>Feature sequence001 465 767 gene locus_tag LOCUS_00010 465 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 873 1157 gene locus_tag LOCUS_00020 873 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00020 1314 2243 gene locus_tag LOCUS_00030 1314 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 2299 2589 gene locus_tag LOCUS_00040 2299 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2849 3067 gene locus_tag LOCUS_00050 2849 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3193 3363 gene locus_tag LOCUS_00060 3193 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3360 3485 gene locus_tag LOCUS_00070 3360 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3644 4576 gene locus_tag LOCUS_00080 3644 4576 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_00080 4622 5566 gene locus_tag LOCUS_00090 4622 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6869 5625 gene locus_tag LOCUS_00100 6869 5625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_00100 8620 6866 gene locus_tag LOCUS_00110 8620 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9303 8617 gene locus_tag LOCUS_00120 9303 8617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895848.1 protein_id gnl|my_center|LOCUS_00120 10456 9293 gene locus_tag LOCUS_00130 10456 9293 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 protein_id gnl|my_center|LOCUS_00130 10583 12229 gene locus_tag LOCUS_00140 10583 12229 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_00140 13365 12253 gene locus_tag LOCUS_00150 13365 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13605 14474 gene locus_tag LOCUS_00160 13605 14474 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_00160 14708 16945 gene locus_tag LOCUS_00170 gene pflB 14708 16945 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_00170 16974 17699 gene locus_tag LOCUS_00180 gene pflA 16974 17699 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_00180 20240 17751 gene locus_tag LOCUS_00190 20240 17751 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283090.1 protein_id gnl|my_center|LOCUS_00190 20825 20241 gene locus_tag LOCUS_00200 gene recU 20825 20241 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_00200 20938 21279 gene locus_tag LOCUS_00210 gene gpsB 20938 21279 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263050.1 protein_id gnl|my_center|LOCUS_00210 21904 22542 gene locus_tag LOCUS_00220 21904 22542 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_00220 22550 23005 gene locus_tag LOCUS_00230 22550 23005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23186 24124 gene locus_tag LOCUS_00240 23186 24124 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_00240 24652 24176 gene locus_tag LOCUS_00250 24652 24176 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_00250 24801 25385 gene locus_tag LOCUS_00260 24801 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25397 26587 gene locus_tag LOCUS_00270 25397 26587 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_00270 27532 26600 gene locus_tag LOCUS_00280 27532 26600 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921733.1 protein_id gnl|my_center|LOCUS_00280 27665 28063 gene locus_tag LOCUS_00290 27665 28063 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_00290 28787 28089 gene locus_tag LOCUS_00300 28787 28089 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_00300 29110 31284 gene locus_tag LOCUS_00310 gene nrdD 29110 31284 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_00310 31318 31839 gene locus_tag LOCUS_00320 gene nrdG 31318 31839 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287943.1 protein_id gnl|my_center|LOCUS_00320 31889 32536 gene locus_tag LOCUS_00330 gene ispD 31889 32536 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_00330 32545 33012 gene locus_tag LOCUS_00340 32545 33012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33085 35292 gene locus_tag LOCUS_00350 33085 35292 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_00350 36421 35306 gene locus_tag LOCUS_00360 36421 35306 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_00360 37435 36533 gene locus_tag LOCUS_00370 37435 36533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_00370 37920 37435 gene locus_tag LOCUS_00380 37920 37435 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_00380 38779 37925 gene locus_tag LOCUS_00390 38779 37925 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 protein_id gnl|my_center|LOCUS_00390 39839 38781 gene locus_tag LOCUS_00400 39839 38781 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_00400 39976 40731 gene locus_tag LOCUS_00410 39976 40731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40721 42694 gene locus_tag LOCUS_00420 gene recG 40721 42694 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151509.1 protein_id gnl|my_center|LOCUS_00420 42705 43499 gene locus_tag LOCUS_00430 42705 43499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43897 43505 gene locus_tag LOCUS_00440 43897 43505 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775686.1 protein_id gnl|my_center|LOCUS_00440 44282 45637 gene locus_tag LOCUS_00450 44282 45637 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 protein_id gnl|my_center|LOCUS_00450 45634 46689 gene locus_tag LOCUS_00460 gene vanG 45634 46689 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_00460 46683 47834 gene locus_tag LOCUS_00470 gene alr 46683 47834 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_00470 47831 48844 gene locus_tag LOCUS_00480 47831 48844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48849 50420 gene locus_tag LOCUS_00490 48849 50420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_00490 50421 50945 gene locus_tag LOCUS_00500 50421 50945 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 protein_id gnl|my_center|LOCUS_00500 50938 52017 gene locus_tag LOCUS_00510 gene yqeH 50938 52017 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991828.1 protein_id gnl|my_center|LOCUS_00510 52017 52307 gene locus_tag LOCUS_00520 gene yhbY 52017 52307 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_00520 52304 53320 gene locus_tag LOCUS_00530 52304 53320 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874692.1 protein_id gnl|my_center|LOCUS_00530 53323 53661 gene locus_tag LOCUS_00540 gene rsfS 53323 53661 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431718.1 protein_id gnl|my_center|LOCUS_00540 53651 54361 gene locus_tag LOCUS_00550 53651 54361 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 protein_id gnl|my_center|LOCUS_00550 54358 55038 gene locus_tag LOCUS_00560 54358 55038 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286756.1 protein_id gnl|my_center|LOCUS_00560 55057 55524 gene locus_tag LOCUS_00570 55057 55524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55524 56063 gene locus_tag LOCUS_00580 55524 56063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 56060 56686 gene locus_tag LOCUS_00590 gene nth 56060 56686 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 protein_id gnl|my_center|LOCUS_00590 56732 57526 gene locus_tag LOCUS_00600 56732 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 57568 58026 gene locus_tag LOCUS_00610 57568 58026 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_00610 58036 58350 gene locus_tag LOCUS_00620 58036 58350 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_00620 58354 58854 gene locus_tag LOCUS_00630 58354 58854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59706 58831 gene locus_tag LOCUS_00640 59706 58831 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_00640 59810 60835 gene locus_tag LOCUS_00650 59810 60835 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_00650 61713 60844 gene locus_tag LOCUS_00660 61713 60844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_00660 61897 62646 gene locus_tag LOCUS_00670 61897 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 63968 62658 gene locus_tag LOCUS_00680 63968 62658 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_00680 64436 64074 gene locus_tag LOCUS_00690 64436 64074 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_00690 64570 64495 gene locus_tag LOCUS_t00010 64570 64495 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 64678 65553 gene locus_tag LOCUS_00700 64678 65553 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_00700 66577 65540 gene locus_tag LOCUS_00710 66577 65540 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_00710 66687 67157 gene locus_tag LOCUS_00720 66687 67157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 67703 71755 gene locus_tag LOCUS_00730 67703 71755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71830 72768 gene locus_tag LOCUS_00740 gene cas1 71830 72768 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 protein_id gnl|my_center|LOCUS_00740 72776 73111 gene locus_tag LOCUS_00750 gene cas2 72776 73111 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_00750 73095 73970 gene locus_tag LOCUS_00760 73095 73970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 74004 75616 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcttgaggactgaatttatttgtattatttgaac 76133 75702 gene locus_tag LOCUS_00770 76133 75702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 77124 78509 gene locus_tag LOCUS_00780 gene ltrA 77124 78509 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_00780 78607 79275 gene locus_tag LOCUS_00790 78607 79275 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_00790 79272 80261 gene locus_tag LOCUS_00800 79272 80261 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_00800 80353 81120 gene locus_tag LOCUS_00810 80353 81120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923535.1 protein_id gnl|my_center|LOCUS_00810 81113 83080 gene locus_tag LOCUS_00820 81113 83080 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_00820 83188 83898 gene locus_tag LOCUS_00830 83188 83898 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_00830 83895 84368 gene locus_tag LOCUS_00840 gene rlmH 83895 84368 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_00840 84476 85660 gene locus_tag LOCUS_00850 84476 85660 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564267.1 protein_id gnl|my_center|LOCUS_00850 85679 86425 gene locus_tag LOCUS_00860 gene tpiA 85679 86425 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922080.1 protein_id gnl|my_center|LOCUS_00860 86560 87549 gene locus_tag LOCUS_00870 86560 87549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 87643 88158 gene locus_tag LOCUS_00880 87643 88158 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_00880 88151 88636 gene locus_tag LOCUS_00890 gene ispF 88151 88636 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_00890 88633 89082 gene locus_tag LOCUS_00900 88633 89082 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_00900 89082 89936 gene locus_tag LOCUS_00910 89082 89936 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355876.1 protein_id gnl|my_center|LOCUS_00910 89939 90130 gene locus_tag LOCUS_00920 89939 90130 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_00920 90149 91252 gene locus_tag LOCUS_00930 gene ychF 90149 91252 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_00930 91245 91886 gene locus_tag LOCUS_00940 91245 91886 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_00940 92045 93853 gene locus_tag LOCUS_00950 92045 93853 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_00950 94908 93874 gene locus_tag LOCUS_00960 94908 93874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 95035 96135 gene locus_tag LOCUS_00970 95035 96135 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_00970 97393 96182 gene locus_tag LOCUS_00980 gene tgt 97393 96182 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_00980 98565 97426 gene locus_tag LOCUS_00990 98565 97426 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 protein_id gnl|my_center|LOCUS_00990 98718 99233 gene locus_tag LOCUS_01000 98718 99233 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 protein_id gnl|my_center|LOCUS_01000 99235 99756 gene locus_tag LOCUS_01010 gene trmL 99235 99756 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_01010 99734 100267 gene locus_tag LOCUS_01020 99734 100267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 100475 101719 gene locus_tag LOCUS_01030 100475 101719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 101788 102987 gene locus_tag LOCUS_01040 101788 102987 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_01040 102977 104230 gene locus_tag LOCUS_01050 102977 104230 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664775.1 protein_id gnl|my_center|LOCUS_01050 104405 104713 gene locus_tag LOCUS_01060 104405 104713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 105409 104801 gene locus_tag LOCUS_01070 gene rpsD 105409 104801 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_01070 105676 107451 gene locus_tag LOCUS_01080 gene ezrA 105676 107451 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229320.1 protein_id gnl|my_center|LOCUS_01080 107451 108581 gene locus_tag LOCUS_01090 107451 108581 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723322.1 protein_id gnl|my_center|LOCUS_01090 108565 109755 gene locus_tag LOCUS_01100 gene thiI 108565 109755 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 protein_id gnl|my_center|LOCUS_01100 109821 110594 gene locus_tag LOCUS_01110 gene rlmA 109821 110594 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_01110 110563 112179 gene locus_tag LOCUS_01120 gene rlmD 110563 112179 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583073.1 protein_id gnl|my_center|LOCUS_01120 112533 114455 gene locus_tag LOCUS_01130 112533 114455 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_01130 114464 116467 gene locus_tag LOCUS_01140 114464 116467 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence002 477 124 gene locus_tag LOCUS_01150 477 124 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_01150 1435 479 gene locus_tag LOCUS_01160 1435 479 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722728.1 protein_id gnl|my_center|LOCUS_01160 2466 1465 gene locus_tag LOCUS_01170 2466 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3906 2557 gene locus_tag LOCUS_01180 3906 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4545 3934 gene locus_tag LOCUS_01190 4545 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5453 4542 gene locus_tag LOCUS_01200 5453 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 5709 5425 gene locus_tag LOCUS_01210 5709 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 6896 5748 gene locus_tag LOCUS_01220 6896 5748 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_01220 7340 7131 gene locus_tag LOCUS_01230 gene rpmE 7340 7131 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_01230 9129 7435 gene locus_tag LOCUS_01240 9129 7435 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_01240 9363 9172 gene locus_tag LOCUS_01250 9363 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10346 9363 gene locus_tag LOCUS_01260 10346 9363 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682378.1 protein_id gnl|my_center|LOCUS_01260 11368 10349 gene locus_tag LOCUS_01270 11368 10349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_01270 12295 11384 gene locus_tag LOCUS_01280 12295 11384 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_01280 13292 12309 gene locus_tag LOCUS_01290 13292 12309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_01290 15186 13474 gene locus_tag LOCUS_01300 15186 13474 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705202.1 protein_id gnl|my_center|LOCUS_01300 15575 16096 gene locus_tag LOCUS_01310 15575 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 17902 16097 gene locus_tag LOCUS_01320 gene glmS 17902 16097 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_01320 19020 18142 gene locus_tag LOCUS_01330 19020 18142 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 protein_id gnl|my_center|LOCUS_01330 19799 19023 gene locus_tag LOCUS_01340 gene soj 19799 19023 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_01340 20503 19802 gene locus_tag LOCUS_01350 gene rsmG 20503 19802 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_01350 20640 21227 gene locus_tag LOCUS_01360 20640 21227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 21230 21874 gene locus_tag LOCUS_01370 21230 21874 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056209.1 protein_id gnl|my_center|LOCUS_01370 23076 21883 gene locus_tag LOCUS_01380 23076 21883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_01380 24525 23461 gene locus_tag LOCUS_01390 24525 23461 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_01390 25732 24527 gene locus_tag LOCUS_01400 25732 24527 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_01400 27987 25750 gene locus_tag LOCUS_01410 27987 25750 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_01410 28375 27989 gene locus_tag LOCUS_01420 28375 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 29275 28457 gene locus_tag LOCUS_01430 gene tagH 29275 28457 CDS product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832071.1 protein_id gnl|my_center|LOCUS_01430 30116 29286 gene locus_tag LOCUS_01440 gene tagG 30116 29286 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_01440 30607 30260 gene locus_tag LOCUS_01450 30607 30260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 32267 30633 gene locus_tag LOCUS_01460 gene argS 32267 30633 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_01460 32640 32254 gene locus_tag LOCUS_01470 32640 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 34008 32809 gene locus_tag LOCUS_01480 34008 32809 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262741.1 protein_id gnl|my_center|LOCUS_01480 34394 33975 gene locus_tag LOCUS_01490 34394 33975 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966113.1 protein_id gnl|my_center|LOCUS_01490 34650 34381 gene locus_tag LOCUS_01500 34650 34381 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 protein_id gnl|my_center|LOCUS_01500 38036 34650 gene locus_tag LOCUS_01510 gene mfd 38036 34650 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_01510 38609 38049 gene locus_tag LOCUS_01520 gene pth 38609 38049 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_01520 39272 38646 gene locus_tag LOCUS_01530 39272 38646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 40274 39282 gene locus_tag LOCUS_01540 40274 39282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 40627 40286 gene locus_tag LOCUS_01550 gene rnpA 40627 40286 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183578.1 protein_id gnl|my_center|LOCUS_01550 40806 40672 gene locus_tag LOCUS_01560 gene rpmH 40806 40672 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240855.1 protein_id gnl|my_center|LOCUS_01560 41690 40908 gene locus_tag LOCUS_01570 41690 40908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 42147 41815 gene locus_tag LOCUS_01580 42147 41815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 43419 42205 gene locus_tag LOCUS_01590 43419 42205 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_01590 43817 45184 gene locus_tag LOCUS_01600 gene dnaA 43817 45184 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290433.1 protein_id gnl|my_center|LOCUS_01600 45330 46448 gene locus_tag LOCUS_01610 gene dnaN 45330 46448 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_01610 46563 46766 gene locus_tag LOCUS_01620 46563 46766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 46763 47842 gene locus_tag LOCUS_01630 gene recF 46763 47842 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_01630 47839 49806 gene locus_tag LOCUS_01640 gene gyrB 47839 49806 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255578.1 protein_id gnl|my_center|LOCUS_01640 49819 52287 gene locus_tag LOCUS_01650 gene gyrA 49819 52287 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_01650 52432 53016 gene locus_tag LOCUS_01660 52432 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 53355 54638 gene locus_tag LOCUS_01670 gene serS 53355 54638 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_01670 54773 55279 gene locus_tag LOCUS_01680 gene tadA 54773 55279 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_01680 55394 57157 gene locus_tag LOCUS_01690 gene dnaX 55394 57157 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 protein_id gnl|my_center|LOCUS_01690 57168 57755 gene locus_tag LOCUS_01700 gene recR 57168 57755 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_01700 58437 58985 gene locus_tag LOCUS_01710 58437 58985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 59527 58982 gene locus_tag LOCUS_01720 59527 58982 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601679.1 protein_id gnl|my_center|LOCUS_01720 59582 60355 gene locus_tag LOCUS_01730 59582 60355 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673190.1 protein_id gnl|my_center|LOCUS_01730 61577 60339 gene locus_tag LOCUS_01740 61577 60339 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_01740 61664 64204 gene locus_tag LOCUS_01750 gene mutS 61664 64204 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 protein_id gnl|my_center|LOCUS_01750 64237 66063 gene locus_tag LOCUS_01760 gene mutL 64237 66063 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_01760 66056 66970 gene locus_tag LOCUS_01770 gene miaA 66056 66970 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_01770 66957 67643 gene locus_tag LOCUS_01780 66957 67643 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_01780 67659 68558 gene locus_tag LOCUS_01790 67659 68558 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_01790 68597 69868 gene locus_tag LOCUS_01800 68597 69868 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_01800 70630 69893 gene locus_tag LOCUS_01810 70630 69893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 71275 70658 gene locus_tag LOCUS_01820 71275 70658 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_01820 71794 71342 gene locus_tag LOCUS_01830 71794 71342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 73756 71927 gene locus_tag LOCUS_01840 73756 71927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 74450 73749 gene locus_tag LOCUS_01850 74450 73749 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_01850 75149 74469 gene locus_tag LOCUS_01860 75149 74469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 75684 77549 gene locus_tag LOCUS_01870 75684 77549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 77525 77926 gene locus_tag LOCUS_01880 gene gtcA 77525 77926 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_01880 77913 78833 gene locus_tag LOCUS_01890 77913 78833 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_01890 80071 78830 gene locus_tag LOCUS_01900 80071 78830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 80573 80082 gene locus_tag LOCUS_01910 80573 80082 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_01910 80509 80946 gene locus_tag LOCUS_01920 80509 80946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 81342 82040 gene locus_tag LOCUS_01930 81342 82040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_01930 82040 84316 gene locus_tag LOCUS_01940 82040 84316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943948.1 protein_id gnl|my_center|LOCUS_01940 84976 84566 gene locus_tag LOCUS_01950 84976 84566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 86364 84979 gene locus_tag LOCUS_01960 gene atpD 86364 84979 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_01960 87275 86355 gene locus_tag LOCUS_01970 gene atpG 87275 86355 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_01970 89017 87275 gene locus_tag LOCUS_01980 gene atpA 89017 87275 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_01980 89482 89018 gene locus_tag LOCUS_01990 89482 89018 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258897.1 protein_id gnl|my_center|LOCUS_01990 89716 89495 gene locus_tag LOCUS_02000 89716 89495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 90418 89735 gene locus_tag LOCUS_02010 gene atpB 90418 89735 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence003 182 928 gene locus_tag LOCUS_02020 182 928 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 protein_id gnl|my_center|LOCUS_02020 990 1175 gene locus_tag LOCUS_02030 990 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1738 2106 gene locus_tag LOCUS_02040 1738 2106 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_02040 2111 2890 gene locus_tag LOCUS_02050 2111 2890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_02050 2887 3501 gene locus_tag LOCUS_02060 2887 3501 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_02060 4007 3498 gene locus_tag LOCUS_02070 4007 3498 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_02070 4105 6672 gene locus_tag LOCUS_02080 4105 6672 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_02080 6711 7190 gene locus_tag LOCUS_02090 6711 7190 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_02090 7193 7357 gene locus_tag LOCUS_02100 7193 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7354 8790 gene locus_tag LOCUS_02110 7354 8790 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_02110 8790 9179 gene locus_tag LOCUS_02120 8790 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9179 9331 gene locus_tag LOCUS_02130 9179 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 9390 9710 gene locus_tag LOCUS_02140 9390 9710 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_02140 9715 10377 gene locus_tag LOCUS_02150 9715 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 10724 10650 gene locus_tag LOCUS_t00020 10724 10650 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12180 10774 gene locus_tag LOCUS_02160 12180 10774 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_02160 12630 12244 gene locus_tag LOCUS_02170 12630 12244 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_02170 13195 12710 gene locus_tag LOCUS_02180 13195 12710 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847065.1 protein_id gnl|my_center|LOCUS_02180 13408 14961 gene locus_tag LOCUS_02190 13408 14961 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 protein_id gnl|my_center|LOCUS_02190 14933 15541 gene locus_tag LOCUS_02200 14933 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 15543 16211 gene locus_tag LOCUS_02210 15543 16211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984985.1 protein_id gnl|my_center|LOCUS_02210 16234 16911 gene locus_tag LOCUS_02220 16234 16911 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_02220 16904 18136 gene locus_tag LOCUS_02230 16904 18136 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_02230 18147 19220 gene locus_tag LOCUS_02240 18147 19220 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_02240 20564 19236 gene locus_tag LOCUS_02250 gene mnmE 20564 19236 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_02250 20636 21232 gene locus_tag LOCUS_02260 20636 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 21403 21669 gene locus_tag LOCUS_02270 21403 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 21742 21825 gene locus_tag LOCUS_t00030 21742 21825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21888 22793 gene locus_tag LOCUS_02280 21888 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 22793 24061 gene locus_tag LOCUS_02290 22793 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 24058 25527 gene locus_tag LOCUS_02300 24058 25527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 25540 26319 gene locus_tag LOCUS_02310 25540 26319 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_02310 26356 27633 gene locus_tag LOCUS_02320 26356 27633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 27667 27741 gene locus_tag LOCUS_t00040 27667 27741 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27794 28927 gene locus_tag LOCUS_02330 27794 28927 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_02330 28967 30154 gene locus_tag LOCUS_02340 28967 30154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 30151 31458 gene locus_tag LOCUS_02350 30151 31458 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_02350 32666 31473 gene locus_tag LOCUS_02360 32666 31473 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461629.1 protein_id gnl|my_center|LOCUS_02360 32826 33965 gene locus_tag LOCUS_02370 gene nagA 32826 33965 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_02370 34737 33994 gene locus_tag LOCUS_02380 34737 33994 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 protein_id gnl|my_center|LOCUS_02380 34878 35546 gene locus_tag LOCUS_02390 gene fsa 34878 35546 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430626.1 protein_id gnl|my_center|LOCUS_02390 35670 38222 gene locus_tag LOCUS_02400 gene clpB 35670 38222 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723824.1 protein_id gnl|my_center|LOCUS_02400 38281 39015 gene locus_tag LOCUS_02410 38281 39015 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_02410 39120 39599 gene locus_tag LOCUS_02420 gene cysE 39120 39599 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964006.1 protein_id gnl|my_center|LOCUS_02420 39608 40915 gene locus_tag LOCUS_02430 39608 40915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 41491 42453 gene locus_tag LOCUS_02440 41491 42453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 42434 43759 gene locus_tag LOCUS_02450 42434 43759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 43756 45510 gene locus_tag LOCUS_02460 43756 45510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 45609 48707 gene locus_tag LOCUS_02470 45609 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 48700 48906 gene locus_tag LOCUS_02480 48700 48906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 48909 49202 gene locus_tag LOCUS_02490 48909 49202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 49215 49499 gene locus_tag LOCUS_02500 49215 49499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 49492 49665 gene locus_tag LOCUS_02510 49492 49665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 49652 50446 gene locus_tag LOCUS_02520 49652 50446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 50459 50731 gene locus_tag LOCUS_02530 50459 50731 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531355.1 protein_id gnl|my_center|LOCUS_02530 51654 50755 gene locus_tag LOCUS_02540 51654 50755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 52679 51654 gene locus_tag LOCUS_02550 52679 51654 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906107.1 protein_id gnl|my_center|LOCUS_02550 52812 53627 gene locus_tag LOCUS_02560 gene sufC 52812 53627 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_02560 53620 54393 gene locus_tag LOCUS_02570 53620 54393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 54380 55621 gene locus_tag LOCUS_02580 gene sufS 54380 55621 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 protein_id gnl|my_center|LOCUS_02580 55637 56083 gene locus_tag LOCUS_02590 55637 56083 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_02590 56076 57479 gene locus_tag LOCUS_02600 gene sufB 56076 57479 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_02600 57472 57969 gene locus_tag LOCUS_02610 57472 57969 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874704.1 protein_id gnl|my_center|LOCUS_02610 57966 58586 gene locus_tag LOCUS_02620 57966 58586 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535461.1 protein_id gnl|my_center|LOCUS_02620 58602 59645 gene locus_tag LOCUS_02630 58602 59645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 60112 59642 gene locus_tag LOCUS_02640 60112 59642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 60382 60170 gene locus_tag LOCUS_02650 60382 60170 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_02650 60598 62040 gene locus_tag LOCUS_02660 60598 62040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 62811 62320 gene locus_tag LOCUS_02670 62811 62320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 63104 63520 gene locus_tag LOCUS_02680 63104 63520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 63504 63818 gene locus_tag LOCUS_02690 63504 63818 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_02690 63820 64707 gene locus_tag LOCUS_02700 63820 64707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 64700 65170 gene locus_tag LOCUS_02710 64700 65170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 65366 66961 gene locus_tag LOCUS_02720 65366 66961 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_02720 66973 67467 gene locus_tag LOCUS_02730 gene lspA 66973 67467 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_02730 67449 68363 gene locus_tag LOCUS_02740 67449 68363 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724126.1 protein_id gnl|my_center|LOCUS_02740 68363 68842 gene locus_tag LOCUS_02750 68363 68842 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_02750 69021 78299 gene locus_tag LOCUS_02760 69021 78299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence004 95 544 gene locus_tag LOCUS_02770 95 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 1107 1469 gene locus_tag LOCUS_02780 1107 1469 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 protein_id gnl|my_center|LOCUS_02780 1579 1761 gene locus_tag LOCUS_02790 1579 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1774 3093 gene locus_tag LOCUS_02800 1774 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 3099 4457 gene locus_tag LOCUS_02810 3099 4457 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_02810 6319 4967 gene locus_tag LOCUS_02820 6319 4967 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_02820 7604 6321 gene locus_tag LOCUS_02830 7604 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7801 7619 gene locus_tag LOCUS_02840 7801 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 8276 7914 gene locus_tag LOCUS_02850 8276 7914 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_02850 8729 8941 gene locus_tag LOCUS_02860 8729 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9427 8978 gene locus_tag LOCUS_02870 9427 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9841 10074 gene locus_tag LOCUS_02880 9841 10074 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_02880 10058 11974 gene locus_tag LOCUS_02890 10058 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12199 12966 gene locus_tag LOCUS_02900 12199 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12963 14813 gene locus_tag LOCUS_02910 12963 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14810 16456 gene locus_tag LOCUS_02920 14810 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 16453 17223 gene locus_tag LOCUS_02930 16453 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17220 18392 gene locus_tag LOCUS_02940 17220 18392 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_02940 18392 18778 gene locus_tag LOCUS_02950 18392 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645884.1 protein_id gnl|my_center|LOCUS_02950 18775 19371 gene locus_tag LOCUS_02960 18775 19371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 19376 19996 gene locus_tag LOCUS_02970 19376 19996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20023 22368 gene locus_tag LOCUS_02980 20023 22368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076562306.1 protein_id gnl|my_center|LOCUS_02980 22358 22603 gene locus_tag LOCUS_02990 22358 22603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 22745 22984 gene locus_tag LOCUS_03000 22745 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 23148 24821 gene locus_tag LOCUS_03010 23148 24821 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_03010 25313 25537 gene locus_tag LOCUS_03020 25313 25537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 27037 25553 gene locus_tag LOCUS_03030 27037 25553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 29420 27084 gene locus_tag LOCUS_03040 29420 27084 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_03040 29787 29362 gene locus_tag LOCUS_03050 29787 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 30010 29777 gene locus_tag LOCUS_03060 30010 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 30841 30074 gene locus_tag LOCUS_03070 30841 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 31946 30831 gene locus_tag LOCUS_03080 31946 30831 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_03080 32884 32054 gene locus_tag LOCUS_03090 32884 32054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 33194 32889 gene locus_tag LOCUS_03100 33194 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 34959 33172 gene locus_tag LOCUS_03110 34959 33172 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_03110 35149 34946 gene locus_tag LOCUS_03120 35149 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 35859 35155 gene locus_tag LOCUS_03130 35859 35155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 37190 35856 gene locus_tag LOCUS_03140 37190 35856 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_03140 37522 37163 gene locus_tag LOCUS_03150 37522 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 37619 37497 gene locus_tag LOCUS_03160 37619 37497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 38530 37694 gene locus_tag LOCUS_03170 38530 37694 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_03170 38898 38689 gene locus_tag LOCUS_03180 38898 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 39614 38916 gene locus_tag LOCUS_03190 39614 38916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 40028 39699 gene locus_tag LOCUS_03200 40028 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 40560 40012 gene locus_tag LOCUS_03210 40560 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 40772 40632 gene locus_tag LOCUS_03220 40772 40632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 41152 40787 gene locus_tag LOCUS_03230 41152 40787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 41674 41213 gene locus_tag LOCUS_03240 41674 41213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 42748 41807 gene locus_tag LOCUS_03250 42748 41807 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_03250 44424 42745 gene locus_tag LOCUS_03260 44424 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 45140 44523 gene locus_tag LOCUS_03270 45140 44523 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_03270 47135 45423 gene locus_tag LOCUS_03280 47135 45423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816152.1 protein_id gnl|my_center|LOCUS_03280 48164 47421 gene locus_tag LOCUS_03290 gene srtB 48164 47421 CDS product sortase SrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903304.1 protein_id gnl|my_center|LOCUS_03290 51199 48170 gene locus_tag LOCUS_03300 51199 48170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 52045 51290 gene locus_tag LOCUS_03310 52045 51290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 53280 52309 gene locus_tag LOCUS_03320 53280 52309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 53510 53295 gene locus_tag LOCUS_03330 53510 53295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 53805 53503 gene locus_tag LOCUS_03340 53805 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 54633 53815 gene locus_tag LOCUS_03350 54633 53815 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_03350 56127 54694 gene locus_tag LOCUS_03360 56127 54694 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_03360 57233 56277 gene locus_tag LOCUS_03370 gene rhuM 57233 56277 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_03370 58015 58893 gene locus_tag LOCUS_03380 58015 58893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 58940 59233 gene locus_tag LOCUS_03390 58940 59233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence005 182 1114 gene locus_tag LOCUS_03400 182 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1099 1602 gene locus_tag LOCUS_03410 1099 1602 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203239.1 protein_id gnl|my_center|LOCUS_03410 1637 3055 gene locus_tag LOCUS_03420 gene ffh 1637 3055 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_03420 3152 3421 gene locus_tag LOCUS_03430 gene rpsP 3152 3421 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_03430 3421 3669 gene locus_tag LOCUS_03440 3421 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3707 4195 gene locus_tag LOCUS_03450 gene rimM 3707 4195 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_03450 4192 4914 gene locus_tag LOCUS_03460 gene trmD 4192 4914 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_03460 5034 5381 gene locus_tag LOCUS_03470 gene rplS 5034 5381 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436293.1 protein_id gnl|my_center|LOCUS_03470 5467 6096 gene locus_tag LOCUS_03480 gene lepB 5467 6096 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_03480 6096 6944 gene locus_tag LOCUS_03490 gene ylqF 6096 6944 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_03490 6934 7542 gene locus_tag LOCUS_03500 gene rnhB 6934 7542 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021956.1 protein_id gnl|my_center|LOCUS_03500 7575 8306 gene locus_tag LOCUS_03510 7575 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8363 10495 gene locus_tag LOCUS_03520 gene topA 8363 10495 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_03520 10495 11793 gene locus_tag LOCUS_03530 gene trmFO 10495 11793 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_03530 11786 12661 gene locus_tag LOCUS_03540 gene xerC 11786 12661 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570336.1 protein_id gnl|my_center|LOCUS_03540 12806 13711 gene locus_tag LOCUS_03550 gene rpsB 12806 13711 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_03550 13737 14627 gene locus_tag LOCUS_03560 gene tsf 13737 14627 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_03560 14731 15441 gene locus_tag LOCUS_03570 gene pyrH 14731 15441 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703168.1 protein_id gnl|my_center|LOCUS_03570 15453 15998 gene locus_tag LOCUS_03580 gene frr 15453 15998 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829472.1 protein_id gnl|my_center|LOCUS_03580 16039 16731 gene locus_tag LOCUS_03590 16039 16731 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 protein_id gnl|my_center|LOCUS_03590 16728 17495 gene locus_tag LOCUS_03600 16728 17495 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_03600 17507 18580 gene locus_tag LOCUS_03610 gene rseP 17507 18580 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_03610 19262 18624 gene locus_tag LOCUS_03620 19262 18624 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_03620 19389 22316 gene locus_tag LOCUS_03630 19389 22316 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_03630 22316 23275 gene locus_tag LOCUS_03640 gene ftsY 22316 23275 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287900.1 protein_id gnl|my_center|LOCUS_03640 23275 23568 gene locus_tag LOCUS_03650 23275 23568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 23581 24780 gene locus_tag LOCUS_03660 23581 24780 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989750.1 protein_id gnl|my_center|LOCUS_03660 24773 25705 gene locus_tag LOCUS_03670 24773 25705 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874906.1 protein_id gnl|my_center|LOCUS_03670 25760 28792 gene locus_tag LOCUS_03680 gene dnaE 25760 28792 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_03680 28796 29425 gene locus_tag LOCUS_03690 28796 29425 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_03690 29692 30786 gene locus_tag LOCUS_03700 gene metK 29692 30786 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_03700 31727 31278 gene locus_tag LOCUS_03710 31727 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 32860 32498 gene locus_tag LOCUS_03720 32860 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 33002 33340 gene locus_tag LOCUS_03730 33002 33340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 33359 33679 gene locus_tag LOCUS_03740 33359 33679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 33985 34854 gene locus_tag LOCUS_03750 33985 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 36095 34932 gene locus_tag LOCUS_03760 gene fucO 36095 34932 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_03760 36256 38520 gene locus_tag LOCUS_03770 36256 38520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 38513 39397 gene locus_tag LOCUS_03780 38513 39397 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_03780 39401 40186 gene locus_tag LOCUS_03790 39401 40186 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_03790 40173 40940 gene locus_tag LOCUS_03800 40173 40940 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_03800 41146 42081 gene locus_tag LOCUS_03810 41146 42081 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_03810 42140 42796 gene locus_tag LOCUS_03820 42140 42796 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_03820 42800 43540 gene locus_tag LOCUS_03830 42800 43540 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_03830 43710 44492 gene locus_tag LOCUS_03840 43710 44492 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926540.1 protein_id gnl|my_center|LOCUS_03840 44620 45825 gene locus_tag LOCUS_03850 44620 45825 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293788.1 protein_id gnl|my_center|LOCUS_03850 45925 46845 gene locus_tag LOCUS_03860 45925 46845 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_03860 46911 47078 gene locus_tag LOCUS_03870 46911 47078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 47071 48117 gene locus_tag LOCUS_03880 gene metN 47071 48117 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_03880 48110 48808 gene locus_tag LOCUS_03890 48110 48808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 protein_id gnl|my_center|LOCUS_03890 48827 49747 gene locus_tag LOCUS_03900 48827 49747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 50080 49775 gene locus_tag LOCUS_03910 50080 49775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 50917 50090 gene locus_tag LOCUS_03920 50917 50090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 51288 50917 gene locus_tag LOCUS_03930 51288 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 51892 51278 gene locus_tag LOCUS_03940 51892 51278 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_03940 51972 52574 gene locus_tag LOCUS_03950 51972 52574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 52571 53185 gene locus_tag LOCUS_03960 52571 53185 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_03960 53723 53175 gene locus_tag LOCUS_03970 53723 53175 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_03970 53787 54158 gene locus_tag LOCUS_03980 53787 54158 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03980 54204 56369 gene locus_tag LOCUS_03990 54204 56369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 56432 57760 gene locus_tag LOCUS_04000 gene eno 56432 57760 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_04000 58311 57943 gene locus_tag LOCUS_04010 58311 57943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence006 222 1538 gene locus_tag LOCUS_04020 222 1538 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549893.1 protein_id gnl|my_center|LOCUS_04020 1692 2273 gene locus_tag LOCUS_04030 1692 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2337 3410 gene locus_tag LOCUS_04040 gene pheA 2337 3410 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 protein_id gnl|my_center|LOCUS_04040 3413 4642 gene locus_tag LOCUS_04050 3413 4642 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016314.1 protein_id gnl|my_center|LOCUS_04050 5055 4639 gene locus_tag LOCUS_04060 5055 4639 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_04060 5140 8310 gene locus_tag LOCUS_04070 5140 8310 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_04070 8401 9870 gene locus_tag LOCUS_04080 gene malQ 8401 9870 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_04080 9929 10504 gene locus_tag LOCUS_04090 9929 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 10587 12254 gene locus_tag LOCUS_04100 10587 12254 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_04100 12244 13881 gene locus_tag LOCUS_04110 gene cydC 12244 13881 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_04110 13881 14186 gene locus_tag LOCUS_04120 13881 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14326 15621 gene locus_tag LOCUS_04130 14326 15621 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_04130 15634 16491 gene locus_tag LOCUS_04140 15634 16491 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 protein_id gnl|my_center|LOCUS_04140 17486 16563 gene locus_tag LOCUS_04150 17486 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 20025 17527 gene locus_tag LOCUS_04160 20025 17527 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_04160 20090 20707 gene locus_tag LOCUS_04170 20090 20707 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_04170 20719 21309 gene locus_tag LOCUS_04180 20719 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 21398 22009 gene locus_tag LOCUS_04190 21398 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22142 22675 gene locus_tag LOCUS_04200 22142 22675 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_04200 22696 24279 gene locus_tag LOCUS_04210 22696 24279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 24283 25110 gene locus_tag LOCUS_04220 24283 25110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_04220 25113 26999 gene locus_tag LOCUS_04230 25113 26999 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_04230 27148 27567 gene locus_tag LOCUS_04240 27148 27567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 27636 28661 gene locus_tag LOCUS_04250 27636 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 28664 29680 gene locus_tag LOCUS_04260 28664 29680 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_04260 30162 29809 gene locus_tag LOCUS_04270 30162 29809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 31061 30414 gene locus_tag LOCUS_04280 31061 30414 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_04280 32156 31074 gene locus_tag LOCUS_04290 32156 31074 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_04290 32263 32436 gene locus_tag LOCUS_04300 32263 32436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 32553 34406 gene locus_tag LOCUS_04310 32553 34406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 34399 35130 gene locus_tag LOCUS_04320 34399 35130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439430.1 protein_id gnl|my_center|LOCUS_04320 35792 36085 gene locus_tag LOCUS_04330 35792 36085 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_04330 36095 38803 gene locus_tag LOCUS_04340 36095 38803 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04340 38882 39037 gene locus_tag LOCUS_04350 38882 39037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 39578 39703 gene locus_tag LOCUS_04360 39578 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 40689 40303 gene locus_tag LOCUS_04370 gene mutT 40689 40303 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_04370 43552 40694 gene locus_tag LOCUS_04380 43552 40694 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_04380 43635 45152 gene locus_tag LOCUS_04390 43635 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 45242 45472 gene locus_tag LOCUS_04400 45242 45472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 45610 45990 gene locus_tag LOCUS_04410 45610 45990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 48658 45959 gene locus_tag LOCUS_04420 48658 45959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 49126 50658 gene locus_tag LOCUS_04430 49126 50658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 51835 50912 gene locus_tag LOCUS_04440 51835 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 52832 52101 gene locus_tag LOCUS_04450 52832 52101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 54488 52836 gene locus_tag LOCUS_04460 54488 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 55261 54449 gene locus_tag LOCUS_04470 55261 54449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence007 119 3193 gene locus_tag LOCUS_04480 119 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3318 3644 gene locus_tag LOCUS_04490 3318 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04490 3584 4267 gene locus_tag LOCUS_04500 3584 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04500 5533 4298 gene locus_tag LOCUS_04510 5533 4298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_04510 5744 8662 gene locus_tag LOCUS_04520 5744 8662 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_04520 8665 9921 gene locus_tag LOCUS_04530 8665 9921 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_04530 9918 11141 gene locus_tag LOCUS_04540 9918 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 11248 11541 gene locus_tag LOCUS_04550 gene rpsF 11248 11541 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_04550 11558 12076 gene locus_tag LOCUS_04560 gene ssb 11558 12076 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 protein_id gnl|my_center|LOCUS_04560 12094 12324 gene locus_tag LOCUS_04570 gene rpsR 12094 12324 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182979.1 protein_id gnl|my_center|LOCUS_04570 12374 13228 gene locus_tag LOCUS_04580 12374 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 13240 15210 gene locus_tag LOCUS_04590 gene pdeA 13240 15210 CDS product cyclic-di-AMP phosphodiesterase PdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721675.1 protein_id gnl|my_center|LOCUS_04590 15191 15640 gene locus_tag LOCUS_04600 gene rplI 15191 15640 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864305.1 protein_id gnl|my_center|LOCUS_04600 15642 16988 gene locus_tag LOCUS_04610 gene dnaB 15642 16988 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_04610 16978 17718 gene locus_tag LOCUS_04620 16978 17718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989402.1 protein_id gnl|my_center|LOCUS_04620 17852 18472 gene locus_tag LOCUS_04630 gene upp 17852 18472 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_04630 18476 18643 gene locus_tag LOCUS_04640 18476 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 18648 19016 gene locus_tag LOCUS_04650 18648 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 19009 19716 gene locus_tag LOCUS_04660 gene atpB 19009 19716 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_04660 19736 19978 gene locus_tag LOCUS_04670 19736 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 19997 20512 gene locus_tag LOCUS_04680 19997 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20506 21033 gene locus_tag LOCUS_04690 20506 21033 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_04690 21046 22581 gene locus_tag LOCUS_04700 gene atpA 21046 22581 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183010.1 protein_id gnl|my_center|LOCUS_04700 22568 23416 gene locus_tag LOCUS_04710 gene atpG 22568 23416 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183011.1 protein_id gnl|my_center|LOCUS_04710 23429 24829 gene locus_tag LOCUS_04720 gene atpD 23429 24829 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966149.1 protein_id gnl|my_center|LOCUS_04720 24832 25227 gene locus_tag LOCUS_04730 24832 25227 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723461.1 protein_id gnl|my_center|LOCUS_04730 25340 25600 gene locus_tag LOCUS_04740 gene groES 25340 25600 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_04740 25617 27230 gene locus_tag LOCUS_04750 gene groL 25617 27230 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726503.1 protein_id gnl|my_center|LOCUS_04750 27413 28585 gene locus_tag LOCUS_04760 27413 28585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_04760 28639 29517 gene locus_tag LOCUS_04770 28639 29517 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941400.1 protein_id gnl|my_center|LOCUS_04770 29521 30477 gene locus_tag LOCUS_04780 29521 30477 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101995.1 protein_id gnl|my_center|LOCUS_04780 30474 31253 gene locus_tag LOCUS_04790 30474 31253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_04790 31255 31965 gene locus_tag LOCUS_04800 31255 31965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262679.1 protein_id gnl|my_center|LOCUS_04800 31972 32622 gene locus_tag LOCUS_04810 31972 32622 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 protein_id gnl|my_center|LOCUS_04810 33863 32655 gene locus_tag LOCUS_04820 33863 32655 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422058.1 protein_id gnl|my_center|LOCUS_04820 34012 35787 gene locus_tag LOCUS_04830 34012 35787 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 protein_id gnl|my_center|LOCUS_04830 36510 35803 gene locus_tag LOCUS_04840 36510 35803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 36763 40860 gene locus_tag LOCUS_04850 36763 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 40869 44753 gene locus_tag LOCUS_04860 gene rpoC 40869 44753 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_04860 44802 45089 gene locus_tag LOCUS_04870 44802 45089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 46107 45100 gene locus_tag LOCUS_04880 gene asnA 46107 45100 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_04880 46312 46971 gene locus_tag LOCUS_04890 46312 46971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 46968 48326 gene locus_tag LOCUS_04900 46968 48326 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_04900 48338 49279 gene locus_tag LOCUS_04910 48338 49279 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139264482.1 protein_id gnl|my_center|LOCUS_04910 49317 50651 gene locus_tag LOCUS_04920 49317 50651 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_04920 50703 50912 gene locus_tag LOCUS_04930 50703 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 51012 51905 gene locus_tag LOCUS_04940 51012 51905 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_04940 52031 51958 gene locus_tag LOCUS_t00050 52031 51958 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 1124 375 gene locus_tag LOCUS_04950 1124 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1527 1390 gene locus_tag LOCUS_04960 1527 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1631 4528 gene locus_tag LOCUS_04970 1631 4528 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_04970 4682 5104 gene locus_tag LOCUS_04980 4682 5104 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_04980 5892 5389 gene locus_tag LOCUS_04990 5892 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7037 5910 gene locus_tag LOCUS_05000 7037 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 7338 7183 gene locus_tag LOCUS_05010 7338 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 7592 7335 gene locus_tag LOCUS_05020 7592 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 8579 7599 gene locus_tag LOCUS_05030 8579 7599 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_05030 9478 9218 gene locus_tag LOCUS_05040 9478 9218 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_05040 9969 9736 gene locus_tag LOCUS_05050 9969 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10561 10217 gene locus_tag LOCUS_05060 10561 10217 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_05060 11631 10573 gene locus_tag LOCUS_05070 gene trpS 11631 10573 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_05070 12643 11642 gene locus_tag LOCUS_05080 gene galE 12643 11642 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_05080 13101 12691 gene locus_tag LOCUS_05090 13101 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 14951 13173 gene locus_tag LOCUS_05100 14951 13173 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_05100 15670 14972 gene locus_tag LOCUS_05110 15670 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15749 16582 gene locus_tag LOCUS_05120 15749 16582 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_05120 16721 16560 gene locus_tag LOCUS_05130 16721 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 17607 16699 gene locus_tag LOCUS_05140 17607 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 19202 17739 gene locus_tag LOCUS_05150 gene gltX 19202 17739 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_05150 19507 19244 gene locus_tag LOCUS_05160 19507 19244 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_05160 20404 19547 gene locus_tag LOCUS_05170 20404 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 21006 20398 gene locus_tag LOCUS_05180 21006 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22684 21119 gene locus_tag LOCUS_05190 22684 21119 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_05190 24917 22677 gene locus_tag LOCUS_05200 24917 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 25107 25182 gene locus_tag LOCUS_t00060 25107 25182 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26522 25413 gene locus_tag LOCUS_05210 gene ftsZ 26522 25413 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166766.1 protein_id gnl|my_center|LOCUS_05210 27802 26543 gene locus_tag LOCUS_05220 27802 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 28452 27907 gene locus_tag LOCUS_05230 28452 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 29759 28437 gene locus_tag LOCUS_05240 29759 28437 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_05240 31231 29813 gene locus_tag LOCUS_05250 31231 29813 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_05250 33539 31347 gene locus_tag LOCUS_05260 33539 31347 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549356.1 protein_id gnl|my_center|LOCUS_05260 33842 33558 gene locus_tag LOCUS_05270 33842 33558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 34765 33839 gene locus_tag LOCUS_05280 gene rsmH 34765 33839 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905597.1 protein_id gnl|my_center|LOCUS_05280 35203 34772 gene locus_tag LOCUS_05290 gene mraZ 35203 34772 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_05290 35432 36958 gene locus_tag LOCUS_05300 35432 36958 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 protein_id gnl|my_center|LOCUS_05300 37848 37003 gene locus_tag LOCUS_05310 37848 37003 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_05310 38207 38449 gene locus_tag LOCUS_05320 38207 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 39578 38517 gene locus_tag LOCUS_05330 39578 38517 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076036.1 protein_id gnl|my_center|LOCUS_05330 40937 39648 gene locus_tag LOCUS_05340 40937 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 41746 40940 gene locus_tag LOCUS_05350 gene proC 41746 40940 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_05350 43716 41758 gene locus_tag LOCUS_05360 43716 41758 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_05360 44855 43713 gene locus_tag LOCUS_05370 44855 43713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 46422 44911 gene locus_tag LOCUS_05380 46422 44911 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_05380 48576 46468 gene locus_tag LOCUS_05390 gene pulA 48576 46468 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 protein_id gnl|my_center|LOCUS_05390 48678 50051 gene locus_tag LOCUS_05400 gene fumC 48678 50051 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_05400 51449 50070 gene locus_tag LOCUS_05410 gene cls 51449 50070 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_05410 51784 51677 gene locus_tag LOCUS_r00010 51784 51677 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence009 <1 696 gene locus_tag LOCUS_05420 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080009.1:HAD family phosphatase 680 1102 gene locus_tag LOCUS_05430 680 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1099 1560 gene locus_tag LOCUS_05440 1099 1560 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298375.1 protein_id gnl|my_center|LOCUS_05440 1599 2342 gene locus_tag LOCUS_05450 1599 2342 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_05450 2345 3160 gene locus_tag LOCUS_05460 2345 3160 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298371.1 protein_id gnl|my_center|LOCUS_05460 3565 3374 gene locus_tag LOCUS_05470 3565 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4996 4241 gene locus_tag LOCUS_05480 gene frlR 4996 4241 CDS product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 protein_id gnl|my_center|LOCUS_05480 5210 5446 gene locus_tag LOCUS_05490 5210 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6324 5821 gene locus_tag LOCUS_05500 6324 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6664 7374 gene locus_tag LOCUS_05510 gene rgaR 6664 7374 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_05510 7563 8567 gene locus_tag LOCUS_05520 7563 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8680 9924 gene locus_tag LOCUS_05530 gene pepT 8680 9924 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_05530 9982 10067 gene locus_tag LOCUS_t00070 9982 10067 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10078 10153 gene locus_tag LOCUS_t00080 10078 10153 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10246 10965 gene locus_tag LOCUS_05540 10246 10965 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_05540 10980 12092 gene locus_tag LOCUS_05550 10980 12092 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_05550 12154 13533 gene locus_tag LOCUS_05560 gene purF 12154 13533 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_05560 13536 14420 gene locus_tag LOCUS_05570 13536 14420 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_05570 14449 14757 gene locus_tag LOCUS_05580 gene trxA 14449 14757 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453775.1 protein_id gnl|my_center|LOCUS_05580 14794 15204 gene locus_tag LOCUS_05590 14794 15204 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_05590 15258 15842 gene locus_tag LOCUS_05600 15258 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 15832 16731 gene locus_tag LOCUS_05610 15832 16731 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860663.1 protein_id gnl|my_center|LOCUS_05610 17016 17255 gene locus_tag LOCUS_05620 17016 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399633.1 protein_id gnl|my_center|LOCUS_05620 18790 17294 gene locus_tag LOCUS_05630 18790 17294 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_05630 18899 19399 gene locus_tag LOCUS_05640 18899 19399 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_05640 19386 19895 gene locus_tag LOCUS_05650 19386 19895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_05650 19956 20987 gene locus_tag LOCUS_05660 19956 20987 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_05660 21082 24279 gene locus_tag LOCUS_05670 21082 24279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 25812 24511 gene locus_tag LOCUS_05680 25812 24511 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_05680 27832 25961 gene locus_tag LOCUS_05690 gene ftsH 27832 25961 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_05690 28789 27953 gene locus_tag LOCUS_05700 28789 27953 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723338.1 protein_id gnl|my_center|LOCUS_05700 30220 28808 gene locus_tag LOCUS_05710 30220 28808 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_05710 32063 30231 gene locus_tag LOCUS_05720 32063 30231 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_05720 32313 33332 gene locus_tag LOCUS_05730 32313 33332 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567947.1 protein_id gnl|my_center|LOCUS_05730 33419 33607 gene locus_tag LOCUS_05740 33419 33607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 33950 33627 gene locus_tag LOCUS_05750 33950 33627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 34899 33955 gene locus_tag LOCUS_05760 34899 33955 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_05760 35754 34969 gene locus_tag LOCUS_05770 35754 34969 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_05770 35919 36116 gene locus_tag LOCUS_05780 35919 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 37288 36140 gene locus_tag LOCUS_05790 37288 36140 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_05790 38320 37298 gene locus_tag LOCUS_05800 gene iolC 38320 37298 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_05800 39056 38433 gene locus_tag LOCUS_05810 39056 38433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 39192 39950 gene locus_tag LOCUS_05820 gene iolR 39192 39950 CDS product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 protein_id gnl|my_center|LOCUS_05820 40094 42067 gene locus_tag LOCUS_05830 gene manR 40094 42067 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_05830 42083 42628 gene locus_tag LOCUS_05840 42083 42628 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989459.1 protein_id gnl|my_center|LOCUS_05840 42737 43051 gene locus_tag LOCUS_05850 42737 43051 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_05850 43079 44188 gene locus_tag LOCUS_05860 43079 44188 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662199.1 protein_id gnl|my_center|LOCUS_05860 44220 45104 gene locus_tag LOCUS_05870 44220 45104 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989903.1 protein_id gnl|my_center|LOCUS_05870 45159 45917 gene locus_tag LOCUS_05880 gene kduD 45159 45917 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209883.1 protein_id gnl|my_center|LOCUS_05880 45936 46580 gene locus_tag LOCUS_05890 45936 46580 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 protein_id gnl|my_center|LOCUS_05890 46604 47671 gene locus_tag LOCUS_05900 46604 47671 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_05900 47676 48335 gene locus_tag LOCUS_05910 47676 48335 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_05910 48325 49632 gene locus_tag LOCUS_05920 48325 49632 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861696.1 protein_id gnl|my_center|LOCUS_05920 49643 50461 gene locus_tag LOCUS_05930 49643 50461 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_05930 51160 50507 gene locus_tag LOCUS_05940 51160 50507 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence010 452 2005 gene locus_tag LOCUS_05950 gene rny 452 2005 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099773.1 protein_id gnl|my_center|LOCUS_05950 2149 2322 gene locus_tag LOCUS_05960 2149 2322 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_05960 2384 3817 gene locus_tag LOCUS_05970 gene miaB 2384 3817 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439565.1 protein_id gnl|my_center|LOCUS_05970 3857 5548 gene locus_tag LOCUS_05980 3857 5548 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 protein_id gnl|my_center|LOCUS_05980 5563 7905 gene locus_tag LOCUS_05990 gene spoIIIE 5563 7905 CDS product DNA translocase SpoIIIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245350.1 protein_id gnl|my_center|LOCUS_05990 7931 8359 gene locus_tag LOCUS_06000 7931 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 9460 8846 gene locus_tag LOCUS_06010 gene plsY 9460 8846 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258978.1 protein_id gnl|my_center|LOCUS_06010 9857 11782 gene locus_tag LOCUS_06020 gene parE 9857 11782 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 protein_id gnl|my_center|LOCUS_06020 11779 14262 gene locus_tag LOCUS_06030 gene parC 11779 14262 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989723.1 protein_id gnl|my_center|LOCUS_06030 14259 15152 gene locus_tag LOCUS_06040 14259 15152 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_06040 15173 15385 gene locus_tag LOCUS_06050 15173 15385 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183245.1 protein_id gnl|my_center|LOCUS_06050 15494 17569 gene locus_tag LOCUS_06060 15494 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 18108 18386 gene locus_tag LOCUS_06070 18108 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 18513 19952 gene locus_tag LOCUS_06080 18513 19952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20064 20840 gene locus_tag LOCUS_06090 20064 20840 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_06090 20863 22260 gene locus_tag LOCUS_06100 gene nhaC 20863 22260 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461270.1 protein_id gnl|my_center|LOCUS_06100 22517 23857 gene locus_tag LOCUS_06110 gene thiC 22517 23857 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_06110 24047 24697 gene locus_tag LOCUS_06120 24047 24697 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641710.1 protein_id gnl|my_center|LOCUS_06120 26334 24709 gene locus_tag LOCUS_06130 26334 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 27672 26344 gene locus_tag LOCUS_06140 27672 26344 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_06140 27850 28470 gene locus_tag LOCUS_06150 27850 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 28498 29241 gene locus_tag LOCUS_06160 28498 29241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 29276 29623 gene locus_tag LOCUS_06170 29276 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 29685 30515 gene locus_tag LOCUS_06180 29685 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 30508 31155 gene locus_tag LOCUS_06190 30508 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 31158 31805 gene locus_tag LOCUS_06200 31158 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 31798 32409 gene locus_tag LOCUS_06210 31798 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 32419 33093 gene locus_tag LOCUS_06220 32419 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 33095 34255 gene locus_tag LOCUS_06230 33095 34255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 34273 34887 gene locus_tag LOCUS_06240 34273 34887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 34897 35373 gene locus_tag LOCUS_06250 34897 35373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 35383 36729 gene locus_tag LOCUS_06260 35383 36729 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06260 36742 37827 gene locus_tag LOCUS_06270 36742 37827 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_06270 37838 39082 gene locus_tag LOCUS_06280 37838 39082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 39092 39328 gene locus_tag LOCUS_06290 39092 39328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 39429 42635 gene locus_tag LOCUS_06300 39429 42635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 42741 43466 gene locus_tag LOCUS_06310 42741 43466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 43688 43614 gene locus_tag LOCUS_t00090 43688 43614 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 43823 45103 gene locus_tag LOCUS_06320 43823 45103 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_06320 45145 45975 gene locus_tag LOCUS_06330 45145 45975 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence011 204 1007 gene locus_tag LOCUS_06340 204 1007 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_06340 1027 1659 gene locus_tag LOCUS_06350 gene dhuI 1027 1659 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase DhuI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684791.1 protein_id gnl|my_center|LOCUS_06350 2516 1785 gene locus_tag LOCUS_06360 2516 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2631 4007 gene locus_tag LOCUS_06370 2631 4007 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_06370 4027 4872 gene locus_tag LOCUS_06380 gene nudC 4027 4872 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_06380 4962 5519 gene locus_tag LOCUS_06390 gene efp 4962 5519 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_06390 5540 6286 gene locus_tag LOCUS_06400 gene fabG 5540 6286 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_06400 7678 6425 gene locus_tag LOCUS_06410 7678 6425 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965138.1 protein_id gnl|my_center|LOCUS_06410 7767 8711 gene locus_tag LOCUS_06420 gene manA 7767 8711 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294309.1 protein_id gnl|my_center|LOCUS_06420 10890 8851 gene locus_tag LOCUS_06430 10890 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11588 10887 gene locus_tag LOCUS_06440 11588 10887 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_06440 12238 11657 gene locus_tag LOCUS_06450 12238 11657 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563965.1 protein_id gnl|my_center|LOCUS_06450 13795 12470 gene locus_tag LOCUS_06460 13795 12470 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_06460 13869 15005 gene locus_tag LOCUS_06470 13869 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 15103 16557 gene locus_tag LOCUS_06480 15103 16557 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_06480 17990 16812 gene locus_tag LOCUS_06490 17990 16812 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_06490 18068 19201 gene locus_tag LOCUS_06500 18068 19201 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_06500 19725 19210 gene locus_tag LOCUS_06510 19725 19210 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_06510 20932 19748 gene locus_tag LOCUS_06520 20932 19748 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_06520 20999 21430 gene locus_tag LOCUS_06530 20999 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 21497 22762 gene locus_tag LOCUS_06540 21497 22762 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_06540 22759 23091 gene locus_tag LOCUS_06550 22759 23091 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_06550 23627 23088 gene locus_tag LOCUS_06560 23627 23088 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_06560 23717 24661 gene locus_tag LOCUS_06570 gene moaA 23717 24661 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461492.1 protein_id gnl|my_center|LOCUS_06570 24663 25139 gene locus_tag LOCUS_06580 gene moaC 24663 25139 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_06580 25127 26062 gene locus_tag LOCUS_06590 25127 26062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 26043 26738 gene locus_tag LOCUS_06600 gene modB 26043 26738 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 protein_id gnl|my_center|LOCUS_06600 26739 27371 gene locus_tag LOCUS_06610 26739 27371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 27368 28144 gene locus_tag LOCUS_06620 gene modA 27368 28144 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382290.1 protein_id gnl|my_center|LOCUS_06620 28146 29159 gene locus_tag LOCUS_06630 28146 29159 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_06630 29156 29488 gene locus_tag LOCUS_06640 29156 29488 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_06640 29481 29702 gene locus_tag LOCUS_06650 29481 29702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 29702 30730 gene locus_tag LOCUS_06660 gene selD 29702 30730 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_06660 30727 31320 gene locus_tag LOCUS_06670 gene yedF 30727 31320 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_06670 31326 32117 gene locus_tag LOCUS_06680 gene yqeB 31326 32117 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_06680 32104 33195 gene locus_tag LOCUS_06690 32104 33195 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_06690 33185 34552 gene locus_tag LOCUS_06700 33185 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 34567 35358 gene locus_tag LOCUS_06710 34567 35358 CDS product D-Ala-D-Ala carboxypeptidase VanY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948708.1 protein_id gnl|my_center|LOCUS_06710 35437 35937 gene locus_tag LOCUS_06720 35437 35937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 35990 36991 gene locus_tag LOCUS_06730 35990 36991 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027790.1 protein_id gnl|my_center|LOCUS_06730 36997 37767 gene locus_tag LOCUS_06740 36997 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 37764 38309 gene locus_tag LOCUS_06750 37764 38309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 38310 38927 gene locus_tag LOCUS_06760 38310 38927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 38920 40194 gene locus_tag LOCUS_06770 38920 40194 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_06770 41197 40166 gene locus_tag LOCUS_06780 41197 40166 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_06780 41395 42825 gene locus_tag LOCUS_06790 41395 42825 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_06790 42818 44080 gene locus_tag LOCUS_06800 42818 44080 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_06800 44080 44424 gene locus_tag LOCUS_06810 44080 44424 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_06810 44577 45167 gene locus_tag LOCUS_06820 44577 45167 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_06820 45210 45932 gene locus_tag LOCUS_06830 gene thiD 45210 45932 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence012 2647 293 gene locus_tag LOCUS_06840 2647 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4321 2825 gene locus_tag LOCUS_06850 4321 2825 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_06850 5042 4311 gene locus_tag LOCUS_06860 5042 4311 CDS product CTP--phosphocholine cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860673.1 protein_id gnl|my_center|LOCUS_06860 6790 5030 gene locus_tag LOCUS_06870 6790 5030 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_06870 10562 6963 gene locus_tag LOCUS_06880 10562 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10744 10511 gene locus_tag LOCUS_06890 10744 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12370 10952 gene locus_tag LOCUS_06900 12370 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 14368 12566 gene locus_tag LOCUS_06910 14368 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06910 15766 14390 gene locus_tag LOCUS_06920 15766 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06920 19688 15801 gene locus_tag LOCUS_06930 19688 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 23086 19853 gene locus_tag LOCUS_06940 23086 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 29421 23215 gene locus_tag LOCUS_06950 29421 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 30691 29477 gene locus_tag LOCUS_06960 30691 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 32149 30707 gene locus_tag LOCUS_06970 32149 30707 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644570.1 protein_id gnl|my_center|LOCUS_06970 32664 32161 gene locus_tag LOCUS_06980 32664 32161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 33808 32588 gene locus_tag LOCUS_06990 33808 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34520 33801 gene locus_tag LOCUS_07000 34520 33801 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_07000 35116 34535 gene locus_tag LOCUS_07010 35116 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 36210 35113 gene locus_tag LOCUS_07020 36210 35113 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_07020 36949 36212 gene locus_tag LOCUS_07030 36949 36212 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_07030 37611 36946 gene locus_tag LOCUS_07040 37611 36946 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_07040 38852 37605 gene locus_tag LOCUS_07050 38852 37605 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_07050 39859 38852 gene locus_tag LOCUS_07060 39859 38852 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence013 767 111 gene locus_tag LOCUS_07070 767 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1240 830 gene locus_tag LOCUS_07080 1240 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1888 1355 gene locus_tag LOCUS_07090 1888 1355 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143027.1 protein_id gnl|my_center|LOCUS_07090 2778 2014 gene locus_tag LOCUS_07100 2778 2014 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263353.1 protein_id gnl|my_center|LOCUS_07100 3564 2788 gene locus_tag LOCUS_07110 3564 2788 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721723.1 protein_id gnl|my_center|LOCUS_07110 3870 3574 gene locus_tag LOCUS_07120 3870 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4078 3902 gene locus_tag LOCUS_07130 4078 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4286 5413 gene locus_tag LOCUS_07140 4286 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5652 5470 gene locus_tag LOCUS_07150 5652 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7589 5652 gene locus_tag LOCUS_07160 gene metG 7589 5652 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_07160 9424 7868 gene locus_tag LOCUS_07170 9424 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11004 9445 gene locus_tag LOCUS_07180 11004 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12168 11032 gene locus_tag LOCUS_07190 gene dxr 12168 11032 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_07190 12244 12882 gene locus_tag LOCUS_07200 12244 12882 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862987.1 protein_id gnl|my_center|LOCUS_07200 13724 12891 gene locus_tag LOCUS_07210 13724 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 16460 14046 gene locus_tag LOCUS_07220 gene glgP 16460 14046 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_07220 17039 16521 gene locus_tag LOCUS_07230 17039 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 17990 17196 gene locus_tag LOCUS_07240 17990 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 18662 18024 gene locus_tag LOCUS_07250 18662 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 20158 18737 gene locus_tag LOCUS_07260 gene gatB 20158 18737 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_07260 21534 20161 gene locus_tag LOCUS_07270 gene gatA 21534 20161 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 protein_id gnl|my_center|LOCUS_07270 21829 21536 gene locus_tag LOCUS_07280 gene gatC 21829 21536 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 protein_id gnl|my_center|LOCUS_07280 22909 21839 gene locus_tag LOCUS_07290 22909 21839 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722234.1 protein_id gnl|my_center|LOCUS_07290 24899 22896 gene locus_tag LOCUS_07300 gene ligA 24899 22896 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989804.1 protein_id gnl|my_center|LOCUS_07300 27077 24900 gene locus_tag LOCUS_07310 gene pcrA 27077 24900 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_07310 28483 27302 gene locus_tag LOCUS_07320 28483 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 28571 29443 gene locus_tag LOCUS_07330 28571 29443 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_07330 30214 29489 gene locus_tag LOCUS_07340 30214 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30274 30933 gene locus_tag LOCUS_07350 30274 30933 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 protein_id gnl|my_center|LOCUS_07350 31407 31129 gene locus_tag LOCUS_07360 31407 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 33035 31455 gene locus_tag LOCUS_07370 33035 31455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_07370 34462 33113 gene locus_tag LOCUS_07380 34462 33113 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_07380 35117 34449 gene locus_tag LOCUS_07390 35117 34449 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_07390 35831 35172 gene locus_tag LOCUS_07400 35831 35172 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_07400 <36849 35815 gene locus_tag LOCUS_07410 <36849 35815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721658.1:SIS domain-containing protein >Feature sequence014 1039 704 gene locus_tag LOCUS_07420 gene rplV 1039 704 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701308.1 protein_id gnl|my_center|LOCUS_07420 1329 1054 gene locus_tag LOCUS_07430 gene rpsS 1329 1054 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 protein_id gnl|my_center|LOCUS_07430 2181 1348 gene locus_tag LOCUS_07440 gene rplB 2181 1348 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_07440 2533 2240 gene locus_tag LOCUS_07450 gene rplW 2533 2240 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_07450 3162 2533 gene locus_tag LOCUS_07460 gene rplD 3162 2533 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829775.1 protein_id gnl|my_center|LOCUS_07460 3854 3162 gene locus_tag LOCUS_07470 gene rplC 3854 3162 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160207.1 protein_id gnl|my_center|LOCUS_07470 4180 3869 gene locus_tag LOCUS_07480 gene rpsJ 4180 3869 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040596.1 protein_id gnl|my_center|LOCUS_07480 5390 4515 gene locus_tag LOCUS_07490 5390 4515 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_07490 5539 5384 gene locus_tag LOCUS_07500 5539 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6518 5724 gene locus_tag LOCUS_07510 6518 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7402 6515 gene locus_tag LOCUS_07520 7402 6515 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_07520 8678 7539 gene locus_tag LOCUS_07530 8678 7539 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_07530 8816 9580 gene locus_tag LOCUS_07540 8816 9580 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_07540 9905 9603 gene locus_tag LOCUS_07550 9905 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10584 9898 gene locus_tag LOCUS_07560 10584 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10668 11576 gene locus_tag LOCUS_07570 10668 11576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_07570 11931 13271 gene locus_tag LOCUS_07580 gene mgtE 11931 13271 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_07580 14328 13357 gene locus_tag LOCUS_07590 gene pta 14328 13357 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067215.1 protein_id gnl|my_center|LOCUS_07590 14574 16289 gene locus_tag LOCUS_07600 14574 16289 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730661.1 protein_id gnl|my_center|LOCUS_07600 16510 17061 gene locus_tag LOCUS_07610 16510 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 17693 17076 gene locus_tag LOCUS_07620 17693 17076 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_07620 18183 17752 gene locus_tag LOCUS_07630 18183 17752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19395 18235 gene locus_tag LOCUS_07640 19395 18235 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_07640 19432 20091 gene locus_tag LOCUS_07650 19432 20091 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_07650 21377 20106 gene locus_tag LOCUS_07660 21377 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 25357 21374 gene locus_tag LOCUS_07670 25357 21374 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_07670 26477 25344 gene locus_tag LOCUS_07680 26477 25344 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_07680 27958 26486 gene locus_tag LOCUS_07690 27958 26486 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_07690 28879 28022 gene locus_tag LOCUS_07700 28879 28022 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762183.1 protein_id gnl|my_center|LOCUS_07700 29742 28882 gene locus_tag LOCUS_07710 29742 28882 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382324.1 protein_id gnl|my_center|LOCUS_07710 29834 30538 gene locus_tag LOCUS_07720 29834 30538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_07720 30540 33797 gene locus_tag LOCUS_07730 30540 33797 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_07730 35260 33848 gene locus_tag LOCUS_07740 gene pyk 35260 33848 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714110.1 protein_id gnl|my_center|LOCUS_07740 36249 35287 gene locus_tag LOCUS_07750 gene pfkA 36249 35287 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591796.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence015 346 1011 gene locus_tag LOCUS_07760 346 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1106 1414 gene locus_tag LOCUS_07770 1106 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2217 1435 gene locus_tag LOCUS_07780 2217 1435 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_07780 2282 2944 gene locus_tag LOCUS_07790 2282 2944 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_07790 4299 2971 gene locus_tag LOCUS_07800 4299 2971 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902205.1 protein_id gnl|my_center|LOCUS_07800 7463 4356 gene locus_tag LOCUS_07810 7463 4356 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020226099.1 protein_id gnl|my_center|LOCUS_07810 10015 7466 gene locus_tag LOCUS_07820 10015 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10119 11480 gene locus_tag LOCUS_07830 10119 11480 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_07830 11625 13229 gene locus_tag LOCUS_07840 11625 13229 CDS product IS1182-like element ISFnu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016343.1 protein_id gnl|my_center|LOCUS_07840 14639 13269 gene locus_tag LOCUS_07850 14639 13269 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_07850 14827 15711 gene locus_tag LOCUS_07860 14827 15711 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354953.1 protein_id gnl|my_center|LOCUS_07860 15695 16219 gene locus_tag LOCUS_07870 gene rnmV 15695 16219 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_07870 16216 17085 gene locus_tag LOCUS_07880 gene rsmA 16216 17085 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_07880 17057 17890 gene locus_tag LOCUS_07890 gene ispE 17057 17890 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_07890 17892 18098 gene locus_tag LOCUS_07900 17892 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 18085 19023 gene locus_tag LOCUS_07910 18085 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19020 20087 gene locus_tag LOCUS_07920 19020 20087 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_07920 20137 20685 gene locus_tag LOCUS_07930 20137 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 20735 21877 gene locus_tag LOCUS_07940 gene tilS 20735 21877 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166253.1 protein_id gnl|my_center|LOCUS_07940 21924 22466 gene locus_tag LOCUS_07950 gene hpt 21924 22466 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_07950 22477 24432 gene locus_tag LOCUS_07960 gene ftsH 22477 24432 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_07960 24534 25418 gene locus_tag LOCUS_07970 gene hslO 24534 25418 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_07970 25411 26376 gene locus_tag LOCUS_07980 gene dusB 25411 26376 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_07980 26480 28306 gene locus_tag LOCUS_07990 gene glgB 26480 28306 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 protein_id gnl|my_center|LOCUS_07990 28383 28754 gene locus_tag LOCUS_08000 28383 28754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 28804 29652 gene locus_tag LOCUS_08010 28804 29652 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_08010 29652 30566 gene locus_tag LOCUS_08020 29652 30566 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_08020 30568 31158 gene locus_tag LOCUS_08030 30568 31158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_08030 32009 31155 gene locus_tag LOCUS_08040 32009 31155 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_08040 32183 33259 gene locus_tag LOCUS_08050 gene uxuA 32183 33259 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_08050 33262 34878 gene locus_tag LOCUS_08060 33262 34878 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_08060 34891 35532 gene locus_tag LOCUS_08070 34891 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence016 2378 180 gene locus_tag LOCUS_08080 2378 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4036 2708 gene locus_tag LOCUS_08090 4036 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 5945 4044 gene locus_tag LOCUS_08100 5945 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08100 7683 6139 gene locus_tag LOCUS_08110 7683 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 10057 7718 gene locus_tag LOCUS_08120 10057 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 11224 10064 gene locus_tag LOCUS_08130 11224 10064 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428969.1 protein_id gnl|my_center|LOCUS_08130 12092 11214 gene locus_tag LOCUS_08140 12092 11214 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_08140 13350 12085 gene locus_tag LOCUS_08150 13350 12085 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895005.1 protein_id gnl|my_center|LOCUS_08150 13693 13343 gene locus_tag LOCUS_08160 13693 13343 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120772943.1 protein_id gnl|my_center|LOCUS_08160 14413 13697 gene locus_tag LOCUS_08170 14413 13697 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027228.1 protein_id gnl|my_center|LOCUS_08170 16476 14488 gene locus_tag LOCUS_08180 16476 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 17391 16480 gene locus_tag LOCUS_08190 gene rfbD 17391 16480 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836759.1 protein_id gnl|my_center|LOCUS_08190 18465 17431 gene locus_tag LOCUS_08200 gene rfbB 18465 17431 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_08200 19042 18470 gene locus_tag LOCUS_08210 gene rfbC 19042 18470 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286442.1 protein_id gnl|my_center|LOCUS_08210 19936 19058 gene locus_tag LOCUS_08220 gene rfbA 19936 19058 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_08220 20064 21551 gene locus_tag LOCUS_08230 20064 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 22690 21545 gene locus_tag LOCUS_08240 22690 21545 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_08240 25174 22694 gene locus_tag LOCUS_08250 25174 22694 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_08250 26044 25262 gene locus_tag LOCUS_08260 26044 25262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_08260 27185 26055 gene locus_tag LOCUS_08270 27185 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 28907 27273 gene locus_tag LOCUS_08280 gene cps4A 28907 27273 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_08280 29857 28904 gene locus_tag LOCUS_08290 29857 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 30551 30030 gene locus_tag LOCUS_08300 30551 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 31374 30544 gene locus_tag LOCUS_08310 31374 30544 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875981.1 protein_id gnl|my_center|LOCUS_08310 32072 31362 gene locus_tag LOCUS_08320 32072 31362 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_08320 32898 32074 gene locus_tag LOCUS_08330 32898 32074 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_08330 33904 32903 gene locus_tag LOCUS_08340 33904 32903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261029.1 protein_id gnl|my_center|LOCUS_08340 34908 33904 gene locus_tag LOCUS_08350 34908 33904 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679067.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence017 1609 446 gene locus_tag LOCUS_08360 1609 446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244232.1 protein_id gnl|my_center|LOCUS_08360 1998 3227 gene locus_tag LOCUS_08370 1998 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3604 3897 gene locus_tag LOCUS_08380 3604 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4137 4577 gene locus_tag LOCUS_08390 4137 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5275 4955 gene locus_tag LOCUS_08400 5275 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5434 5793 gene locus_tag LOCUS_08410 5434 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6105 7001 gene locus_tag LOCUS_08420 6105 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7128 6979 gene locus_tag LOCUS_08430 7128 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8761 7214 gene locus_tag LOCUS_08440 gene guaA 8761 7214 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_08440 10308 8809 gene locus_tag LOCUS_08450 10308 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11431 10310 gene locus_tag LOCUS_08460 11431 10310 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_08460 12440 11484 gene locus_tag LOCUS_08470 12440 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13451 12450 gene locus_tag LOCUS_08480 gene tsaD 13451 12450 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_08480 13895 13461 gene locus_tag LOCUS_08490 gene rimI 13895 13461 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_08490 14485 13892 gene locus_tag LOCUS_08500 gene tsaB 14485 13892 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183392.1 protein_id gnl|my_center|LOCUS_08500 14930 14478 gene locus_tag LOCUS_08510 gene tsaE 14930 14478 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 protein_id gnl|my_center|LOCUS_08510 16325 14982 gene locus_tag LOCUS_08520 16325 14982 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_08520 17734 16382 gene locus_tag LOCUS_08530 17734 16382 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_08530 18476 17910 gene locus_tag LOCUS_08540 18476 17910 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_08540 19523 18864 gene locus_tag LOCUS_08550 gene pyrE 19523 18864 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_08550 19636 20052 gene locus_tag LOCUS_08560 19636 20052 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_08560 20205 21395 gene locus_tag LOCUS_08570 20205 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 21364 21936 gene locus_tag LOCUS_08580 gene xpt 21364 21936 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421410.1 protein_id gnl|my_center|LOCUS_08580 21966 23714 gene locus_tag LOCUS_08590 21966 23714 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_08590 25046 23733 gene locus_tag LOCUS_08600 25046 23733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_08600 26653 25247 gene locus_tag LOCUS_08610 gene uxaC 26653 25247 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_08610 27980 26670 gene locus_tag LOCUS_08620 27980 26670 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_08620 28456 27983 gene locus_tag LOCUS_08630 28456 27983 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 protein_id gnl|my_center|LOCUS_08630 29483 28458 gene locus_tag LOCUS_08640 29483 28458 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358408.1 protein_id gnl|my_center|LOCUS_08640 30496 29501 gene locus_tag LOCUS_08650 gene ccpA 30496 29501 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727369.1 protein_id gnl|my_center|LOCUS_08650 30785 32269 gene locus_tag LOCUS_08660 30785 32269 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_08660 32232 33782 gene locus_tag LOCUS_08670 32232 33782 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_08670 33796 34431 gene locus_tag LOCUS_08680 33796 34431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence018 541 951 gene locus_tag LOCUS_08690 541 951 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_08690 1266 976 gene locus_tag LOCUS_08700 1266 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3242 1335 gene locus_tag LOCUS_08710 gene htpG 3242 1335 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_08710 4199 3393 gene locus_tag LOCUS_08720 4199 3393 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 protein_id gnl|my_center|LOCUS_08720 4956 4435 gene locus_tag LOCUS_08730 4956 4435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_08730 5618 4986 gene locus_tag LOCUS_08740 5618 4986 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_08740 6101 5763 gene locus_tag LOCUS_08750 6101 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6587 6147 gene locus_tag LOCUS_08760 6587 6147 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_08760 7040 6615 gene locus_tag LOCUS_08770 7040 6615 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_08770 7428 7117 gene locus_tag LOCUS_08780 7428 7117 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901606.1 protein_id gnl|my_center|LOCUS_08780 8326 7430 gene locus_tag LOCUS_08790 8326 7430 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_08790 8907 8323 gene locus_tag LOCUS_08800 8907 8323 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930501.1 protein_id gnl|my_center|LOCUS_08800 9052 9726 gene locus_tag LOCUS_08810 gene deoC 9052 9726 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_08810 9728 10645 gene locus_tag LOCUS_08820 9728 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10649 11521 gene locus_tag LOCUS_08830 gene rfbD 10649 11521 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_08830 11544 11960 gene locus_tag LOCUS_08840 11544 11960 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890718.1 protein_id gnl|my_center|LOCUS_08840 13134 11977 gene locus_tag LOCUS_08850 gene hflX 13134 11977 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391877.1 protein_id gnl|my_center|LOCUS_08850 13260 14135 gene locus_tag LOCUS_08860 13260 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14123 14617 gene locus_tag LOCUS_08870 14123 14617 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386618.1 protein_id gnl|my_center|LOCUS_08870 15650 14649 gene locus_tag LOCUS_08880 gene galE 15650 14649 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_08880 16930 15650 gene locus_tag LOCUS_08890 gene galK 16930 15650 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_08890 17940 16927 gene locus_tag LOCUS_08900 17940 16927 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_08900 19397 17934 gene locus_tag LOCUS_08910 gene galT 19397 17934 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_08910 20368 19718 gene locus_tag LOCUS_08920 20368 19718 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_08920 20607 21362 gene locus_tag LOCUS_08930 20607 21362 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 protein_id gnl|my_center|LOCUS_08930 22685 21387 gene locus_tag LOCUS_08940 22685 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 23942 22713 gene locus_tag LOCUS_08950 23942 22713 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_08950 24196 24002 gene locus_tag LOCUS_08960 24196 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 26342 24216 gene locus_tag LOCUS_08970 gene feoB 26342 24216 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_08970 26583 26365 gene locus_tag LOCUS_08980 26583 26365 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08980 26805 26596 gene locus_tag LOCUS_08990 26805 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 26950 27309 gene locus_tag LOCUS_09000 26950 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 27837 27325 gene locus_tag LOCUS_09010 27837 27325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 29998 27896 gene locus_tag LOCUS_09020 29998 27896 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_09020 30229 30005 gene locus_tag LOCUS_09030 30229 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 30905 30546 gene locus_tag LOCUS_09040 gene rplT 30905 30546 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_09040 31118 30924 gene locus_tag LOCUS_09050 gene rpmI 31118 30924 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027223.1 protein_id gnl|my_center|LOCUS_09050 31683 31132 gene locus_tag LOCUS_09060 gene infC 31683 31132 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031267356.1 protein_id gnl|my_center|LOCUS_09060 31986 31911 gene locus_tag LOCUS_t00100 31986 31911 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33931 32069 gene locus_tag LOCUS_09070 33931 32069 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830004.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence019 1389 97 gene locus_tag LOCUS_09080 gene asnB 1389 97 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_09080 3525 1435 gene locus_tag LOCUS_09090 3525 1435 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_09090 3713 4882 gene locus_tag LOCUS_09100 gene glnA 3713 4882 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_09100 4889 5437 gene locus_tag LOCUS_09110 4889 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5434 5919 gene locus_tag LOCUS_09120 gene ybaK 5434 5919 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_09120 5926 7227 gene locus_tag LOCUS_09130 5926 7227 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_09130 8774 7224 gene locus_tag LOCUS_09140 8774 7224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_09140 8849 10573 gene locus_tag LOCUS_09150 8849 10573 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_09150 10570 10854 gene locus_tag LOCUS_09160 10570 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 10870 11121 gene locus_tag LOCUS_09170 10870 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 11274 14030 gene locus_tag LOCUS_09180 11274 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 14231 14545 gene locus_tag LOCUS_09190 14231 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 14662 15807 gene locus_tag LOCUS_09200 14662 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 15890 17755 gene locus_tag LOCUS_09210 15890 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 17876 18238 gene locus_tag LOCUS_09220 17876 18238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18358 18594 gene locus_tag LOCUS_09230 18358 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 18649 18867 gene locus_tag LOCUS_09240 18649 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 18861 19184 gene locus_tag LOCUS_09250 18861 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 19174 19398 gene locus_tag LOCUS_09260 19174 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 19502 20647 gene locus_tag LOCUS_09270 19502 20647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082538.1 protein_id gnl|my_center|LOCUS_09270 20791 21174 gene locus_tag LOCUS_09280 20791 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 21198 22067 gene locus_tag LOCUS_09290 21198 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 22108 24018 gene locus_tag LOCUS_09300 22108 24018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_09300 24037 25959 gene locus_tag LOCUS_09310 24037 25959 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679307.1 protein_id gnl|my_center|LOCUS_09310 27035 26292 gene locus_tag LOCUS_09320 27035 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 28112 27210 gene locus_tag LOCUS_09330 28112 27210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031057.1 protein_id gnl|my_center|LOCUS_09330 28335 29300 gene locus_tag LOCUS_09340 28335 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 29378 30412 gene locus_tag LOCUS_09350 29378 30412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 30420 31262 gene locus_tag LOCUS_09360 30420 31262 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 protein_id gnl|my_center|LOCUS_09360 31550 31702 gene locus_tag LOCUS_09370 31550 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 31818 33854 gene locus_tag LOCUS_09380 31818 33854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence020 913 260 gene locus_tag LOCUS_09390 913 260 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_09390 2136 913 gene locus_tag LOCUS_09400 gene rpoD 2136 913 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_09400 3910 2141 gene locus_tag LOCUS_09410 gene dnaG 3910 2141 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_09410 5289 3910 gene locus_tag LOCUS_09420 5289 3910 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_09420 5792 5481 gene locus_tag LOCUS_09430 5792 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6608 5886 gene locus_tag LOCUS_09440 gene recO 6608 5886 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_09440 7506 6598 gene locus_tag LOCUS_09450 gene era 7506 6598 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_09450 7866 7519 gene locus_tag LOCUS_09460 gene dagK 7866 7519 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365219.1 protein_id gnl|my_center|LOCUS_09460 8302 7847 gene locus_tag LOCUS_09470 gene ybeY 8302 7847 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 protein_id gnl|my_center|LOCUS_09470 9613 8606 gene locus_tag LOCUS_09480 gene ccpA 9613 8606 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 protein_id gnl|my_center|LOCUS_09480 10149 9616 gene locus_tag LOCUS_09490 10149 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 10501 10151 gene locus_tag LOCUS_09500 10501 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 11187 10765 gene locus_tag LOCUS_09510 11187 10765 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476020.1 protein_id gnl|my_center|LOCUS_09510 12639 11332 gene locus_tag LOCUS_09520 gene murC 12639 11332 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101415.1 protein_id gnl|my_center|LOCUS_09520 13309 12641 gene locus_tag LOCUS_09530 13309 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13641 13303 gene locus_tag LOCUS_09540 13641 13303 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_09540 14275 13634 gene locus_tag LOCUS_09550 gene trmB 14275 13634 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_09550 15665 14277 gene locus_tag LOCUS_09560 gene pepV 15665 14277 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 protein_id gnl|my_center|LOCUS_09560 17881 15740 gene locus_tag LOCUS_09570 gene pnp 17881 15740 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_09570 18215 17949 gene locus_tag LOCUS_09580 gene rpsO 18215 17949 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_09580 19383 18304 gene locus_tag LOCUS_09590 gene hemW 19383 18304 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922247.1 protein_id gnl|my_center|LOCUS_09590 21185 19383 gene locus_tag LOCUS_09600 gene lepA 21185 19383 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_09600 22125 21196 gene locus_tag LOCUS_09610 gene fmt 22125 21196 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701719.1 protein_id gnl|my_center|LOCUS_09610 22236 22499 gene locus_tag LOCUS_09620 gene rpsT 22236 22499 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812925.1 protein_id gnl|my_center|LOCUS_09620 24447 23506 gene locus_tag LOCUS_09630 gene holA 24447 23506 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_09630 25070 24444 gene locus_tag LOCUS_09640 25070 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 26665 26288 gene locus_tag LOCUS_09650 26665 26288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 27294 26806 gene locus_tag LOCUS_09660 gene greA 27294 26806 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_09660 28452 27361 gene locus_tag LOCUS_09670 gene mltG 28452 27361 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722008.1 protein_id gnl|my_center|LOCUS_09670 28699 28442 gene locus_tag LOCUS_09680 28699 28442 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 protein_id gnl|my_center|LOCUS_09680 29159 28734 gene locus_tag LOCUS_09690 gene ruvX 29159 28734 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_09690 29410 29159 gene locus_tag LOCUS_09700 29410 29159 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_09700 29785 29657 gene locus_tag LOCUS_09710 29785 29657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 33797 30135 gene locus_tag LOCUS_09720 33797 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence021 331 555 gene locus_tag LOCUS_09730 331 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1926 586 gene locus_tag LOCUS_09740 1926 586 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_09740 3267 1999 gene locus_tag LOCUS_09750 gene murA 3267 1999 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_09750 5211 3358 gene locus_tag LOCUS_09760 5211 3358 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_09760 6143 5274 gene locus_tag LOCUS_09770 gene fba 6143 5274 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_09770 7124 6222 gene locus_tag LOCUS_09780 gene dnaI 7124 6222 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_09780 8257 7124 gene locus_tag LOCUS_09790 8257 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8852 8247 gene locus_tag LOCUS_09800 gene coaE 8852 8247 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 protein_id gnl|my_center|LOCUS_09800 9646 8825 gene locus_tag LOCUS_09810 gene mutM 9646 8825 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_09810 12222 9646 gene locus_tag LOCUS_09820 gene polA 12222 9646 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_09820 12848 12282 gene locus_tag LOCUS_09830 12848 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13681 12845 gene locus_tag LOCUS_09840 gene mreC 13681 12845 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132018.1 protein_id gnl|my_center|LOCUS_09840 14388 13729 gene locus_tag LOCUS_09850 gene radC 14388 13729 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_09850 14508 14584 gene locus_tag LOCUS_t00110 14508 14584 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14659 15261 gene locus_tag LOCUS_09860 14659 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 16096 15242 gene locus_tag LOCUS_09870 16096 15242 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_09870 16249 16174 gene locus_tag LOCUS_t00120 16249 16174 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16360 16270 gene locus_tag LOCUS_t00130 16360 16270 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18256 16508 gene locus_tag LOCUS_09880 gene thrS 18256 16508 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_09880 18924 18550 gene locus_tag LOCUS_09890 18924 18550 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948924.1 protein_id gnl|my_center|LOCUS_09890 19881 19423 gene locus_tag LOCUS_09900 gene smpB 19881 19423 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_09900 21002 19878 gene locus_tag LOCUS_09910 21002 19878 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_09910 21121 21196 gene locus_tag LOCUS_t00140 21121 21196 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21895 21242 gene locus_tag LOCUS_09920 gene phoU 21895 21242 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_09920 22647 21895 gene locus_tag LOCUS_09930 gene pstB 22647 21895 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_09930 23537 22659 gene locus_tag LOCUS_09940 gene pstA 23537 22659 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994131.1 protein_id gnl|my_center|LOCUS_09940 24433 23540 gene locus_tag LOCUS_09950 gene pstC 24433 23540 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965013.1 protein_id gnl|my_center|LOCUS_09950 25372 24497 gene locus_tag LOCUS_09960 25372 24497 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_09960 25592 26677 gene locus_tag LOCUS_09970 gene serC 25592 26677 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_09970 26670 27818 gene locus_tag LOCUS_09980 26670 27818 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_09980 27833 28609 gene locus_tag LOCUS_09990 27833 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 29568 28648 gene locus_tag LOCUS_10000 29568 28648 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_10000 31324 29582 gene locus_tag LOCUS_10010 31324 29582 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_10010 31371 32432 gene locus_tag LOCUS_10020 gene iadA 31371 32432 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence022 386 835 gene locus_tag LOCUS_10030 386 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 841 1902 gene locus_tag LOCUS_10040 841 1902 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_10040 1921 2355 gene locus_tag LOCUS_10050 1921 2355 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419646.1 protein_id gnl|my_center|LOCUS_10050 2367 2807 gene locus_tag LOCUS_10060 2367 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2979 5294 gene locus_tag LOCUS_10070 2979 5294 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714097.1 protein_id gnl|my_center|LOCUS_10070 5308 6018 gene locus_tag LOCUS_10080 5308 6018 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232674.1 protein_id gnl|my_center|LOCUS_10080 6018 6974 gene locus_tag LOCUS_10090 6018 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6987 7343 gene locus_tag LOCUS_10100 6987 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 7340 7798 gene locus_tag LOCUS_10110 7340 7798 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438449.1 protein_id gnl|my_center|LOCUS_10110 7795 8895 gene locus_tag LOCUS_10120 7795 8895 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229940.1 protein_id gnl|my_center|LOCUS_10120 8885 9772 gene locus_tag LOCUS_10130 8885 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9784 10092 gene locus_tag LOCUS_10140 9784 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10094 10594 gene locus_tag LOCUS_10150 10094 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10594 10926 gene locus_tag LOCUS_10160 10594 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10926 12005 gene locus_tag LOCUS_10170 10926 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 12193 12633 gene locus_tag LOCUS_10180 12193 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13264 14418 gene locus_tag LOCUS_10190 13264 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 14509 14880 gene locus_tag LOCUS_10200 14509 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 14965 15942 gene locus_tag LOCUS_10210 14965 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16019 16774 gene locus_tag LOCUS_10220 16019 16774 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028307122.1 protein_id gnl|my_center|LOCUS_10220 16855 17064 gene locus_tag LOCUS_10230 16855 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 17559 17206 gene locus_tag LOCUS_10240 17559 17206 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_10240 17705 18031 gene locus_tag LOCUS_10250 17705 18031 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_10250 18308 19342 gene locus_tag LOCUS_10260 18308 19342 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_10260 19542 19847 gene locus_tag LOCUS_10270 19542 19847 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_10270 19844 20173 gene locus_tag LOCUS_10280 19844 20173 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_10280 20276 21130 gene locus_tag LOCUS_10290 20276 21130 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_10290 21234 21398 gene locus_tag LOCUS_10300 21234 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 21417 21605 gene locus_tag LOCUS_10310 21417 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22594 21758 gene locus_tag LOCUS_10320 22594 21758 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_10320 22488 22688 gene locus_tag LOCUS_10330 22488 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 22685 22885 gene locus_tag LOCUS_10340 22685 22885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 22940 23221 gene locus_tag LOCUS_10350 22940 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 23230 24969 gene locus_tag LOCUS_10360 23230 24969 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 protein_id gnl|my_center|LOCUS_10360 24966 25595 gene locus_tag LOCUS_10370 24966 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 25695 26402 gene locus_tag LOCUS_10380 25695 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26384 27067 gene locus_tag LOCUS_10390 26384 27067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 27116 28048 gene locus_tag LOCUS_10400 27116 28048 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_10400 29645 28125 gene locus_tag LOCUS_10410 gene cls 29645 28125 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_10410 30259 30110 gene locus_tag LOCUS_10420 30259 30110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 30721 31059 gene locus_tag LOCUS_10430 30721 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence023 211 396 gene locus_tag LOCUS_10440 211 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 467 2137 gene locus_tag LOCUS_10450 467 2137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 protein_id gnl|my_center|LOCUS_10450 3089 2526 gene locus_tag LOCUS_10460 3089 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4051 3836 gene locus_tag LOCUS_10470 4051 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4644 4084 gene locus_tag LOCUS_10480 4644 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4828 4637 gene locus_tag LOCUS_10490 4828 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5347 5712 gene locus_tag LOCUS_10500 5347 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5712 6809 gene locus_tag LOCUS_10510 5712 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6817 7035 gene locus_tag LOCUS_10520 6817 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8290 7646 gene locus_tag LOCUS_10530 8290 7646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_10530 10320 8293 gene locus_tag LOCUS_10540 10320 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 10810 10469 gene locus_tag LOCUS_10550 10810 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 13114 11633 gene locus_tag LOCUS_10560 13114 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 15612 13276 gene locus_tag LOCUS_10570 15612 13276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_10570 15979 15554 gene locus_tag LOCUS_10580 15979 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 16202 15969 gene locus_tag LOCUS_10590 16202 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 16497 16324 gene locus_tag LOCUS_10600 16497 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 17602 16487 gene locus_tag LOCUS_10610 17602 16487 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_10610 18597 17767 gene locus_tag LOCUS_10620 18597 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 18917 18612 gene locus_tag LOCUS_10630 18917 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 20682 18895 gene locus_tag LOCUS_10640 20682 18895 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_10640 20875 20669 gene locus_tag LOCUS_10650 20875 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 21603 20881 gene locus_tag LOCUS_10660 21603 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 22937 21600 gene locus_tag LOCUS_10670 22937 21600 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_10670 23269 22910 gene locus_tag LOCUS_10680 23269 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 23697 23488 gene locus_tag LOCUS_10690 23697 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 24413 23715 gene locus_tag LOCUS_10700 24413 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 24829 24500 gene locus_tag LOCUS_10710 24829 24500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25361 24813 gene locus_tag LOCUS_10720 25361 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 25741 25427 gene locus_tag LOCUS_10730 25741 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 26024 25731 gene locus_tag LOCUS_10740 26024 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 27261 26338 gene locus_tag LOCUS_10750 27261 26338 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_10750 28937 27258 gene locus_tag LOCUS_10760 28937 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 30314 29118 gene locus_tag LOCUS_10770 30314 29118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_10770 31239 30580 gene locus_tag LOCUS_10780 31239 30580 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence024 153 1616 gene locus_tag LOCUS_10790 153 1616 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918342.1 protein_id gnl|my_center|LOCUS_10790 1626 1913 gene locus_tag LOCUS_10800 1626 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1913 2212 gene locus_tag LOCUS_10810 1913 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2221 3006 gene locus_tag LOCUS_10820 gene udp 2221 3006 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_10820 4499 3003 gene locus_tag LOCUS_10830 4499 3003 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048317.1 protein_id gnl|my_center|LOCUS_10830 4600 6207 gene locus_tag LOCUS_10840 4600 6207 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985856.1 protein_id gnl|my_center|LOCUS_10840 6209 8056 gene locus_tag LOCUS_10850 gene mnmG 6209 8056 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183567.1 protein_id gnl|my_center|LOCUS_10850 8110 8400 gene locus_tag LOCUS_10860 8110 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 8554 8469 gene locus_tag LOCUS_t00150 8554 8469 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9864 8569 gene locus_tag LOCUS_10870 gene rlmD 9864 8569 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_10870 9976 10401 gene locus_tag LOCUS_10880 9976 10401 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267583.1 protein_id gnl|my_center|LOCUS_10880 10413 12143 gene locus_tag LOCUS_10890 10413 12143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_10890 12133 13956 gene locus_tag LOCUS_10900 12133 13956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_10900 14126 14959 gene locus_tag LOCUS_10910 14126 14959 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_10910 15057 16424 gene locus_tag LOCUS_10920 15057 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 16414 17832 gene locus_tag LOCUS_10930 16414 17832 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048735.1 protein_id gnl|my_center|LOCUS_10930 17829 18275 gene locus_tag LOCUS_10940 17829 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18409 18485 gene locus_tag LOCUS_t00160 18409 18485 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19499 18660 gene locus_tag LOCUS_10950 19499 18660 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948612.1 protein_id gnl|my_center|LOCUS_10950 19882 20283 gene locus_tag LOCUS_10960 19882 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 20470 23463 gene locus_tag LOCUS_10970 20470 23463 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_10970 23519 24286 gene locus_tag LOCUS_10980 23519 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 24279 25664 gene locus_tag LOCUS_10990 24279 25664 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_10990 25780 26511 gene locus_tag LOCUS_11000 25780 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 26504 27781 gene locus_tag LOCUS_11010 gene tig 26504 27781 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11010 27846 30152 gene locus_tag LOCUS_11020 gene lon 27846 30152 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_11020 30154 30738 gene locus_tag LOCUS_11030 gene yihA 30154 30738 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence025 2245 1319 gene locus_tag LOCUS_11040 2245 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4848 3061 gene locus_tag LOCUS_11050 4848 3061 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476404.1 protein_id gnl|my_center|LOCUS_11050 6115 4850 gene locus_tag LOCUS_11060 6115 4850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 protein_id gnl|my_center|LOCUS_11060 7449 6112 gene locus_tag LOCUS_11070 7449 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8311 7868 gene locus_tag LOCUS_11080 8311 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8771 8298 gene locus_tag LOCUS_11090 8771 8298 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_11090 9993 10433 gene locus_tag LOCUS_11100 9993 10433 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_11100 12652 10508 gene locus_tag LOCUS_11110 gene gnpA 12652 10508 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_11110 13760 12669 gene locus_tag LOCUS_11120 gene msmX 13760 12669 CDS product maltodextrin ABC transporter ATP-binding protein MsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242648.1 protein_id gnl|my_center|LOCUS_11120 13945 13772 gene locus_tag LOCUS_11130 13945 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 14816 13956 gene locus_tag LOCUS_11140 14816 13956 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_11140 15709 14828 gene locus_tag LOCUS_11150 15709 14828 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258533.1 protein_id gnl|my_center|LOCUS_11150 17101 15773 gene locus_tag LOCUS_11160 gene ngcE 17101 15773 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_11160 17283 18119 gene locus_tag LOCUS_11170 17283 18119 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_11170 18565 18140 gene locus_tag LOCUS_11180 18565 18140 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_11180 19258 18845 gene locus_tag LOCUS_11190 19258 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 19803 21704 gene locus_tag LOCUS_11200 19803 21704 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903255.1 protein_id gnl|my_center|LOCUS_11200 21701 21982 gene locus_tag LOCUS_11210 21701 21982 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723138.1 protein_id gnl|my_center|LOCUS_11210 22009 23139 gene locus_tag LOCUS_11220 22009 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 23157 24500 gene locus_tag LOCUS_11230 23157 24500 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 protein_id gnl|my_center|LOCUS_11230 25863 24916 gene locus_tag LOCUS_11240 gene manA 25863 24916 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_11240 27011 25860 gene locus_tag LOCUS_11250 27011 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 27390 26998 gene locus_tag LOCUS_11260 27390 26998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 28218 27397 gene locus_tag LOCUS_11270 28218 27397 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 protein_id gnl|my_center|LOCUS_11270 29045 28218 gene locus_tag LOCUS_11280 29045 28218 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_11280 29547 29065 gene locus_tag LOCUS_11290 29547 29065 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964767.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence026 1935 3221 gene locus_tag LOCUS_11300 1935 3221 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_11300 3218 4213 gene locus_tag LOCUS_11310 3218 4213 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_11310 4489 4232 gene locus_tag LOCUS_11320 4489 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5783 4566 gene locus_tag LOCUS_11330 5783 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5939 7063 gene locus_tag LOCUS_11340 5939 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7139 8098 gene locus_tag LOCUS_11350 7139 8098 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131609.1 protein_id gnl|my_center|LOCUS_11350 8858 8112 gene locus_tag LOCUS_11360 8858 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9307 11043 gene locus_tag LOCUS_11370 9307 11043 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_11370 11328 11513 gene locus_tag LOCUS_11380 11328 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 13247 11622 gene locus_tag LOCUS_11390 13247 11622 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027136.1 protein_id gnl|my_center|LOCUS_11390 13617 13258 gene locus_tag LOCUS_11400 13617 13258 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_11400 14680 13673 gene locus_tag LOCUS_11410 14680 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 15573 14674 gene locus_tag LOCUS_11420 gene murB 15573 14674 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_11420 16657 15575 gene locus_tag LOCUS_11430 gene murG 16657 15575 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_11430 17442 16687 gene locus_tag LOCUS_11440 gene srtB 17442 16687 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_11440 18231 17512 gene locus_tag LOCUS_11450 gene nagB 18231 17512 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_11450 18419 19744 gene locus_tag LOCUS_11460 gene kbaZ 18419 19744 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263816.1 protein_id gnl|my_center|LOCUS_11460 20357 19809 gene locus_tag LOCUS_11470 20357 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 20949 20368 gene locus_tag LOCUS_11480 20949 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 21967 21089 gene locus_tag LOCUS_11490 gene agaE 21967 21089 CDS product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704757.1 protein_id gnl|my_center|LOCUS_11490 22748 21957 gene locus_tag LOCUS_11500 gene agaW 22748 21957 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704758.1 protein_id gnl|my_center|LOCUS_11500 23248 22772 gene locus_tag LOCUS_11510 gene agaV 23248 22772 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_11510 24653 23487 gene locus_tag LOCUS_11520 24653 23487 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_11520 25183 24752 gene locus_tag LOCUS_11530 25183 24752 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_11530 26398 25220 gene locus_tag LOCUS_11540 26398 25220 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_11540 27390 26539 gene locus_tag LOCUS_11550 27390 26539 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_11550 28172 27414 gene locus_tag LOCUS_11560 28172 27414 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_11560 29232 28387 gene locus_tag LOCUS_11570 29232 28387 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707055.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence027 302 132 gene locus_tag LOCUS_11580 302 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2247 523 gene locus_tag LOCUS_11590 2247 523 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_11590 2780 2244 gene locus_tag LOCUS_11600 2780 2244 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_11600 4421 2994 gene locus_tag LOCUS_11610 4421 2994 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039351.1 protein_id gnl|my_center|LOCUS_11610 4497 4862 gene locus_tag LOCUS_11620 4497 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4924 6279 gene locus_tag LOCUS_11630 4924 6279 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_11630 6272 6982 gene locus_tag LOCUS_11640 6272 6982 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681526.1 protein_id gnl|my_center|LOCUS_11640 6982 8382 gene locus_tag LOCUS_11650 6982 8382 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_11650 9859 8414 gene locus_tag LOCUS_11660 9859 8414 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_11660 10481 9870 gene locus_tag LOCUS_11670 10481 9870 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861198.1 protein_id gnl|my_center|LOCUS_11670 11538 10522 gene locus_tag LOCUS_11680 gene recA 11538 10522 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_11680 12014 11520 gene locus_tag LOCUS_11690 12014 11520 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164919776.1 protein_id gnl|my_center|LOCUS_11690 12601 12014 gene locus_tag LOCUS_11700 gene pgsA 12601 12014 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_11700 13637 12561 gene locus_tag LOCUS_11710 13637 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 13725 14477 gene locus_tag LOCUS_11720 13725 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 14516 14968 gene locus_tag LOCUS_11730 gene msrA 14516 14968 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963415.1 protein_id gnl|my_center|LOCUS_11730 16188 14965 gene locus_tag LOCUS_11740 16188 14965 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830813.1 protein_id gnl|my_center|LOCUS_11740 16988 16182 gene locus_tag LOCUS_11750 16988 16182 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 protein_id gnl|my_center|LOCUS_11750 17863 16988 gene locus_tag LOCUS_11760 17863 16988 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_11760 18372 17950 gene locus_tag LOCUS_11770 18372 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 19438 18377 gene locus_tag LOCUS_11780 19438 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 20192 19521 gene locus_tag LOCUS_11790 20192 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 20550 20356 gene locus_tag LOCUS_11800 20550 20356 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_11800 21548 20550 gene locus_tag LOCUS_11810 21548 20550 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_11810 22391 21630 gene locus_tag LOCUS_11820 gene aroD 22391 21630 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_11820 23509 23180 gene locus_tag LOCUS_11830 23509 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 23788 25071 gene locus_tag LOCUS_11840 23788 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 25121 26884 gene locus_tag LOCUS_11850 25121 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 27662 26871 gene locus_tag LOCUS_11860 27662 26871 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 protein_id gnl|my_center|LOCUS_11860 27764 29011 gene locus_tag LOCUS_11870 27764 29011 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence028 299 96 gene locus_tag LOCUS_11880 299 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 488 330 gene locus_tag LOCUS_11890 488 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2348 576 gene locus_tag LOCUS_11900 gene pepF 2348 576 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_11900 3089 2373 gene locus_tag LOCUS_11910 3089 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3055 4383 gene locus_tag LOCUS_11920 3055 4383 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_11920 5145 4411 gene locus_tag LOCUS_11930 5145 4411 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_11930 6259 5138 gene locus_tag LOCUS_11940 6259 5138 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_11940 7220 6261 gene locus_tag LOCUS_11950 7220 6261 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_11950 7597 7274 gene locus_tag LOCUS_11960 7597 7274 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_11960 7930 7607 gene locus_tag LOCUS_11970 7930 7607 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722139.1 protein_id gnl|my_center|LOCUS_11970 8102 9814 gene locus_tag LOCUS_11980 8102 9814 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_11980 9811 10716 gene locus_tag LOCUS_11990 9811 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 12214 10754 gene locus_tag LOCUS_12000 12214 10754 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061584.1 protein_id gnl|my_center|LOCUS_12000 13301 12219 gene locus_tag LOCUS_12010 13301 12219 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163555.1 protein_id gnl|my_center|LOCUS_12010 14332 13310 gene locus_tag LOCUS_12020 14332 13310 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484975.1 protein_id gnl|my_center|LOCUS_12020 14968 14447 gene locus_tag LOCUS_12030 14968 14447 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_12030 16342 14987 gene locus_tag LOCUS_12040 gene celB 16342 14987 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_12040 17010 16426 gene locus_tag LOCUS_12050 17010 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 18933 17026 gene locus_tag LOCUS_12060 18933 17026 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_12060 19084 19965 gene locus_tag LOCUS_12070 19084 19965 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 protein_id gnl|my_center|LOCUS_12070 20645 19983 gene locus_tag LOCUS_12080 20645 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 21297 20632 gene locus_tag LOCUS_12090 21297 20632 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814197.1 protein_id gnl|my_center|LOCUS_12090 22194 21307 gene locus_tag LOCUS_12100 22194 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 23312 22272 gene locus_tag LOCUS_12110 gene prfB 23312 22272 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_12110 25769 23373 gene locus_tag LOCUS_12120 gene secA 25769 23373 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700639.1 protein_id gnl|my_center|LOCUS_12120 26344 25868 gene locus_tag LOCUS_12130 26344 25868 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068320.1 protein_id gnl|my_center|LOCUS_12130 27318 26332 gene locus_tag LOCUS_12140 gene mutY 27318 26332 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_12140 28301 27339 gene locus_tag LOCUS_12150 gene manA 28301 27339 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence029 144 713 gene locus_tag LOCUS_12160 144 713 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389090.1 protein_id gnl|my_center|LOCUS_12160 716 1168 gene locus_tag LOCUS_12170 716 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1235 2053 gene locus_tag LOCUS_12180 1235 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2038 2898 gene locus_tag LOCUS_12190 2038 2898 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 protein_id gnl|my_center|LOCUS_12190 2891 3688 gene locus_tag LOCUS_12200 2891 3688 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186526.1 protein_id gnl|my_center|LOCUS_12200 3685 4428 gene locus_tag LOCUS_12210 gene truA 3685 4428 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733032.1 protein_id gnl|my_center|LOCUS_12210 4415 5239 gene locus_tag LOCUS_12220 4415 5239 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_12220 5357 5794 gene locus_tag LOCUS_12230 gene rplM 5357 5794 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_12230 5808 6209 gene locus_tag LOCUS_12240 gene rpsI 5808 6209 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_12240 6644 6892 gene locus_tag LOCUS_12250 6644 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7461 6919 gene locus_tag LOCUS_12260 7461 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7651 7872 gene locus_tag LOCUS_12270 7651 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7888 8106 gene locus_tag LOCUS_12280 7888 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8103 9917 gene locus_tag LOCUS_12290 8103 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10255 10872 gene locus_tag LOCUS_12300 10255 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 10949 11086 gene locus_tag LOCUS_12310 10949 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11105 11749 gene locus_tag LOCUS_12320 11105 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11881 12153 gene locus_tag LOCUS_12330 11881 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12161 13216 gene locus_tag LOCUS_12340 12161 13216 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475608.1 protein_id gnl|my_center|LOCUS_12340 13411 13563 gene locus_tag LOCUS_12350 13411 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 15225 14017 gene locus_tag LOCUS_12360 15225 14017 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12360 16219 17490 gene locus_tag LOCUS_12370 16219 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 18115 18348 gene locus_tag LOCUS_12380 18115 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 18411 18992 gene locus_tag LOCUS_12390 18411 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 18997 20004 gene locus_tag LOCUS_12400 18997 20004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 20009 21334 gene locus_tag LOCUS_12410 20009 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 21446 22315 gene locus_tag LOCUS_12420 21446 22315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948473.1 protein_id gnl|my_center|LOCUS_12420 22318 22761 gene locus_tag LOCUS_12430 22318 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 22676 23434 gene locus_tag LOCUS_12440 22676 23434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 23436 24776 gene locus_tag LOCUS_12450 23436 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 24757 25011 gene locus_tag LOCUS_12460 24757 25011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 25044 27074 gene locus_tag LOCUS_12470 25044 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 27071 27700 gene locus_tag LOCUS_12480 27071 27700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence030 1123 221 gene locus_tag LOCUS_12490 1123 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2707 1175 gene locus_tag LOCUS_12500 gene purH 2707 1175 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_12500 3288 2707 gene locus_tag LOCUS_12510 gene purN 3288 2707 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 protein_id gnl|my_center|LOCUS_12510 4313 3282 gene locus_tag LOCUS_12520 gene purM 4313 3282 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947069.1 protein_id gnl|my_center|LOCUS_12520 5696 4317 gene locus_tag LOCUS_12530 gene purF 5696 4317 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879029.1 protein_id gnl|my_center|LOCUS_12530 9399 5698 gene locus_tag LOCUS_12540 9399 5698 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_12540 9898 9410 gene locus_tag LOCUS_12550 gene purE 9898 9410 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_12550 11432 10086 gene locus_tag LOCUS_12560 11432 10086 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_12560 13181 11523 gene locus_tag LOCUS_12570 13181 11523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948959.1 protein_id gnl|my_center|LOCUS_12570 16003 13586 gene locus_tag LOCUS_12580 16003 13586 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922246.1 protein_id gnl|my_center|LOCUS_12580 16185 17099 gene locus_tag LOCUS_12590 16185 17099 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_12590 17164 17910 gene locus_tag LOCUS_12600 17164 17910 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991277.1 protein_id gnl|my_center|LOCUS_12600 20133 18451 gene locus_tag LOCUS_12610 20133 18451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730693.1 protein_id gnl|my_center|LOCUS_12610 21094 20249 gene locus_tag LOCUS_12620 gene rsmI 21094 20249 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267819.1 protein_id gnl|my_center|LOCUS_12620 21920 21087 gene locus_tag LOCUS_12630 21920 21087 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_12630 22834 21920 gene locus_tag LOCUS_12640 gene holB 22834 21920 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384059.1 protein_id gnl|my_center|LOCUS_12640 23459 22827 gene locus_tag LOCUS_12650 gene tmk 23459 22827 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_12650 24519 23650 gene locus_tag LOCUS_12660 24519 23650 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_12660 26475 24607 gene locus_tag LOCUS_12670 26475 24607 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_12670 26784 26566 gene locus_tag LOCUS_12680 26784 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 26925 27278 gene locus_tag LOCUS_12690 26925 27278 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence031 818 210 gene locus_tag LOCUS_12700 818 210 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_12700 1003 3084 gene locus_tag LOCUS_12710 1003 3084 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_12710 3087 5588 gene locus_tag LOCUS_12720 3087 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5682 5834 gene locus_tag LOCUS_12730 gene scfA 5682 5834 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_12730 5915 7309 gene locus_tag LOCUS_12740 gene scfB 5915 7309 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_12740 7290 8618 gene locus_tag LOCUS_12750 7290 8618 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_12750 8707 10638 gene locus_tag LOCUS_12760 8707 10638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_12760 11380 10643 gene locus_tag LOCUS_12770 11380 10643 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_12770 11437 13107 gene locus_tag LOCUS_12780 11437 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 13104 13814 gene locus_tag LOCUS_12790 13104 13814 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261883.1 protein_id gnl|my_center|LOCUS_12790 13828 13971 gene locus_tag LOCUS_12800 13828 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 13994 14386 gene locus_tag LOCUS_12810 13994 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 15525 14401 gene locus_tag LOCUS_12820 gene zinU 15525 14401 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_12820 15584 16600 gene locus_tag LOCUS_12830 15584 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 16681 16926 gene locus_tag LOCUS_12840 16681 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16975 17226 gene locus_tag LOCUS_12850 16975 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17438 18025 gene locus_tag LOCUS_12860 17438 18025 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_12860 18100 18828 gene locus_tag LOCUS_12870 18100 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 19830 18847 gene locus_tag LOCUS_12880 19830 18847 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_12880 21146 19827 gene locus_tag LOCUS_12890 21146 19827 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_12890 22264 21152 gene locus_tag LOCUS_12900 22264 21152 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_12900 22355 23827 gene locus_tag LOCUS_12910 gene thrC 22355 23827 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 protein_id gnl|my_center|LOCUS_12910 23820 24692 gene locus_tag LOCUS_12920 gene thrB 23820 24692 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_12920 24685 25119 gene locus_tag LOCUS_12930 24685 25119 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_12930 25119 25808 gene locus_tag LOCUS_12940 25119 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 25805 26353 gene locus_tag LOCUS_12950 25805 26353 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_12950 26404 26688 gene locus_tag LOCUS_12960 26404 26688 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence032 431 147 gene locus_tag LOCUS_12970 431 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 654 433 gene locus_tag LOCUS_12980 654 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 919 641 gene locus_tag LOCUS_12990 919 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1233 1033 gene locus_tag LOCUS_13000 1233 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13000 1551 1297 gene locus_tag LOCUS_13010 1551 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13010 3782 2040 gene locus_tag LOCUS_13020 3782 2040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680643.1 protein_id gnl|my_center|LOCUS_13020 5538 3784 gene locus_tag LOCUS_13030 5538 3784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_13030 6232 5606 gene locus_tag LOCUS_13040 6232 5606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_13040 6542 6324 gene locus_tag LOCUS_13050 6542 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7029 6562 gene locus_tag LOCUS_13060 7029 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7727 7026 gene locus_tag LOCUS_13070 7727 7026 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_13070 8648 7884 gene locus_tag LOCUS_13080 8648 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9324 8671 gene locus_tag LOCUS_13090 9324 8671 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_13090 10249 9314 gene locus_tag LOCUS_13100 10249 9314 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_13100 11055 10255 gene locus_tag LOCUS_13110 11055 10255 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_13110 11828 11052 gene locus_tag LOCUS_13120 11828 11052 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_13120 13747 12089 gene locus_tag LOCUS_13130 13747 12089 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13130 14560 13877 gene locus_tag LOCUS_13140 14560 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 15423 14557 gene locus_tag LOCUS_13150 15423 14557 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068614.1 protein_id gnl|my_center|LOCUS_13150 17061 15487 gene locus_tag LOCUS_13160 17061 15487 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837258.1 protein_id gnl|my_center|LOCUS_13160 24993 17095 gene locus_tag LOCUS_13170 24993 17095 CDS product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390380.1 protein_id gnl|my_center|LOCUS_13170 26483 25041 gene locus_tag LOCUS_13180 26483 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence033 224 2131 gene locus_tag LOCUS_13190 224 2131 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_13190 2133 3413 gene locus_tag LOCUS_13200 2133 3413 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_13200 3426 5039 gene locus_tag LOCUS_13210 3426 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5126 6169 gene locus_tag LOCUS_13220 5126 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6178 7191 gene locus_tag LOCUS_13230 6178 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7178 8410 gene locus_tag LOCUS_13240 7178 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8700 9368 gene locus_tag LOCUS_13250 8700 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 9371 10318 gene locus_tag LOCUS_13260 9371 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 10345 11796 gene locus_tag LOCUS_13270 10345 11796 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_13270 11793 12926 gene locus_tag LOCUS_13280 gene wecB 11793 12926 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_13280 12962 14074 gene locus_tag LOCUS_13290 12962 14074 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_13290 14077 15309 gene locus_tag LOCUS_13300 14077 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 15315 16364 gene locus_tag LOCUS_13310 gene ala 15315 16364 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_13310 16718 17710 gene locus_tag LOCUS_13320 16718 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 18254 19933 gene locus_tag LOCUS_13330 18254 19933 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 protein_id gnl|my_center|LOCUS_13330 19930 21432 gene locus_tag LOCUS_13340 19930 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 21699 21983 gene locus_tag LOCUS_13350 21699 21983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 22376 22699 gene locus_tag LOCUS_13360 22376 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 22911 23090 gene locus_tag LOCUS_13370 22911 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 23433 23047 gene locus_tag LOCUS_13380 23433 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 24233 23799 gene locus_tag LOCUS_13390 24233 23799 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_13390 25203 24235 gene locus_tag LOCUS_13400 gene dcm 25203 24235 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734158.1 protein_id gnl|my_center|LOCUS_13400 26654 25191 gene locus_tag LOCUS_13410 26654 25191 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285316.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence034 1508 303 gene locus_tag LOCUS_13420 1508 303 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_13420 1797 2936 gene locus_tag LOCUS_13430 1797 2936 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_13430 2958 3752 gene locus_tag LOCUS_13440 2958 3752 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_13440 3768 4799 gene locus_tag LOCUS_13450 3768 4799 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965996.1 protein_id gnl|my_center|LOCUS_13450 4820 5656 gene locus_tag LOCUS_13460 4820 5656 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_13460 5720 6499 gene locus_tag LOCUS_13470 5720 6499 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_13470 6522 8072 gene locus_tag LOCUS_13480 6522 8072 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_13480 8135 9169 gene locus_tag LOCUS_13490 8135 9169 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_13490 10245 9172 gene locus_tag LOCUS_13500 10245 9172 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_13500 10997 10242 gene locus_tag LOCUS_13510 10997 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 12190 10994 gene locus_tag LOCUS_13520 12190 10994 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_13520 12707 12195 gene locus_tag LOCUS_13530 12707 12195 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986429.1 protein_id gnl|my_center|LOCUS_13530 13465 12761 gene locus_tag LOCUS_13540 13465 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 13556 14287 gene locus_tag LOCUS_13550 gene scpA 13556 14287 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_13550 14289 14834 gene locus_tag LOCUS_13560 gene scpB 14289 14834 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223904.1 protein_id gnl|my_center|LOCUS_13560 14838 15566 gene locus_tag LOCUS_13570 gene rluB 14838 15566 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_13570 15566 16285 gene locus_tag LOCUS_13580 15566 16285 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183200.1 protein_id gnl|my_center|LOCUS_13580 16293 17582 gene locus_tag LOCUS_13590 gene mtaB 16293 17582 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_13590 17573 19015 gene locus_tag LOCUS_13600 17573 19015 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_13600 19094 19273 gene locus_tag LOCUS_13610 gene rpsU 19094 19273 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565673.1 protein_id gnl|my_center|LOCUS_13610 19316 20272 gene locus_tag LOCUS_13620 19316 20272 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 protein_id gnl|my_center|LOCUS_13620 20332 21066 gene locus_tag LOCUS_13630 20332 21066 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533705.1 protein_id gnl|my_center|LOCUS_13630 21294 22604 gene locus_tag LOCUS_13640 gene hisS 21294 22604 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence035 2417 1059 gene locus_tag LOCUS_13650 gene trkA 2417 1059 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_13650 2734 5229 gene locus_tag LOCUS_13660 2734 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5896 5252 gene locus_tag LOCUS_13670 5896 5252 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906403.1 protein_id gnl|my_center|LOCUS_13670 6935 6276 gene locus_tag LOCUS_13680 6935 6276 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641710.1 protein_id gnl|my_center|LOCUS_13680 7256 7035 gene locus_tag LOCUS_13690 7256 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7422 7237 gene locus_tag LOCUS_13700 7422 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7899 7567 gene locus_tag LOCUS_13710 7899 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8146 7889 gene locus_tag LOCUS_13720 8146 7889 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_13720 11100 8995 gene locus_tag LOCUS_13730 11100 8995 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484987.1 protein_id gnl|my_center|LOCUS_13730 12244 11084 gene locus_tag LOCUS_13740 gene mnmA 12244 11084 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_13740 12407 12321 gene locus_tag LOCUS_t00170 12407 12321 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12520 12434 gene locus_tag LOCUS_t00180 12520 12434 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13627 12626 gene locus_tag LOCUS_13750 13627 12626 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 protein_id gnl|my_center|LOCUS_13750 14034 13723 gene locus_tag LOCUS_13760 14034 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 14852 14151 gene locus_tag LOCUS_13770 14852 14151 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154460019.1 protein_id gnl|my_center|LOCUS_13770 15579 14905 gene locus_tag LOCUS_13780 15579 14905 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_13780 16063 15596 gene locus_tag LOCUS_13790 16063 15596 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 protein_id gnl|my_center|LOCUS_13790 17112 16072 gene locus_tag LOCUS_13800 17112 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 18905 17148 gene locus_tag LOCUS_13810 gene uvrC 18905 17148 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_13810 21226 18914 gene locus_tag LOCUS_13820 21226 18914 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833037.1 protein_id gnl|my_center|LOCUS_13820 21290 22138 gene locus_tag LOCUS_13830 gene rnhC 21290 22138 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_13830 24080 22152 gene locus_tag LOCUS_13840 24080 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence036 668 1012 gene locus_tag LOCUS_13850 668 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13850 1905 4229 gene locus_tag LOCUS_13860 1905 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4693 4992 gene locus_tag LOCUS_13870 4693 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5389 6036 gene locus_tag LOCUS_13880 gene lepB 5389 6036 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_13880 6047 11038 gene locus_tag LOCUS_13890 6047 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 11035 12492 gene locus_tag LOCUS_13900 11035 12492 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_13900 12537 13367 gene locus_tag LOCUS_13910 12537 13367 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_13910 13348 14127 gene locus_tag LOCUS_13920 13348 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14109 14669 gene locus_tag LOCUS_13930 14109 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 15195 14698 gene locus_tag LOCUS_13940 15195 14698 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_13940 15289 16569 gene locus_tag LOCUS_13950 15289 16569 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348025.1 protein_id gnl|my_center|LOCUS_13950 16811 19441 gene locus_tag LOCUS_13960 gene alaS 16811 19441 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_13960 19455 19832 gene locus_tag LOCUS_13970 19455 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 19897 20400 gene locus_tag LOCUS_13980 19897 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 20474 21478 gene locus_tag LOCUS_13990 20474 21478 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence037 1369 98 gene locus_tag LOCUS_14000 1369 98 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_14000 1459 1920 gene locus_tag LOCUS_14010 1459 1920 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228454.1 protein_id gnl|my_center|LOCUS_14010 1938 2177 gene locus_tag LOCUS_14020 1938 2177 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681558.1 protein_id gnl|my_center|LOCUS_14020 2218 3543 gene locus_tag LOCUS_14030 2218 3543 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182545.1 protein_id gnl|my_center|LOCUS_14030 4644 3907 gene locus_tag LOCUS_14040 4644 3907 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_14040 4754 6583 gene locus_tag LOCUS_14050 gene typA 4754 6583 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430621.1 protein_id gnl|my_center|LOCUS_14050 8321 7047 gene locus_tag LOCUS_14060 8321 7047 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363502.1 protein_id gnl|my_center|LOCUS_14060 10659 8821 gene locus_tag LOCUS_14070 10659 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 11221 10676 gene locus_tag LOCUS_14080 11221 10676 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989628.1 protein_id gnl|my_center|LOCUS_14080 12014 11304 gene locus_tag LOCUS_14090 12014 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 12360 12190 gene locus_tag LOCUS_14100 12360 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13686 12376 gene locus_tag LOCUS_14110 gene gtfB 13686 12376 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 protein_id gnl|my_center|LOCUS_14110 15161 13680 gene locus_tag LOCUS_14120 gene gtfA 15161 13680 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158423.1 protein_id gnl|my_center|LOCUS_14120 17491 15182 gene locus_tag LOCUS_14130 gene secA2 17491 15182 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 protein_id gnl|my_center|LOCUS_14130 17924 17493 gene locus_tag LOCUS_14140 gene asp3 17924 17493 CDS product accessory Sec system protein Asp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906887.1 protein_id gnl|my_center|LOCUS_14140 19425 17914 gene locus_tag LOCUS_14150 gene asp2 19425 17914 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 protein_id gnl|my_center|LOCUS_14150 20998 19412 gene locus_tag LOCUS_14160 gene asp1 20998 19412 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_14160 22195 21011 gene locus_tag LOCUS_14170 gene secY 22195 21011 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616784.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence038 699 118 gene locus_tag LOCUS_14180 699 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 979 1803 gene locus_tag LOCUS_14190 gene truB 979 1803 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262200.1 protein_id gnl|my_center|LOCUS_14190 1803 2780 gene locus_tag LOCUS_14200 gene ribF 1803 2780 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_14200 2819 3148 gene locus_tag LOCUS_14210 2819 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3184 4080 gene locus_tag LOCUS_14220 3184 4080 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_14220 4081 4458 gene locus_tag LOCUS_14230 4081 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4455 5786 gene locus_tag LOCUS_14240 gene xseA 4455 5786 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_14240 5788 5997 gene locus_tag LOCUS_14250 5788 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5984 6832 gene locus_tag LOCUS_14260 5984 6832 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230262.1 protein_id gnl|my_center|LOCUS_14260 6921 8783 gene locus_tag LOCUS_14270 gene dxs 6921 8783 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 protein_id gnl|my_center|LOCUS_14270 8776 9507 gene locus_tag LOCUS_14280 8776 9507 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_14280 9612 11246 gene locus_tag LOCUS_14290 gene recN 9612 11246 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830981.1 protein_id gnl|my_center|LOCUS_14290 11239 12408 gene locus_tag LOCUS_14300 11239 12408 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208858.1 protein_id gnl|my_center|LOCUS_14300 12405 13058 gene locus_tag LOCUS_14310 12405 13058 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 protein_id gnl|my_center|LOCUS_14310 13078 13980 gene locus_tag LOCUS_14320 gene xerD 13078 13980 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360354.1 protein_id gnl|my_center|LOCUS_14320 13984 14817 gene locus_tag LOCUS_14330 13984 14817 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 protein_id gnl|my_center|LOCUS_14330 14889 15437 gene locus_tag LOCUS_14340 14889 15437 CDS product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858500.1 protein_id gnl|my_center|LOCUS_14340 16896 15466 gene locus_tag LOCUS_14350 gene purB 16896 15466 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14350 17010 18326 gene locus_tag LOCUS_14360 17010 18326 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836724.1 protein_id gnl|my_center|LOCUS_14360 18323 19054 gene locus_tag LOCUS_14370 18323 19054 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_14370 19219 20064 gene locus_tag LOCUS_14380 19219 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 20074 20985 gene locus_tag LOCUS_14390 20074 20985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 21035 21880 gene locus_tag LOCUS_14400 21035 21880 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_14400 21938 22186 gene locus_tag LOCUS_14410 21938 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence039 624 178 gene locus_tag LOCUS_14420 gene rpiB 624 178 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437841.1 protein_id gnl|my_center|LOCUS_14420 1082 687 gene locus_tag LOCUS_14430 1082 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_14430 1250 2581 gene locus_tag LOCUS_14440 gene gdhA 1250 2581 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_14440 2662 3333 gene locus_tag LOCUS_14450 2662 3333 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_14450 3886 3287 gene locus_tag LOCUS_14460 3886 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4128 4691 gene locus_tag LOCUS_14470 4128 4691 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_14470 5203 4703 gene locus_tag LOCUS_14480 5203 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6546 5203 gene locus_tag LOCUS_14490 6546 5203 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_14490 7694 6639 gene locus_tag LOCUS_14500 7694 6639 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_14500 7989 7696 gene locus_tag LOCUS_14510 7989 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8309 7989 gene locus_tag LOCUS_14520 8309 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 8746 8306 gene locus_tag LOCUS_14530 8746 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 9036 8746 gene locus_tag LOCUS_14540 9036 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10039 9041 gene locus_tag LOCUS_14550 10039 9041 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892080.1 protein_id gnl|my_center|LOCUS_14550 10956 10051 gene locus_tag LOCUS_14560 10956 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13074 10975 gene locus_tag LOCUS_14570 13074 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 14371 13178 gene locus_tag LOCUS_14580 14371 13178 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080300.1 protein_id gnl|my_center|LOCUS_14580 14957 14478 gene locus_tag LOCUS_14590 14957 14478 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_14590 15828 14965 gene locus_tag LOCUS_14600 15828 14965 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_14600 16648 15815 gene locus_tag LOCUS_14610 16648 15815 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263635.1 protein_id gnl|my_center|LOCUS_14610 18031 16652 gene locus_tag LOCUS_14620 18031 16652 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_14620 18804 18031 gene locus_tag LOCUS_14630 gene murI 18804 18031 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115668.1 protein_id gnl|my_center|LOCUS_14630 19264 18884 gene locus_tag LOCUS_14640 19264 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 20133 19627 gene locus_tag LOCUS_14650 20133 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 20458 20126 gene locus_tag LOCUS_14660 gene hisI 20458 20126 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_14660 21210 20455 gene locus_tag LOCUS_14670 gene hisF 21210 20455 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence040 1205 126 gene locus_tag LOCUS_14680 1205 126 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793088.1 protein_id gnl|my_center|LOCUS_14680 2470 1205 gene locus_tag LOCUS_14690 2470 1205 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836379.1 protein_id gnl|my_center|LOCUS_14690 3067 2474 gene locus_tag LOCUS_14700 3067 2474 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547910.1 protein_id gnl|my_center|LOCUS_14700 3727 3068 gene locus_tag LOCUS_14710 gene rpe 3727 3068 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264901.1 protein_id gnl|my_center|LOCUS_14710 4587 3724 gene locus_tag LOCUS_14720 gene rsgA 4587 3724 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_14720 6247 4580 gene locus_tag LOCUS_14730 gene pknB 6247 4580 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_14730 6990 6253 gene locus_tag LOCUS_14740 6990 6253 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_14740 8038 6995 gene locus_tag LOCUS_14750 gene rlmN 8038 6995 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989487.1 protein_id gnl|my_center|LOCUS_14750 9263 8070 gene locus_tag LOCUS_14760 gene rsmB 9263 8070 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206580826.1 protein_id gnl|my_center|LOCUS_14760 11283 9265 gene locus_tag LOCUS_14770 gene priA 11283 9265 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560839.1 protein_id gnl|my_center|LOCUS_14770 11627 11445 gene locus_tag LOCUS_14780 11627 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 12428 11640 gene locus_tag LOCUS_14790 12428 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 12716 12976 gene locus_tag LOCUS_14800 12716 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 13812 13084 gene locus_tag LOCUS_14810 gene rlmB 13812 13084 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_14810 13886 15043 gene locus_tag LOCUS_14820 13886 15043 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_14820 15111 15995 gene locus_tag LOCUS_14830 15111 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 16209 16015 gene locus_tag LOCUS_14840 16209 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16443 16222 gene locus_tag LOCUS_14850 16443 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 16662 16576 gene locus_tag LOCUS_t00190 16662 16576 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16743 16670 gene locus_tag LOCUS_t00200 16743 16670 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16856 16770 gene locus_tag LOCUS_t00210 16856 16770 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16938 16865 gene locus_tag LOCUS_t00220 16938 16865 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17106 17987 gene locus_tag LOCUS_14860 17106 17987 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000530036.1 protein_id gnl|my_center|LOCUS_14860 18574 18155 gene locus_tag LOCUS_14870 18574 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 20337 19018 gene locus_tag LOCUS_14880 20337 19018 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence041 398 844 gene locus_tag LOCUS_14890 398 844 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 protein_id gnl|my_center|LOCUS_14890 1541 828 gene locus_tag LOCUS_14900 1541 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3039 1558 gene locus_tag LOCUS_14910 gene glpK 3039 1558 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_14910 5520 3133 gene locus_tag LOCUS_14920 gene pheT 5520 3133 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 protein_id gnl|my_center|LOCUS_14920 6567 5533 gene locus_tag LOCUS_14930 gene pheS 6567 5533 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 protein_id gnl|my_center|LOCUS_14930 6870 7604 gene locus_tag LOCUS_14940 6870 7604 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_14940 8930 7611 gene locus_tag LOCUS_14950 8930 7611 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_14950 10200 9016 gene locus_tag LOCUS_14960 gene deoB 10200 9016 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_14960 10913 10197 gene locus_tag LOCUS_14970 gene deoD 10913 10197 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183561.1 protein_id gnl|my_center|LOCUS_14970 11562 10960 gene locus_tag LOCUS_14980 11562 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387231.1 protein_id gnl|my_center|LOCUS_14980 12181 11585 gene locus_tag LOCUS_14990 12181 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 protein_id gnl|my_center|LOCUS_14990 12533 12183 gene locus_tag LOCUS_15000 12533 12183 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963705.1 protein_id gnl|my_center|LOCUS_15000 12798 12505 gene locus_tag LOCUS_15010 12798 12505 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722179.1 protein_id gnl|my_center|LOCUS_15010 14142 12814 gene locus_tag LOCUS_15020 14142 12814 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454201.1 protein_id gnl|my_center|LOCUS_15020 16114 14213 gene locus_tag LOCUS_15030 16114 14213 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 protein_id gnl|my_center|LOCUS_15030 17387 16125 gene locus_tag LOCUS_15040 17387 16125 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892810.1 protein_id gnl|my_center|LOCUS_15040 18447 17644 gene locus_tag LOCUS_15050 18447 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 19302 18529 gene locus_tag LOCUS_15060 19302 18529 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_15060 20236 19295 gene locus_tag LOCUS_15070 20236 19295 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 protein_id gnl|my_center|LOCUS_15070 20919 20245 gene locus_tag LOCUS_15080 gene rpiA 20919 20245 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964740.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence042 <1 857 gene locus_tag LOCUS_15090 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357329.1:acetyl-CoA C-acetyltransferase 1478 1140 gene locus_tag LOCUS_15100 gene rbfA 1478 1140 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_15100 3333 1480 gene locus_tag LOCUS_15110 gene infB 3333 1480 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990095.1 protein_id gnl|my_center|LOCUS_15110 3632 3342 gene locus_tag LOCUS_15120 3632 3342 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_15120 3885 3625 gene locus_tag LOCUS_15130 3885 3625 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_15130 5510 3897 gene locus_tag LOCUS_15140 5510 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5979 5521 gene locus_tag LOCUS_15150 gene rimP 5979 5521 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357863.1 protein_id gnl|my_center|LOCUS_15150 6654 6076 gene locus_tag LOCUS_15160 gene gmk 6654 6076 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_15160 6760 8394 gene locus_tag LOCUS_15170 6760 8394 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 protein_id gnl|my_center|LOCUS_15170 8731 8423 gene locus_tag LOCUS_15180 8731 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8916 8734 gene locus_tag LOCUS_15190 8916 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 9491 8916 gene locus_tag LOCUS_15200 gene rsxA 9491 8916 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_15200 10152 9493 gene locus_tag LOCUS_15210 10152 9493 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_15210 10675 10166 gene locus_tag LOCUS_15220 10675 10166 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583455.1 protein_id gnl|my_center|LOCUS_15220 11814 10672 gene locus_tag LOCUS_15230 11814 10672 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_15230 13118 11826 gene locus_tag LOCUS_15240 gene rsxC 13118 11826 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_15240 13255 14340 gene locus_tag LOCUS_15250 13255 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 17089 14363 gene locus_tag LOCUS_15260 gene ileS2 17089 14363 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455951.1 protein_id gnl|my_center|LOCUS_15260 18060 17332 gene locus_tag LOCUS_15270 18060 17332 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_15270 18516 18085 gene locus_tag LOCUS_15280 gene sepF 18516 18085 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_15280 19166 18633 gene locus_tag LOCUS_15290 gene raiA 19166 18633 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 protein_id gnl|my_center|LOCUS_15290 19515 20528 gene locus_tag LOCUS_15300 gene aroF 19515 20528 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence043 1982 675 gene locus_tag LOCUS_15310 1982 675 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_15310 3335 2151 gene locus_tag LOCUS_15320 gene tuf 3335 2151 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_15320 5504 3408 gene locus_tag LOCUS_15330 gene fusA 5504 3408 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090370.1 protein_id gnl|my_center|LOCUS_15330 5993 5523 gene locus_tag LOCUS_15340 gene rpsG 5993 5523 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_15340 6432 6019 gene locus_tag LOCUS_15350 gene rpsL 6432 6019 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356190.1 protein_id gnl|my_center|LOCUS_15350 6657 7460 gene locus_tag LOCUS_15360 gene yidA 6657 7460 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989393.1 protein_id gnl|my_center|LOCUS_15360 7971 7603 gene locus_tag LOCUS_15370 gene rplL 7971 7603 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183499.1 protein_id gnl|my_center|LOCUS_15370 8533 7994 gene locus_tag LOCUS_15380 gene rplJ 8533 7994 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_15380 9402 8716 gene locus_tag LOCUS_15390 gene rplA 9402 8716 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_15390 9836 9417 gene locus_tag LOCUS_15400 gene rplK 9836 9417 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183506.1 protein_id gnl|my_center|LOCUS_15400 10790 10062 gene locus_tag LOCUS_15410 10790 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 11900 10854 gene locus_tag LOCUS_15420 11900 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15420 12093 12905 gene locus_tag LOCUS_15430 12093 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 13441 12902 gene locus_tag LOCUS_15440 gene mocA 13441 12902 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890188.1 protein_id gnl|my_center|LOCUS_15440 15710 13434 gene locus_tag LOCUS_15450 15710 13434 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_15450 16164 15703 gene locus_tag LOCUS_15460 16164 15703 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_15460 16903 16154 gene locus_tag LOCUS_15470 16903 16154 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_15470 18288 16981 gene locus_tag LOCUS_15480 18288 16981 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_15480 19394 18480 gene locus_tag LOCUS_15490 19394 18480 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_15490 20288 19464 gene locus_tag LOCUS_15500 20288 19464 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_15500 20437 20512 gene locus_tag LOCUS_t00230 20437 20512 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 575 1081 gene locus_tag LOCUS_15510 575 1081 CDS product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836950.1 protein_id gnl|my_center|LOCUS_15510 3723 1099 gene locus_tag LOCUS_15520 3723 1099 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048290.1 protein_id gnl|my_center|LOCUS_15520 3873 5189 gene locus_tag LOCUS_15530 3873 5189 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_15530 6145 5195 gene locus_tag LOCUS_15540 gene bsh 6145 5195 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_15540 6916 6395 gene locus_tag LOCUS_15550 6916 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 7014 7568 gene locus_tag LOCUS_15560 7014 7568 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289120.1 protein_id gnl|my_center|LOCUS_15560 8138 7590 gene locus_tag LOCUS_15570 8138 7590 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_15570 8679 8131 gene locus_tag LOCUS_15580 8679 8131 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_15580 9499 8681 gene locus_tag LOCUS_15590 9499 8681 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_15590 11910 9574 gene locus_tag LOCUS_15600 gene feoB 11910 9574 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_15600 12059 12490 gene locus_tag LOCUS_15610 12059 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 12492 13865 gene locus_tag LOCUS_15620 12492 13865 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_15620 15176 13866 gene locus_tag LOCUS_15630 15176 13866 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_15630 15991 15218 gene locus_tag LOCUS_15640 15991 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17319 15994 gene locus_tag LOCUS_15650 17319 15994 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_15650 18700 17312 gene locus_tag LOCUS_15660 18700 17312 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_15660 19392 18703 gene locus_tag LOCUS_15670 19392 18703 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_15670 19570 19646 gene locus_tag LOCUS_t00240 19570 19646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19669 19745 gene locus_tag LOCUS_t00250 19669 19745 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19762 19837 gene locus_tag LOCUS_t00260 19762 19837 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 1050 136 gene locus_tag LOCUS_15680 1050 136 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_15680 1455 1051 gene locus_tag LOCUS_15690 1455 1051 CDS product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074477.1 protein_id gnl|my_center|LOCUS_15690 2684 1443 gene locus_tag LOCUS_15700 2684 1443 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102086.1 protein_id gnl|my_center|LOCUS_15700 3487 2684 gene locus_tag LOCUS_15710 3487 2684 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002350294.1 protein_id gnl|my_center|LOCUS_15710 4259 3477 gene locus_tag LOCUS_15720 4259 3477 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312633.1 protein_id gnl|my_center|LOCUS_15720 4755 4282 gene locus_tag LOCUS_15730 4755 4282 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312631.1 protein_id gnl|my_center|LOCUS_15730 7419 4771 gene locus_tag LOCUS_15740 7419 4771 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 protein_id gnl|my_center|LOCUS_15740 8345 7686 gene locus_tag LOCUS_15750 8345 7686 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_15750 9180 8395 gene locus_tag LOCUS_15760 9180 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10155 9184 gene locus_tag LOCUS_15770 10155 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 10894 10172 gene locus_tag LOCUS_15780 10894 10172 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890462.1 protein_id gnl|my_center|LOCUS_15780 11756 10896 gene locus_tag LOCUS_15790 11756 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12182 11766 gene locus_tag LOCUS_15800 12182 11766 CDS product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573589.1 protein_id gnl|my_center|LOCUS_15800 13052 12252 gene locus_tag LOCUS_15810 13052 12252 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002350294.1 protein_id gnl|my_center|LOCUS_15810 13824 13045 gene locus_tag LOCUS_15820 13824 13045 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312633.1 protein_id gnl|my_center|LOCUS_15820 14334 13852 gene locus_tag LOCUS_15830 14334 13852 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312631.1 protein_id gnl|my_center|LOCUS_15830 15262 14570 gene locus_tag LOCUS_15840 15262 14570 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687705.1 protein_id gnl|my_center|LOCUS_15840 17978 15246 gene locus_tag LOCUS_15850 17978 15246 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323457.1 protein_id gnl|my_center|LOCUS_15850 18884 17982 gene locus_tag LOCUS_15860 gene pfkB 18884 17982 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence046 463 963 gene locus_tag LOCUS_15870 463 963 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_15870 944 1717 gene locus_tag LOCUS_15880 gene pgeF 944 1717 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_15880 2009 1725 gene locus_tag LOCUS_15890 2009 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2380 2123 gene locus_tag LOCUS_15900 2380 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2537 3304 gene locus_tag LOCUS_15910 2537 3304 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963554.1 protein_id gnl|my_center|LOCUS_15910 3308 4066 gene locus_tag LOCUS_15920 3308 4066 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_15920 5238 4078 gene locus_tag LOCUS_15930 5238 4078 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_15930 5374 6225 gene locus_tag LOCUS_15940 5374 6225 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_15940 6760 6374 gene locus_tag LOCUS_15950 6760 6374 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 protein_id gnl|my_center|LOCUS_15950 7696 6779 gene locus_tag LOCUS_15960 7696 6779 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721724.1 protein_id gnl|my_center|LOCUS_15960 8538 7720 gene locus_tag LOCUS_15970 8538 7720 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_15970 9537 8557 gene locus_tag LOCUS_15980 9537 8557 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_15980 10577 9738 gene locus_tag LOCUS_15990 10577 9738 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_15990 12667 10577 gene locus_tag LOCUS_16000 12667 10577 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890592.1 protein_id gnl|my_center|LOCUS_16000 13536 12781 gene locus_tag LOCUS_16010 13536 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 15010 13619 gene locus_tag LOCUS_16020 15010 13619 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_16020 17292 15031 gene locus_tag LOCUS_16030 17292 15031 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_16030 17498 18718 gene locus_tag LOCUS_16040 17498 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence047 <1 837 gene locus_tag LOCUS_16050 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475468.1:iron-containing alcohol dehydrogenase family protein 1850 873 gene locus_tag LOCUS_16060 1850 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2025 2927 gene locus_tag LOCUS_16070 gene ftsX 2025 2927 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_16070 2924 4288 gene locus_tag LOCUS_16080 2924 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4299 4985 gene locus_tag LOCUS_16090 gene ftsE 4299 4985 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_16090 4985 5884 gene locus_tag LOCUS_16100 gene ftsX 4985 5884 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905664.1 protein_id gnl|my_center|LOCUS_16100 5981 7396 gene locus_tag LOCUS_16110 5981 7396 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831212.1 protein_id gnl|my_center|LOCUS_16110 7445 9418 gene locus_tag LOCUS_16120 gene uvrB 7445 9418 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_16120 9420 10358 gene locus_tag LOCUS_16130 9420 10358 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986321.1 protein_id gnl|my_center|LOCUS_16130 10627 11244 gene locus_tag LOCUS_16140 10627 11244 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_16140 11247 12008 gene locus_tag LOCUS_16150 11247 12008 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 protein_id gnl|my_center|LOCUS_16150 12065 12727 gene locus_tag LOCUS_16160 12065 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 13278 14852 gene locus_tag LOCUS_16170 13278 14852 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_16170 14900 15667 gene locus_tag LOCUS_16180 14900 15667 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132563.1 protein_id gnl|my_center|LOCUS_16180 15690 16628 gene locus_tag LOCUS_16190 gene cdaA 15690 16628 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674352.1 protein_id gnl|my_center|LOCUS_16190 16612 17406 gene locus_tag LOCUS_16200 16612 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence048 401 1192 gene locus_tag LOCUS_16210 401 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1923 1240 gene locus_tag LOCUS_16220 1923 1240 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_16220 3254 1920 gene locus_tag LOCUS_16230 3254 1920 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_16230 4438 3254 gene locus_tag LOCUS_16240 4438 3254 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048275.1 protein_id gnl|my_center|LOCUS_16240 5604 4483 gene locus_tag LOCUS_16250 5604 4483 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948513.1 protein_id gnl|my_center|LOCUS_16250 6728 5604 gene locus_tag LOCUS_16260 6728 5604 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_16260 7849 6728 gene locus_tag LOCUS_16270 7849 6728 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_16270 8973 7849 gene locus_tag LOCUS_16280 8973 7849 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_16280 9099 10271 gene locus_tag LOCUS_16290 9099 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 10314 11060 gene locus_tag LOCUS_16300 10314 11060 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_16300 11156 12499 gene locus_tag LOCUS_16310 11156 12499 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_16310 13972 12800 gene locus_tag LOCUS_16320 gene rpoN 13972 12800 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_16320 14078 16777 gene locus_tag LOCUS_16330 14078 16777 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323457.1 protein_id gnl|my_center|LOCUS_16330 16879 17292 gene locus_tag LOCUS_16340 16879 17292 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861087.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence049 602 120 gene locus_tag LOCUS_16350 gene dut 602 120 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390601.1 protein_id gnl|my_center|LOCUS_16350 1056 595 gene locus_tag LOCUS_16360 1056 595 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_16360 2339 1041 gene locus_tag LOCUS_16370 gene rimO 2339 1041 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_16370 3274 2336 gene locus_tag LOCUS_16380 gene yhaM 3274 2336 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_16380 5238 3271 gene locus_tag LOCUS_16390 5238 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6282 5242 gene locus_tag LOCUS_16400 6282 5242 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_16400 7349 6291 gene locus_tag LOCUS_16410 7349 6291 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966297.1 protein_id gnl|my_center|LOCUS_16410 7950 7633 gene locus_tag LOCUS_16420 7950 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 8873 8043 gene locus_tag LOCUS_16430 8873 8043 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964769.1 protein_id gnl|my_center|LOCUS_16430 9715 8876 gene locus_tag LOCUS_16440 9715 8876 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 protein_id gnl|my_center|LOCUS_16440 10261 9770 gene locus_tag LOCUS_16450 10261 9770 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896729.1 protein_id gnl|my_center|LOCUS_16450 10745 10317 gene locus_tag LOCUS_16460 10745 10317 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964766.1 protein_id gnl|my_center|LOCUS_16460 12286 10982 gene locus_tag LOCUS_16470 12286 10982 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_16470 12945 12286 gene locus_tag LOCUS_16480 12945 12286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 protein_id gnl|my_center|LOCUS_16480 14248 12938 gene locus_tag LOCUS_16490 14248 12938 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964763.1 protein_id gnl|my_center|LOCUS_16490 15225 14245 gene locus_tag LOCUS_16500 15225 14245 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_16500 15599 15273 gene locus_tag LOCUS_16510 15599 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 16365 15592 gene locus_tag LOCUS_16520 16365 15592 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 protein_id gnl|my_center|LOCUS_16520 16907 16365 gene locus_tag LOCUS_16530 16907 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 16986 17417 gene locus_tag LOCUS_16540 gene paaI 16986 17417 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence050 63 2402 gene locus_tag LOCUS_16550 63 2402 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941424.1 protein_id gnl|my_center|LOCUS_16550 2625 3080 gene locus_tag LOCUS_16560 2625 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3077 3544 gene locus_tag LOCUS_16570 3077 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3811 3566 gene locus_tag LOCUS_16580 3811 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4122 6734 gene locus_tag LOCUS_16590 gene valS 4122 6734 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_16590 7607 6834 gene locus_tag LOCUS_16600 7607 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7796 8158 gene locus_tag LOCUS_16610 7796 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8386 9534 gene locus_tag LOCUS_16620 8386 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11248 9902 gene locus_tag LOCUS_16630 11248 9902 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016886.1 protein_id gnl|my_center|LOCUS_16630 11602 12519 gene locus_tag LOCUS_16640 11602 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12739 14058 gene locus_tag LOCUS_16650 12739 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 14060 14617 gene locus_tag LOCUS_16660 14060 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 14556 15167 gene locus_tag LOCUS_16670 14556 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 15538 15678 gene locus_tag LOCUS_16680 15538 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 15712 16515 gene locus_tag LOCUS_16690 15712 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16616 16789 gene locus_tag LOCUS_16700 16616 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence051 2234 2004 gene locus_tag LOCUS_16710 gene secG 2234 2004 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727926.1 protein_id gnl|my_center|LOCUS_16710 3060 2290 gene locus_tag LOCUS_16720 3060 2290 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016102.1 protein_id gnl|my_center|LOCUS_16720 3630 3085 gene locus_tag LOCUS_16730 gene nusG 3630 3085 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415794.1 protein_id gnl|my_center|LOCUS_16730 3838 3641 gene locus_tag LOCUS_16740 3838 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4614 4042 gene locus_tag LOCUS_16750 4614 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5430 4714 gene locus_tag LOCUS_16760 gene rlmB 5430 4714 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_16760 5813 5427 gene locus_tag LOCUS_16770 5813 5427 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 protein_id gnl|my_center|LOCUS_16770 7144 5813 gene locus_tag LOCUS_16780 gene cysS 7144 5813 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152276.1 protein_id gnl|my_center|LOCUS_16780 7896 7216 gene locus_tag LOCUS_16790 7896 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 8065 7889 gene locus_tag LOCUS_16800 8065 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 9257 8244 gene locus_tag LOCUS_16810 gene gap 9257 8244 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_16810 9451 9945 gene locus_tag LOCUS_16820 9451 9945 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_16820 9945 11105 gene locus_tag LOCUS_16830 9945 11105 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_16830 12859 11165 gene locus_tag LOCUS_16840 gene pgcA 12859 11165 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_16840 13193 12927 gene locus_tag LOCUS_16850 13193 12927 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154654.1 protein_id gnl|my_center|LOCUS_16850 13680 13255 gene locus_tag LOCUS_16860 13680 13255 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_16860 15119 13680 gene locus_tag LOCUS_16870 gene glgA 15119 13680 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922502.1 protein_id gnl|my_center|LOCUS_16870 16234 15119 gene locus_tag LOCUS_16880 gene glgD 16234 15119 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_16880 <17199 16237 gene locus_tag LOCUS_16890 <17199 16237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922500.1:glucose-1-phosphate adenylyltransferase >Feature sequence052 125 1054 gene locus_tag LOCUS_16900 125 1054 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 protein_id gnl|my_center|LOCUS_16900 2303 1071 gene locus_tag LOCUS_16910 gene tyrS 2303 1071 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355444.1 protein_id gnl|my_center|LOCUS_16910 3809 2556 gene locus_tag LOCUS_16920 3809 2556 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 protein_id gnl|my_center|LOCUS_16920 6236 3822 gene locus_tag LOCUS_16930 gene leuS 6236 3822 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_16930 6858 6490 gene locus_tag LOCUS_16940 6858 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7234 6839 gene locus_tag LOCUS_16950 7234 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 7355 7194 gene locus_tag LOCUS_16960 7355 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 7734 7342 gene locus_tag LOCUS_16970 7734 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8011 7712 gene locus_tag LOCUS_16980 gene comGC 8011 7712 CDS product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 protein_id gnl|my_center|LOCUS_16980 8973 8026 gene locus_tag LOCUS_16990 8973 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 9925 8933 gene locus_tag LOCUS_17000 gene comGA 9925 8933 CDS product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 protein_id gnl|my_center|LOCUS_17000 10592 9969 gene locus_tag LOCUS_17010 10592 9969 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_17010 10781 10632 gene locus_tag LOCUS_17020 gene rpmG 10781 10632 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_17020 12936 10861 gene locus_tag LOCUS_17030 gene pbpA 12936 10861 CDS product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 protein_id gnl|my_center|LOCUS_17030 13039 14088 gene locus_tag LOCUS_17040 gene ispG 13039 14088 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_17040 14934 14095 gene locus_tag LOCUS_17050 14934 14095 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990126.1 protein_id gnl|my_center|LOCUS_17050 16253 14931 gene locus_tag LOCUS_17060 gene cshB 16253 14931 CDS product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721956.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence053 524 36 gene locus_tag LOCUS_17070 524 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 909 616 gene locus_tag LOCUS_17080 909 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2239 1301 gene locus_tag LOCUS_17090 2239 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4113 2353 gene locus_tag LOCUS_17100 gene cps4A 4113 2353 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_17100 4590 4228 gene locus_tag LOCUS_17110 4590 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6162 4654 gene locus_tag LOCUS_17120 6162 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7728 6232 gene locus_tag LOCUS_17130 7728 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9098 7731 gene locus_tag LOCUS_17140 9098 7731 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_17140 9809 9192 gene locus_tag LOCUS_17150 9809 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10452 9736 gene locus_tag LOCUS_17160 10452 9736 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966341.1 protein_id gnl|my_center|LOCUS_17160 11231 10455 gene locus_tag LOCUS_17170 11231 10455 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_17170 11935 11231 gene locus_tag LOCUS_17180 11935 11231 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033073.1 protein_id gnl|my_center|LOCUS_17180 13277 12039 gene locus_tag LOCUS_17190 13277 12039 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685095.1 protein_id gnl|my_center|LOCUS_17190 15774 13402 gene locus_tag LOCUS_17200 15774 13402 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence054 687 322 gene locus_tag LOCUS_17210 687 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2918 771 gene locus_tag LOCUS_17220 2918 771 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 protein_id gnl|my_center|LOCUS_17220 4309 2975 gene locus_tag LOCUS_17230 4309 2975 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_17230 4594 5436 gene locus_tag LOCUS_17240 4594 5436 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_17240 5566 6987 gene locus_tag LOCUS_17250 5566 6987 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_17250 6987 7826 gene locus_tag LOCUS_17260 6987 7826 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_17260 7933 8367 gene locus_tag LOCUS_17270 7933 8367 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893678.1 protein_id gnl|my_center|LOCUS_17270 8364 9032 gene locus_tag LOCUS_17280 8364 9032 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_17280 9416 9042 gene locus_tag LOCUS_17290 9416 9042 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_17290 9579 9361 gene locus_tag LOCUS_17300 9579 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 11140 9767 gene locus_tag LOCUS_17310 11140 9767 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_17310 12019 11153 gene locus_tag LOCUS_17320 12019 11153 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_17320 12684 12115 gene locus_tag LOCUS_17330 12684 12115 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_17330 13631 12783 gene locus_tag LOCUS_17340 gene prmC 13631 12783 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227647.1 protein_id gnl|my_center|LOCUS_17340 14707 13631 gene locus_tag LOCUS_17350 gene prfA 14707 13631 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_17350 14873 16252 gene locus_tag LOCUS_17360 14873 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence055 50 985 gene locus_tag LOCUS_17370 50 985 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166554.1 protein_id gnl|my_center|LOCUS_17370 982 1509 gene locus_tag LOCUS_17380 982 1509 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681144.1 protein_id gnl|my_center|LOCUS_17380 1506 2033 gene locus_tag LOCUS_17390 1506 2033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764419.1 protein_id gnl|my_center|LOCUS_17390 3078 2239 gene locus_tag LOCUS_17400 3078 2239 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898793.1 protein_id gnl|my_center|LOCUS_17400 4924 3113 gene locus_tag LOCUS_17410 gene rnjA 4924 3113 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_17410 5550 4999 gene locus_tag LOCUS_17420 gene def 5550 4999 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831696.1 protein_id gnl|my_center|LOCUS_17420 5648 6856 gene locus_tag LOCUS_17430 gene ftsW 5648 6856 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787940.1 protein_id gnl|my_center|LOCUS_17430 6853 7407 gene locus_tag LOCUS_17440 gene rsmD 6853 7407 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900954.1 protein_id gnl|my_center|LOCUS_17440 7404 7880 gene locus_tag LOCUS_17450 gene coaD 7404 7880 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416314.1 protein_id gnl|my_center|LOCUS_17450 7882 8565 gene locus_tag LOCUS_17460 gene rncS 7882 8565 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_17460 8567 12880 gene locus_tag LOCUS_17470 8567 12880 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_17470 12963 14174 gene locus_tag LOCUS_17480 12963 14174 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_17480 14282 14554 gene locus_tag LOCUS_17490 14282 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 15434 14535 gene locus_tag LOCUS_17500 15434 14535 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence056 1117 2442 gene locus_tag LOCUS_17510 1117 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2735 3541 gene locus_tag LOCUS_17520 2735 3541 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583591.1 protein_id gnl|my_center|LOCUS_17520 3544 4536 gene locus_tag LOCUS_17530 3544 4536 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_17530 4635 5306 gene locus_tag LOCUS_17540 4635 5306 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 protein_id gnl|my_center|LOCUS_17540 5306 6259 gene locus_tag LOCUS_17550 5306 6259 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 protein_id gnl|my_center|LOCUS_17550 6273 6920 gene locus_tag LOCUS_17560 gene pcp 6273 6920 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_17560 7458 8288 gene locus_tag LOCUS_17570 7458 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17570 8291 9013 gene locus_tag LOCUS_17580 8291 9013 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_17580 9024 9761 gene locus_tag LOCUS_17590 9024 9761 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_17590 9865 11403 gene locus_tag LOCUS_17600 gene gpmI 9865 11403 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_17600 11493 12179 gene locus_tag LOCUS_17610 11493 12179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_17610 12172 13566 gene locus_tag LOCUS_17620 12172 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 14579 13563 gene locus_tag LOCUS_17630 14579 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 14713 15081 gene locus_tag LOCUS_17640 14713 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence057 1001 24 gene locus_tag LOCUS_17650 gene frlB 1001 24 CDS product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 protein_id gnl|my_center|LOCUS_17650 1546 2340 gene locus_tag LOCUS_17660 1546 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4110 2440 gene locus_tag LOCUS_17670 4110 2440 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_17670 5344 4112 gene locus_tag LOCUS_17680 gene purD 5344 4112 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 protein_id gnl|my_center|LOCUS_17680 5791 5468 gene locus_tag LOCUS_17690 5791 5468 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_17690 5992 7365 gene locus_tag LOCUS_17700 5992 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7901 7410 gene locus_tag LOCUS_17710 7901 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 8948 8034 gene locus_tag LOCUS_17720 gene trxB 8948 8034 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_17720 10381 8924 gene locus_tag LOCUS_17730 10381 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11321 10359 gene locus_tag LOCUS_17740 gene hprK 11321 10359 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_17740 14148 11299 gene locus_tag LOCUS_17750 gene uvrA 14148 11299 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990003.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence058 148 504 gene locus_tag LOCUS_17760 148 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 727 1398 gene locus_tag LOCUS_17770 727 1398 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073543581.1 protein_id gnl|my_center|LOCUS_17770 1409 3481 gene locus_tag LOCUS_17780 gene fusA 1409 3481 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_17780 4291 3521 gene locus_tag LOCUS_17790 4291 3521 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_17790 4381 6117 gene locus_tag LOCUS_17800 4381 6117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_17800 6220 7923 gene locus_tag LOCUS_17810 gene ptsP 6220 7923 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 protein_id gnl|my_center|LOCUS_17810 7972 9711 gene locus_tag LOCUS_17820 7972 9711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897981.1 protein_id gnl|my_center|LOCUS_17820 9698 11455 gene locus_tag LOCUS_17830 9698 11455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986492.1 protein_id gnl|my_center|LOCUS_17830 12121 11465 gene locus_tag LOCUS_17840 12121 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12254 12769 gene locus_tag LOCUS_17850 12254 12769 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_17850 12766 13479 gene locus_tag LOCUS_17860 12766 13479 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence059 655 1908 gene locus_tag LOCUS_17870 655 1908 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_17870 1868 2038 gene locus_tag LOCUS_17880 1868 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2647 2925 gene locus_tag LOCUS_17890 2647 2925 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 protein_id gnl|my_center|LOCUS_17890 2979 3125 gene locus_tag LOCUS_17900 2979 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3259 3576 gene locus_tag LOCUS_17910 3259 3576 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_17910 3561 3881 gene locus_tag LOCUS_17920 3561 3881 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_17920 4050 4175 gene locus_tag LOCUS_17930 4050 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5180 5365 gene locus_tag LOCUS_17940 5180 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5359 6231 gene locus_tag LOCUS_17950 5359 6231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_17950 6224 7342 gene locus_tag LOCUS_17960 6224 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7353 8528 gene locus_tag LOCUS_17970 7353 8528 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861380.1 protein_id gnl|my_center|LOCUS_17970 8655 9308 gene locus_tag LOCUS_17980 8655 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 10243 9611 gene locus_tag LOCUS_17990 10243 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 11541 10831 gene locus_tag LOCUS_18000 11541 10831 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_18000 12125 11817 gene locus_tag LOCUS_18010 12125 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 12508 13416 gene locus_tag LOCUS_18020 12508 13416 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence060 555 1739 gene locus_tag LOCUS_18030 555 1739 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_18030 2503 1736 gene locus_tag LOCUS_18040 2503 1736 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783138.1 protein_id gnl|my_center|LOCUS_18040 3701 2505 gene locus_tag LOCUS_18050 gene coaBC 3701 2505 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 protein_id gnl|my_center|LOCUS_18050 3878 5011 gene locus_tag LOCUS_18060 3878 5011 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831597.1 protein_id gnl|my_center|LOCUS_18060 5020 5529 gene locus_tag LOCUS_18070 5020 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5522 6505 gene locus_tag LOCUS_18080 gene ansB 5522 6505 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394102.1 protein_id gnl|my_center|LOCUS_18080 6583 6972 gene locus_tag LOCUS_18090 6583 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811520.1 protein_id gnl|my_center|LOCUS_18090 7069 7611 gene locus_tag LOCUS_18100 7069 7611 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_18100 7675 7923 gene locus_tag LOCUS_18110 7675 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7938 8399 gene locus_tag LOCUS_18120 7938 8399 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_18120 8464 8985 gene locus_tag LOCUS_18130 8464 8985 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_18130 9134 10039 gene locus_tag LOCUS_18140 gene nadA 9134 10039 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_18140 10041 11333 gene locus_tag LOCUS_18150 10041 11333 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_18150 11326 12177 gene locus_tag LOCUS_18160 gene nadC 11326 12177 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_18160 12178 12684 gene locus_tag LOCUS_18170 12178 12684 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence061 423 956 gene locus_tag LOCUS_18180 gene thiW 423 956 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 protein_id gnl|my_center|LOCUS_18180 937 1707 gene locus_tag LOCUS_18190 gene thiM 937 1707 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986722.1 protein_id gnl|my_center|LOCUS_18190 1704 2333 gene locus_tag LOCUS_18200 gene thiE 1704 2333 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_18200 2380 3738 gene locus_tag LOCUS_18210 2380 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4069 3785 gene locus_tag LOCUS_18220 4069 3785 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183098.1 protein_id gnl|my_center|LOCUS_18220 4638 4093 gene locus_tag LOCUS_18230 4638 4093 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_18230 5342 4707 gene locus_tag LOCUS_18240 5342 4707 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_18240 6487 5492 gene locus_tag LOCUS_18250 6487 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8003 6549 gene locus_tag LOCUS_18260 8003 6549 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_18260 12458 8019 gene locus_tag LOCUS_18270 gene gltB 12458 8019 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence062 <1 2083 gene locus_tag LOCUS_18280 <1 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103372260.1:CDP-glycerol glycerophosphotransferase family protein 2111 5122 gene locus_tag LOCUS_18290 2111 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5187 7691 gene locus_tag LOCUS_18300 5187 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8042 9196 gene locus_tag LOCUS_18310 8042 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9237 9668 gene locus_tag LOCUS_18320 9237 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 9691 9858 gene locus_tag LOCUS_18330 9691 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 10283 11794 gene locus_tag LOCUS_18340 10283 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence063 949 215 gene locus_tag LOCUS_18350 949 215 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_18350 2480 942 gene locus_tag LOCUS_18360 2480 942 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 protein_id gnl|my_center|LOCUS_18360 3746 2772 gene locus_tag LOCUS_18370 3746 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4184 3840 gene locus_tag LOCUS_18380 4184 3840 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_18380 6867 4186 gene locus_tag LOCUS_18390 6867 4186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_18390 7531 6869 gene locus_tag LOCUS_18400 gene hypB 7531 6869 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_18400 7656 8444 gene locus_tag LOCUS_18410 7656 8444 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_18410 8422 9390 gene locus_tag LOCUS_18420 8422 9390 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_18420 10175 9480 gene locus_tag LOCUS_18430 10175 9480 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_18430 10260 10814 gene locus_tag LOCUS_18440 10260 10814 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_18440 11598 10807 gene locus_tag LOCUS_18450 11598 10807 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_18450 12023 11595 gene locus_tag LOCUS_18460 12023 11595 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence064 309 1652 gene locus_tag LOCUS_18470 309 1652 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_18470 1703 2623 gene locus_tag LOCUS_18480 1703 2623 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476646.1 protein_id gnl|my_center|LOCUS_18480 2675 2968 gene locus_tag LOCUS_18490 2675 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2971 3861 gene locus_tag LOCUS_18500 2971 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3973 4251 gene locus_tag LOCUS_18510 3973 4251 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889969.1 protein_id gnl|my_center|LOCUS_18510 4238 4864 gene locus_tag LOCUS_18520 4238 4864 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_18520 5907 4861 gene locus_tag LOCUS_18530 5907 4861 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_18530 5992 6549 gene locus_tag LOCUS_18540 5992 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6560 7120 gene locus_tag LOCUS_18550 gene dhaS 6560 7120 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204281.1 protein_id gnl|my_center|LOCUS_18550 7417 9330 gene locus_tag LOCUS_18560 gene lysS 7417 9330 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922069.1 protein_id gnl|my_center|LOCUS_18560 10302 11951 gene locus_tag LOCUS_18570 10302 11951 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461634.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence065 445 2532 gene locus_tag LOCUS_18580 445 2532 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_18580 2629 3789 gene locus_tag LOCUS_18590 2629 3789 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_18590 3786 4955 gene locus_tag LOCUS_18600 3786 4955 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_18600 5925 5002 gene locus_tag LOCUS_18610 5925 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7453 5936 gene locus_tag LOCUS_18620 7453 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7636 8799 gene locus_tag LOCUS_18630 7636 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8805 9692 gene locus_tag LOCUS_18640 8805 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 11123 9858 gene locus_tag LOCUS_18650 11123 9858 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889841.1 protein_id gnl|my_center|LOCUS_18650 11761 11120 gene locus_tag LOCUS_18660 11761 11120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285815.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence066 633 2102 gene locus_tag LOCUS_18670 633 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3113 2022 gene locus_tag LOCUS_18680 3113 2022 CDS product IS1595-like element ISSsu9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775606.1 protein_id gnl|my_center|LOCUS_18680 3266 3508 gene locus_tag LOCUS_18690 3266 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3703 7695 gene locus_tag LOCUS_18700 3703 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7820 9259 gene locus_tag LOCUS_18710 7820 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9310 10218 gene locus_tag LOCUS_18720 9310 10218 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_18720 10364 11380 gene locus_tag LOCUS_18730 10364 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence067 1389 448 gene locus_tag LOCUS_18740 1389 448 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767244.1 protein_id gnl|my_center|LOCUS_18740 3658 1352 gene locus_tag LOCUS_18750 3658 1352 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184833.1 protein_id gnl|my_center|LOCUS_18750 4444 3722 gene locus_tag LOCUS_18760 4444 3722 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_18760 4510 5811 gene locus_tag LOCUS_18770 4510 5811 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_18770 6316 5771 gene locus_tag LOCUS_18780 gene yfcE 6316 5771 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_18780 8018 6369 gene locus_tag LOCUS_18790 8018 6369 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_18790 8760 8107 gene locus_tag LOCUS_18800 gene catA 8760 8107 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668557.1 protein_id gnl|my_center|LOCUS_18800 9644 8769 gene locus_tag LOCUS_18810 9644 8769 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_18810 10151 9699 gene locus_tag LOCUS_18820 gene bcp 10151 9699 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_18820 11458 10238 gene locus_tag LOCUS_18830 gene rlmD 11458 10238 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476294.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence068 512 817 gene locus_tag LOCUS_18840 512 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 814 1158 gene locus_tag LOCUS_18850 814 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3468 1564 gene locus_tag LOCUS_18860 3468 1564 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965088.1 protein_id gnl|my_center|LOCUS_18860 5051 3534 gene locus_tag LOCUS_18870 5051 3534 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_18870 5189 5830 gene locus_tag LOCUS_18880 5189 5830 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_18880 5817 6704 gene locus_tag LOCUS_18890 5817 6704 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_18890 6719 7915 gene locus_tag LOCUS_18900 6719 7915 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_18900 9193 8402 gene locus_tag LOCUS_18910 9193 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 9255 9623 gene locus_tag LOCUS_18920 9255 9623 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_18920 9686 10906 gene locus_tag LOCUS_18930 9686 10906 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence069 805 335 gene locus_tag LOCUS_18940 805 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272655.1 protein_id gnl|my_center|LOCUS_18940 1641 892 gene locus_tag LOCUS_18950 1641 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4664 1647 gene locus_tag LOCUS_18960 4664 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5717 5034 gene locus_tag LOCUS_18970 5717 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6953 5973 gene locus_tag LOCUS_18980 6953 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 7476 7171 gene locus_tag LOCUS_18990 7476 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 8308 7490 gene locus_tag LOCUS_19000 8308 7490 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_19000 8699 8624 gene locus_tag LOCUS_t00270 8699 8624 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9519 8893 gene locus_tag LOCUS_19010 9519 8893 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266015.1 protein_id gnl|my_center|LOCUS_19010 9608 9532 gene locus_tag LOCUS_t00280 9608 9532 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9700 10953 gene locus_tag LOCUS_19020 gene uraA 9700 10953 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence070 2565 421 gene locus_tag LOCUS_19030 2565 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3352 2549 gene locus_tag LOCUS_19040 3352 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4829 3354 gene locus_tag LOCUS_19050 4829 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 7067 4899 gene locus_tag LOCUS_19060 7067 4899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130435197.1 protein_id gnl|my_center|LOCUS_19060 8919 7165 gene locus_tag LOCUS_19070 8919 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence071 240 563 gene locus_tag LOCUS_19080 240 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 676 984 gene locus_tag LOCUS_19090 676 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1965 1111 gene locus_tag LOCUS_19100 1965 1111 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_19100 2874 2020 gene locus_tag LOCUS_19110 2874 2020 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_19110 4133 2871 gene locus_tag LOCUS_19120 gene aroA 4133 2871 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_19120 5239 4130 gene locus_tag LOCUS_19130 gene aroC 5239 4130 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_19130 6242 5229 gene locus_tag LOCUS_19140 gene aroB 6242 5229 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702179.1 protein_id gnl|my_center|LOCUS_19140 6325 6933 gene locus_tag LOCUS_19150 6325 6933 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678955.1 protein_id gnl|my_center|LOCUS_19150 7371 6928 gene locus_tag LOCUS_19160 7371 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 8064 7471 gene locus_tag LOCUS_19170 8064 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 9104 8136 gene locus_tag LOCUS_19180 9104 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 9138 9551 gene locus_tag LOCUS_19190 9138 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence072 54 377 gene locus_tag LOCUS_19200 54 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 358 915 gene locus_tag LOCUS_19210 358 915 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_19210 1020 3077 gene locus_tag LOCUS_19220 1020 3077 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_19220 3305 3607 gene locus_tag LOCUS_19230 gene rplU 3305 3607 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_19230 3610 3924 gene locus_tag LOCUS_19240 3610 3924 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564644.1 protein_id gnl|my_center|LOCUS_19240 3928 4212 gene locus_tag LOCUS_19250 gene rpmA 3928 4212 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944957.1 protein_id gnl|my_center|LOCUS_19250 4277 5557 gene locus_tag LOCUS_19260 gene obgE 4277 5557 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_19260 5619 6368 gene locus_tag LOCUS_19270 5619 6368 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569685.1 protein_id gnl|my_center|LOCUS_19270 6370 6948 gene locus_tag LOCUS_19280 gene ruvA 6370 6948 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272487.1 protein_id gnl|my_center|LOCUS_19280 6954 7964 gene locus_tag LOCUS_19290 gene ruvB 6954 7964 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_19290 8013 9557 gene locus_tag LOCUS_19300 8013 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence073 131 1891 gene locus_tag LOCUS_19310 131 1891 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_19310 1980 2759 gene locus_tag LOCUS_19320 1980 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4213 2774 gene locus_tag LOCUS_19330 4213 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4457 4714 gene locus_tag LOCUS_19340 4457 4714 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_19340 4707 5750 gene locus_tag LOCUS_19350 gene hydE 4707 5750 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_19350 5768 7216 gene locus_tag LOCUS_19360 gene hydG 5768 7216 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_19360 7219 8391 gene locus_tag LOCUS_19370 gene hydF 7219 8391 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_19370 8392 9207 gene locus_tag LOCUS_19380 8392 9207 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence074 230 979 gene locus_tag LOCUS_19390 230 979 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_19390 991 1446 gene locus_tag LOCUS_19400 991 1446 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_19400 1504 1580 gene locus_tag LOCUS_t00290 1504 1580 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1607 1682 gene locus_tag LOCUS_t00300 1607 1682 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1782 2930 gene locus_tag LOCUS_19410 1782 2930 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_19410 2964 3158 gene locus_tag LOCUS_19420 2964 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5156 3195 gene locus_tag LOCUS_19430 5156 3195 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_19430 5811 5248 gene locus_tag LOCUS_19440 5811 5248 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_19440 6044 6331 gene locus_tag LOCUS_19450 6044 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6501 7670 gene locus_tag LOCUS_19460 6501 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 7734 9050 gene locus_tag LOCUS_19470 7734 9050 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence075 607 446 gene locus_tag LOCUS_19480 607 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1900 737 gene locus_tag LOCUS_19490 gene cytX 1900 737 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_19490 2706 1897 gene locus_tag LOCUS_19500 gene thiD 2706 1897 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_19500 3788 2961 gene locus_tag LOCUS_19510 3788 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3858 4259 gene locus_tag LOCUS_19520 3858 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4627 4406 gene locus_tag LOCUS_19530 4627 4406 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_19530 5226 4630 gene locus_tag LOCUS_19540 5226 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5225 5419 gene locus_tag LOCUS_19550 5225 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5385 5618 gene locus_tag LOCUS_19560 5385 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19560 6997 5987 gene locus_tag LOCUS_19570 6997 5987 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922035.1 protein_id gnl|my_center|LOCUS_19570 8934 7060 gene locus_tag LOCUS_19580 8934 7060 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922036.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence076 1569 133 gene locus_tag LOCUS_19590 gene bglH 1569 133 CDS product aryl-phospho-beta-d-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243232.1 protein_id gnl|my_center|LOCUS_19590 2062 1571 gene locus_tag LOCUS_19600 2062 1571 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897702.1 protein_id gnl|my_center|LOCUS_19600 3453 2065 gene locus_tag LOCUS_19610 3453 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 4327 3446 gene locus_tag LOCUS_19620 4327 3446 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440056.1 protein_id gnl|my_center|LOCUS_19620 5716 4967 gene locus_tag LOCUS_19630 5716 4967 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_19630 8586 5956 gene locus_tag LOCUS_19640 gene ppdK 8586 5956 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence077 <1 2670 gene locus_tag LOCUS_19650 <1 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002323457.1:sigma 54-interacting transcriptional regulator 2830 2976 gene locus_tag LOCUS_19660 2830 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4649 3387 gene locus_tag LOCUS_19670 4649 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5368 4739 gene locus_tag LOCUS_19680 gene ttdB 5368 4739 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596657.1 protein_id gnl|my_center|LOCUS_19680 6300 5389 gene locus_tag LOCUS_19690 gene ttdA 6300 5389 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_19690 7462 6527 gene locus_tag LOCUS_19700 7462 6527 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_19700 8677 7514 gene locus_tag LOCUS_19710 8677 7514 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence078 1424 2338 gene locus_tag LOCUS_19720 1424 2338 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837478.1 protein_id gnl|my_center|LOCUS_19720 2340 3125 gene locus_tag LOCUS_19730 2340 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3129 3920 gene locus_tag LOCUS_19740 3129 3920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 protein_id gnl|my_center|LOCUS_19740 4059 4937 gene locus_tag LOCUS_19750 4059 4937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 protein_id gnl|my_center|LOCUS_19750 5023 6033 gene locus_tag LOCUS_19760 5023 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 6045 7400 gene locus_tag LOCUS_19770 6045 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 7657 8001 gene locus_tag LOCUS_19780 7657 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8033 8191 gene locus_tag LOCUS_19790 8033 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence079 253 918 gene locus_tag LOCUS_19800 253 918 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860672.1 protein_id gnl|my_center|LOCUS_19800 1263 940 gene locus_tag LOCUS_19810 gene mazF 1263 940 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_19810 1514 1263 gene locus_tag LOCUS_19820 1514 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1677 2540 gene locus_tag LOCUS_19830 1677 2540 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 protein_id gnl|my_center|LOCUS_19830 2533 3735 gene locus_tag LOCUS_19840 2533 3735 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830748.1 protein_id gnl|my_center|LOCUS_19840 3753 5447 gene locus_tag LOCUS_19850 3753 5447 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_19850 5542 7245 gene locus_tag LOCUS_19860 5542 7245 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964293.1 protein_id gnl|my_center|LOCUS_19860 7247 7957 gene locus_tag LOCUS_19870 7247 7957 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence080 433 606 gene locus_tag LOCUS_19880 433 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 596 1396 gene locus_tag LOCUS_19890 596 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1940 2557 gene locus_tag LOCUS_19900 1940 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3063 3362 gene locus_tag LOCUS_19910 3063 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3377 3625 gene locus_tag LOCUS_19920 3377 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3912 3664 gene locus_tag LOCUS_19930 3912 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4894 4121 gene locus_tag LOCUS_19940 4894 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5549 4887 gene locus_tag LOCUS_19950 5549 4887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677519.1 protein_id gnl|my_center|LOCUS_19950 6535 5630 gene locus_tag LOCUS_19960 6535 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7649 6927 gene locus_tag LOCUS_19970 7649 6927 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948310.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence081 452 1297 gene locus_tag LOCUS_19980 452 1297 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_19980 1299 2771 gene locus_tag LOCUS_19990 1299 2771 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_19990 2771 3367 gene locus_tag LOCUS_20000 2771 3367 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 protein_id gnl|my_center|LOCUS_20000 3364 4278 gene locus_tag LOCUS_20010 3364 4278 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_20010 4323 4700 gene locus_tag LOCUS_20020 4323 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4703 5017 gene locus_tag LOCUS_20030 4703 5017 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002924730.1 protein_id gnl|my_center|LOCUS_20030 5010 5849 gene locus_tag LOCUS_20040 5010 5849 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_20040 6885 5980 gene locus_tag LOCUS_20050 6885 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 7139 6882 gene locus_tag LOCUS_20060 7139 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 7805 7206 gene locus_tag LOCUS_20070 7805 7206 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence082 257 409 gene locus_tag LOCUS_20080 257 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1616 612 gene locus_tag LOCUS_20090 1616 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2345 2794 gene locus_tag LOCUS_20100 2345 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2891 4858 gene locus_tag LOCUS_20110 2891 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5627 5493 gene locus_tag LOCUS_20120 5627 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6038 5883 gene locus_tag LOCUS_20130 6038 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6562 7275 gene locus_tag LOCUS_20140 6562 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence083 1389 97 gene locus_tag LOCUS_20150 1389 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4077 1411 gene locus_tag LOCUS_20160 4077 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7190 4080 gene locus_tag LOCUS_20170 7190 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence084 375 169 gene locus_tag LOCUS_20180 375 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1565 360 gene locus_tag LOCUS_20190 gene pepC 1565 360 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731859.1 protein_id gnl|my_center|LOCUS_20190 2949 1558 gene locus_tag LOCUS_20200 2949 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3236 2940 gene locus_tag LOCUS_20210 3236 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4161 3238 gene locus_tag LOCUS_20220 4161 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4387 4220 gene locus_tag LOCUS_20230 4387 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5443 4496 gene locus_tag LOCUS_20240 5443 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 6635 5436 gene locus_tag LOCUS_20250 6635 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 7279 6641 gene locus_tag LOCUS_20260 7279 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence085 496 1209 gene locus_tag LOCUS_20270 496 1209 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_20270 1471 1247 gene locus_tag LOCUS_20280 1471 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1647 1459 gene locus_tag LOCUS_20290 1647 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2371 1730 gene locus_tag LOCUS_20300 2371 1730 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 protein_id gnl|my_center|LOCUS_20300 2939 2613 gene locus_tag LOCUS_20310 2939 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3331 2936 gene locus_tag LOCUS_20320 3331 2936 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 protein_id gnl|my_center|LOCUS_20320 5298 4000 gene locus_tag LOCUS_20330 gene ltrA 5298 4000 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292559.1 protein_id gnl|my_center|LOCUS_20330 6038 5871 gene locus_tag LOCUS_20340 6038 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7124 6186 gene locus_tag LOCUS_20350 gene rhuM 7124 6186 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence086 236 1639 gene locus_tag LOCUS_20360 gene uxaC 236 1639 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_20360 1852 1691 gene locus_tag LOCUS_20370 1852 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2645 1809 gene locus_tag LOCUS_20380 2645 1809 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_20380 2801 4042 gene locus_tag LOCUS_20390 2801 4042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_20390 4193 4948 gene locus_tag LOCUS_20400 4193 4948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_20400 4970 6895 gene locus_tag LOCUS_20410 4970 6895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence087 438 208 gene locus_tag LOCUS_20420 438 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 564 1757 gene locus_tag LOCUS_20430 gene rpoN 564 1757 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732487.1 protein_id gnl|my_center|LOCUS_20430 3503 1845 gene locus_tag LOCUS_20440 3503 1845 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_20440 5023 3515 gene locus_tag LOCUS_20450 5023 3515 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_20450 6377 5118 gene locus_tag LOCUS_20460 6377 5118 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_20460 7002 7077 gene locus_tag LOCUS_t00310 7002 7077 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 3147 1534 gene locus_tag LOCUS_20470 3147 1534 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_20470 3278 4366 gene locus_tag LOCUS_20480 3278 4366 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_20480 <6826 4632 gene locus_tag LOCUS_20490 <6826 4632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034785583.1:Ig-like domain-containing protein >Feature sequence089 416 1039 gene locus_tag LOCUS_20500 416 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1050 1427 gene locus_tag LOCUS_20510 1050 1427 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665817.1 protein_id gnl|my_center|LOCUS_20510 1585 2487 gene locus_tag LOCUS_20520 gene pyrB 1585 2487 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 protein_id gnl|my_center|LOCUS_20520 2490 3755 gene locus_tag LOCUS_20530 2490 3755 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723081.1 protein_id gnl|my_center|LOCUS_20530 3743 4150 gene locus_tag LOCUS_20540 3743 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4152 4877 gene locus_tag LOCUS_20550 4152 4877 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_20550 4877 5785 gene locus_tag LOCUS_20560 4877 5785 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_20560 5785 6483 gene locus_tag LOCUS_20570 gene pyrF 5785 6483 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence090 2050 581 gene locus_tag LOCUS_20580 2050 581 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_20580 2874 2056 gene locus_tag LOCUS_20590 2874 2056 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_20590 4346 2874 gene locus_tag LOCUS_20600 4346 2874 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_20600 5552 4359 gene locus_tag LOCUS_20610 5552 4359 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_20610 <6545 5621 gene locus_tag LOCUS_20620 <6545 5621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101390.1:PTS transporter subunit EIIC >Feature sequence091 1706 114 gene locus_tag LOCUS_20630 1706 114 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077152662.1 protein_id gnl|my_center|LOCUS_20630 2637 1993 gene locus_tag LOCUS_20640 2637 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3601 2753 gene locus_tag LOCUS_20650 3601 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4787 3771 gene locus_tag LOCUS_20660 4787 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5132 5626 gene locus_tag LOCUS_20670 5132 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5861 5643 gene locus_tag LOCUS_20680 5861 5643 CDS product DUF3791 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390170.1 protein_id gnl|my_center|LOCUS_20680 6142 6405 gene locus_tag LOCUS_20690 6142 6405 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence092 247 1509 gene locus_tag LOCUS_20700 247 1509 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853230.1 protein_id gnl|my_center|LOCUS_20700 1568 2329 gene locus_tag LOCUS_20710 1568 2329 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166819.1 protein_id gnl|my_center|LOCUS_20710 2353 4206 gene locus_tag LOCUS_20720 2353 4206 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 protein_id gnl|my_center|LOCUS_20720 4762 4226 gene locus_tag LOCUS_20730 4762 4226 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_20730 6192 4828 gene locus_tag LOCUS_20740 6192 4828 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence093 548 2185 gene locus_tag LOCUS_20750 548 2185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_20750 2854 3081 gene locus_tag LOCUS_20760 2854 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4597 3506 gene locus_tag LOCUS_20770 4597 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4933 4598 gene locus_tag LOCUS_20780 4933 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 5733 5897 gene locus_tag LOCUS_20790 5733 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 6113 5871 gene locus_tag LOCUS_20800 6113 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6213 6138 gene locus_tag LOCUS_t00320 6213 6138 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6293 6217 gene locus_tag LOCUS_t00330 6293 6217 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence094 <1 1263 gene locus_tag LOCUS_20810 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000521476.1:phosphoglucosamine mutase 1279 1938 gene locus_tag LOCUS_20820 1279 1938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_20820 1999 3414 gene locus_tag LOCUS_20830 gene cssS 1999 3414 CDS product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 protein_id gnl|my_center|LOCUS_20830 3411 4394 gene locus_tag LOCUS_20840 3411 4394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 protein_id gnl|my_center|LOCUS_20840 5060 4386 gene locus_tag LOCUS_20850 gene yaaA 5060 4386 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 protein_id gnl|my_center|LOCUS_20850 5143 6171 gene locus_tag LOCUS_20860 5143 6171 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence095 2 943 gene locus_tag LOCUS_20870 2 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 961 1314 gene locus_tag LOCUS_20880 961 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1422 2918 gene locus_tag LOCUS_20890 1422 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2932 3816 gene locus_tag LOCUS_20900 2932 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3998 5110 gene locus_tag LOCUS_20910 3998 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence096 1387 236 gene locus_tag LOCUS_20920 1387 236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_20920 2721 2242 gene locus_tag LOCUS_20930 2721 2242 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_20930 2851 2776 gene locus_tag LOCUS_t00340 2851 2776 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2942 2866 gene locus_tag LOCUS_t00350 2942 2866 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3089 4729 gene locus_tag LOCUS_20940 3089 4729 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_20940 5658 4762 gene locus_tag LOCUS_20950 5658 4762 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836909.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence097 920 171 gene locus_tag LOCUS_20960 920 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 977 1483 gene locus_tag LOCUS_20970 977 1483 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_20970 1562 2485 gene locus_tag LOCUS_20980 1562 2485 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_20980 2529 3005 gene locus_tag LOCUS_20990 2529 3005 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_20990 3061 4065 gene locus_tag LOCUS_21000 3061 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_21000 4070 4891 gene locus_tag LOCUS_21010 4070 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 5930 4971 gene locus_tag LOCUS_21020 5930 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence098 161 595 gene locus_tag LOCUS_21030 161 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 605 2104 gene locus_tag LOCUS_21040 605 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2106 3026 gene locus_tag LOCUS_21050 2106 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3202 4767 gene locus_tag LOCUS_21060 3202 4767 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_21060 4871 5884 gene locus_tag LOCUS_21070 4871 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence099 454 1674 gene locus_tag LOCUS_21080 454 1674 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_21080 1678 2313 gene locus_tag LOCUS_21090 1678 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2332 5193 gene locus_tag LOCUS_21100 2332 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5342 5965 gene locus_tag LOCUS_21110 5342 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence100 1632 691 gene locus_tag LOCUS_21120 1632 691 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949031.1 protein_id gnl|my_center|LOCUS_21120 2662 3630 gene locus_tag LOCUS_21130 2662 3630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889836.1 protein_id gnl|my_center|LOCUS_21130 3641 4276 gene locus_tag LOCUS_21140 3641 4276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_21140 4278 5645 gene locus_tag LOCUS_21150 4278 5645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298085.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence101 257 3805 gene locus_tag LOCUS_21160 gene nifJ 257 3805 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_21160 3897 4847 gene locus_tag LOCUS_21170 3897 4847 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence102 169 1299 gene locus_tag LOCUS_21180 169 1299 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_21180 1533 2684 gene locus_tag LOCUS_21190 1533 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2685 3755 gene locus_tag LOCUS_21200 2685 3755 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_21200 3810 3941 gene locus_tag LOCUS_21210 3810 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4154 4882 gene locus_tag LOCUS_21220 4154 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence103 581 1276 gene locus_tag LOCUS_21230 581 1276 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_21230 1487 3112 gene locus_tag LOCUS_21240 1487 3112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 protein_id gnl|my_center|LOCUS_21240 3531 4406 gene locus_tag LOCUS_21250 3531 4406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528801.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence104 999 427 gene locus_tag LOCUS_21260 999 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1253 1122 gene locus_tag LOCUS_21270 1253 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 1963 1802 gene locus_tag LOCUS_21280 1963 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2464 2186 gene locus_tag LOCUS_21290 2464 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3088 2798 gene locus_tag LOCUS_21300 3088 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3227 3075 gene locus_tag LOCUS_21310 3227 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3967 3275 gene locus_tag LOCUS_21320 3967 3275 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_21320 4329 3988 gene locus_tag LOCUS_21330 4329 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4672 4310 gene locus_tag LOCUS_21340 4672 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence105 123 278 gene locus_tag LOCUS_21350 123 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 448 1500 gene locus_tag LOCUS_21360 gene hrcA 448 1500 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 protein_id gnl|my_center|LOCUS_21360 1481 2053 gene locus_tag LOCUS_21370 gene grpE 1481 2053 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_21370 2067 3872 gene locus_tag LOCUS_21380 gene dnaK 2067 3872 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475828.1 protein_id gnl|my_center|LOCUS_21380 3940 5052 gene locus_tag LOCUS_21390 gene dnaJ 3940 5052 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence106 386 1135 gene locus_tag LOCUS_21400 386 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1189 2016 gene locus_tag LOCUS_21410 1189 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3115 2021 gene locus_tag LOCUS_21420 3115 2021 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_21420 3249 3992 gene locus_tag LOCUS_21430 3249 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4225 4010 gene locus_tag LOCUS_21440 4225 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4440 4571 gene locus_tag LOCUS_21450 4440 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4576 4758 gene locus_tag LOCUS_21460 4576 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 4775 4897 gene locus_tag LOCUS_21470 4775 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence107 370 1446 gene locus_tag LOCUS_21480 gene carA 370 1446 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_21480 1439 4648 gene locus_tag LOCUS_21490 gene carB 1439 4648 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence108 514 281 gene locus_tag LOCUS_21500 514 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 924 622 gene locus_tag LOCUS_21510 924 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1125 1973 gene locus_tag LOCUS_21520 1125 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2193 2435 gene locus_tag LOCUS_21530 2193 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4204 2453 gene locus_tag LOCUS_21540 4204 2453 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994298.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence109 47 2251 gene locus_tag LOCUS_21550 47 2251 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 protein_id gnl|my_center|LOCUS_21550 2799 2257 gene locus_tag LOCUS_21560 2799 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3799 2789 gene locus_tag LOCUS_21570 3799 2789 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394037.1 protein_id gnl|my_center|LOCUS_21570 3887 4396 gene locus_tag LOCUS_21580 3887 4396 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989883.1 protein_id gnl|my_center|LOCUS_21580 4408 4578 gene locus_tag LOCUS_21590 gene rpmF 4408 4578 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence110 1654 683 gene locus_tag LOCUS_21600 1654 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2861 1644 gene locus_tag LOCUS_21610 2861 1644 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_21610 3983 2865 gene locus_tag LOCUS_21620 3983 2865 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence111 685 380 gene locus_tag LOCUS_21630 685 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1464 823 gene locus_tag LOCUS_21640 1464 823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_21640 2426 1461 gene locus_tag LOCUS_21650 2426 1461 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948749.1 protein_id gnl|my_center|LOCUS_21650 3384 2509 gene locus_tag LOCUS_21660 3384 2509 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948751.1 protein_id gnl|my_center|LOCUS_21660 4160 4014 gene locus_tag LOCUS_21670 4160 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence112 503 321 gene locus_tag LOCUS_21680 503 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 642 508 gene locus_tag LOCUS_21690 642 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1209 1084 gene locus_tag LOCUS_21700 1209 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1650 1444 gene locus_tag LOCUS_21710 1650 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2163 2041 gene locus_tag LOCUS_21720 2163 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2939 2616 gene locus_tag LOCUS_21730 2939 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4262 4125 gene locus_tag LOCUS_21740 4262 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence113 1614 256 gene locus_tag LOCUS_21750 1614 256 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851469.1 protein_id gnl|my_center|LOCUS_21750 3119 1617 gene locus_tag LOCUS_21760 3119 1617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136732.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence114 1168 371 gene locus_tag LOCUS_21770 1168 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1616 1200 gene locus_tag LOCUS_21780 1616 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2125 1697 gene locus_tag LOCUS_21790 2125 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3006 2686 gene locus_tag LOCUS_21800 3006 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3377 3021 gene locus_tag LOCUS_21810 3377 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4164 3553 gene locus_tag LOCUS_21820 4164 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence115 2540 2289 gene locus_tag LOCUS_21830 2540 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4205 2544 gene locus_tag LOCUS_21840 4205 2544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence116 204 923 gene locus_tag LOCUS_21850 204 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 928 3216 gene locus_tag LOCUS_21860 gene rad50 928 3216 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_21860 3239 3868 gene locus_tag LOCUS_21870 3239 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence117 806 177 gene locus_tag LOCUS_21880 806 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1040 861 gene locus_tag LOCUS_21890 1040 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2632 1496 gene locus_tag LOCUS_21900 2632 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636465.1 protein_id gnl|my_center|LOCUS_21900 2793 2629 gene locus_tag LOCUS_21910 2793 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3508 3173 gene locus_tag LOCUS_21920 3508 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence118 679 491 gene locus_tag LOCUS_21930 679 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1499 2446 gene locus_tag LOCUS_21940 1499 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018641672.1 protein_id gnl|my_center|LOCUS_21940 2443 2679 gene locus_tag LOCUS_21950 2443 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence119 141 1745 gene locus_tag LOCUS_21960 141 1745 CDS product IS1182-like element ISFnu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016343.1 protein_id gnl|my_center|LOCUS_21960 1861 3606 gene locus_tag LOCUS_21970 1861 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence120 3 998 gene locus_tag LOCUS_21980 3 998 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_21980 1009 1503 gene locus_tag LOCUS_21990 1009 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1500 2582 gene locus_tag LOCUS_22000 1500 2582 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence121 831 331 gene locus_tag LOCUS_22010 831 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1361 855 gene locus_tag LOCUS_22020 1361 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2037 1867 gene locus_tag LOCUS_22030 2037 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2946 2281 gene locus_tag LOCUS_22040 2946 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence122 2550 16 gene locus_tag LOCUS_22050 2550 16 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187006353.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence123 219 395 gene locus_tag LOCUS_22060 219 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 868 353 gene locus_tag LOCUS_22070 868 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1674 925 gene locus_tag LOCUS_22080 1674 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22080 2222 1743 gene locus_tag LOCUS_22090 2222 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2908 2234 gene locus_tag LOCUS_22100 2908 2234 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence124 318 467 gene locus_tag LOCUS_22110 318 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1014 1502 gene locus_tag LOCUS_22120 1014 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1542 1919 gene locus_tag LOCUS_22130 1542 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2006 2506 gene locus_tag LOCUS_22140 2006 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence125 1499 135 gene locus_tag LOCUS_22150 1499 135 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_22150 2375 1536 gene locus_tag LOCUS_22160 2375 1536 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 protein_id gnl|my_center|LOCUS_22160 3094 2372 gene locus_tag LOCUS_22170 3094 2372 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861086.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence126 628 365 gene locus_tag LOCUS_22180 628 365 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 protein_id gnl|my_center|LOCUS_22180 1615 662 gene locus_tag LOCUS_22190 1615 662 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_22190 2261 1914 gene locus_tag LOCUS_22200 2261 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2366 2292 gene locus_tag LOCUS_t00360 2366 2292 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2631 2380 gene locus_tag LOCUS_22210 2631 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3175 2990 gene locus_tag LOCUS_22220 3175 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence127 224 463 gene locus_tag LOCUS_22230 224 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 460 657 gene locus_tag LOCUS_22240 460 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 826 1317 gene locus_tag LOCUS_22250 826 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence128 1260 64 gene locus_tag LOCUS_22260 gene pepT 1260 64 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_22260 2872 1274 gene locus_tag LOCUS_22270 2872 1274 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence129 190 1605 gene locus_tag LOCUS_22280 gene ccpM 190 1605 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_22280 1595 2614 gene locus_tag LOCUS_22290 1595 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2604 2885 gene locus_tag LOCUS_22300 2604 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence130 <1 1159 gene locus_tag LOCUS_22310 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107236.1:Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain 1149 2120 gene locus_tag LOCUS_22320 1149 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence131 2343 160 gene locus_tag LOCUS_22330 2343 160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_22330 2780 2340 gene locus_tag LOCUS_22340 2780 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence132 374 153 gene locus_tag LOCUS_22350 374 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 696 319 gene locus_tag LOCUS_22360 696 319 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_22360 1475 1332 gene locus_tag LOCUS_22370 1475 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1771 1472 gene locus_tag LOCUS_22380 1771 1472 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 protein_id gnl|my_center|LOCUS_22380 2512 1814 gene locus_tag LOCUS_22390 2512 1814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 protein_id gnl|my_center|LOCUS_22390 2747 2496 gene locus_tag LOCUS_22400 2747 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence133 99 24 gene locus_tag LOCUS_t00370 99 24 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 204 131 gene locus_tag LOCUS_t00380 204 131 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 289 214 gene locus_tag LOCUS_t00390 289 214 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 378 295 gene locus_tag LOCUS_t00400 378 295 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 461 386 gene locus_tag LOCUS_t00410 461 386 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 913 500 gene locus_tag LOCUS_22410 913 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1044 2012 gene locus_tag LOCUS_22420 gene mbl 1044 2012 CDS product cell shape-determining protein Mbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227776.1 protein_id gnl|my_center|LOCUS_22420 2165 2314 gene locus_tag LOCUS_22430 2165 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2971 3046 gene locus_tag LOCUS_t00420 2971 3046 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 2867 2340 gene locus_tag LOCUS_22440 2867 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence135 671 2212 gene locus_tag LOCUS_22450 gene istA 671 2212 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_22450 2212 2949 gene locus_tag LOCUS_22460 gene istB 2212 2949 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence136 <1 1086 gene locus_tag LOCUS_22470 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048372.1:transcription elongation factor GreA 1088 1810 gene locus_tag LOCUS_22480 1088 1810 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890462.1 protein_id gnl|my_center|LOCUS_22480 1827 2798 gene locus_tag LOCUS_22490 1827 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence137 2240 1161 gene locus_tag LOCUS_22500 2240 1161 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_22500 2708 2265 gene locus_tag LOCUS_22510 2708 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence138 910 2388 gene locus_tag LOCUS_22520 910 2388 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649719.1 protein_id gnl|my_center|LOCUS_22520 2879 2448 gene locus_tag LOCUS_22530 gene paaI 2879 2448 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence139 1917 430 gene locus_tag LOCUS_22540 1917 430 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_22540 <2908 1984 gene locus_tag LOCUS_22550 <2908 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836951.1:PTS transporter subunit EIIC >Feature sequence140 1178 2497 gene locus_tag LOCUS_22560 1178 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence141 2103 940 gene locus_tag LOCUS_22570 2103 940 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_22570 <2837 2126 gene locus_tag LOCUS_22580 <2837 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986316.1:1-phosphofructokinase >Feature sequence142 594 1316 gene locus_tag LOCUS_22590 gene trmD 594 1316 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_22590 1436 1783 gene locus_tag LOCUS_22600 gene rplS 1436 1783 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436293.1 protein_id gnl|my_center|LOCUS_22600 1869 2498 gene locus_tag LOCUS_22610 gene lepB 1869 2498 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence143 74 787 gene locus_tag LOCUS_22620 74 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 735 1148 gene locus_tag LOCUS_22630 735 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1356 2432 gene locus_tag LOCUS_22640 1356 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2465 2650 gene locus_tag LOCUS_22650 2465 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence144 1138 215 gene locus_tag LOCUS_22660 1138 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1555 1142 gene locus_tag LOCUS_22670 1555 1142 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202464.1 protein_id gnl|my_center|LOCUS_22670 2426 1548 gene locus_tag LOCUS_22680 2426 1548 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202466.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence145 <2718 2065 gene locus_tag LOCUS_22690 <2718 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945405.1:putative DNA binding domain-containing protein >Feature sequence146 1211 936 gene locus_tag LOCUS_22700 1211 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1322 1639 gene locus_tag LOCUS_22710 1322 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence147 221 1111 gene locus_tag LOCUS_22720 221 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1285 1896 gene locus_tag LOCUS_22730 1285 1896 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183217.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence148 625 846 gene locus_tag LOCUS_22740 625 846 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789042.1 protein_id gnl|my_center|LOCUS_22740 909 1946 gene locus_tag LOCUS_22750 909 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence149 98 631 gene locus_tag LOCUS_22760 98 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 655 1581 gene locus_tag LOCUS_22770 655 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence150 <1 1762 gene locus_tag LOCUS_22780 <1 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895630.1:AAA family ATPase 1765 2517 gene locus_tag LOCUS_22790 1765 2517 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence151 939 778 gene locus_tag LOCUS_22800 939 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2513 912 gene locus_tag LOCUS_22810 2513 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence152 <2528 1934 gene locus_tag LOCUS_22820 <2528 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202422.1:oligosaccharide flippase family protein >Feature sequence153 95 1105 gene locus_tag LOCUS_22830 gene hisC 95 1105 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_22830 1092 1673 gene locus_tag LOCUS_22840 gene hisB 1092 1673 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436680.1 protein_id gnl|my_center|LOCUS_22840 1670 2269 gene locus_tag LOCUS_22850 gene hisH 1670 2269 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_22850