 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 16600 16674 gene locus_tag LOCUS_t00060 16600 16674 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16796 17032 gene locus_tag LOCUS_01220 16796 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 18015 17140 gene locus_tag LOCUS_01230 18015 17140 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 protein_id gnl|my_center|LOCUS_01230 18736 18197 gene locus_tag LOCUS_01240 18736 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 19964 18954 gene locus_tag LOCUS_01250 19964 18954 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112900.1 protein_id gnl|my_center|LOCUS_01250 20090 20178 gene locus_tag LOCUS_t00070 20090 20178 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20767 20279 gene locus_tag LOCUS_01260 20767 20279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21220 20981 gene locus_tag LOCUS_01270 21220 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 22312 21812 gene locus_tag LOCUS_01280 22312 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 22848 22519 gene locus_tag LOCUS_01290 22848 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 23539 23120 gene locus_tag LOCUS_01300 23539 23120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 23798 23889 gene locus_tag LOCUS_t00080 23798 23889 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24498 23953 gene locus_tag LOCUS_01310 24498 23953 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_01310 25362 24607 gene locus_tag LOCUS_01320 25362 24607 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803978.1 protein_id gnl|my_center|LOCUS_01320 26581 25943 gene locus_tag LOCUS_01330 gene upp 26581 25943 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_01330 26770 26683 gene locus_tag LOCUS_t00090 26770 26683 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27581 26961 gene locus_tag LOCUS_01340 27581 26961 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227922.1 protein_id gnl|my_center|LOCUS_01340 30267 27661 gene locus_tag LOCUS_01350 30267 27661 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_01350 31163 30270 gene locus_tag LOCUS_01360 31163 30270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 32116 31616 gene locus_tag LOCUS_01370 gene tadA 32116 31616 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_01370 34332 32179 gene locus_tag LOCUS_01380 34332 32179 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775917.1 protein_id gnl|my_center|LOCUS_01380 34630 35286 gene locus_tag LOCUS_01390 34630 35286 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 protein_id gnl|my_center|LOCUS_01390 35896 35378 gene locus_tag LOCUS_01400 35896 35378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 37651 35975 gene locus_tag LOCUS_01410 37651 35975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 38329 37715 gene locus_tag LOCUS_01420 38329 37715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 39295 38489 gene locus_tag LOCUS_01430 39295 38489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 39972 39433 gene locus_tag LOCUS_01440 39972 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 40549 40040 gene locus_tag LOCUS_01450 40549 40040 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_01450 40718 40644 gene locus_tag LOCUS_t00100 40718 40644 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 40951 41580 gene locus_tag LOCUS_01460 40951 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_01460 42231 42848 gene locus_tag LOCUS_01470 42231 42848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 42848 43888 gene locus_tag LOCUS_01480 42848 43888 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_01480 44028 45086 gene locus_tag LOCUS_01490 44028 45086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 45090 46889 gene locus_tag LOCUS_01500 45090 46889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 47013 48419 gene locus_tag LOCUS_01510 47013 48419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 49975 48524 gene locus_tag LOCUS_01520 gene radA 49975 48524 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_01520 50175 51260 gene locus_tag LOCUS_01530 gene disA 50175 51260 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_01530 51362 51586 gene locus_tag LOCUS_01540 51362 51586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 52471 51695 gene locus_tag LOCUS_01550 52471 51695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 52651 53586 gene locus_tag LOCUS_01560 52651 53586 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_01560 56278 53708 gene locus_tag LOCUS_01570 56278 53708 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence004 280 828 gene locus_tag LOCUS_01580 280 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 1538 1179 gene locus_tag LOCUS_01590 1538 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1467 2309 gene locus_tag LOCUS_01600 1467 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2963 2334 gene locus_tag LOCUS_01610 2963 2334 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095323.1 protein_id gnl|my_center|LOCUS_01610 3155 4072 gene locus_tag LOCUS_01620 3155 4072 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_01620 4559 4245 gene locus_tag LOCUS_01630 4559 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4712 5461 gene locus_tag LOCUS_01640 4712 5461 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_01640 5477 5638 gene locus_tag LOCUS_01650 5477 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5654 6286 gene locus_tag LOCUS_01660 5654 6286 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 protein_id gnl|my_center|LOCUS_01660 8577 6484 gene locus_tag LOCUS_01670 gene pknB 8577 6484 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_01670 10374 8626 gene locus_tag LOCUS_01680 10374 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 11810 10371 gene locus_tag LOCUS_01690 11810 10371 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_01690 13263 11803 gene locus_tag LOCUS_01700 13263 11803 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 protein_id gnl|my_center|LOCUS_01700 14971 13256 gene locus_tag LOCUS_01710 14971 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 15439 14975 gene locus_tag LOCUS_01720 gene fhaB 15439 14975 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_01720 16368 15439 gene locus_tag LOCUS_01730 gene fhaA 16368 15439 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_01730 16687 16601 gene locus_tag LOCUS_t00110 16687 16601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17085 16840 gene locus_tag LOCUS_01740 17085 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 18855 17293 gene locus_tag LOCUS_01750 18855 17293 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 protein_id gnl|my_center|LOCUS_01750 22416 19153 gene locus_tag LOCUS_01760 gene lysX 22416 19153 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_01760 24011 22647 gene locus_tag LOCUS_01770 gene nhaA 24011 22647 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777007.1 protein_id gnl|my_center|LOCUS_01770 24806 24276 gene locus_tag LOCUS_01780 24806 24276 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284940.1 protein_id gnl|my_center|LOCUS_01780 25915 25367 gene locus_tag LOCUS_01790 25915 25367 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_01790 27369 27992 gene locus_tag LOCUS_01800 27369 27992 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_01800 29886 28126 gene locus_tag LOCUS_01810 29886 28126 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336737.1 protein_id gnl|my_center|LOCUS_01810 31254 30442 gene locus_tag LOCUS_01820 31254 30442 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804024.1 protein_id gnl|my_center|LOCUS_01820 31835 31515 gene locus_tag LOCUS_01830 31835 31515 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_01830 32523 31939 gene locus_tag LOCUS_01840 32523 31939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_01840 32721 34286 gene locus_tag LOCUS_01850 32721 34286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_01850 34599 34417 gene locus_tag LOCUS_01860 34599 34417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 34541 35869 gene locus_tag LOCUS_01870 34541 35869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 36495 36274 gene locus_tag LOCUS_01880 36495 36274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 37741 36887 gene locus_tag LOCUS_01890 37741 36887 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_01890 38628 37738 gene locus_tag LOCUS_01900 38628 37738 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_01900 39710 38625 gene locus_tag LOCUS_01910 39710 38625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 41557 39806 gene locus_tag LOCUS_01920 41557 39806 CDS product anchored repeat ABC transporter, substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993979.1 protein_id gnl|my_center|LOCUS_01920 43826 41544 gene locus_tag LOCUS_01930 43826 41544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence005 865 203 gene locus_tag LOCUS_01940 865 203 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_01940 1014 865 gene locus_tag LOCUS_01950 1014 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1168 2946 gene locus_tag LOCUS_01960 1168 2946 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_01960 3262 4143 gene locus_tag LOCUS_01970 3262 4143 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 protein_id gnl|my_center|LOCUS_01970 4287 5345 gene locus_tag LOCUS_01980 4287 5345 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_01980 5346 6041 gene locus_tag LOCUS_01990 5346 6041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_01990 6909 6145 gene locus_tag LOCUS_02000 6909 6145 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930017.1 protein_id gnl|my_center|LOCUS_02000 8504 7086 gene locus_tag LOCUS_02010 8504 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 9478 8504 gene locus_tag LOCUS_02020 9478 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9706 10992 gene locus_tag LOCUS_02030 9706 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10982 11560 gene locus_tag LOCUS_02040 10982 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 11868 12659 gene locus_tag LOCUS_02050 11868 12659 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_02050 12659 13609 gene locus_tag LOCUS_02060 12659 13609 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_02060 13743 15755 gene locus_tag LOCUS_02070 13743 15755 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_02070 15855 17549 gene locus_tag LOCUS_02080 gene ptsP 15855 17549 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804335.1 protein_id gnl|my_center|LOCUS_02080 17796 18074 gene locus_tag LOCUS_02090 17796 18074 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_02090 18521 20584 gene locus_tag LOCUS_02100 18521 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 21346 20675 gene locus_tag LOCUS_02110 21346 20675 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_02110 21512 21874 gene locus_tag LOCUS_02120 21512 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 22032 22622 gene locus_tag LOCUS_02130 22032 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 22968 24590 gene locus_tag LOCUS_02140 gene groL 22968 24590 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_02140 24724 25932 gene locus_tag LOCUS_02150 gene rlmC 24724 25932 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816017.1 protein_id gnl|my_center|LOCUS_02150 26267 28048 gene locus_tag LOCUS_02160 26267 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 28048 28560 gene locus_tag LOCUS_02170 28048 28560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 29210 28698 gene locus_tag LOCUS_02180 29210 28698 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 protein_id gnl|my_center|LOCUS_02180 29454 30863 gene locus_tag LOCUS_02190 29454 30863 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_02190 31137 31838 gene locus_tag LOCUS_02200 31137 31838 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206721.1 protein_id gnl|my_center|LOCUS_02200 31835 32602 gene locus_tag LOCUS_02210 31835 32602 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092036.1 protein_id gnl|my_center|LOCUS_02210 32669 33772 gene locus_tag LOCUS_02220 gene amoC 32669 33772 CDS product amonabactin biosynthesis isochorismate synthase AmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_02220 34924 33884 gene locus_tag LOCUS_02230 34924 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 35079 36497 gene locus_tag LOCUS_02240 35079 36497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 36993 36703 gene locus_tag LOCUS_02250 36993 36703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 38870 37371 gene locus_tag LOCUS_02260 38870 37371 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_02260 39576 38872 gene locus_tag LOCUS_02270 39576 38872 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_02270 39926 39654 gene locus_tag LOCUS_02280 39926 39654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 40067 40894 gene locus_tag LOCUS_02290 40067 40894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 41071 41775 gene locus_tag LOCUS_02300 41071 41775 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_02300 42505 43140 gene locus_tag LOCUS_02310 42505 43140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 43582 43280 gene locus_tag LOCUS_02320 43582 43280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02320 44267 43563 gene locus_tag LOCUS_02330 44267 43563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 44419 44492 gene locus_tag LOCUS_t00120 44419 44492 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 2791 122 gene locus_tag LOCUS_02340 2791 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3488 3216 gene locus_tag LOCUS_02350 gene rpsQ 3488 3216 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_02350 3724 3485 gene locus_tag LOCUS_02360 gene rpmC 3724 3485 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_02360 4149 3730 gene locus_tag LOCUS_02370 gene rplP 4149 3730 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_02370 4947 4150 gene locus_tag LOCUS_02380 gene rpsC 4947 4150 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_02380 5313 4948 gene locus_tag LOCUS_02390 gene rplV 5313 4948 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_02390 5655 5374 gene locus_tag LOCUS_02400 gene rpsS 5655 5374 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403584.1 protein_id gnl|my_center|LOCUS_02400 6504 5668 gene locus_tag LOCUS_02410 gene rplB 6504 5668 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_02410 6847 6545 gene locus_tag LOCUS_02420 gene rplW 6847 6545 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_02420 7464 6847 gene locus_tag LOCUS_02430 gene rplD 7464 6847 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_02430 8127 7471 gene locus_tag LOCUS_02440 gene rplC 8127 7471 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_02440 8449 8141 gene locus_tag LOCUS_02450 gene rpsJ 8449 8141 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_02450 9102 12443 gene locus_tag LOCUS_02460 9102 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14132 12942 gene locus_tag LOCUS_02470 gene tuf 14132 12942 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 protein_id gnl|my_center|LOCUS_02470 16448 14334 gene locus_tag LOCUS_02480 gene fusA 16448 14334 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_02480 16991 16521 gene locus_tag LOCUS_02490 gene rpsG 16991 16521 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_02490 17365 16991 gene locus_tag LOCUS_02500 gene rpsL 17365 16991 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_02500 19917 17962 gene locus_tag LOCUS_02510 19917 17962 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_02510 24524 20613 gene locus_tag LOCUS_02520 24524 20613 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_02520 28141 24635 gene locus_tag LOCUS_02530 gene rpoB 28141 24635 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_02530 29990 28494 gene locus_tag LOCUS_02540 29990 28494 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877699.1 protein_id gnl|my_center|LOCUS_02540 31419 30301 gene locus_tag LOCUS_02550 gene gcvT 31419 30301 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_02550 34423 31583 gene locus_tag LOCUS_02560 gene gcvP 34423 31583 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_02560 35966 34743 gene locus_tag LOCUS_02570 35966 34743 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_02570 36830 35997 gene locus_tag LOCUS_02580 gene narI 36830 35997 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_02580 37597 36857 gene locus_tag LOCUS_02590 gene narJ 37597 36857 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775895.1 protein_id gnl|my_center|LOCUS_02590 39215 37602 gene locus_tag LOCUS_02600 gene narH 39215 37602 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_02600 <41075 39215 gene locus_tag LOCUS_02610 <41075 39215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898748.1:nitrate reductase subunit alpha >Feature sequence007 1629 1853 gene locus_tag LOCUS_02620 1629 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3364 2165 gene locus_tag LOCUS_02630 3364 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 protein_id gnl|my_center|LOCUS_02630 4392 3517 gene locus_tag LOCUS_02640 4392 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4821 4444 gene locus_tag LOCUS_02650 4821 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5559 4822 gene locus_tag LOCUS_02660 5559 4822 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_02660 7734 5731 gene locus_tag LOCUS_02670 7734 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_02670 8118 8660 gene locus_tag LOCUS_02680 8118 8660 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250228.1 protein_id gnl|my_center|LOCUS_02680 8781 10010 gene locus_tag LOCUS_02690 gene argE 8781 10010 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_02690 10440 10222 gene locus_tag LOCUS_02700 10440 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10435 10812 gene locus_tag LOCUS_02710 10435 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 11658 11032 gene locus_tag LOCUS_02720 11658 11032 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_02720 12329 11691 gene locus_tag LOCUS_02730 12329 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13002 12550 gene locus_tag LOCUS_02740 13002 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13406 13002 gene locus_tag LOCUS_02750 13406 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 16321 13538 gene locus_tag LOCUS_02760 16321 13538 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_02760 17234 16533 gene locus_tag LOCUS_02770 17234 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 19047 17386 gene locus_tag LOCUS_02780 19047 17386 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_02780 19950 19207 gene locus_tag LOCUS_02790 19950 19207 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_02790 20250 21113 gene locus_tag LOCUS_02800 20250 21113 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_02800 21740 21417 gene locus_tag LOCUS_02810 21740 21417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 22247 21750 gene locus_tag LOCUS_02820 22247 21750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 24156 22420 gene locus_tag LOCUS_02830 24156 22420 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 protein_id gnl|my_center|LOCUS_02830 25298 24405 gene locus_tag LOCUS_02840 25298 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 25591 26193 gene locus_tag LOCUS_02850 25591 26193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 26470 27867 gene locus_tag LOCUS_02860 gene galK 26470 27867 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776399.1 protein_id gnl|my_center|LOCUS_02860 28284 28487 gene locus_tag LOCUS_02870 28284 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 29059 29379 gene locus_tag LOCUS_02880 29059 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 29381 30199 gene locus_tag LOCUS_02890 29381 30199 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 protein_id gnl|my_center|LOCUS_02890 31359 30544 gene locus_tag LOCUS_02900 31359 30544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 32041 31514 gene locus_tag LOCUS_02910 32041 31514 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 protein_id gnl|my_center|LOCUS_02910 32212 32547 gene locus_tag LOCUS_02920 32212 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 32867 32757 gene locus_tag LOCUS_r00010 32867 32757 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence008 1068 1781 gene locus_tag LOCUS_02930 1068 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3896 1872 gene locus_tag LOCUS_02940 3896 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8402 4014 gene locus_tag LOCUS_02950 8402 4014 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_02950 9844 8519 gene locus_tag LOCUS_02960 9844 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12927 9946 gene locus_tag LOCUS_02970 12927 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13970 13278 gene locus_tag LOCUS_02980 13970 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14719 14060 gene locus_tag LOCUS_02990 14719 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15466 14807 gene locus_tag LOCUS_03000 15466 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 15972 16190 gene locus_tag LOCUS_03010 15972 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 16335 17063 gene locus_tag LOCUS_03020 16335 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 18652 17177 gene locus_tag LOCUS_03030 18652 17177 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068231.1 protein_id gnl|my_center|LOCUS_03030 18980 22060 gene locus_tag LOCUS_03040 18980 22060 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068233.1 protein_id gnl|my_center|LOCUS_03040 24191 22209 gene locus_tag LOCUS_03050 24191 22209 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_03050 25882 24437 gene locus_tag LOCUS_03060 gene glpT 25882 24437 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_03060 28779 26452 gene locus_tag LOCUS_03070 gene metE 28779 26452 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_03070 29832 28927 gene locus_tag LOCUS_03080 29832 28927 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 protein_id gnl|my_center|LOCUS_03080 30076 29801 gene locus_tag LOCUS_03090 30076 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 30130 30309 gene locus_tag LOCUS_03100 30130 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 31645 32175 gene locus_tag LOCUS_03110 31645 32175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence009 213 1475 gene locus_tag LOCUS_03120 gene mshA 213 1475 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_03120 1505 2287 gene locus_tag LOCUS_03130 1505 2287 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_03130 2897 4378 gene locus_tag LOCUS_03140 2897 4378 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_03140 6195 4609 gene locus_tag LOCUS_03150 6195 4609 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_03150 6727 6287 gene locus_tag LOCUS_03160 6727 6287 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_03160 8860 6977 gene locus_tag LOCUS_03170 gene glmS 8860 6977 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 protein_id gnl|my_center|LOCUS_03170 9094 10011 gene locus_tag LOCUS_03180 gene coaA 9094 10011 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_03180 10404 10934 gene locus_tag LOCUS_03190 10404 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11206 11580 gene locus_tag LOCUS_03200 gene mscL 11206 11580 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 protein_id gnl|my_center|LOCUS_03200 13102 11744 gene locus_tag LOCUS_03210 gene glmM 13102 11744 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_03210 14466 13405 gene locus_tag LOCUS_03220 gene ppk2 14466 13405 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082944.1 protein_id gnl|my_center|LOCUS_03220 15185 14694 gene locus_tag LOCUS_03230 gene rpsI 15185 14694 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_03230 15660 15217 gene locus_tag LOCUS_03240 gene rplM 15660 15217 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_03240 16976 16008 gene locus_tag LOCUS_03250 gene truA 16976 16008 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_03250 17793 17125 gene locus_tag LOCUS_03260 gene rplQ 17793 17125 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819143.1 protein_id gnl|my_center|LOCUS_03260 18891 17899 gene locus_tag LOCUS_03270 18891 17899 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776351.1 protein_id gnl|my_center|LOCUS_03270 19438 19031 gene locus_tag LOCUS_03280 gene rpsK 19438 19031 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_03280 19875 19507 gene locus_tag LOCUS_03290 gene rpsM 19875 19507 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_03290 20510 20289 gene locus_tag LOCUS_03300 gene infA 20510 20289 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_03300 22070 20853 gene locus_tag LOCUS_03310 gene rlmN 22070 20853 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_03310 22975 22139 gene locus_tag LOCUS_03320 gene map 22975 22139 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776355.1 protein_id gnl|my_center|LOCUS_03320 23660 23097 gene locus_tag LOCUS_03330 23660 23097 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_03330 24964 23657 gene locus_tag LOCUS_03340 gene secY 24964 23657 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_03340 25695 25249 gene locus_tag LOCUS_03350 gene rplO 25695 25249 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_03350 25904 25698 gene locus_tag LOCUS_03360 gene rpmD 25904 25698 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_03360 26581 25907 gene locus_tag LOCUS_03370 gene rpsE 26581 25907 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776360.1 protein_id gnl|my_center|LOCUS_03370 26940 26581 gene locus_tag LOCUS_03380 gene rplR 26940 26581 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_03380 27479 26943 gene locus_tag LOCUS_03390 gene rplF 27479 26943 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_03390 27905 27507 gene locus_tag LOCUS_03400 gene rpsH 27905 27507 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_03400 28539 27979 gene locus_tag LOCUS_03410 gene rplE 28539 27979 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_03410 28874 28539 gene locus_tag LOCUS_03420 gene rplX 28874 28539 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 protein_id gnl|my_center|LOCUS_03420 29249 28878 gene locus_tag LOCUS_03430 gene rplN 29249 28878 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_03430 31135 29948 gene locus_tag LOCUS_03440 31135 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence010 4080 55 gene locus_tag LOCUS_03450 4080 55 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_03450 4478 5188 gene locus_tag LOCUS_03460 4478 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5363 5857 gene locus_tag LOCUS_03470 5363 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6107 7399 gene locus_tag LOCUS_03480 6107 7399 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_03480 7772 9373 gene locus_tag LOCUS_03490 7772 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10130 9435 gene locus_tag LOCUS_03500 10130 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10415 11452 gene locus_tag LOCUS_03510 10415 11452 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013358.1 protein_id gnl|my_center|LOCUS_03510 12198 11515 gene locus_tag LOCUS_03520 12198 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 13468 12428 gene locus_tag LOCUS_03530 13468 12428 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537420.1 protein_id gnl|my_center|LOCUS_03530 14783 13494 gene locus_tag LOCUS_03540 14783 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 14894 15922 gene locus_tag LOCUS_03550 14894 15922 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383252.1 protein_id gnl|my_center|LOCUS_03550 17737 16121 gene locus_tag LOCUS_03560 17737 16121 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_03560 18107 19558 gene locus_tag LOCUS_03570 18107 19558 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726769.1 protein_id gnl|my_center|LOCUS_03570 19570 20076 gene locus_tag LOCUS_03580 19570 20076 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_03580 20498 21385 gene locus_tag LOCUS_03590 20498 21385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21810 22961 gene locus_tag LOCUS_03600 21810 22961 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804431.1 protein_id gnl|my_center|LOCUS_03600 23274 24434 gene locus_tag LOCUS_03610 23274 24434 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804431.1 protein_id gnl|my_center|LOCUS_03610 24507 25352 gene locus_tag LOCUS_03620 24507 25352 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 protein_id gnl|my_center|LOCUS_03620 25622 26440 gene locus_tag LOCUS_03630 25622 26440 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 protein_id gnl|my_center|LOCUS_03630 26469 27143 gene locus_tag LOCUS_03640 26469 27143 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529174.1 protein_id gnl|my_center|LOCUS_03640 27136 27885 gene locus_tag LOCUS_03650 27136 27885 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 protein_id gnl|my_center|LOCUS_03650 28792 27986 gene locus_tag LOCUS_03660 28792 27986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence011 903 43 gene locus_tag LOCUS_03670 903 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03670 1358 903 gene locus_tag LOCUS_03680 1358 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03680 3792 1522 gene locus_tag LOCUS_03690 3792 1522 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_03690 4941 3907 gene locus_tag LOCUS_03700 gene mshD 4941 3907 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_03700 5742 5065 gene locus_tag LOCUS_03710 gene glnR 5742 5065 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_03710 5910 6029 gene locus_tag LOCUS_03720 5910 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6249 6941 gene locus_tag LOCUS_03730 6249 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7014 8270 gene locus_tag LOCUS_03740 7014 8270 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930019.1 protein_id gnl|my_center|LOCUS_03740 9400 8369 gene locus_tag LOCUS_03750 9400 8369 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_03750 10960 9758 gene locus_tag LOCUS_03760 10960 9758 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_03760 11323 11396 gene locus_tag LOCUS_t00130 11323 11396 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11472 11750 gene locus_tag LOCUS_03770 11472 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11872 12597 gene locus_tag LOCUS_03780 gene nusG 11872 12597 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080371.1 protein_id gnl|my_center|LOCUS_03780 12885 13313 gene locus_tag LOCUS_03790 gene rplK 12885 13313 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_03790 13450 14145 gene locus_tag LOCUS_03800 gene rplA 13450 14145 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403292.1 protein_id gnl|my_center|LOCUS_03800 14455 15429 gene locus_tag LOCUS_03810 gene tehA 14455 15429 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225019.1 protein_id gnl|my_center|LOCUS_03810 15519 16709 gene locus_tag LOCUS_03820 15519 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 17034 16777 gene locus_tag LOCUS_03830 17034 16777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 17105 17635 gene locus_tag LOCUS_03840 gene rplJ 17105 17635 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_03840 17789 18163 gene locus_tag LOCUS_03850 gene rplL 17789 18163 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_03850 18334 19875 gene locus_tag LOCUS_03860 18334 19875 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_03860 20119 22110 gene locus_tag LOCUS_03870 20119 22110 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015272.1 protein_id gnl|my_center|LOCUS_03870 22381 23043 gene locus_tag LOCUS_03880 22381 23043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862331.1 protein_id gnl|my_center|LOCUS_03880 24240 23149 gene locus_tag LOCUS_03890 24240 23149 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 protein_id gnl|my_center|LOCUS_03890 25677 24382 gene locus_tag LOCUS_03900 25677 24382 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_03900 26436 25747 gene locus_tag LOCUS_03910 26436 25747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 26719 26453 gene locus_tag LOCUS_03920 26719 26453 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 protein_id gnl|my_center|LOCUS_03920 27747 26782 gene locus_tag LOCUS_03930 gene moaA 27747 26782 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804484.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence012 490 738 gene locus_tag LOCUS_03940 490 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2098 875 gene locus_tag LOCUS_03950 2098 875 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_03950 3391 2105 gene locus_tag LOCUS_03960 3391 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3900 3388 gene locus_tag LOCUS_03970 3900 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5074 3917 gene locus_tag LOCUS_03980 5074 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5600 5106 gene locus_tag LOCUS_03990 5600 5106 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775742.1 protein_id gnl|my_center|LOCUS_03990 7880 6270 gene locus_tag LOCUS_04000 7880 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9088 8180 gene locus_tag LOCUS_04010 gene galU 9088 8180 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_04010 9364 10047 gene locus_tag LOCUS_04020 9364 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10179 10364 gene locus_tag LOCUS_04030 10179 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10774 10478 gene locus_tag LOCUS_04040 10774 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14729 10767 gene locus_tag LOCUS_04050 14729 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 15296 14838 gene locus_tag LOCUS_04060 15296 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 16218 15400 gene locus_tag LOCUS_04070 16218 15400 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613407.1 protein_id gnl|my_center|LOCUS_04070 18102 16462 gene locus_tag LOCUS_04080 gene malP 18102 16462 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_04080 18525 19403 gene locus_tag LOCUS_04090 18525 19403 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670838.1 protein_id gnl|my_center|LOCUS_04090 19484 21298 gene locus_tag LOCUS_04100 19484 21298 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102265.1 protein_id gnl|my_center|LOCUS_04100 21422 23227 gene locus_tag LOCUS_04110 gene malL 21422 23227 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_04110 24341 23367 gene locus_tag LOCUS_04120 24341 23367 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_04120 24867 25133 gene locus_tag LOCUS_04130 24867 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 25314 25141 gene locus_tag LOCUS_04140 25314 25141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 25495 25334 gene locus_tag LOCUS_04150 25495 25334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 27288 25696 gene locus_tag LOCUS_04160 gene guaA 27288 25696 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_04160 <28286 27508 gene locus_tag LOCUS_04170 <28286 27508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052748.1:GuaB3 family IMP dehydrogenase-related protein >Feature sequence013 239 1255 gene locus_tag LOCUS_04180 239 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1412 2437 gene locus_tag LOCUS_04190 gene rarD 1412 2437 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_04190 2683 2540 gene locus_tag LOCUS_04200 2683 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4275 2692 gene locus_tag LOCUS_04210 4275 2692 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776843.1 protein_id gnl|my_center|LOCUS_04210 5692 4631 gene locus_tag LOCUS_04220 5692 4631 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_04220 6540 5809 gene locus_tag LOCUS_04230 6540 5809 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_04230 6797 7636 gene locus_tag LOCUS_04240 6797 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7769 8572 gene locus_tag LOCUS_04250 7769 8572 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_04250 8606 9385 gene locus_tag LOCUS_04260 8606 9385 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_04260 10320 9487 gene locus_tag LOCUS_04270 10320 9487 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_04270 10911 10525 gene locus_tag LOCUS_04280 10911 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 12524 11094 gene locus_tag LOCUS_04290 12524 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12883 13962 gene locus_tag LOCUS_04300 12883 13962 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_04300 14082 15974 gene locus_tag LOCUS_04310 gene menD 14082 15974 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_04310 16200 17219 gene locus_tag LOCUS_04320 16200 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 18279 17371 gene locus_tag LOCUS_04330 18279 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 18460 19470 gene locus_tag LOCUS_04340 gene gluQRS 18460 19470 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 protein_id gnl|my_center|LOCUS_04340 19890 21377 gene locus_tag LOCUS_04350 gene putP 19890 21377 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730456.1 protein_id gnl|my_center|LOCUS_04350 21496 22449 gene locus_tag LOCUS_04360 21496 22449 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_04360 22598 23908 gene locus_tag LOCUS_04370 gene menE 22598 23908 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_04370 24000 24914 gene locus_tag LOCUS_04380 24000 24914 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_04380 25031 25453 gene locus_tag LOCUS_04390 25031 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence014 4484 1419 gene locus_tag LOCUS_04400 4484 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6267 4693 gene locus_tag LOCUS_04410 6267 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6461 6946 gene locus_tag LOCUS_04420 6461 6946 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_04420 7213 7437 gene locus_tag LOCUS_04430 7213 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7483 8724 gene locus_tag LOCUS_04440 7483 8724 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014221.1 protein_id gnl|my_center|LOCUS_04440 8819 9961 gene locus_tag LOCUS_04450 gene tilS 8819 9961 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_04450 10234 10785 gene locus_tag LOCUS_04460 gene hpt 10234 10785 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_04460 11034 13250 gene locus_tag LOCUS_04470 gene ftsH 11034 13250 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_04470 13237 13821 gene locus_tag LOCUS_04480 gene folE 13237 13821 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_04480 14133 13942 gene locus_tag LOCUS_04490 14133 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14291 15262 gene locus_tag LOCUS_04500 gene folP 14291 15262 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_04500 15341 15772 gene locus_tag LOCUS_04510 gene folB 15341 15772 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_04510 15775 16359 gene locus_tag LOCUS_04520 15775 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 16405 16920 gene locus_tag LOCUS_04530 16405 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 16907 17554 gene locus_tag LOCUS_04540 16907 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 17554 19323 gene locus_tag LOCUS_04550 17554 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19487 20449 gene locus_tag LOCUS_04560 19487 20449 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804901.1 protein_id gnl|my_center|LOCUS_04560 20446 21393 gene locus_tag LOCUS_04570 gene panC 20446 21393 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013399.1 protein_id gnl|my_center|LOCUS_04570 21446 23029 gene locus_tag LOCUS_04580 gene lysS 21446 23029 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804903.1 protein_id gnl|my_center|LOCUS_04580 23867 24217 gene locus_tag LOCUS_04590 gene lsr2 23867 24217 CDS product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence015 683 2359 gene locus_tag LOCUS_04600 gene pgi 683 2359 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804725.1 protein_id gnl|my_center|LOCUS_04600 3179 2493 gene locus_tag LOCUS_04610 gene pcp 3179 2493 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816813.1 protein_id gnl|my_center|LOCUS_04610 3774 3184 gene locus_tag LOCUS_04620 3774 3184 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185518.1 protein_id gnl|my_center|LOCUS_04620 4466 3936 gene locus_tag LOCUS_04630 4466 3936 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330934.1 protein_id gnl|my_center|LOCUS_04630 6149 4656 gene locus_tag LOCUS_04640 6149 4656 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114709.1 protein_id gnl|my_center|LOCUS_04640 6947 6450 gene locus_tag LOCUS_04650 6947 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 7170 7979 gene locus_tag LOCUS_04660 7170 7979 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111777.1 protein_id gnl|my_center|LOCUS_04660 8494 8829 gene locus_tag LOCUS_04670 8494 8829 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 protein_id gnl|my_center|LOCUS_04670 8839 9762 gene locus_tag LOCUS_04680 8839 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 10517 10017 gene locus_tag LOCUS_04690 gene tpx 10517 10017 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 protein_id gnl|my_center|LOCUS_04690 10794 11555 gene locus_tag LOCUS_04700 10794 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 12024 12416 gene locus_tag LOCUS_04710 12024 12416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223040.1 protein_id gnl|my_center|LOCUS_04710 12583 12840 gene locus_tag LOCUS_04720 12583 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13347 12979 gene locus_tag LOCUS_04730 13347 12979 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856918.1 protein_id gnl|my_center|LOCUS_04730 13346 13603 gene locus_tag LOCUS_04740 13346 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 13693 13905 gene locus_tag LOCUS_04750 13693 13905 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 protein_id gnl|my_center|LOCUS_04750 16039 14030 gene locus_tag LOCUS_04760 16039 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17273 16188 gene locus_tag LOCUS_04770 gene ychF 17273 16188 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 protein_id gnl|my_center|LOCUS_04770 18122 17490 gene locus_tag LOCUS_04780 18122 17490 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_04780 19524 18262 gene locus_tag LOCUS_04790 19524 18262 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228376.1 protein_id gnl|my_center|LOCUS_04790 20462 19704 gene locus_tag LOCUS_04800 20462 19704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21471 20518 gene locus_tag LOCUS_04810 21471 20518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_04810 22863 21778 gene locus_tag LOCUS_04820 22863 21778 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_04820 24024 22891 gene locus_tag LOCUS_04830 24024 22891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence016 981 1508 gene locus_tag LOCUS_04840 981 1508 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226777.1 protein_id gnl|my_center|LOCUS_04840 1510 2157 gene locus_tag LOCUS_04850 1510 2157 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674225.1 protein_id gnl|my_center|LOCUS_04850 3640 2327 gene locus_tag LOCUS_04860 3640 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3924 4073 gene locus_tag LOCUS_04870 3924 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4558 6747 gene locus_tag LOCUS_04880 4558 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 7000 9084 gene locus_tag LOCUS_04890 7000 9084 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899282.1 protein_id gnl|my_center|LOCUS_04890 9241 9993 gene locus_tag LOCUS_04900 9241 9993 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04900 12537 10102 gene locus_tag LOCUS_04910 12537 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13957 14196 gene locus_tag LOCUS_04920 13957 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 14342 14863 gene locus_tag LOCUS_04930 14342 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 16128 15925 gene locus_tag LOCUS_04940 16128 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17382 16789 gene locus_tag LOCUS_04950 17382 16789 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022833.1 protein_id gnl|my_center|LOCUS_04950 18716 17481 gene locus_tag LOCUS_04960 18716 17481 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_04960 19441 19365 gene locus_tag LOCUS_t00140 19441 19365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22829 19686 gene locus_tag LOCUS_04970 22829 19686 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068258.1 protein_id gnl|my_center|LOCUS_04970 24266 23043 gene locus_tag LOCUS_04980 24266 23043 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence017 646 1071 gene locus_tag LOCUS_04990 646 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1135 1350 gene locus_tag LOCUS_05000 1135 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1380 1766 gene locus_tag LOCUS_05010 1380 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1942 4449 gene locus_tag LOCUS_05020 1942 4449 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_05020 5076 4711 gene locus_tag LOCUS_05030 5076 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05030 5367 5077 gene locus_tag LOCUS_05040 5367 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 6974 5505 gene locus_tag LOCUS_05050 6974 5505 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_05050 7452 7060 gene locus_tag LOCUS_05060 7452 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 7741 8568 gene locus_tag LOCUS_05070 7741 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9855 8692 gene locus_tag LOCUS_05080 9855 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 protein_id gnl|my_center|LOCUS_05080 9997 10620 gene locus_tag LOCUS_05090 9997 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 10734 11843 gene locus_tag LOCUS_05100 10734 11843 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_05100 13651 11999 gene locus_tag LOCUS_05110 13651 11999 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 protein_id gnl|my_center|LOCUS_05110 15666 14065 gene locus_tag LOCUS_05120 15666 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 16546 16034 gene locus_tag LOCUS_05130 16546 16034 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989640.1 protein_id gnl|my_center|LOCUS_05130 16883 17464 gene locus_tag LOCUS_05140 16883 17464 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804467.1 protein_id gnl|my_center|LOCUS_05140 18682 17654 gene locus_tag LOCUS_05150 gene fbaA 18682 17654 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_05150 18975 19361 gene locus_tag LOCUS_05160 18975 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19666 21285 gene locus_tag LOCUS_05170 19666 21285 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence018 511 1131 gene locus_tag LOCUS_05180 511 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1326 2057 gene locus_tag LOCUS_05190 1326 2057 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_05190 3118 2219 gene locus_tag LOCUS_05200 3118 2219 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_05200 3927 3121 gene locus_tag LOCUS_05210 3927 3121 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_05210 4952 3999 gene locus_tag LOCUS_05220 4952 3999 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_05220 5958 5158 gene locus_tag LOCUS_05230 5958 5158 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_05230 6920 6141 gene locus_tag LOCUS_05240 6920 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8553 7225 gene locus_tag LOCUS_05250 8553 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9340 8921 gene locus_tag LOCUS_05260 9340 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 9784 9470 gene locus_tag LOCUS_05270 9784 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10997 9765 gene locus_tag LOCUS_05280 10997 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11926 11207 gene locus_tag LOCUS_05290 11926 11207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_05290 12345 12064 gene locus_tag LOCUS_05300 12345 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14273 12927 gene locus_tag LOCUS_05310 14273 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15806 14811 gene locus_tag LOCUS_05320 15806 14811 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 protein_id gnl|my_center|LOCUS_05320 17498 15927 gene locus_tag LOCUS_05330 17498 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 18867 17731 gene locus_tag LOCUS_05340 18867 17731 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence019 150 1202 gene locus_tag LOCUS_05350 150 1202 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_05350 1774 2778 gene locus_tag LOCUS_05360 gene gap 1774 2778 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_05360 3117 4340 gene locus_tag LOCUS_05370 3117 4340 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_05370 4827 11684 gene locus_tag LOCUS_05380 4827 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 11949 12323 gene locus_tag LOCUS_05390 11949 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12326 13204 gene locus_tag LOCUS_05400 12326 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 13274 13864 gene locus_tag LOCUS_05410 13274 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14108 14884 gene locus_tag LOCUS_05420 gene tpiA 14108 14884 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057795.1 protein_id gnl|my_center|LOCUS_05420 15160 15624 gene locus_tag LOCUS_05430 15160 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 15734 15991 gene locus_tag LOCUS_05440 gene secG 15734 15991 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 protein_id gnl|my_center|LOCUS_05440 16477 18873 gene locus_tag LOCUS_05450 16477 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence020 1405 2172 gene locus_tag LOCUS_05460 1405 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2172 3281 gene locus_tag LOCUS_05470 2172 3281 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_05470 3290 5107 gene locus_tag LOCUS_05480 3290 5107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_05480 6193 5222 gene locus_tag LOCUS_05490 6193 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 7152 6190 gene locus_tag LOCUS_05500 7152 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7334 8254 gene locus_tag LOCUS_05510 7334 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8513 9511 gene locus_tag LOCUS_05520 8513 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 9502 10602 gene locus_tag LOCUS_05530 9502 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803906.1 protein_id gnl|my_center|LOCUS_05530 10602 11330 gene locus_tag LOCUS_05540 10602 11330 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_05540 11420 13663 gene locus_tag LOCUS_05550 11420 13663 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582619.1 protein_id gnl|my_center|LOCUS_05550 13675 14760 gene locus_tag LOCUS_05560 13675 14760 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_05560 14757 15872 gene locus_tag LOCUS_05570 14757 15872 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_05570 15869 17293 gene locus_tag LOCUS_05580 15869 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 17296 18336 gene locus_tag LOCUS_05590 17296 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence021 1367 429 gene locus_tag LOCUS_05600 gene rsmI 1367 429 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_05600 1540 3171 gene locus_tag LOCUS_05610 1540 3171 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_05610 4614 3265 gene locus_tag LOCUS_05620 4614 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4998 4774 gene locus_tag LOCUS_05630 4998 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5438 5019 gene locus_tag LOCUS_05640 5438 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6126 6920 gene locus_tag LOCUS_05650 6126 6920 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111929.1 protein_id gnl|my_center|LOCUS_05650 7652 7047 gene locus_tag LOCUS_05660 7652 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7921 9111 gene locus_tag LOCUS_05670 7921 9111 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_05670 9223 9861 gene locus_tag LOCUS_05680 gene purE 9223 9861 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776122.1 protein_id gnl|my_center|LOCUS_05680 9881 10882 gene locus_tag LOCUS_05690 9881 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 11984 10977 gene locus_tag LOCUS_05700 gene glpX 11984 10977 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803850.1 protein_id gnl|my_center|LOCUS_05700 12306 13037 gene locus_tag LOCUS_05710 12306 13037 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731025.1 protein_id gnl|my_center|LOCUS_05710 13272 14678 gene locus_tag LOCUS_05720 13272 14678 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776300.1 protein_id gnl|my_center|LOCUS_05720 16031 14814 gene locus_tag LOCUS_05730 gene entS 16031 14814 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704709.1 protein_id gnl|my_center|LOCUS_05730 16405 16028 gene locus_tag LOCUS_05740 16405 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17658 16402 gene locus_tag LOCUS_05750 17658 16402 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228622.1 protein_id gnl|my_center|LOCUS_05750 18252 17707 gene locus_tag LOCUS_05760 18252 17707 CDS product DUF6423 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228623.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence022 1542 55 gene locus_tag LOCUS_05770 1542 55 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_05770 2529 1651 gene locus_tag LOCUS_05780 gene rfbA 2529 1651 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803925.1 protein_id gnl|my_center|LOCUS_05780 2586 3584 gene locus_tag LOCUS_05790 gene rfbB 2586 3584 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_05790 3584 5008 gene locus_tag LOCUS_05800 3584 5008 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_05800 5243 5527 gene locus_tag LOCUS_05810 5243 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5716 6303 gene locus_tag LOCUS_05820 gene pth 5716 6303 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804953.1 protein_id gnl|my_center|LOCUS_05820 6460 7758 gene locus_tag LOCUS_05830 6460 7758 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_05830 7850 8320 gene locus_tag LOCUS_05840 7850 8320 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_05840 8608 9105 gene locus_tag LOCUS_05850 8608 9105 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_05850 9735 9238 gene locus_tag LOCUS_05860 9735 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 10722 10012 gene locus_tag LOCUS_05870 10722 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 11470 10991 gene locus_tag LOCUS_05880 11470 10991 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_05880 12826 11594 gene locus_tag LOCUS_05890 12826 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 14751 12880 gene locus_tag LOCUS_05900 14751 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16094 14748 gene locus_tag LOCUS_05910 16094 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 17063 16113 gene locus_tag LOCUS_05920 17063 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence023 227 1222 gene locus_tag LOCUS_05930 227 1222 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_05930 1226 1696 gene locus_tag LOCUS_05940 1226 1696 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_05940 2752 1946 gene locus_tag LOCUS_05950 gene trmB 2752 1946 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 protein_id gnl|my_center|LOCUS_05950 3331 2933 gene locus_tag LOCUS_05960 3331 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013365.1 protein_id gnl|my_center|LOCUS_05960 3842 5311 gene locus_tag LOCUS_05970 gene cycA 3842 5311 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_05970 5729 7204 gene locus_tag LOCUS_05980 gene cycA 5729 7204 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_05980 8967 7333 gene locus_tag LOCUS_05990 8967 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9204 11699 gene locus_tag LOCUS_06000 9204 11699 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_06000 12738 11902 gene locus_tag LOCUS_06010 12738 11902 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803740.1 protein_id gnl|my_center|LOCUS_06010 13655 12942 gene locus_tag LOCUS_06020 13655 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 13790 14113 gene locus_tag LOCUS_06030 13790 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15321 14110 gene locus_tag LOCUS_06040 15321 14110 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence024 374 27 gene locus_tag LOCUS_06050 374 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1942 635 gene locus_tag LOCUS_06060 1942 635 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776646.1 protein_id gnl|my_center|LOCUS_06060 3084 2098 gene locus_tag LOCUS_06070 3084 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3394 5277 gene locus_tag LOCUS_06080 3394 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6928 5390 gene locus_tag LOCUS_06090 6928 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8310 6925 gene locus_tag LOCUS_06100 8310 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8671 11658 gene locus_tag LOCUS_06110 8671 11658 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 protein_id gnl|my_center|LOCUS_06110 12028 12810 gene locus_tag LOCUS_06120 12028 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14237 13026 gene locus_tag LOCUS_06130 14237 13026 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_06130 14961 14668 gene locus_tag LOCUS_06140 14961 14668 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_06140 15129 15410 gene locus_tag LOCUS_06150 15129 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence025 4312 1043 gene locus_tag LOCUS_06160 4312 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4245 4469 gene locus_tag LOCUS_06170 4245 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5372 4515 gene locus_tag LOCUS_06180 5372 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8064 5722 gene locus_tag LOCUS_06190 8064 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10991 8631 gene locus_tag LOCUS_06200 10991 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11503 15267 gene locus_tag LOCUS_06210 gene mfd 11503 15267 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence026 709 71 gene locus_tag LOCUS_06220 gene pdxT 709 71 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013889.1 protein_id gnl|my_center|LOCUS_06220 1721 816 gene locus_tag LOCUS_06230 gene pdxS 1721 816 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_06230 2136 3656 gene locus_tag LOCUS_06240 2136 3656 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965780.1 protein_id gnl|my_center|LOCUS_06240 4608 3775 gene locus_tag LOCUS_06250 gene nadE 4608 3775 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174904.1 protein_id gnl|my_center|LOCUS_06250 4828 5199 gene locus_tag LOCUS_06260 4828 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5714 5319 gene locus_tag LOCUS_06270 5714 5319 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_06270 5977 5714 gene locus_tag LOCUS_06280 5977 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 10057 6107 gene locus_tag LOCUS_06290 10057 6107 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_06290 14447 10461 gene locus_tag LOCUS_06300 14447 10461 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence027 <1 1413 gene locus_tag LOCUS_06310 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776102.1:glycosyltransferase 1413 3371 gene locus_tag LOCUS_06320 1413 3371 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_06320 3485 4792 gene locus_tag LOCUS_06330 3485 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4792 5373 gene locus_tag LOCUS_06340 4792 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5401 5661 gene locus_tag LOCUS_06350 5401 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5774 6571 gene locus_tag LOCUS_06360 gene atpB 5774 6571 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_06360 6744 6947 gene locus_tag LOCUS_06370 6744 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 6999 7556 gene locus_tag LOCUS_06380 6999 7556 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_06380 7556 8368 gene locus_tag LOCUS_06390 7556 8368 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_06390 8557 10182 gene locus_tag LOCUS_06400 gene atpA 8557 10182 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_06400 10258 11199 gene locus_tag LOCUS_06410 10258 11199 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814331.1 protein_id gnl|my_center|LOCUS_06410 11256 12719 gene locus_tag LOCUS_06420 gene atpD 11256 12719 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775938.1 protein_id gnl|my_center|LOCUS_06420 12722 12979 gene locus_tag LOCUS_06430 12722 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13864 13151 gene locus_tag LOCUS_06440 gene nucS 13864 13151 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_06440 13935 14261 gene locus_tag LOCUS_06450 13935 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence028 197 2158 gene locus_tag LOCUS_06460 197 2158 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_06460 3711 2380 gene locus_tag LOCUS_06470 3711 2380 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804661.1 protein_id gnl|my_center|LOCUS_06470 6131 3912 gene locus_tag LOCUS_06480 6131 3912 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929901.1 protein_id gnl|my_center|LOCUS_06480 6806 6537 gene locus_tag LOCUS_06490 gene rpsO 6806 6537 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_06490 8423 7017 gene locus_tag LOCUS_06500 8423 7017 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 protein_id gnl|my_center|LOCUS_06500 8968 8666 gene locus_tag LOCUS_06510 8968 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10068 9169 gene locus_tag LOCUS_06520 gene mtnN 10068 9169 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804292.1 protein_id gnl|my_center|LOCUS_06520 10526 10068 gene locus_tag LOCUS_06530 10526 10068 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 protein_id gnl|my_center|LOCUS_06530 11739 10696 gene locus_tag LOCUS_06540 11739 10696 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 protein_id gnl|my_center|LOCUS_06540 12689 11913 gene locus_tag LOCUS_06550 12689 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13941 12844 gene locus_tag LOCUS_06560 gene truB 13941 12844 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence029 1756 401 gene locus_tag LOCUS_06570 gene dnaB 1756 401 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929839.1 protein_id gnl|my_center|LOCUS_06570 2766 1960 gene locus_tag LOCUS_06580 2766 1960 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014886.1 protein_id gnl|my_center|LOCUS_06580 3830 3525 gene locus_tag LOCUS_06590 3830 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4495 4043 gene locus_tag LOCUS_06600 gene rplI 4495 4043 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_06600 4752 4516 gene locus_tag LOCUS_06610 gene rpsR 4752 4516 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_06610 5465 4836 gene locus_tag LOCUS_06620 5465 4836 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015545.1 protein_id gnl|my_center|LOCUS_06620 5864 5559 gene locus_tag LOCUS_06630 gene rpsF 5864 5559 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_06630 7478 6054 gene locus_tag LOCUS_06640 7478 6054 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_06640 7594 8097 gene locus_tag LOCUS_06650 7594 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06650 8195 9859 gene locus_tag LOCUS_06660 8195 9859 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399360.1 protein_id gnl|my_center|LOCUS_06660 9983 11170 gene locus_tag LOCUS_06670 9983 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 11415 12449 gene locus_tag LOCUS_06680 gene trxB 11415 12449 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_06680 12494 12820 gene locus_tag LOCUS_06690 gene trxA 12494 12820 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence030 439 1734 gene locus_tag LOCUS_06700 439 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1736 3325 gene locus_tag LOCUS_06710 1736 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3318 6128 gene locus_tag LOCUS_06720 3318 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6128 7240 gene locus_tag LOCUS_06730 6128 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8108 7377 gene locus_tag LOCUS_06740 8108 7377 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012552828.1 protein_id gnl|my_center|LOCUS_06740 8521 9606 gene locus_tag LOCUS_06750 8521 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence031 <1 1396 gene locus_tag LOCUS_06760 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776100.1:glycosyltransferase 1393 2274 gene locus_tag LOCUS_06770 1393 2274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776099.1 protein_id gnl|my_center|LOCUS_06770 2279 3052 gene locus_tag LOCUS_06780 2279 3052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_06780 3523 4785 gene locus_tag LOCUS_06790 3523 4785 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_06790 4785 5639 gene locus_tag LOCUS_06800 4785 5639 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_06800 5636 6568 gene locus_tag LOCUS_06810 5636 6568 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_06810 6676 6903 gene locus_tag LOCUS_06820 6676 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6903 7358 gene locus_tag LOCUS_06830 6903 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 7456 7845 gene locus_tag LOCUS_06840 7456 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7832 8344 gene locus_tag LOCUS_06850 7832 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 8520 9647 gene locus_tag LOCUS_06860 gene prfB 8520 9647 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_06860 9666 10160 gene locus_tag LOCUS_06870 gene smpB 9666 10160 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_06870 10308 10772 gene locus_tag LOCUS_06880 10308 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10989 11723 gene locus_tag LOCUS_06890 10989 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11993 12363 gene locus_tag LOCUS_tm00010 11993 12363 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 1735 788 gene locus_tag LOCUS_06900 1735 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1830 2531 gene locus_tag LOCUS_06910 1830 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3299 2634 gene locus_tag LOCUS_06920 3299 2634 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_06920 4576 3464 gene locus_tag LOCUS_06930 4576 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803908.1 protein_id gnl|my_center|LOCUS_06930 6104 5046 gene locus_tag LOCUS_06940 6104 5046 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 protein_id gnl|my_center|LOCUS_06940 6865 6095 gene locus_tag LOCUS_06950 6865 6095 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 protein_id gnl|my_center|LOCUS_06950 7153 6956 gene locus_tag LOCUS_06960 gene thiS 7153 6956 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857586.1 protein_id gnl|my_center|LOCUS_06960 8292 7204 gene locus_tag LOCUS_06970 gene thiO 8292 7204 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 protein_id gnl|my_center|LOCUS_06970 8918 8295 gene locus_tag LOCUS_06980 8918 8295 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 protein_id gnl|my_center|LOCUS_06980 9709 9636 gene locus_tag LOCUS_t00150 9709 9636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9852 10451 gene locus_tag LOCUS_06990 gene dcd 9852 10451 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_06990 10581 11921 gene locus_tag LOCUS_07000 10581 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence033 1302 574 gene locus_tag LOCUS_07010 1302 574 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_07010 2988 1588 gene locus_tag LOCUS_07020 2988 1588 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776817.1 protein_id gnl|my_center|LOCUS_07020 3493 4428 gene locus_tag LOCUS_07030 3493 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4482 5777 gene locus_tag LOCUS_07040 4482 5777 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_07040 7664 5919 gene locus_tag LOCUS_07050 7664 5919 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_07050 10256 7872 gene locus_tag LOCUS_07060 10256 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 11801 10683 gene locus_tag LOCUS_07070 11801 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence034 <1 720 gene locus_tag LOCUS_07080 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776152.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase 1685 843 gene locus_tag LOCUS_07090 gene phnF 1685 843 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_07090 1768 2643 gene locus_tag LOCUS_07100 1768 2643 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_07100 2739 3803 gene locus_tag LOCUS_07110 gene trpS 2739 3803 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124091865.1 protein_id gnl|my_center|LOCUS_07110 3855 4433 gene locus_tag LOCUS_07120 3855 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4942 4529 gene locus_tag LOCUS_07130 4942 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 6302 5163 gene locus_tag LOCUS_07140 6302 5163 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_07140 6621 7079 gene locus_tag LOCUS_07150 gene sdhC 6621 7079 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_07150 7083 7568 gene locus_tag LOCUS_07160 gene sdhD 7083 7568 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776148.1 protein_id gnl|my_center|LOCUS_07160 7622 9385 gene locus_tag LOCUS_07170 gene sdhA 7622 9385 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776149.1 protein_id gnl|my_center|LOCUS_07170 9387 10175 gene locus_tag LOCUS_07180 9387 10175 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_07180 10461 11711 gene locus_tag LOCUS_07190 10461 11711 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence035 576 2324 gene locus_tag LOCUS_07200 576 2324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230757.1 protein_id gnl|my_center|LOCUS_07200 2725 4428 gene locus_tag LOCUS_07210 2725 4428 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399395.1 protein_id gnl|my_center|LOCUS_07210 5467 4694 gene locus_tag LOCUS_07220 5467 4694 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776825.1 protein_id gnl|my_center|LOCUS_07220 6523 5693 gene locus_tag LOCUS_07230 6523 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776826.1 protein_id gnl|my_center|LOCUS_07230 8937 6526 gene locus_tag LOCUS_07240 8937 6526 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_07240 9543 10223 gene locus_tag LOCUS_07250 9543 10223 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence036 98 25 gene locus_tag LOCUS_t00160 98 25 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 316 242 gene locus_tag LOCUS_t00170 316 242 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1136 546 gene locus_tag LOCUS_07260 1136 546 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 protein_id gnl|my_center|LOCUS_07260 3769 1136 gene locus_tag LOCUS_07270 gene gyrA 3769 1136 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803674.1 protein_id gnl|my_center|LOCUS_07270 5860 3842 gene locus_tag LOCUS_07280 gene gyrB 5860 3842 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_07280 7010 6273 gene locus_tag LOCUS_07290 7010 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8268 7003 gene locus_tag LOCUS_07300 gene recF 8268 7003 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_07300 9511 8387 gene locus_tag LOCUS_07310 gene dnaN 9511 8387 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_07310 <11720 10317 gene locus_tag LOCUS_07320 <11720 10317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013221955.1:chromosomal replication initiator protein DnaA >Feature sequence037 870 2111 gene locus_tag LOCUS_07330 870 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2468 2788 gene locus_tag LOCUS_07340 2468 2788 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_07340 2791 3720 gene locus_tag LOCUS_07350 2791 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4454 3867 gene locus_tag LOCUS_07360 4454 3867 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_07360 4590 9974 gene locus_tag LOCUS_07370 4590 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 10960 10259 gene locus_tag LOCUS_07380 10960 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence038 205 963 gene locus_tag LOCUS_07390 205 963 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_07390 1166 1852 gene locus_tag LOCUS_07400 1166 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2031 2651 gene locus_tag LOCUS_07410 gene ruvA 2031 2651 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076202.1 protein_id gnl|my_center|LOCUS_07410 2741 3838 gene locus_tag LOCUS_07420 gene ruvB 2741 3838 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_07420 4143 4517 gene locus_tag LOCUS_07430 4143 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4628 6331 gene locus_tag LOCUS_07440 gene secD 4628 6331 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_07440 6334 7479 gene locus_tag LOCUS_07450 gene secF 6334 7479 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_07450 7744 10368 gene locus_tag LOCUS_07460 gene relA 7744 10368 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence039 749 60 gene locus_tag LOCUS_07470 749 60 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_07470 3356 1230 gene locus_tag LOCUS_07480 3356 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4697 3444 gene locus_tag LOCUS_07490 4697 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5128 5358 gene locus_tag LOCUS_07500 5128 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5556 6833 gene locus_tag LOCUS_07510 5556 6833 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_07510 6826 7488 gene locus_tag LOCUS_07520 6826 7488 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_07520 8510 7665 gene locus_tag LOCUS_07530 gene proC 8510 7665 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_07530 8974 10287 gene locus_tag LOCUS_07540 8974 10287 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254652.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence040 <1 4707 gene locus_tag LOCUS_07550 <1 4707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028707.1:NAD-glutamate dehydrogenase 5215 6570 gene locus_tag LOCUS_07560 5215 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6660 8378 gene locus_tag LOCUS_07570 gene pelF 6660 8378 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016350.1 protein_id gnl|my_center|LOCUS_07570 8365 9558 gene locus_tag LOCUS_07580 8365 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 10421 9657 gene locus_tag LOCUS_07590 10421 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence041 2 193 gene locus_tag LOCUS_07600 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 235 1791 gene locus_tag LOCUS_07610 gene glpK 235 1791 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_07610 2389 2706 gene locus_tag LOCUS_07620 2389 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2805 3416 gene locus_tag LOCUS_07630 2805 3416 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804574.1 protein_id gnl|my_center|LOCUS_07630 3636 4424 gene locus_tag LOCUS_07640 3636 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 4949 4557 gene locus_tag LOCUS_07650 4949 4557 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086131.1 protein_id gnl|my_center|LOCUS_07650 6855 5233 gene locus_tag LOCUS_07660 6855 5233 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_07660 9022 7382 gene locus_tag LOCUS_07670 9022 7382 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_07670 9773 9699 gene locus_tag LOCUS_t00180 9773 9699 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 1168 527 gene locus_tag LOCUS_07680 gene raiA 1168 527 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_07680 2084 1377 gene locus_tag LOCUS_07690 2084 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3995 2277 gene locus_tag LOCUS_07700 gene lpqB 3995 2277 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 protein_id gnl|my_center|LOCUS_07700 6016 4253 gene locus_tag LOCUS_07710 gene mtrB 6016 4253 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 protein_id gnl|my_center|LOCUS_07710 6766 6065 gene locus_tag LOCUS_07720 gene mtrA 6766 6065 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 protein_id gnl|my_center|LOCUS_07720 8073 6823 gene locus_tag LOCUS_07730 8073 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8542 8129 gene locus_tag LOCUS_07740 8542 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 9793 8582 gene locus_tag LOCUS_07750 gene mnmA 9793 8582 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence043 1439 450 gene locus_tag LOCUS_07760 gene rlmB 1439 450 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_07760 2948 1536 gene locus_tag LOCUS_07770 gene cysS 2948 1536 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_07770 3519 3037 gene locus_tag LOCUS_07780 gene ispF 3519 3037 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_07780 4388 3567 gene locus_tag LOCUS_07790 gene ispD 4388 3567 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419436.1 protein_id gnl|my_center|LOCUS_07790 5094 4411 gene locus_tag LOCUS_07800 5094 4411 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_07800 6270 5134 gene locus_tag LOCUS_07810 6270 5134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_07810 7158 6421 gene locus_tag LOCUS_07820 7158 6421 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814666.1 protein_id gnl|my_center|LOCUS_07820 7683 7366 gene locus_tag LOCUS_07830 7683 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8936 7755 gene locus_tag LOCUS_07840 8936 7755 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_07840 9141 9878 gene locus_tag LOCUS_07850 9141 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence044 2550 1345 gene locus_tag LOCUS_07860 gene mraY 2550 1345 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_07860 4167 2557 gene locus_tag LOCUS_07870 4167 2557 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_07870 5919 4171 gene locus_tag LOCUS_07880 5919 4171 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_07880 7912 6062 gene locus_tag LOCUS_07890 7912 6062 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389659.1 protein_id gnl|my_center|LOCUS_07890 8977 7967 gene locus_tag LOCUS_07900 8977 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 10108 9053 gene locus_tag LOCUS_07910 gene rsmH 10108 9053 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence045 107 940 gene locus_tag LOCUS_07920 107 940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_07920 943 2163 gene locus_tag LOCUS_07930 943 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2248 3054 gene locus_tag LOCUS_07940 2248 3054 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_07940 3680 3916 gene locus_tag LOCUS_07950 gene rpmB 3680 3916 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731012.1 protein_id gnl|my_center|LOCUS_07950 3920 4090 gene locus_tag LOCUS_07960 gene rpmG 3920 4090 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_07960 4093 4398 gene locus_tag LOCUS_07970 gene rpsN 4093 4398 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_07970 4493 4777 gene locus_tag LOCUS_07980 4493 4777 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_07980 5776 5396 gene locus_tag LOCUS_07990 5776 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5769 6191 gene locus_tag LOCUS_08000 5769 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6459 7214 gene locus_tag LOCUS_08010 6459 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7511 7284 gene locus_tag LOCUS_08020 7511 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7851 7531 gene locus_tag LOCUS_08030 7851 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7850 8278 gene locus_tag LOCUS_08040 7850 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence046 476 1990 gene locus_tag LOCUS_08050 gene miaB 476 1990 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_08050 2077 2997 gene locus_tag LOCUS_08060 gene miaA 2077 2997 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_08060 3095 4030 gene locus_tag LOCUS_08070 gene dapF 3095 4030 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_08070 4764 4141 gene locus_tag LOCUS_08080 4764 4141 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_08080 4939 6618 gene locus_tag LOCUS_08090 gene hflX 4939 6618 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_08090 6631 8709 gene locus_tag LOCUS_08100 6631 8709 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_08100 9621 8959 gene locus_tag LOCUS_08110 gene lexA 9621 8959 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence047 765 118 gene locus_tag LOCUS_08120 765 118 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_08120 2272 1499 gene locus_tag LOCUS_08130 2272 1499 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_08130 3244 2852 gene locus_tag LOCUS_08140 gene gcvH 3244 2852 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_08140 7078 3587 gene locus_tag LOCUS_08150 7078 3587 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_08150 7652 8578 gene locus_tag LOCUS_08160 7652 8578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_08160 9382 8612 gene locus_tag LOCUS_08170 9382 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence048 1445 285 gene locus_tag LOCUS_08180 gene ispG 1445 285 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_08180 2957 1602 gene locus_tag LOCUS_08190 2957 1602 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_08190 4714 3389 gene locus_tag LOCUS_08200 gene dxr 4714 3389 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_08200 5442 4855 gene locus_tag LOCUS_08210 5442 4855 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804641.1 protein_id gnl|my_center|LOCUS_08210 6493 5648 gene locus_tag LOCUS_08220 6493 5648 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804638.1 protein_id gnl|my_center|LOCUS_08220 7130 6573 gene locus_tag LOCUS_08230 gene frr 7130 6573 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_08230 8140 7397 gene locus_tag LOCUS_08240 gene pyrH 8140 7397 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 protein_id gnl|my_center|LOCUS_08240 9156 8326 gene locus_tag LOCUS_08250 gene tsf 9156 8326 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence049 184 636 gene locus_tag LOCUS_08260 184 636 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_08260 636 1097 gene locus_tag LOCUS_08270 636 1097 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_08270 1306 2412 gene locus_tag LOCUS_08280 1306 2412 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 protein_id gnl|my_center|LOCUS_08280 3531 2542 gene locus_tag LOCUS_08290 3531 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5071 3665 gene locus_tag LOCUS_08300 5071 3665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 protein_id gnl|my_center|LOCUS_08300 5383 5643 gene locus_tag LOCUS_08310 5383 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6909 5770 gene locus_tag LOCUS_08320 gene asd 6909 5770 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 protein_id gnl|my_center|LOCUS_08320 7781 7113 gene locus_tag LOCUS_08330 7781 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8688 7804 gene locus_tag LOCUS_08340 8688 7804 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence050 1434 85 gene locus_tag LOCUS_08350 gene efeB 1434 85 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_08350 2811 1594 gene locus_tag LOCUS_08360 2811 1594 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_08360 3758 2931 gene locus_tag LOCUS_08370 3758 2931 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_08370 4734 4243 gene locus_tag LOCUS_08380 4734 4243 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_08380 5565 4750 gene locus_tag LOCUS_08390 5565 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6510 5584 gene locus_tag LOCUS_08400 6510 5584 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_08400 7598 6684 gene locus_tag LOCUS_08410 7598 6684 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_08410 8240 7860 gene locus_tag LOCUS_08420 gene rplT 8240 7860 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence051 <1 909 gene locus_tag LOCUS_08430 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775682.1:lipoyl synthase 1116 1832 gene locus_tag LOCUS_08440 1116 1832 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_08440 2157 3581 gene locus_tag LOCUS_08450 gene glnA 2157 3581 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_08450 4092 3901 gene locus_tag LOCUS_08460 4092 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4544 5041 gene locus_tag LOCUS_08470 4544 5041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130977.1 protein_id gnl|my_center|LOCUS_08470 5303 6052 gene locus_tag LOCUS_08480 gene budA 5303 6052 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174786.1 protein_id gnl|my_center|LOCUS_08480 6593 6165 gene locus_tag LOCUS_08490 6593 6165 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_08490 7348 6671 gene locus_tag LOCUS_08500 7348 6671 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_08500 7509 7973 gene locus_tag LOCUS_08510 7509 7973 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_08510 8496 8161 gene locus_tag LOCUS_08520 8496 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence052 1994 948 gene locus_tag LOCUS_08530 1994 948 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776630.1 protein_id gnl|my_center|LOCUS_08530 3069 1996 gene locus_tag LOCUS_08540 3069 1996 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776631.1 protein_id gnl|my_center|LOCUS_08540 5584 3386 gene locus_tag LOCUS_08550 5584 3386 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776647.1 protein_id gnl|my_center|LOCUS_08550 5784 5710 gene locus_tag LOCUS_t00190 5784 5710 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6865 5987 gene locus_tag LOCUS_08560 6865 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8036 7293 gene locus_tag LOCUS_08570 8036 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence053 141 527 gene locus_tag LOCUS_08580 141 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 713 795 gene locus_tag LOCUS_t00200 713 795 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1119 1496 gene locus_tag LOCUS_08590 gene trxA 1119 1496 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_08590 2647 1583 gene locus_tag LOCUS_08600 2647 1583 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_08600 2990 4777 gene locus_tag LOCUS_08610 2990 4777 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_08610 5409 7523 gene locus_tag LOCUS_08620 5409 7523 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 protein_id gnl|my_center|LOCUS_08620 7784 7856 gene locus_tag LOCUS_t00210 7784 7856 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7890 7964 gene locus_tag LOCUS_t00220 7890 7964 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7965 8037 gene locus_tag LOCUS_t00230 7965 8037 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 145 1122 gene locus_tag LOCUS_08630 145 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1286 2452 gene locus_tag LOCUS_08640 gene dusB 1286 2452 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_08640 2557 4638 gene locus_tag LOCUS_08650 gene dnaG 2557 4638 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_08650 4862 4935 gene locus_tag LOCUS_t00240 4862 4935 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5380 6252 gene locus_tag LOCUS_08660 5380 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6579 7784 gene locus_tag LOCUS_08670 6579 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7978 8052 gene locus_tag LOCUS_t00250 7978 8052 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 207 16 gene locus_tag LOCUS_08680 207 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 365 1117 gene locus_tag LOCUS_08690 365 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137447494.1 protein_id gnl|my_center|LOCUS_08690 1486 1175 gene locus_tag LOCUS_08700 1486 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1788 1573 gene locus_tag LOCUS_08710 1788 1573 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_08710 2020 3399 gene locus_tag LOCUS_08720 2020 3399 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775737.1 protein_id gnl|my_center|LOCUS_08720 5690 4221 gene locus_tag LOCUS_08730 5690 4221 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859486.1 protein_id gnl|my_center|LOCUS_08730 6064 5762 gene locus_tag LOCUS_08740 6064 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 6415 6179 gene locus_tag LOCUS_08750 6415 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 6831 6646 gene locus_tag LOCUS_08760 6831 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6743 7069 gene locus_tag LOCUS_08770 6743 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 7321 7076 gene locus_tag LOCUS_08780 7321 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence056 2285 1200 gene locus_tag LOCUS_08790 2285 1200 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 protein_id gnl|my_center|LOCUS_08790 2839 2315 gene locus_tag LOCUS_08800 2839 2315 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079458.1 protein_id gnl|my_center|LOCUS_08800 4276 3086 gene locus_tag LOCUS_08810 4276 3086 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_08810 6076 4616 gene locus_tag LOCUS_08820 6076 4616 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446571.1 protein_id gnl|my_center|LOCUS_08820 6385 6717 gene locus_tag LOCUS_08830 6385 6717 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence057 290 763 gene locus_tag LOCUS_08840 gene nsrR 290 763 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_08840 1249 2430 gene locus_tag LOCUS_08850 1249 2430 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_08850 3993 2587 gene locus_tag LOCUS_08860 3993 2587 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_08860 4131 5318 gene locus_tag LOCUS_08870 gene manA 4131 5318 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_08870 5614 5883 gene locus_tag LOCUS_08880 5614 5883 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_08880 5893 7248 gene locus_tag LOCUS_08890 5893 7248 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_08890 <7946 7379 gene locus_tag LOCUS_08900 <7946 7379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005083491.1:DNA polymerase III subunit delta' >Feature sequence058 287 1441 gene locus_tag LOCUS_08910 287 1441 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_08910 2594 1671 gene locus_tag LOCUS_08920 2594 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3803 2886 gene locus_tag LOCUS_08930 gene sucD 3803 2886 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_08930 4999 3833 gene locus_tag LOCUS_08940 gene sucC 4999 3833 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_08940 <7913 5350 gene locus_tag LOCUS_08950 <7913 5350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029870.1:DNA helicase PcrA >Feature sequence059 1915 722 gene locus_tag LOCUS_08960 1915 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3009 1993 gene locus_tag LOCUS_08970 3009 1993 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 protein_id gnl|my_center|LOCUS_08970 3938 3066 gene locus_tag LOCUS_08980 gene rsmA 3938 3066 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_08980 4805 3984 gene locus_tag LOCUS_08990 4805 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6002 5181 gene locus_tag LOCUS_09000 6002 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6278 6015 gene locus_tag LOCUS_09010 6278 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6834 6271 gene locus_tag LOCUS_09020 6834 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 <7884 7108 gene locus_tag LOCUS_09030 <7884 7108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028796.1:TatD family hydrolase >Feature sequence060 418 1062 gene locus_tag LOCUS_09040 418 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1616 1176 gene locus_tag LOCUS_09050 1616 1176 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993516.1 protein_id gnl|my_center|LOCUS_09050 2424 1894 gene locus_tag LOCUS_09060 2424 1894 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730168.1 protein_id gnl|my_center|LOCUS_09060 3009 2428 gene locus_tag LOCUS_09070 3009 2428 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730169.1 protein_id gnl|my_center|LOCUS_09070 3166 3840 gene locus_tag LOCUS_09080 3166 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4241 3924 gene locus_tag LOCUS_09090 4241 3924 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728332.1 protein_id gnl|my_center|LOCUS_09090 4513 6096 gene locus_tag LOCUS_09100 4513 6096 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_09100 6460 7584 gene locus_tag LOCUS_09110 6460 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence061 3114 1921 gene locus_tag LOCUS_09120 3114 1921 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 protein_id gnl|my_center|LOCUS_09120 3759 3235 gene locus_tag LOCUS_09130 3759 3235 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 protein_id gnl|my_center|LOCUS_09130 4267 3749 gene locus_tag LOCUS_09140 4267 3749 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013474.1 protein_id gnl|my_center|LOCUS_09140 4818 4324 gene locus_tag LOCUS_09150 gene moaC 4818 4324 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013475.1 protein_id gnl|my_center|LOCUS_09150 6286 4907 gene locus_tag LOCUS_09160 6286 4907 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804485.1 protein_id gnl|my_center|LOCUS_09160 7066 6386 gene locus_tag LOCUS_09170 7066 6386 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013477.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence062 1030 53 gene locus_tag LOCUS_09180 gene nrdF 1030 53 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_09180 3357 1177 gene locus_tag LOCUS_09190 gene nrdE 3357 1177 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_09190 3860 3330 gene locus_tag LOCUS_09200 3860 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4159 3935 gene locus_tag LOCUS_09210 4159 3935 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 protein_id gnl|my_center|LOCUS_09210 5935 5021 gene locus_tag LOCUS_09220 5935 5021 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_09220 5861 6097 gene locus_tag LOCUS_09230 5861 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6295 7392 gene locus_tag LOCUS_09240 6295 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence063 371 892 gene locus_tag LOCUS_09250 gene msrA 371 892 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_09250 993 1766 gene locus_tag LOCUS_09260 993 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1962 2780 gene locus_tag LOCUS_09270 1962 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2949 3773 gene locus_tag LOCUS_09280 2949 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4004 3929 gene locus_tag LOCUS_t00260 4004 3929 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6442 4238 gene locus_tag LOCUS_09290 6442 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence064 <1 794 gene locus_tag LOCUS_09300 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805053.1:DUF3710 domain-containing protein 794 1327 gene locus_tag LOCUS_09310 794 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1329 2180 gene locus_tag LOCUS_09320 1329 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3021 2368 gene locus_tag LOCUS_09330 3021 2368 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_09330 3839 3021 gene locus_tag LOCUS_09340 3839 3021 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_09340 4016 6082 gene locus_tag LOCUS_09350 4016 6082 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825004.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence065 1369 101 gene locus_tag LOCUS_09360 1369 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2474 1632 gene locus_tag LOCUS_09370 2474 1632 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777153.1 protein_id gnl|my_center|LOCUS_09370 3609 2968 gene locus_tag LOCUS_09380 gene rsmG 3609 2968 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777154.1 protein_id gnl|my_center|LOCUS_09380 4171 3611 gene locus_tag LOCUS_09390 4171 3611 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_09390 5266 4280 gene locus_tag LOCUS_09400 gene yidC 5266 4280 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_09400 5790 5317 gene locus_tag LOCUS_09410 5790 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6017 5787 gene locus_tag LOCUS_09420 6017 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6406 6269 gene locus_tag LOCUS_09430 gene rpmH 6406 6269 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence066 489 139 gene locus_tag LOCUS_09440 489 139 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905229.1 protein_id gnl|my_center|LOCUS_09440 696 508 gene locus_tag LOCUS_09450 696 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2151 829 gene locus_tag LOCUS_09460 2151 829 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_09460 3687 2341 gene locus_tag LOCUS_09470 3687 2341 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_09470 4410 4060 gene locus_tag LOCUS_09480 4410 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5407 5763 gene locus_tag LOCUS_09490 5407 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6164 7150 gene locus_tag LOCUS_09500 6164 7150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114774.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence067 72 1637 gene locus_tag LOCUS_09510 72 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2169 3554 gene locus_tag LOCUS_09520 2169 3554 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_09520 3821 3895 gene locus_tag LOCUS_t00270 3821 3895 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4556 5446 gene locus_tag LOCUS_09530 4556 5446 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100993.1 protein_id gnl|my_center|LOCUS_09530 5616 6554 gene locus_tag LOCUS_09540 5616 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence068 1329 391 gene locus_tag LOCUS_09550 1329 391 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776274.1 protein_id gnl|my_center|LOCUS_09550 2009 1326 gene locus_tag LOCUS_09560 2009 1326 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776275.1 protein_id gnl|my_center|LOCUS_09560 2858 2028 gene locus_tag LOCUS_09570 2858 2028 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 protein_id gnl|my_center|LOCUS_09570 3636 2872 gene locus_tag LOCUS_09580 3636 2872 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143316.1 protein_id gnl|my_center|LOCUS_09580 5024 4011 gene locus_tag LOCUS_09590 gene galE 5024 4011 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 protein_id gnl|my_center|LOCUS_09590 6254 5298 gene locus_tag LOCUS_09600 gene dapD 6254 5298 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence069 <1 1298 gene locus_tag LOCUS_09610 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029835.1:alanine racemase 1302 1934 gene locus_tag LOCUS_09620 1302 1934 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776314.1 protein_id gnl|my_center|LOCUS_09620 1958 2734 gene locus_tag LOCUS_09630 gene tsaB 1958 2734 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_09630 2735 3244 gene locus_tag LOCUS_09640 gene rimI 2735 3244 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_09640 3348 4448 gene locus_tag LOCUS_09650 gene tsaD 3348 4448 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_09650 5774 4626 gene locus_tag LOCUS_09660 5774 4626 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_09660 6886 6059 gene locus_tag LOCUS_09670 6886 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence070 <1 659 gene locus_tag LOCUS_09680 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929902.1:DNA translocase FtsK 873 1529 gene locus_tag LOCUS_09690 873 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1676 2266 gene locus_tag LOCUS_09700 1676 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2590 2994 gene locus_tag LOCUS_09710 2590 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3119 3400 gene locus_tag LOCUS_09720 3119 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3808 4914 gene locus_tag LOCUS_09730 gene recA 3808 4914 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_09730 5222 5004 gene locus_tag LOCUS_09740 5222 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5115 6854 gene locus_tag LOCUS_09750 5115 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence071 752 1306 gene locus_tag LOCUS_09760 752 1306 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 protein_id gnl|my_center|LOCUS_09760 2324 1416 gene locus_tag LOCUS_09770 2324 1416 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_09770 2453 3274 gene locus_tag LOCUS_09780 2453 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3574 4176 gene locus_tag LOCUS_09790 3574 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5526 4333 gene locus_tag LOCUS_09800 5526 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <6916 5821 gene locus_tag LOCUS_09810 <6916 5821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028475.1:aminopeptidase N >Feature sequence072 1961 780 gene locus_tag LOCUS_09820 gene ftsZ 1961 780 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_09820 3668 2160 gene locus_tag LOCUS_09830 3668 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5189 3687 gene locus_tag LOCUS_09840 gene murC 5189 3687 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_09840 6289 5189 gene locus_tag LOCUS_09850 gene murG 6289 5189 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804702.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence073 54 1013 gene locus_tag LOCUS_09860 54 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1239 1970 gene locus_tag LOCUS_09870 1239 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2392 2066 gene locus_tag LOCUS_09880 gene nirD 2392 2066 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_09880 2285 2533 gene locus_tag LOCUS_09890 2285 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2984 5653 gene locus_tag LOCUS_09900 gene nirB 2984 5653 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775907.1 protein_id gnl|my_center|LOCUS_09900 5655 6566 gene locus_tag LOCUS_09910 gene cobA 5655 6566 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence074 2117 1536 gene locus_tag LOCUS_09920 2117 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3931 2321 gene locus_tag LOCUS_09930 gene purH 3931 2321 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_09930 4702 4145 gene locus_tag LOCUS_09940 gene purN 4702 4145 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_09940 4780 5574 gene locus_tag LOCUS_09950 4780 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence075 2730 1714 gene locus_tag LOCUS_09960 2730 1714 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_09960 3710 2967 gene locus_tag LOCUS_09970 3710 2967 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_09970 3980 3783 gene locus_tag LOCUS_09980 3980 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4995 3958 gene locus_tag LOCUS_09990 4995 3958 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_09990 6295 5177 gene locus_tag LOCUS_10000 6295 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence076 734 249 gene locus_tag LOCUS_10010 734 249 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_10010 1861 1085 gene locus_tag LOCUS_10020 1861 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4650 2080 gene locus_tag LOCUS_10030 gene pheT 4650 2080 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_10030 5781 4654 gene locus_tag LOCUS_10040 gene pheS 5781 4654 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_10040 6619 6098 gene locus_tag LOCUS_10050 6619 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence077 59 2311 gene locus_tag LOCUS_10060 gene ligA 59 2311 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_10060 3058 3789 gene locus_tag LOCUS_10070 3058 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4020 4316 gene locus_tag LOCUS_10080 gene gatC 4020 4316 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_10080 4332 5936 gene locus_tag LOCUS_10090 gene gatA 4332 5936 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence078 1716 1030 gene locus_tag LOCUS_10100 1716 1030 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_10100 1776 2417 gene locus_tag LOCUS_10110 1776 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4104 2650 gene locus_tag LOCUS_10120 gene rpsA 4104 2650 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805100.1 protein_id gnl|my_center|LOCUS_10120 <6646 4825 gene locus_tag LOCUS_10130 <6646 4825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467407.1:DNA polymerase I >Feature sequence079 1385 1948 gene locus_tag LOCUS_10140 1385 1948 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775979.1 protein_id gnl|my_center|LOCUS_10140 2143 2511 gene locus_tag LOCUS_10150 gene rplS 2143 2511 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_10150 2808 3911 gene locus_tag LOCUS_10160 2808 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3922 4770 gene locus_tag LOCUS_10170 3922 4770 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_10170 4889 5215 gene locus_tag LOCUS_10180 4889 5215 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804628.1 protein_id gnl|my_center|LOCUS_10180 5421 5927 gene locus_tag LOCUS_10190 5421 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence080 2463 1498 gene locus_tag LOCUS_10200 2463 1498 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067981.1 protein_id gnl|my_center|LOCUS_10200 2724 2651 gene locus_tag LOCUS_t00280 2724 2651 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3449 3012 gene locus_tag LOCUS_10210 gene rsfS 3449 3012 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_10210 4571 3510 gene locus_tag LOCUS_10220 4571 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5313 4564 gene locus_tag LOCUS_10230 gene nadD 5313 4564 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_10230 5325 5486 gene locus_tag LOCUS_10240 5325 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6456 5560 gene locus_tag LOCUS_10250 6456 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence081 <1 857 gene locus_tag LOCUS_10260 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973642.1:threonine synthase 953 1990 gene locus_tag LOCUS_10270 gene thrB 953 1990 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_10270 2476 4554 gene locus_tag LOCUS_10280 2476 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4706 5788 gene locus_tag LOCUS_10290 gene prfA 4706 5788 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence082 <1 714 gene locus_tag LOCUS_10300 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775774.1:NAD-dependent epimerase/dehydratase family protein 1290 736 gene locus_tag LOCUS_10310 1290 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1898 1302 gene locus_tag LOCUS_10320 1898 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3113 2067 gene locus_tag LOCUS_10330 gene mutM 3113 2067 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_10330 3843 3154 gene locus_tag LOCUS_10340 gene rnc 3843 3154 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414820.1 protein_id gnl|my_center|LOCUS_10340 4063 3860 gene locus_tag LOCUS_10350 4063 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4618 4094 gene locus_tag LOCUS_10360 4618 4094 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_10360 5392 4916 gene locus_tag LOCUS_10370 gene coaD 5392 4916 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 protein_id gnl|my_center|LOCUS_10370 6159 5530 gene locus_tag LOCUS_10380 gene rsmD 6159 5530 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775870.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence083 94 591 gene locus_tag LOCUS_10390 94 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 723 1322 gene locus_tag LOCUS_10400 723 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1839 2318 gene locus_tag LOCUS_10410 1839 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5325 2419 gene locus_tag LOCUS_10420 5325 2419 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence084 3818 222 gene locus_tag LOCUS_10430 3818 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4292 4519 gene locus_tag LOCUS_10440 4292 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4530 4964 gene locus_tag LOCUS_10450 4530 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence085 182 781 gene locus_tag LOCUS_10460 182 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1158 925 gene locus_tag LOCUS_10470 1158 925 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_10470 1521 2222 gene locus_tag LOCUS_10480 1521 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2219 3871 gene locus_tag LOCUS_10490 2219 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4267 5841 gene locus_tag LOCUS_10500 4267 5841 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776067.1 protein_id gnl|my_center|LOCUS_10500 5843 6085 gene locus_tag LOCUS_10510 5843 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence086 255 37 gene locus_tag LOCUS_10520 255 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 136 798 gene locus_tag LOCUS_10530 136 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2868 1252 gene locus_tag LOCUS_10540 2868 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3973 3002 gene locus_tag LOCUS_10550 3973 3002 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_10550 4202 4038 gene locus_tag LOCUS_10560 4202 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <6187 4225 gene locus_tag LOCUS_10570 <6187 4225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776591.1:type I DNA topoisomerase >Feature sequence087 809 132 gene locus_tag LOCUS_10580 809 132 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_10580 1137 2315 gene locus_tag LOCUS_10590 1137 2315 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141863754.1 protein_id gnl|my_center|LOCUS_10590 2895 2455 gene locus_tag LOCUS_10600 gene aroQ 2895 2455 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728012.1 protein_id gnl|my_center|LOCUS_10600 3066 4007 gene locus_tag LOCUS_10610 3066 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4100 4864 gene locus_tag LOCUS_10620 4100 4864 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_10620 <6165 4965 gene locus_tag LOCUS_10630 <6165 4965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930206.1:bifunctional 3'-5' exonuclease/DNA polymerase >Feature sequence088 2669 1296 gene locus_tag LOCUS_10640 2669 1296 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_10640 3608 2850 gene locus_tag LOCUS_10650 3608 2850 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_10650 3871 4806 gene locus_tag LOCUS_10660 3871 4806 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence089 324 2849 gene locus_tag LOCUS_10670 324 2849 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_10670 3159 3845 gene locus_tag LOCUS_10680 3159 3845 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_10680 <6019 3983 gene locus_tag LOCUS_10690 <6019 3983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029332.1:thiol reductant ABC exporter subunit CydD note possible pseudo, internal stop codon >Feature sequence090 1398 1078 gene locus_tag LOCUS_10700 1398 1078 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803685.1 protein_id gnl|my_center|LOCUS_10700 3127 1763 gene locus_tag LOCUS_10710 3127 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5310 3400 gene locus_tag LOCUS_10720 gene typA 5310 3400 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence091 1245 265 gene locus_tag LOCUS_10730 1245 265 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_10730 2720 1266 gene locus_tag LOCUS_10740 gene glmU 2720 1266 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_10740 2879 2808 gene locus_tag LOCUS_t00290 2879 2808 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3379 3146 gene locus_tag LOCUS_10750 3379 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3272 4978 gene locus_tag LOCUS_10760 3272 4978 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_10760 5129 5611 gene locus_tag LOCUS_10770 5129 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence092 <1 1158 gene locus_tag LOCUS_10780 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014498.1:aspartate--tRNA ligase 1380 1907 gene locus_tag LOCUS_10790 1380 1907 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_10790 2012 2446 gene locus_tag LOCUS_10800 gene dtd 2012 2446 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_10800 2629 4134 gene locus_tag LOCUS_10810 2629 4134 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_10810 4820 5452 gene locus_tag LOCUS_10820 gene rpsD 4820 5452 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence093 950 123 gene locus_tag LOCUS_10830 950 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2271 943 gene locus_tag LOCUS_10840 2271 943 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_10840 2385 3410 gene locus_tag LOCUS_10850 2385 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5107 3572 gene locus_tag LOCUS_10860 5107 3572 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence094 169 563 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagctcacccccgcacacgcggggaacgc 2339 660 gene locus_tag LOCUS_10870 2339 660 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_10870 3161 2736 gene locus_tag LOCUS_10880 3161 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4357 3269 gene locus_tag LOCUS_10890 4357 3269 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_10890 <5637 4434 gene locus_tag LOCUS_10900 <5637 4434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004574367.1:serine--tRNA ligase >Feature sequence095 1848 742 gene locus_tag LOCUS_10910 gene ftsY 1848 742 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_10910 2025 3482 gene locus_tag LOCUS_10920 2025 3482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_10920 5021 3564 gene locus_tag LOCUS_10930 5021 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5620 5309 gene locus_tag LOCUS_10940 5620 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence096 955 80 gene locus_tag LOCUS_10950 955 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2264 1329 gene locus_tag LOCUS_10960 2264 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence097 1630 539 gene locus_tag LOCUS_10970 gene nusA 1630 539 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804652.1 protein_id gnl|my_center|LOCUS_10970 2411 1740 gene locus_tag LOCUS_10980 2411 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4246 2414 gene locus_tag LOCUS_10990 4246 2414 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_10990 <5524 4394 gene locus_tag LOCUS_11000 <5524 4394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193499286.1:DUF4081 domain-containing GNAT family N-acetyltransferase >Feature sequence098 745 1575 gene locus_tag LOCUS_11010 745 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1689 2891 gene locus_tag LOCUS_11020 gene rsgA 1689 2891 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_11020 3116 5293 gene locus_tag LOCUS_11030 3116 5293 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence099 261 3803 gene locus_tag LOCUS_11040 gene dnaE 261 3803 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_11040 4012 4467 gene locus_tag LOCUS_11050 gene nrdR 4012 4467 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_11050 5454 4603 gene locus_tag LOCUS_11060 5454 4603 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence100 641 174 gene locus_tag LOCUS_11070 641 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1434 721 gene locus_tag LOCUS_11080 1434 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2726 1527 gene locus_tag LOCUS_11090 2726 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4276 2723 gene locus_tag LOCUS_11100 4276 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence101 665 868 gene locus_tag LOCUS_11110 665 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1103 1795 gene locus_tag LOCUS_11120 1103 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4222 1952 gene locus_tag LOCUS_11130 4222 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5177 4233 gene locus_tag LOCUS_11140 5177 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence102 <1 1223 gene locus_tag LOCUS_11150 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387765.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 2355 1276 gene locus_tag LOCUS_11160 2355 1276 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_11160 3109 2510 gene locus_tag LOCUS_11170 3109 2510 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 protein_id gnl|my_center|LOCUS_11170 3847 3194 gene locus_tag LOCUS_11180 3847 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 <5371 4093 gene locus_tag LOCUS_11190 <5371 4093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804956.1:phosphopyruvate hydratase >Feature sequence103 1432 128 gene locus_tag LOCUS_11200 gene tyrS 1432 128 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_11200 3847 1553 gene locus_tag LOCUS_11210 3847 1553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_11210 4410 4081 gene locus_tag LOCUS_11220 4410 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 <5226 4684 gene locus_tag LOCUS_11230 <5226 4684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810876.1:RNA polymerase sporulation sigma factor SigK >Feature sequence104 159 1823 gene locus_tag LOCUS_11240 159 1823 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_11240 1826 2374 gene locus_tag LOCUS_11250 1826 2374 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081158.1 protein_id gnl|my_center|LOCUS_11250 2746 2570 gene locus_tag LOCUS_11260 2746 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 3465 2761 gene locus_tag LOCUS_11270 3465 2761 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086746.1 protein_id gnl|my_center|LOCUS_11270 3767 3408 gene locus_tag LOCUS_11280 3767 3408 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_11280 5054 3963 gene locus_tag LOCUS_11290 5054 3963 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384492.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence105 3531 298 gene locus_tag LOCUS_11300 3531 298 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_11300 3875 4330 gene locus_tag LOCUS_11310 3875 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <5149 4478 gene locus_tag LOCUS_11320 <5149 4478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940288.1:phosphate acetyltransferase >Feature sequence106 261 884 gene locus_tag LOCUS_11330 261 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1286 2830 gene locus_tag LOCUS_11340 1286 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3099 4169 gene locus_tag LOCUS_11350 3099 4169 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence107 <1 994 gene locus_tag LOCUS_11360 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976572.1:type I glutamate--ammonia ligase 1144 4488 gene locus_tag LOCUS_11370 1144 4488 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_11370 4866 4939 gene locus_tag LOCUS_t00300 4866 4939 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 <1 592 gene locus_tag LOCUS_11380 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805040.1:DNA topoisomerase IV subunit B 1106 2677 gene locus_tag LOCUS_11390 1106 2677 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_11390 2699 3769 gene locus_tag LOCUS_11400 gene cydB 2699 3769 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_11400 3992 4921 gene locus_tag LOCUS_11410 3992 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence109 2004 487 gene locus_tag LOCUS_11420 gene guaB 2004 487 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_11420 3947 2361 gene locus_tag LOCUS_11430 gene groL 3947 2361 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_11430 4449 4051 gene locus_tag LOCUS_11440 4449 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence110 1836 688 gene locus_tag LOCUS_11450 1836 688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 protein_id gnl|my_center|LOCUS_11450 3193 2018 gene locus_tag LOCUS_11460 3193 2018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 protein_id gnl|my_center|LOCUS_11460 4171 3224 gene locus_tag LOCUS_11470 4171 3224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814366.1 protein_id gnl|my_center|LOCUS_11470 <4849 4171 gene locus_tag LOCUS_11480 <4849 4171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810402.1:iron ABC transporter permease >Feature sequence111 427 2244 gene locus_tag LOCUS_11490 427 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2308 3222 gene locus_tag LOCUS_11500 gene panB 2308 3222 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_11500 3617 3363 gene locus_tag LOCUS_11510 3617 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3880 4791 gene locus_tag LOCUS_11520 gene map 3880 4791 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence112 531 1691 gene locus_tag LOCUS_11530 531 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1710 2879 gene locus_tag LOCUS_11540 1710 2879 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_11540 2931 3623 gene locus_tag LOCUS_11550 2931 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence113 1070 297 gene locus_tag LOCUS_11560 1070 297 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_11560 4043 2331 gene locus_tag LOCUS_11570 4043 2331 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_11570 <4774 4259 gene locus_tag LOCUS_11580 <4774 4259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804077.1:zinc-dependent alcohol dehydrogenase family protein >Feature sequence114 86 1627 gene locus_tag LOCUS_11590 86 1627 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_11590 1640 2773 gene locus_tag LOCUS_11600 gene hemC 1640 2773 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 protein_id gnl|my_center|LOCUS_11600 2776 3627 gene locus_tag LOCUS_11610 2776 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3683 4684 gene locus_tag LOCUS_11620 gene hemB 3683 4684 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence115 433 1686 gene locus_tag LOCUS_11630 433 1686 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_11630 1711 2244 gene locus_tag LOCUS_11640 1711 2244 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_11640 4427 2355 gene locus_tag LOCUS_11650 gene dxs 4427 2355 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence116 1138 2073 gene locus_tag LOCUS_11660 1138 2073 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_11660 2187 2732 gene locus_tag LOCUS_11670 2187 2732 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_11670 2794 3606 gene locus_tag LOCUS_11680 2794 3606 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_11680 4491 3907 gene locus_tag LOCUS_11690 4491 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence117 <1 865 gene locus_tag LOCUS_11700 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930212.1:RNA methyltransferase 1077 1334 gene locus_tag LOCUS_11710 1077 1334 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_11710 1620 2762 gene locus_tag LOCUS_11720 1620 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4273 3008 gene locus_tag LOCUS_11730 4273 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence118 2 1531 gene locus_tag LOCUS_11740 2 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1748 2806 gene locus_tag LOCUS_11750 1748 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3869 2964 gene locus_tag LOCUS_11760 3869 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence119 739 5 gene locus_tag LOCUS_11770 739 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1922 969 gene locus_tag LOCUS_11780 1922 969 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_11780 2046 3791 gene locus_tag LOCUS_11790 2046 3791 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776958.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence120 130 56 gene locus_tag LOCUS_t00310 130 56 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1897 218 gene locus_tag LOCUS_11800 gene mptB 1897 218 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_11800 2078 2737 gene locus_tag LOCUS_11810 2078 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2944 3018 gene locus_tag LOCUS_t00320 2944 3018 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3247 3819 gene locus_tag LOCUS_11820 3247 3819 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence121 2148 1180 gene locus_tag LOCUS_11830 gene fmt 2148 1180 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 protein_id gnl|my_center|LOCUS_11830 2760 2155 gene locus_tag LOCUS_11840 2760 2155 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 protein_id gnl|my_center|LOCUS_11840 3847 2984 gene locus_tag LOCUS_11850 3847 2984 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775690.1 protein_id gnl|my_center|LOCUS_11850 4081 4007 gene locus_tag LOCUS_t00330 4081 4007 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1147 2052 gene locus_tag LOCUS_11860 1147 2052 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 protein_id gnl|my_center|LOCUS_11860 2311 4194 gene locus_tag LOCUS_11870 2311 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence123 2175 907 gene locus_tag LOCUS_11880 2175 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 2606 3967 gene locus_tag LOCUS_11890 gene hisS 2606 3967 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence124 1182 682 gene locus_tag LOCUS_11900 gene ilvN 1182 682 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056841.1 protein_id gnl|my_center|LOCUS_11900 2987 1182 gene locus_tag LOCUS_11910 2987 1182 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_11910 3451 3990 gene locus_tag LOCUS_11920 3451 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence125 <1 2513 gene locus_tag LOCUS_11930 <1 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027705.1:SMC family ATPase 2750 4159 gene locus_tag LOCUS_11940 2750 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence126 1819 221 gene locus_tag LOCUS_11950 1819 221 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_11950 2111 2728 gene locus_tag LOCUS_11960 2111 2728 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391691.1 protein_id gnl|my_center|LOCUS_11960 2762 3649 gene locus_tag LOCUS_11970 2762 3649 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968897.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence127 2480 1131 gene locus_tag LOCUS_11980 gene hemL 2480 1131 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_11980 4086 2707 gene locus_tag LOCUS_11990 4086 2707 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence128 98 25 gene locus_tag LOCUS_t00340 98 25 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1346 216 gene locus_tag LOCUS_12000 1346 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1977 1531 gene locus_tag LOCUS_12010 1977 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2336 2031 gene locus_tag LOCUS_12020 2336 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3566 2340 gene locus_tag LOCUS_12030 3566 2340 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 protein_id gnl|my_center|LOCUS_12030 4124 4014 gene locus_tag LOCUS_r00020 4124 4014 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence129 865 215 gene locus_tag LOCUS_12040 865 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1261 2553 gene locus_tag LOCUS_12050 1261 2553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013638.1 protein_id gnl|my_center|LOCUS_12050 3552 2638 gene locus_tag LOCUS_12060 3552 2638 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531451.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence130 1353 946 gene locus_tag LOCUS_12070 1353 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1990 1274 gene locus_tag LOCUS_12080 1990 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2809 2546 gene locus_tag LOCUS_12090 gene rpsT 2809 2546 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_12090 3703 3071 gene locus_tag LOCUS_12100 3703 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence131 596 99 gene locus_tag LOCUS_12110 gene greA 596 99 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_12110 1090 2061 gene locus_tag LOCUS_12120 gene mca 1090 2061 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896662.1 protein_id gnl|my_center|LOCUS_12120 2313 3122 gene locus_tag LOCUS_12130 gene uppS 2313 3122 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776303.1 protein_id gnl|my_center|LOCUS_12130 3235 3762 gene locus_tag LOCUS_12140 3235 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence132 316 1680 gene locus_tag LOCUS_12150 316 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1764 2825 gene locus_tag LOCUS_12160 1764 2825 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence133 2214 823 gene locus_tag LOCUS_12170 2214 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2745 2224 gene locus_tag LOCUS_12180 gene ybeY 2745 2224 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_12180 3876 2749 gene locus_tag LOCUS_12190 3876 2749 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence134 3477 1651 gene locus_tag LOCUS_12200 3477 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence135 2406 3317 gene locus_tag LOCUS_12210 2406 3317 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_12210 3317 3814 gene locus_tag LOCUS_12220 3317 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence136 2073 955 gene locus_tag LOCUS_12230 2073 955 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_12230 3453 2335 gene locus_tag LOCUS_12240 3453 2335 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence137 1243 485 gene locus_tag LOCUS_12250 1243 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2544 1240 gene locus_tag LOCUS_12260 2544 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 <3910 2767 gene locus_tag LOCUS_12270 <3910 2767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803669.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence138 1473 568 gene locus_tag LOCUS_12280 1473 568 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_12280 2475 1474 gene locus_tag LOCUS_12290 2475 1474 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_12290 3847 2753 gene locus_tag LOCUS_12300 3847 2753 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence139 3755 381 gene locus_tag LOCUS_12310 3755 381 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence140 2812 68 gene locus_tag LOCUS_12320 2812 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 <3878 2915 gene locus_tag LOCUS_12330 <3878 2915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389541.1:signal recognition particle protein >Feature sequence141 <1 2400 gene locus_tag LOCUS_12340 <1 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein 3374 2514 gene locus_tag LOCUS_12350 3374 2514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399561.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence142 712 86 gene locus_tag LOCUS_12360 712 86 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731327.1 protein_id gnl|my_center|LOCUS_12360 2148 850 gene locus_tag LOCUS_12370 2148 850 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_12370 2428 2763 gene locus_tag LOCUS_12380 gene clpS 2428 2763 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_12380 2763 3338 gene locus_tag LOCUS_12390 2763 3338 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence143 <1 593 gene locus_tag LOCUS_12400 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728904.1:tryptophan synthase subunit beta 593 1447 gene locus_tag LOCUS_12410 gene trpA 593 1447 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805093.1 protein_id gnl|my_center|LOCUS_12410 1447 2466 gene locus_tag LOCUS_12420 1447 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence144 1263 109 gene locus_tag LOCUS_12430 1263 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence145 2595 3056 gene locus_tag LOCUS_12440 2595 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence146 <3724 2738 gene locus_tag LOCUS_12450 <3724 2738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804669.1:ribonuclease J >Feature sequence147 1708 419 gene locus_tag LOCUS_12460 1708 419 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_12460 3519 1999 gene locus_tag LOCUS_12470 gene lysA 3519 1999 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence148 1373 801 gene locus_tag LOCUS_12480 1373 801 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_12480 2118 1534 gene locus_tag LOCUS_12490 2118 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 <3661 2502 gene locus_tag LOCUS_12500 <3661 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270384.1:potassium channel family protein >Feature sequence149 1957 2529 gene locus_tag LOCUS_12510 1957 2529 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence150 1374 490 gene locus_tag LOCUS_12520 gene htpX 1374 490 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 protein_id gnl|my_center|LOCUS_12520 1827 1513 gene locus_tag LOCUS_12530 1827 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2013 2609 gene locus_tag LOCUS_12540 2013 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence151 152 1354 gene locus_tag LOCUS_12550 152 1354 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179943937.1 protein_id gnl|my_center|LOCUS_12550 2888 1455 gene locus_tag LOCUS_12560 2888 1455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707224.1 protein_id gnl|my_center|LOCUS_12560 3540 2974 gene locus_tag LOCUS_12570 3540 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence152 541 894 gene locus_tag LOCUS_12580 gene erpA 541 894 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_12580 1009 2082 gene locus_tag LOCUS_12590 gene trpD 1009 2082 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_12590 2644 3093 gene locus_tag LOCUS_12600 2644 3093 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057865.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence153 <1 1357 gene locus_tag LOCUS_12610 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775971.1:3-phosphoshikimate 1-carboxyvinyltransferase 1357 2484 gene locus_tag LOCUS_12620 gene rsgA 1357 2484 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_12620 2528 3469 gene locus_tag LOCUS_12630 2528 3469 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence154 1452 46 gene locus_tag LOCUS_12640 1452 46 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_12640 1842 1609 gene locus_tag LOCUS_12650 1842 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2263 2883 gene locus_tag LOCUS_12660 2263 2883 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence155 203 1216 gene locus_tag LOCUS_12670 203 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 <3446 2206 gene locus_tag LOCUS_12680 <3446 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013880.1:ATP-dependent helicase >Feature sequence156 597 355 gene locus_tag LOCUS_12690 597 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1120 869 gene locus_tag LOCUS_12700 1120 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence157 1477 110 gene locus_tag LOCUS_12710 1477 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2636 1644 gene locus_tag LOCUS_12720 2636 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3338 3266 gene locus_tag LOCUS_t00350 3338 3266 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 427 3114 gene locus_tag LOCUS_12730 gene alaS 427 3114 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775671.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence159 79 834 gene locus_tag LOCUS_12740 gene frnE 79 834 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_12740 1104 1691 gene locus_tag LOCUS_12750 1104 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2708 1836 gene locus_tag LOCUS_12760 2708 1836 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769928.1 protein_id gnl|my_center|LOCUS_12760 3250 2978 gene locus_tag LOCUS_12770 3250 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence160 >Feature sequence161 <3337 2083 gene locus_tag LOCUS_12780 <3337 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939709.1:ABC transporter permease >Feature sequence162 1900 50 gene locus_tag LOCUS_12790 1900 50 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_12790 2498 2573 gene locus_tag LOCUS_t00360 2498 2573 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence163 1045 1132 gene locus_tag LOCUS_t00370 1045 1132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2380 1295 gene locus_tag LOCUS_12800 2380 1295 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence164 <1 1071 gene locus_tag LOCUS_12810 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233725.1:anion permease 1264 2745 gene locus_tag LOCUS_12820 1264 2745 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732872.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence165 <1 1435 gene locus_tag LOCUS_12830 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029950.1:biotin carboxylase N-terminal domain-containing protein 1838 3238 gene locus_tag LOCUS_12840 1838 3238 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence166 971 57 gene locus_tag LOCUS_12850 971 57 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_12850 1064 1687 gene locus_tag LOCUS_12860 1064 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence167 2 1702 gene locus_tag LOCUS_12870 2 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence168 918 1286 gene locus_tag LOCUS_12880 918 1286 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_12880 2685 1501 gene locus_tag LOCUS_12890 2685 1501 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence169 1546 1130 gene locus_tag LOCUS_12900 1546 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 <3215 2159 gene locus_tag LOCUS_12910 <3215 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804592.1:valine--tRNA ligase >Feature sequence170 2951 2049 gene locus_tag LOCUS_12920 2951 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence171 <1 1877 gene locus_tag LOCUS_12930 <1 1877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804451.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type 3172 2183 gene locus_tag LOCUS_12940 3172 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence172 71 1015 gene locus_tag LOCUS_12950 gene trmD 71 1015 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_12950 2019 1603 gene locus_tag LOCUS_12960 2019 1603 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence173 503 1753 gene locus_tag LOCUS_12970 503 1753 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_12970 2183 1869 gene locus_tag LOCUS_12980 2183 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3037 2180 gene locus_tag LOCUS_12990 3037 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence174 136 1257 gene locus_tag LOCUS_13000 gene aroB 136 1257 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_13000 1470 2033 gene locus_tag LOCUS_13010 gene efp 1470 2033 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 protein_id gnl|my_center|LOCUS_13010 2033 2443 gene locus_tag LOCUS_13020 2033 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence175 834 3002 gene locus_tag LOCUS_13030 gene uvrB 834 3002 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence176 >Feature sequence177 <1 540 gene locus_tag LOCUS_13040 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976765.1:imidazole glycerol phosphate synthase subunit HisH 540 1322 gene locus_tag LOCUS_13050 gene priA 540 1322 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_13050 1862 1440 gene locus_tag LOCUS_13060 1862 1440 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929982.1 protein_id gnl|my_center|LOCUS_13060 2030 2881 gene locus_tag LOCUS_13070 gene infC 2030 2881 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence178 1946 345 gene locus_tag LOCUS_13080 1946 345 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_13080 2495 2214 gene locus_tag LOCUS_13090 2495 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence179 264 740 gene locus_tag LOCUS_13100 gene bcp 264 740 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_13100 890 972 gene locus_tag LOCUS_t00380 890 972 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence180 61 930 gene locus_tag LOCUS_13110 61 930 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775761.1 protein_id gnl|my_center|LOCUS_13110 1174 1572 gene locus_tag LOCUS_13120 1174 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 <2974 2269 gene locus_tag LOCUS_13130 <2974 2269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326185.1:radical SAM family heme chaperone HemW >Feature sequence181 1052 105 gene locus_tag LOCUS_13140 1052 105 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_13140 1336 1262 gene locus_tag LOCUS_t00390 1336 1262 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 231 1490 gene locus_tag LOCUS_13150 231 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1699 2514 gene locus_tag LOCUS_13160 1699 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence183 461 799 gene locus_tag LOCUS_13170 gene rbpA 461 799 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410601.1 protein_id gnl|my_center|LOCUS_13170 1747 1010 gene locus_tag LOCUS_13180 1747 1010 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_13180 <2953 1883 gene locus_tag LOCUS_13190 <2953 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729377.1:amidohydrolase >Feature sequence184 241 1353 gene locus_tag LOCUS_13200 gene fepG 241 1353 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_13200 1353 2201 gene locus_tag LOCUS_13210 1353 2201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093530.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence185 236 1219 gene locus_tag LOCUS_13220 236 1219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814760.1 protein_id gnl|my_center|LOCUS_13220 1195 2871 gene locus_tag LOCUS_13230 1195 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence186 <1 1121 gene locus_tag LOCUS_13240 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485775.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 1384 2295 gene locus_tag LOCUS_13250 gene rapZ 1384 2295 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence187 497 1255 gene locus_tag LOCUS_13260 gene sufC 497 1255 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894511.1 protein_id gnl|my_center|LOCUS_13260 1296 1625 gene locus_tag LOCUS_13270 1296 1625 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_13270 1867 2448 gene locus_tag LOCUS_13280 1867 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2903 2550 gene locus_tag LOCUS_13290 2903 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence188 >Feature sequence189 1974 961 gene locus_tag LOCUS_13300 1974 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence190 429 1976 gene locus_tag LOCUS_13310 gene zwf 429 1976 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence191 113 781 gene locus_tag LOCUS_13320 113 781 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_13320 868 2037 gene locus_tag LOCUS_13330 gene xerD 868 2037 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence192 125 424 gene locus_tag LOCUS_13340 125 424 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776029.1 protein_id gnl|my_center|LOCUS_13340 665 2452 gene locus_tag LOCUS_13350 665 2452 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence193 1655 117 gene locus_tag LOCUS_13360 gene mtr 1655 117 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_13360 2613 1801 gene locus_tag LOCUS_13370 2613 1801 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805154.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence194 1488 313 gene locus_tag LOCUS_13380 gene hemE 1488 313 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776651.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence195 1904 165 gene locus_tag LOCUS_13390 gene leuA 1904 165 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence196 <1 1247 gene locus_tag LOCUS_13400 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016350.1:GT4 family glycosyltransferase PelF 1234 2427 gene locus_tag LOCUS_13410 1234 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence197 216 2711 gene locus_tag LOCUS_13420 gene leuS 216 2711 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence198 <1 1226 gene locus_tag LOCUS_13430 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243083.1:(2,3-dihydroxybenzoyl)adenylate synthase 1307 1534 gene locus_tag LOCUS_13440 1307 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence199 1689 499 gene locus_tag LOCUS_13450 1689 499 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775947.1 protein_id gnl|my_center|LOCUS_13450 2727 1861 gene locus_tag LOCUS_13460 gene prmC 2727 1861 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence200 2423 1368 gene locus_tag LOCUS_13470 2423 1368 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence201 214 891 gene locus_tag LOCUS_13480 214 891 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_13480 1327 1995 gene locus_tag LOCUS_13490 1327 1995 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908466.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence202 2219 1002 gene locus_tag LOCUS_13500 gene aroC 2219 1002 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence203 2139 1204 gene locus_tag LOCUS_13510 gene dapA 2139 1204 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804668.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence204 <1 1962 gene locus_tag LOCUS_13520 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152204006.1:translation initiation factor IF-2 >Feature sequence205 744 2177 gene locus_tag LOCUS_13530 gene murA 744 2177 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence206 <1 1176 gene locus_tag LOCUS_13540 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775887.1:glutamate--tRNA ligase 1179 1619 gene locus_tag LOCUS_13550 1179 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1935 2010 gene locus_tag LOCUS_t00400 1935 2010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 893 1204 gene locus_tag LOCUS_13560 gene rplU 893 1204 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_13560 1246 1503 gene locus_tag LOCUS_13570 gene rpmA 1246 1503 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_13570