>Feature sequence001 381 181 gene locus_tag LOCUS_00010 381 181 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106389.1 protein_id gnl|my_center|LOCUS_00010 2198 393 gene locus_tag LOCUS_00020 gene kefB 2198 393 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 protein_id gnl|my_center|LOCUS_00020 2749 2198 gene locus_tag LOCUS_00030 gene kefG 2749 2198 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 protein_id gnl|my_center|LOCUS_00030 2876 4786 gene locus_tag LOCUS_00040 2876 4786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_00040 5142 6263 gene locus_tag LOCUS_00050 5142 6263 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 protein_id gnl|my_center|LOCUS_00050 6318 7292 gene locus_tag LOCUS_00060 6318 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8860 7370 gene locus_tag LOCUS_00070 8860 7370 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_00070 9729 8872 gene locus_tag LOCUS_00080 9729 8872 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_00080 9926 10645 gene locus_tag LOCUS_00090 9926 10645 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_00090 10718 11734 gene locus_tag LOCUS_00100 10718 11734 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 protein_id gnl|my_center|LOCUS_00100 11735 11953 gene locus_tag LOCUS_00110 11735 11953 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 protein_id gnl|my_center|LOCUS_00110 12002 12871 gene locus_tag LOCUS_00120 12002 12871 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 protein_id gnl|my_center|LOCUS_00120 13323 12916 gene locus_tag LOCUS_00130 13323 12916 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 protein_id gnl|my_center|LOCUS_00130 13634 14266 gene locus_tag LOCUS_00140 gene crp 13634 14266 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 protein_id gnl|my_center|LOCUS_00140 14329 16413 gene locus_tag LOCUS_00150 14329 16413 CDS product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 protein_id gnl|my_center|LOCUS_00150 17634 16414 gene locus_tag LOCUS_00160 17634 16414 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190017.1 protein_id gnl|my_center|LOCUS_00160 18284 17721 gene locus_tag LOCUS_00170 gene pabA 18284 17721 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 protein_id gnl|my_center|LOCUS_00170 18917 18315 gene locus_tag LOCUS_00180 18917 18315 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 protein_id gnl|my_center|LOCUS_00180 19077 18907 gene locus_tag LOCUS_00190 19077 18907 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736862.1 protein_id gnl|my_center|LOCUS_00190 19754 19182 gene locus_tag LOCUS_00200 gene ppiA 19754 19182 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 protein_id gnl|my_center|LOCUS_00200 20030 21217 gene locus_tag LOCUS_00210 gene tsgA 20030 21217 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185243.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 3504 841 gene locus_tag LOCUS_00220 gene aceE 3504 841 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003851.1 protein_id gnl|my_center|LOCUS_00220 4524 3760 gene locus_tag LOCUS_00230 gene pdhR 4524 3760 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 protein_id gnl|my_center|LOCUS_00230 5064 6437 gene locus_tag LOCUS_00240 gene aroP 5064 6437 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277864.1 protein_id gnl|my_center|LOCUS_00240 6594 7994 gene locus_tag LOCUS_00250 6594 7994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_00250 8004 8957 gene locus_tag LOCUS_00260 8004 8957 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 protein_id gnl|my_center|LOCUS_00260 9831 8977 gene locus_tag LOCUS_00270 gene ampE 9831 8977 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 protein_id gnl|my_center|LOCUS_00270 10391 9828 gene locus_tag LOCUS_00280 gene ampD 10391 9828 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 protein_id gnl|my_center|LOCUS_00280 10479 11369 gene locus_tag LOCUS_00290 gene nadC 10479 11369 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704410.1 protein_id gnl|my_center|LOCUS_00290 11622 12056 gene locus_tag LOCUS_00300 gene ppdD 11622 12056 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095588.1 protein_id gnl|my_center|LOCUS_00300 12071 13453 gene locus_tag LOCUS_00310 gene gspE 12071 13453 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704408.1 protein_id gnl|my_center|LOCUS_00310 13446 14645 gene locus_tag LOCUS_00320 gene hofC 13446 14645 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095586.1 protein_id gnl|my_center|LOCUS_00320 15728 14685 gene locus_tag LOCUS_00330 15728 14685 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 protein_id gnl|my_center|LOCUS_00330 15993 16613 gene locus_tag LOCUS_00340 gene coaE 15993 16613 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270913.1 protein_id gnl|my_center|LOCUS_00340 16613 17356 gene locus_tag LOCUS_00350 gene zapD 16613 17356 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 protein_id gnl|my_center|LOCUS_00350 17366 17566 gene locus_tag LOCUS_00360 gene yacG 17366 17566 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286419.1 protein_id gnl|my_center|LOCUS_00360 17955 17563 gene locus_tag LOCUS_00370 gene mutT 17955 17563 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368238.1 protein_id gnl|my_center|LOCUS_00370 20721 18016 gene locus_tag LOCUS_00380 gene secA 20721 18016 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 protein_id gnl|my_center|LOCUS_00380 21213 20779 gene locus_tag LOCUS_00390 gene secM 21213 20779 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095579.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence003 861 121 gene locus_tag LOCUS_00400 gene hemD 861 121 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 protein_id gnl|my_center|LOCUS_00400 1799 858 gene locus_tag LOCUS_00410 gene hemC 1799 858 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303155.1 protein_id gnl|my_center|LOCUS_00410 2082 4628 gene locus_tag LOCUS_00420 gene cyaA 2082 4628 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 protein_id gnl|my_center|LOCUS_00420 4949 4629 gene locus_tag LOCUS_00430 gene cyaY 4949 4629 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 protein_id gnl|my_center|LOCUS_00430 5116 5319 gene locus_tag LOCUS_00440 5116 5319 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799889.1 protein_id gnl|my_center|LOCUS_00440 5352 6176 gene locus_tag LOCUS_00450 gene dapF 5352 6176 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_00450 6173 6877 gene locus_tag LOCUS_00460 6173 6877 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 protein_id gnl|my_center|LOCUS_00460 6874 7779 gene locus_tag LOCUS_00470 gene xerC 6874 7779 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703983.1 protein_id gnl|my_center|LOCUS_00470 7779 8495 gene locus_tag LOCUS_00480 gene yigB 7779 8495 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213567.1 protein_id gnl|my_center|LOCUS_00480 8635 10797 gene locus_tag LOCUS_00490 gene uvrD 8635 10797 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383407.1 protein_id gnl|my_center|LOCUS_00490 11278 12228 gene locus_tag LOCUS_00500 gene corA 11278 12228 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 protein_id gnl|my_center|LOCUS_00500 12689 12285 gene locus_tag LOCUS_00510 12689 12285 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356594.1 protein_id gnl|my_center|LOCUS_00510 13135 12749 gene locus_tag LOCUS_00520 13135 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 14218 13325 gene locus_tag LOCUS_00530 gene rarD 14218 13325 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099254.1 protein_id gnl|my_center|LOCUS_00530 14741 14271 gene locus_tag LOCUS_00540 gene yigI 14741 14271 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097567.1 protein_id gnl|my_center|LOCUS_00540 14922 15791 gene locus_tag LOCUS_00550 gene pldA 14922 15791 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259692.1 protein_id gnl|my_center|LOCUS_00550 15859 17688 gene locus_tag LOCUS_00560 gene recQ 15859 17688 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368858.1 protein_id gnl|my_center|LOCUS_00560 17748 18368 gene locus_tag LOCUS_00570 gene rhtC 17748 18368 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 protein_id gnl|my_center|LOCUS_00570 18989 18369 gene locus_tag LOCUS_00580 gene rhtB 18989 18369 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 protein_id gnl|my_center|LOCUS_00580 19156 20091 gene locus_tag LOCUS_00590 gene pldB 19156 20091 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 protein_id gnl|my_center|LOCUS_00590 20141 20941 gene locus_tag LOCUS_00600 gene yigL 20141 20941 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence004 1395 535 gene locus_tag LOCUS_00610 gene tesB 1395 535 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 protein_id gnl|my_center|LOCUS_00610 1621 2193 gene locus_tag LOCUS_00620 1621 2193 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 protein_id gnl|my_center|LOCUS_00620 2536 2225 gene locus_tag LOCUS_00630 2536 2225 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 protein_id gnl|my_center|LOCUS_00630 2853 5375 gene locus_tag LOCUS_00640 2853 5375 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 protein_id gnl|my_center|LOCUS_00640 5729 7297 gene locus_tag LOCUS_00650 gene casA 5729 7297 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084082.1 protein_id gnl|my_center|LOCUS_00650 7298 7903 gene locus_tag LOCUS_00660 gene casB 7298 7903 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029331.1 protein_id gnl|my_center|LOCUS_00660 7915 8679 gene locus_tag LOCUS_00670 7915 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 8612 8929 gene locus_tag LOCUS_00680 8612 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 8939 9691 gene locus_tag LOCUS_00690 gene cas5e 8939 9691 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085058.1 protein_id gnl|my_center|LOCUS_00690 9673 10323 gene locus_tag LOCUS_00700 gene cas6e 9673 10323 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_00700 10320 11237 gene locus_tag LOCUS_00710 gene cas1e 10320 11237 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144847.1 protein_id gnl|my_center|LOCUS_00710 11237 11530 gene locus_tag LOCUS_00720 gene cas2e 11237 11530 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_00720 11627 13486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg 13592 14050 gene locus_tag LOCUS_00730 13592 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 14724 14975 gene locus_tag LOCUS_00740 14724 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367929.1 protein_id gnl|my_center|LOCUS_00740 14972 15193 gene locus_tag LOCUS_00750 14972 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095877.1 protein_id gnl|my_center|LOCUS_00750 16990 15569 gene locus_tag LOCUS_00760 16990 15569 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095878.1 protein_id gnl|my_center|LOCUS_00760 17077 17694 gene locus_tag LOCUS_00770 17077 17694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_00770 17751 18578 gene locus_tag LOCUS_00780 17751 18578 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368409.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence005 492 716 gene locus_tag LOCUS_00790 gene feoA 492 716 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160955.1 protein_id gnl|my_center|LOCUS_00790 743 3058 gene locus_tag LOCUS_00800 gene feoB 743 3058 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737007.1 protein_id gnl|my_center|LOCUS_00800 3058 3294 gene locus_tag LOCUS_00810 gene feoC 3058 3294 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 protein_id gnl|my_center|LOCUS_00810 3609 3340 gene locus_tag LOCUS_00820 3609 3340 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369359.1 protein_id gnl|my_center|LOCUS_00820 4470 3691 gene locus_tag LOCUS_00830 gene bioH 4470 3691 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 protein_id gnl|my_center|LOCUS_00830 4510 5187 gene locus_tag LOCUS_00840 gene gntX 4510 5187 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958739.1 protein_id gnl|my_center|LOCUS_00840 5246 5821 gene locus_tag LOCUS_00850 gene nfuA 5246 5821 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_00850 6192 5980 gene locus_tag LOCUS_00860 gene cspA 6192 5980 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_00860 8570 6462 gene locus_tag LOCUS_00870 gene malQ 8570 6462 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703682.1 protein_id gnl|my_center|LOCUS_00870 10984 8582 gene locus_tag LOCUS_00880 gene malP 10984 8582 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 protein_id gnl|my_center|LOCUS_00880 11583 14288 gene locus_tag LOCUS_00890 gene malT 11583 14288 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 protein_id gnl|my_center|LOCUS_00890 15251 14493 gene locus_tag LOCUS_00900 15251 14493 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 protein_id gnl|my_center|LOCUS_00900 16107 15277 gene locus_tag LOCUS_00910 gene glpG 16107 15277 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 protein_id gnl|my_center|LOCUS_00910 16512 16183 gene locus_tag LOCUS_00920 gene glpE 16512 16183 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369349.1 protein_id gnl|my_center|LOCUS_00920 16716 18251 gene locus_tag LOCUS_00930 gene glpD 16716 18251 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448119.1 protein_id gnl|my_center|LOCUS_00930 >Feature sequence006 802 2154 gene locus_tag LOCUS_00940 gene glpT 802 2154 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 protein_id gnl|my_center|LOCUS_00940 2164 3222 gene locus_tag LOCUS_00950 gene glpQ 2164 3222 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 protein_id gnl|my_center|LOCUS_00950 3567 3313 gene locus_tag LOCUS_00960 gene yfaE 3567 3313 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 protein_id gnl|my_center|LOCUS_00960 4699 3569 gene locus_tag LOCUS_00970 gene nrdB 4699 3569 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365618.1 protein_id gnl|my_center|LOCUS_00970 7159 4874 gene locus_tag LOCUS_00980 gene nrdA 7159 4874 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098011.1 protein_id gnl|my_center|LOCUS_00980 8243 7512 gene locus_tag LOCUS_00990 8243 7512 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990765.1 protein_id gnl|my_center|LOCUS_00990 8403 11039 gene locus_tag LOCUS_01000 gene gyrA 8403 11039 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 protein_id gnl|my_center|LOCUS_01000 11225 14074 gene locus_tag LOCUS_01010 gene rcsC 11225 14074 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 protein_id gnl|my_center|LOCUS_01010 14896 14246 gene locus_tag LOCUS_01020 gene rcsB 14896 14246 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061917.1 protein_id gnl|my_center|LOCUS_01020 <16469 14913 gene locus_tag LOCUS_01030 <16469 14913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023619743.1:phosphotransferase RcsD >Feature sequence007 631 95 gene locus_tag LOCUS_01040 631 95 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 protein_id gnl|my_center|LOCUS_01040 790 1458 gene locus_tag LOCUS_01050 gene hxpB 790 1458 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106859.1 protein_id gnl|my_center|LOCUS_01050 1646 2401 gene locus_tag LOCUS_01060 gene kduD 1646 2401 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_01060 2515 3105 gene locus_tag LOCUS_01070 2515 3105 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 protein_id gnl|my_center|LOCUS_01070 3240 4631 gene locus_tag LOCUS_01080 gene tcyP 3240 4631 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 protein_id gnl|my_center|LOCUS_01080 5084 4743 gene locus_tag LOCUS_01090 5084 4743 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806442.1 protein_id gnl|my_center|LOCUS_01090 5296 5117 gene locus_tag LOCUS_01100 5296 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 5420 5238 gene locus_tag LOCUS_01110 5420 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 5763 5584 gene locus_tag LOCUS_01120 5763 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 6026 8281 gene locus_tag LOCUS_01130 gene katE 6026 8281 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077850.1 protein_id gnl|my_center|LOCUS_01130 8735 8394 gene locus_tag LOCUS_01140 gene osmE 8735 8394 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366182.1 protein_id gnl|my_center|LOCUS_01140 8978 9805 gene locus_tag LOCUS_01150 gene nadE 8978 9805 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 protein_id gnl|my_center|LOCUS_01150 9892 10782 gene locus_tag LOCUS_01160 gene yddG 9892 10782 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 protein_id gnl|my_center|LOCUS_01160 10850 11341 gene locus_tag LOCUS_01170 10850 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 11341 11604 gene locus_tag LOCUS_01180 11341 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12140 11595 gene locus_tag LOCUS_01190 gene ves 12140 11595 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_01190 12899 12417 gene locus_tag LOCUS_01200 gene spy 12899 12417 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228995.1 protein_id gnl|my_center|LOCUS_01200 14159 13194 gene locus_tag LOCUS_01210 gene astE 14159 13194 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_01210 <15195 14169 gene locus_tag LOCUS_01220 <15195 14169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097029.1:N-succinylarginine dihydrolase >Feature sequence008 <1 510 gene locus_tag LOCUS_01230 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001298577.1:sensor domain-containing phosphodiesterase 1737 553 gene locus_tag LOCUS_01240 1737 553 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 protein_id gnl|my_center|LOCUS_01240 2157 3332 gene locus_tag LOCUS_01250 2157 3332 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 protein_id gnl|my_center|LOCUS_01250 3753 3397 gene locus_tag LOCUS_01260 3753 3397 CDS product DUF2502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878154.1 protein_id gnl|my_center|LOCUS_01260 4878 3889 gene locus_tag LOCUS_01270 gene mgrA 4878 3889 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_01270 5099 6766 gene locus_tag LOCUS_01280 gene ipdC 5099 6766 CDS product indolepyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098183.1 protein_id gnl|my_center|LOCUS_01280 6920 7885 gene locus_tag LOCUS_01290 gene glk 6920 7885 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 protein_id gnl|my_center|LOCUS_01290 8652 7921 gene locus_tag LOCUS_01300 8652 7921 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 protein_id gnl|my_center|LOCUS_01300 10337 8664 gene locus_tag LOCUS_01310 gene ypdA 10337 8664 CDS product two-component system sensor histidine kinase YpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544379.1 protein_id gnl|my_center|LOCUS_01310 11675 10434 gene locus_tag LOCUS_01320 11675 10434 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172156.1 protein_id gnl|my_center|LOCUS_01320 11916 13157 gene locus_tag LOCUS_01330 gene alaC 11916 13157 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878147.1 protein_id gnl|my_center|LOCUS_01330 13621 13977 gene locus_tag LOCUS_01340 13621 13977 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 protein_id gnl|my_center|LOCUS_01340 14923 13955 gene locus_tag LOCUS_01350 14923 13955 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence009 244 8 gene locus_tag LOCUS_01360 244 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 392 562 gene locus_tag LOCUS_01370 392 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 789 1757 gene locus_tag LOCUS_01380 789 1757 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_01380 1882 2055 gene locus_tag LOCUS_01390 1882 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3292 2096 gene locus_tag LOCUS_01400 3292 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4354 3413 gene locus_tag LOCUS_01410 4354 3413 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162198566.1 protein_id gnl|my_center|LOCUS_01410 4791 5096 gene locus_tag LOCUS_01420 4791 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097068.1 protein_id gnl|my_center|LOCUS_01420 5449 5093 gene locus_tag LOCUS_01430 5449 5093 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678599.1 protein_id gnl|my_center|LOCUS_01430 5653 6360 gene locus_tag LOCUS_01440 5653 6360 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 protein_id gnl|my_center|LOCUS_01440 7546 6362 gene locus_tag LOCUS_01450 7546 6362 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_01450 8065 7619 gene locus_tag LOCUS_01460 8065 7619 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 protein_id gnl|my_center|LOCUS_01460 8777 8253 gene locus_tag LOCUS_01470 8777 8253 CDS product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097062.1 protein_id gnl|my_center|LOCUS_01470 9154 9387 gene locus_tag LOCUS_01480 9154 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 10856 9438 gene locus_tag LOCUS_01490 10856 9438 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113692.1 protein_id gnl|my_center|LOCUS_01490 10942 11151 gene locus_tag LOCUS_01500 10942 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12545 11244 gene locus_tag LOCUS_01510 12545 11244 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 protein_id gnl|my_center|LOCUS_01510 <14149 12650 gene locus_tag LOCUS_01520 <14149 12650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001019882.1:protein kinase YeaG >Feature sequence010 405 43 gene locus_tag LOCUS_01530 gene queD 405 43 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 protein_id gnl|my_center|LOCUS_01530 866 2512 gene locus_tag LOCUS_01540 gene cysJ 866 2512 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 protein_id gnl|my_center|LOCUS_01540 2512 4224 gene locus_tag LOCUS_01550 gene cysI 2512 4224 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290679.1 protein_id gnl|my_center|LOCUS_01550 4382 5116 gene locus_tag LOCUS_01560 gene cysH 4382 5116 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 protein_id gnl|my_center|LOCUS_01560 6137 5148 gene locus_tag LOCUS_01570 gene iap 6137 5148 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490413.1 protein_id gnl|my_center|LOCUS_01570 6382 7797 gene locus_tag LOCUS_01580 gene cysG 6382 7797 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184003.1 protein_id gnl|my_center|LOCUS_01580 7807 8715 gene locus_tag LOCUS_01590 gene cysD 7807 8715 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369979.1 protein_id gnl|my_center|LOCUS_01590 8725 10152 gene locus_tag LOCUS_01600 gene cysN 8725 10152 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 protein_id gnl|my_center|LOCUS_01600 10152 10757 gene locus_tag LOCUS_01610 gene cysC 10152 10757 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 protein_id gnl|my_center|LOCUS_01610 10807 11130 gene locus_tag LOCUS_01620 10807 11130 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369982.1 protein_id gnl|my_center|LOCUS_01620 11293 11604 gene locus_tag LOCUS_01630 gene ftsB 11293 11604 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 protein_id gnl|my_center|LOCUS_01630 11579 12334 gene locus_tag LOCUS_01640 gene ispD 11579 12334 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 protein_id gnl|my_center|LOCUS_01640 12334 12813 gene locus_tag LOCUS_01650 gene ispF 12334 12813 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 protein_id gnl|my_center|LOCUS_01650 12810 13859 gene locus_tag LOCUS_01660 gene truD 12810 13859 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568943.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence011 192 902 gene locus_tag LOCUS_01670 192 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 905 1240 gene locus_tag LOCUS_01680 gene fdx 905 1240 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 protein_id gnl|my_center|LOCUS_01680 1242 1442 gene locus_tag LOCUS_01690 gene iscX 1242 1442 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523612.1 protein_id gnl|my_center|LOCUS_01690 1506 2792 gene locus_tag LOCUS_01700 gene pepB 1506 2792 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370317.1 protein_id gnl|my_center|LOCUS_01700 3111 3908 gene locus_tag LOCUS_01710 gene sseB 3111 3908 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703169.1 protein_id gnl|my_center|LOCUS_01710 4118 6226 gene locus_tag LOCUS_01720 4118 6226 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269327.1 protein_id gnl|my_center|LOCUS_01720 6339 8465 gene locus_tag LOCUS_01730 6339 8465 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269327.1 protein_id gnl|my_center|LOCUS_01730 9267 8494 gene locus_tag LOCUS_01740 9267 8494 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 protein_id gnl|my_center|LOCUS_01740 10115 9267 gene locus_tag LOCUS_01750 gene sseA 10115 9267 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 protein_id gnl|my_center|LOCUS_01750 11572 10208 gene locus_tag LOCUS_01760 11572 10208 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_01760 13129 11585 gene locus_tag LOCUS_01770 13129 11585 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence012 <1 989 gene locus_tag LOCUS_01780 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000484984.1:exoribonuclease II 1286 3280 gene locus_tag LOCUS_01790 gene pdeR 1286 3280 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 protein_id gnl|my_center|LOCUS_01790 4171 3302 gene locus_tag LOCUS_01800 4171 3302 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_01800 4383 4565 gene locus_tag LOCUS_01810 4383 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366235.1 protein_id gnl|my_center|LOCUS_01810 5241 4579 gene locus_tag LOCUS_01820 gene fsa 5241 4579 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215192.1 protein_id gnl|my_center|LOCUS_01820 5376 6275 gene locus_tag LOCUS_01830 5376 6275 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 protein_id gnl|my_center|LOCUS_01830 6281 8713 gene locus_tag LOCUS_01840 6281 8713 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097442.1 protein_id gnl|my_center|LOCUS_01840 8759 9514 gene locus_tag LOCUS_01850 8759 9514 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 protein_id gnl|my_center|LOCUS_01850 9772 9987 gene locus_tag LOCUS_01860 gene osmB 9772 9987 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100683974.1 protein_id gnl|my_center|LOCUS_01860 10435 10109 gene locus_tag LOCUS_01870 gene yciH 10435 10109 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_01870 11169 10435 gene locus_tag LOCUS_01880 gene pyrF 11169 10435 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763993.1 protein_id gnl|my_center|LOCUS_01880 12564 11395 gene locus_tag LOCUS_01890 gene lapB 12564 11395 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 protein_id gnl|my_center|LOCUS_01890 12879 12571 gene locus_tag LOCUS_01900 12879 12571 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366229.1 protein_id gnl|my_center|LOCUS_01900 <13529 13027 gene locus_tag LOCUS_01910 <13529 13027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038420925.1:phosphatidylglycerophosphatase B >Feature sequence013 364 113 gene locus_tag LOCUS_01920 364 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156431.1 protein_id gnl|my_center|LOCUS_01920 658 401 gene locus_tag LOCUS_01930 658 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 1245 652 gene locus_tag LOCUS_01940 1245 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640243.1 protein_id gnl|my_center|LOCUS_01940 1378 1575 gene locus_tag LOCUS_01950 1378 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2312 2806 gene locus_tag LOCUS_01960 2312 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4079 2814 gene locus_tag LOCUS_01970 4079 2814 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 protein_id gnl|my_center|LOCUS_01970 5551 4133 gene locus_tag LOCUS_01980 5551 4133 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704271.1 protein_id gnl|my_center|LOCUS_01980 5728 5892 gene locus_tag LOCUS_01990 5728 5892 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704272.1 protein_id gnl|my_center|LOCUS_01990 6085 5927 gene locus_tag LOCUS_02000 6085 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02000 6283 6134 gene locus_tag LOCUS_02010 6283 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7530 6421 gene locus_tag LOCUS_02020 7530 6421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 protein_id gnl|my_center|LOCUS_02020 7890 9113 gene locus_tag LOCUS_02030 7890 9113 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 protein_id gnl|my_center|LOCUS_02030 9199 10506 gene locus_tag LOCUS_02040 9199 10506 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209900.1 protein_id gnl|my_center|LOCUS_02040 10516 11367 gene locus_tag LOCUS_02050 10516 11367 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209899.1 protein_id gnl|my_center|LOCUS_02050 11372 12571 gene locus_tag LOCUS_02060 11372 12571 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097214.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence014 1466 675 gene locus_tag LOCUS_02070 gene ssuC 1466 675 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367447.1 protein_id gnl|my_center|LOCUS_02070 2621 1476 gene locus_tag LOCUS_02080 gene ssuD 2621 1476 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097272.1 protein_id gnl|my_center|LOCUS_02080 3589 2618 gene locus_tag LOCUS_02090 gene ssuA 3589 2618 CDS product aliphatic sulfonate ABC transporter substrate-binding protein SsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488238.1 protein_id gnl|my_center|LOCUS_02090 4157 3582 gene locus_tag LOCUS_02100 gene ssuE 4157 3582 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263934.1 protein_id gnl|my_center|LOCUS_02100 4406 5416 gene locus_tag LOCUS_02110 gene pyrD 4406 5416 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 protein_id gnl|my_center|LOCUS_02110 5638 6126 gene locus_tag LOCUS_02120 gene zapC 5638 6126 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704901.1 protein_id gnl|my_center|LOCUS_02120 7229 6123 gene locus_tag LOCUS_02130 7229 6123 CDS product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 protein_id gnl|my_center|LOCUS_02130 7332 9449 gene locus_tag LOCUS_02140 gene rlmKL 7332 9449 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086517.1 protein_id gnl|my_center|LOCUS_02140 9455 11359 gene locus_tag LOCUS_02150 9455 11359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 protein_id gnl|my_center|LOCUS_02150 11376 12644 gene locus_tag LOCUS_02160 gene pqiA 11376 12644 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333176.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence015 2664 1894 gene locus_tag LOCUS_02170 2664 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4491 3235 gene locus_tag LOCUS_02180 4491 3235 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369950.1 protein_id gnl|my_center|LOCUS_02180 7389 4699 gene locus_tag LOCUS_02190 gene mgtA 7389 4699 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705490.1 protein_id gnl|my_center|LOCUS_02190 9102 7981 gene locus_tag LOCUS_02200 9102 7981 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095420.1 protein_id gnl|my_center|LOCUS_02200 9252 9419 gene locus_tag LOCUS_02210 9252 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9544 12483 gene locus_tag LOCUS_02220 9544 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence016 967 278 gene locus_tag LOCUS_02230 gene trmH 967 278 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369142.1 protein_id gnl|my_center|LOCUS_02230 3092 972 gene locus_tag LOCUS_02240 gene spoT 3092 972 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094882.1 protein_id gnl|my_center|LOCUS_02240 3387 3112 gene locus_tag LOCUS_02250 gene rpoZ 3387 3112 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_02250 4065 3442 gene locus_tag LOCUS_02260 gene gmk 4065 3442 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369144.1 protein_id gnl|my_center|LOCUS_02260 4323 6008 gene locus_tag LOCUS_02270 gene ligB 4323 6008 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703813.1 protein_id gnl|my_center|LOCUS_02270 6655 6038 gene locus_tag LOCUS_02280 6655 6038 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 protein_id gnl|my_center|LOCUS_02280 7691 6828 gene locus_tag LOCUS_02290 7691 6828 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 protein_id gnl|my_center|LOCUS_02290 7898 8533 gene locus_tag LOCUS_02300 gene rph 7898 8533 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 protein_id gnl|my_center|LOCUS_02300 8598 9239 gene locus_tag LOCUS_02310 gene pyrE 8598 9239 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_02310 9887 9291 gene locus_tag LOCUS_02320 gene slmA 9887 9291 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094890.1 protein_id gnl|my_center|LOCUS_02320 10471 10013 gene locus_tag LOCUS_02330 gene dut 10471 10013 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077682.1 protein_id gnl|my_center|LOCUS_02330 11660 10449 gene locus_tag LOCUS_02340 gene coaBC 11660 10449 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528250.1 protein_id gnl|my_center|LOCUS_02340 11843 12496 gene locus_tag LOCUS_02350 gene radC 11843 12496 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence017 1295 222 gene locus_tag LOCUS_02360 1295 222 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 protein_id gnl|my_center|LOCUS_02360 2142 1297 gene locus_tag LOCUS_02370 gene ugpE 2142 1297 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572199.1 protein_id gnl|my_center|LOCUS_02370 3026 2139 gene locus_tag LOCUS_02380 gene ugpA 3026 2139 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 protein_id gnl|my_center|LOCUS_02380 4416 3163 gene locus_tag LOCUS_02390 gene ugpB 4416 3163 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_02390 5021 4653 gene locus_tag LOCUS_02400 5021 4653 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 protein_id gnl|my_center|LOCUS_02400 5242 5021 gene locus_tag LOCUS_02410 5242 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6094 5381 gene locus_tag LOCUS_02420 gene livF 6094 5381 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 protein_id gnl|my_center|LOCUS_02420 6863 6096 gene locus_tag LOCUS_02430 gene livG 6863 6096 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082083.1 protein_id gnl|my_center|LOCUS_02430 8140 6860 gene locus_tag LOCUS_02440 gene livM 8140 6860 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099130.1 protein_id gnl|my_center|LOCUS_02440 9063 8137 gene locus_tag LOCUS_02450 gene livH 9063 8137 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 protein_id gnl|my_center|LOCUS_02450 9400 9131 gene locus_tag LOCUS_02460 9400 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 9569 9297 gene locus_tag LOCUS_02470 9569 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 9823 10215 gene locus_tag LOCUS_02480 gene panM 9823 10215 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778873.1 protein_id gnl|my_center|LOCUS_02480 11501 10404 gene locus_tag LOCUS_02490 gene livJ 11501 10404 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021986.1 protein_id gnl|my_center|LOCUS_02490 12744 11758 gene locus_tag LOCUS_02500 12744 11758 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105913.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence018 312 1013 gene locus_tag LOCUS_02510 312 1013 CDS product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098962.1 protein_id gnl|my_center|LOCUS_02510 1107 3467 gene locus_tag LOCUS_02520 1107 3467 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098961.1 protein_id gnl|my_center|LOCUS_02520 3458 4009 gene locus_tag LOCUS_02530 3458 4009 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098960.1 protein_id gnl|my_center|LOCUS_02530 4124 4774 gene locus_tag LOCUS_02540 4124 4774 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 protein_id gnl|my_center|LOCUS_02540 4793 5443 gene locus_tag LOCUS_02550 4793 5443 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096697.1 protein_id gnl|my_center|LOCUS_02550 5864 5568 gene locus_tag LOCUS_02560 5864 5568 CDS product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 protein_id gnl|my_center|LOCUS_02560 6259 5861 gene locus_tag LOCUS_02570 6259 5861 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 protein_id gnl|my_center|LOCUS_02570 6564 6262 gene locus_tag LOCUS_02580 6564 6262 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 protein_id gnl|my_center|LOCUS_02580 6968 6600 gene locus_tag LOCUS_02590 6968 6600 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369574.1 protein_id gnl|my_center|LOCUS_02590 7504 7121 gene locus_tag LOCUS_02600 gene mzrA 7504 7121 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 protein_id gnl|my_center|LOCUS_02600 8170 7508 gene locus_tag LOCUS_02610 gene yqjA 8170 7508 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369576.1 protein_id gnl|my_center|LOCUS_02610 9265 8486 gene locus_tag LOCUS_02620 gene exuR 9265 8486 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 protein_id gnl|my_center|LOCUS_02620 10437 9379 gene locus_tag LOCUS_02630 10437 9379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 protein_id gnl|my_center|LOCUS_02630 10436 10852 gene locus_tag LOCUS_02640 10436 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 11018 11758 gene locus_tag LOCUS_02650 11018 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 11710 12450 gene locus_tag LOCUS_02660 11710 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02660 >Feature sequence019 741 136 gene locus_tag LOCUS_02670 741 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179259.1 protein_id gnl|my_center|LOCUS_02670 1061 741 gene locus_tag LOCUS_02680 1061 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123829847.1 protein_id gnl|my_center|LOCUS_02680 1491 1114 gene locus_tag LOCUS_02690 1491 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053064332.1 protein_id gnl|my_center|LOCUS_02690 1942 1502 gene locus_tag LOCUS_02700 1942 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627074.1 protein_id gnl|my_center|LOCUS_02700 2979 1993 gene locus_tag LOCUS_02710 2979 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123829849.1 protein_id gnl|my_center|LOCUS_02710 3910 3032 gene locus_tag LOCUS_02720 3910 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4503 4087 gene locus_tag LOCUS_02730 4503 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4706 4500 gene locus_tag LOCUS_02740 4706 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5236 4703 gene locus_tag LOCUS_02750 5236 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5740 5273 gene locus_tag LOCUS_02760 5740 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_02760 6635 5856 gene locus_tag LOCUS_02770 6635 5856 CDS product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 protein_id gnl|my_center|LOCUS_02770 7420 6632 gene locus_tag LOCUS_02780 7420 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7532 7413 gene locus_tag LOCUS_02790 7532 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7732 7529 gene locus_tag LOCUS_02800 7732 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8123 7878 gene locus_tag LOCUS_02810 8123 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282459.1 protein_id gnl|my_center|LOCUS_02810 8278 8865 gene locus_tag LOCUS_02820 8278 8865 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836290.1 protein_id gnl|my_center|LOCUS_02820 9105 9242 gene locus_tag LOCUS_02830 9105 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9403 10329 gene locus_tag LOCUS_02840 9403 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005791.1 protein_id gnl|my_center|LOCUS_02840 10338 10640 gene locus_tag LOCUS_02850 10338 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133973.1 protein_id gnl|my_center|LOCUS_02850 10637 10846 gene locus_tag LOCUS_02860 10637 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 10843 11664 gene locus_tag LOCUS_02870 10843 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence020 2707 569 gene locus_tag LOCUS_02880 gene tssI 2707 569 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096197.1 protein_id gnl|my_center|LOCUS_02880 3811 3410 gene locus_tag LOCUS_02890 3811 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096201.1 protein_id gnl|my_center|LOCUS_02890 4463 4029 gene locus_tag LOCUS_02900 4463 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4781 4527 gene locus_tag LOCUS_02910 4781 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5070 4756 gene locus_tag LOCUS_02920 5070 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5808 5266 gene locus_tag LOCUS_02930 5808 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 9827 5808 gene locus_tag LOCUS_02940 9827 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 10726 10046 gene locus_tag LOCUS_02950 10726 10046 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096194.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence021 457 26 gene locus_tag LOCUS_02960 457 26 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_02960 1778 576 gene locus_tag LOCUS_02970 1778 576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094986.1 protein_id gnl|my_center|LOCUS_02970 2564 1935 gene locus_tag LOCUS_02980 2564 1935 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620076.1 protein_id gnl|my_center|LOCUS_02980 2721 3284 gene locus_tag LOCUS_02990 2721 3284 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817446.1 protein_id gnl|my_center|LOCUS_02990 3281 3721 gene locus_tag LOCUS_03000 3281 3721 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 protein_id gnl|my_center|LOCUS_03000 6023 3690 gene locus_tag LOCUS_03010 gene bisC 6023 3690 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013914.1 protein_id gnl|my_center|LOCUS_03010 6202 6864 gene locus_tag LOCUS_03020 6202 6864 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 protein_id gnl|my_center|LOCUS_03020 7549 6911 gene locus_tag LOCUS_03030 gene zinT 7549 6911 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703955.1 protein_id gnl|my_center|LOCUS_03030 7751 8770 gene locus_tag LOCUS_03040 7751 8770 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 protein_id gnl|my_center|LOCUS_03040 8883 9632 gene locus_tag LOCUS_03050 8883 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 protein_id gnl|my_center|LOCUS_03050 9635 10576 gene locus_tag LOCUS_03060 9635 10576 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703773.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence022 234 1325 gene locus_tag LOCUS_03070 gene ispB 234 1325 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_03070 1630 1893 gene locus_tag LOCUS_03080 gene sfsB 1630 1893 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445406.1 protein_id gnl|my_center|LOCUS_03080 3266 2007 gene locus_tag LOCUS_03090 gene murA 3266 2007 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 protein_id gnl|my_center|LOCUS_03090 3576 3319 gene locus_tag LOCUS_03100 gene ibaG 3576 3319 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369504.1 protein_id gnl|my_center|LOCUS_03100 4003 3701 gene locus_tag LOCUS_03110 gene mlaB 4003 3701 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_03110 4638 4003 gene locus_tag LOCUS_03120 gene mlaC 4638 4003 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 protein_id gnl|my_center|LOCUS_03120 5205 4654 gene locus_tag LOCUS_03130 gene mlaD 5205 4654 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369501.1 protein_id gnl|my_center|LOCUS_03130 5991 5209 gene locus_tag LOCUS_03140 gene mlaE 5991 5209 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369500.1 protein_id gnl|my_center|LOCUS_03140 6814 5999 gene locus_tag LOCUS_03150 gene mlaF 6814 5999 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 protein_id gnl|my_center|LOCUS_03150 7048 8025 gene locus_tag LOCUS_03160 7048 8025 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 protein_id gnl|my_center|LOCUS_03160 8040 9026 gene locus_tag LOCUS_03170 gene kdsD 8040 9026 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 protein_id gnl|my_center|LOCUS_03170 9042 9608 gene locus_tag LOCUS_03180 gene kdsC 9042 9608 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_03180 9605 10180 gene locus_tag LOCUS_03190 gene lptC 9605 10180 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 protein_id gnl|my_center|LOCUS_03190 10149 10706 gene locus_tag LOCUS_03200 gene lptA 10149 10706 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_03200 10713 11438 gene locus_tag LOCUS_03210 gene lptB 10713 11438 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence023 2163 244 gene locus_tag LOCUS_03220 gene ppk1 2163 244 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 protein_id gnl|my_center|LOCUS_03220 3042 2401 gene locus_tag LOCUS_03230 gene purN 3042 2401 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 protein_id gnl|my_center|LOCUS_03230 4079 3042 gene locus_tag LOCUS_03240 gene purM 4079 3042 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 protein_id gnl|my_center|LOCUS_03240 4312 4938 gene locus_tag LOCUS_03250 gene upp 4312 4938 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370402.1 protein_id gnl|my_center|LOCUS_03250 5020 6309 gene locus_tag LOCUS_03260 gene uraA 5020 6309 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 protein_id gnl|my_center|LOCUS_03260 6429 7106 gene locus_tag LOCUS_03270 6429 7106 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_03270 7513 7157 gene locus_tag LOCUS_03280 gene arsC 7513 7157 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 protein_id gnl|my_center|LOCUS_03280 8991 7525 gene locus_tag LOCUS_03290 gene bepA 8991 7525 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489659.1 protein_id gnl|my_center|LOCUS_03290 9214 10278 gene locus_tag LOCUS_03300 9214 10278 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 protein_id gnl|my_center|LOCUS_03300 10797 10324 gene locus_tag LOCUS_03310 gene bcp 10797 10324 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_03310 11366 10797 gene locus_tag LOCUS_03320 11366 10797 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence024 3086 768 gene locus_tag LOCUS_03330 gene mngB 3086 768 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649004.1 protein_id gnl|my_center|LOCUS_03330 3410 3090 gene locus_tag LOCUS_03340 3410 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03340 5351 3435 gene locus_tag LOCUS_03350 gene mngA 5351 3435 CDS product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097538.1 protein_id gnl|my_center|LOCUS_03350 5533 6249 gene locus_tag LOCUS_03360 5533 6249 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 protein_id gnl|my_center|LOCUS_03360 7200 6331 gene locus_tag LOCUS_03370 gene sucD 7200 6331 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114639.1 protein_id gnl|my_center|LOCUS_03370 8366 7200 gene locus_tag LOCUS_03380 gene sucC 8366 7200 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809579.1 protein_id gnl|my_center|LOCUS_03380 9700 8477 gene locus_tag LOCUS_03390 gene odhB 9700 8477 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 protein_id gnl|my_center|LOCUS_03390 <11156 9715 gene locus_tag LOCUS_03400 <11156 9715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023622290.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence025 <1 2448 gene locus_tag LOCUS_03410 <1 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099383.1:DNA polymerase I 3419 2751 gene locus_tag LOCUS_03420 gene yihA 3419 2751 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703927.1 protein_id gnl|my_center|LOCUS_03420 3977 4507 gene locus_tag LOCUS_03430 gene yihI 3977 4507 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_03430 4692 6065 gene locus_tag LOCUS_03440 gene hemN 4692 6065 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116108.1 protein_id gnl|my_center|LOCUS_03440 6215 6093 gene locus_tag LOCUS_03450 6215 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7735 6326 gene locus_tag LOCUS_03460 gene glnG 7735 6326 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099377.1 protein_id gnl|my_center|LOCUS_03460 8793 7744 gene locus_tag LOCUS_03470 gene glnL 8793 7744 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 protein_id gnl|my_center|LOCUS_03470 10401 8992 gene locus_tag LOCUS_03480 gene glnA 10401 8992 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence026 1925 1314 gene locus_tag LOCUS_03490 1925 1314 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 protein_id gnl|my_center|LOCUS_03490 3256 1925 gene locus_tag LOCUS_03500 gene pepQ 3256 1925 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 protein_id gnl|my_center|LOCUS_03500 3446 5635 gene locus_tag LOCUS_03510 gene fadB 3446 5635 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965964.1 protein_id gnl|my_center|LOCUS_03510 5646 6809 gene locus_tag LOCUS_03520 gene fadA 5646 6809 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438778.1 protein_id gnl|my_center|LOCUS_03520 6945 7292 gene locus_tag LOCUS_03530 6945 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 8021 7320 gene locus_tag LOCUS_03540 gene fre 8021 7320 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 protein_id gnl|my_center|LOCUS_03540 9551 8067 gene locus_tag LOCUS_03550 gene ubiD 9551 8067 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339819.1 protein_id gnl|my_center|LOCUS_03550 9735 10223 gene locus_tag LOCUS_03560 gene rfaH 9735 10223 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 protein_id gnl|my_center|LOCUS_03560 10603 10271 gene locus_tag LOCUS_03570 10603 10271 CDS product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098702.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence027 680 366 gene locus_tag LOCUS_03580 680 366 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 protein_id gnl|my_center|LOCUS_03580 971 1924 gene locus_tag LOCUS_03590 971 1924 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 protein_id gnl|my_center|LOCUS_03590 2572 1952 gene locus_tag LOCUS_03600 2572 1952 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198741.1 protein_id gnl|my_center|LOCUS_03600 3124 5415 gene locus_tag LOCUS_03610 3124 5415 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211928.1 protein_id gnl|my_center|LOCUS_03610 5431 7449 gene locus_tag LOCUS_03620 5431 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7673 7942 gene locus_tag LOCUS_03630 7673 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 8195 8479 gene locus_tag LOCUS_03640 8195 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8479 9741 gene locus_tag LOCUS_03650 8479 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence028 845 1027 gene locus_tag LOCUS_03660 gene sgrT 845 1027 CDS product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095557.1 protein_id gnl|my_center|LOCUS_03660 1147 2325 gene locus_tag LOCUS_03670 1147 2325 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 protein_id gnl|my_center|LOCUS_03670 3102 2497 gene locus_tag LOCUS_03680 gene leuD 3102 2497 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095559.1 protein_id gnl|my_center|LOCUS_03680 4513 3113 gene locus_tag LOCUS_03690 gene leuC 4513 3113 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140632.1 protein_id gnl|my_center|LOCUS_03690 5607 4516 gene locus_tag LOCUS_03700 gene leuB 5607 4516 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368262.1 protein_id gnl|my_center|LOCUS_03700 7178 5607 gene locus_tag LOCUS_03710 gene leuA 7178 5607 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 protein_id gnl|my_center|LOCUS_03710 7979 8923 gene locus_tag LOCUS_03720 gene leuO 7979 8923 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence029 462 800 gene locus_tag LOCUS_03730 gene maoP 462 800 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_03730 2399 879 gene locus_tag LOCUS_03740 2399 879 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 protein_id gnl|my_center|LOCUS_03740 2988 4634 gene locus_tag LOCUS_03750 gene ilvG 2988 4634 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012613.1 protein_id gnl|my_center|LOCUS_03750 4631 4888 gene locus_tag LOCUS_03760 gene ilvM 4631 4888 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 protein_id gnl|my_center|LOCUS_03760 4909 5838 gene locus_tag LOCUS_03770 gene ilvE 4909 5838 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 protein_id gnl|my_center|LOCUS_03770 5903 7753 gene locus_tag LOCUS_03780 gene ilvD 5903 7753 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 protein_id gnl|my_center|LOCUS_03780 7753 9300 gene locus_tag LOCUS_03790 gene ilvA 7753 9300 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 protein_id gnl|my_center|LOCUS_03790 10190 9297 gene locus_tag LOCUS_03800 gene ilvY 10190 9297 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365776.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence030 1333 53 gene locus_tag LOCUS_03810 gene hemL 1333 53 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045277.1 protein_id gnl|my_center|LOCUS_03810 1506 2909 gene locus_tag LOCUS_03820 gene clcA 1506 2909 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845433.1 protein_id gnl|my_center|LOCUS_03820 2991 3335 gene locus_tag LOCUS_03830 gene erpA 2991 3335 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 protein_id gnl|my_center|LOCUS_03830 4009 3389 gene locus_tag LOCUS_03840 4009 3389 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_03840 4826 4026 gene locus_tag LOCUS_03850 gene btuF 4826 4026 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095645.1 protein_id gnl|my_center|LOCUS_03850 5517 4819 gene locus_tag LOCUS_03860 gene mtnN 5517 4819 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_03860 5610 7124 gene locus_tag LOCUS_03870 gene dgt 5610 7124 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057094.1 protein_id gnl|my_center|LOCUS_03870 7265 8692 gene locus_tag LOCUS_03880 gene degP 7265 8692 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753945.1 protein_id gnl|my_center|LOCUS_03880 9160 8771 gene locus_tag LOCUS_03890 9160 8771 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 protein_id gnl|my_center|LOCUS_03890 10094 9270 gene locus_tag LOCUS_03900 gene dapD 10094 9270 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence031 <1 1293 gene locus_tag LOCUS_03910 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704193.1:autotransporter assembly complex protein TamB 1296 1631 gene locus_tag LOCUS_03920 1296 1631 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 protein_id gnl|my_center|LOCUS_03920 1879 3474 gene locus_tag LOCUS_03930 1879 3474 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196212.1 protein_id gnl|my_center|LOCUS_03930 4053 3526 gene locus_tag LOCUS_03940 gene ppa 4053 3526 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368588.1 protein_id gnl|my_center|LOCUS_03940 4497 5411 gene locus_tag LOCUS_03950 gene ytfQ 4497 5411 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 protein_id gnl|my_center|LOCUS_03950 5612 7114 gene locus_tag LOCUS_03960 5612 7114 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 protein_id gnl|my_center|LOCUS_03960 7128 8150 gene locus_tag LOCUS_03970 7128 8150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572298.1 protein_id gnl|my_center|LOCUS_03970 8137 9126 gene locus_tag LOCUS_03980 gene yjfF 8137 9126 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence032 335 748 gene locus_tag LOCUS_03990 gene msrB 335 748 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 protein_id gnl|my_center|LOCUS_03990 789 1067 gene locus_tag LOCUS_04000 789 1067 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 protein_id gnl|my_center|LOCUS_04000 1789 1148 gene locus_tag LOCUS_04010 gene pncA 1789 1148 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 protein_id gnl|my_center|LOCUS_04010 2818 1802 gene locus_tag LOCUS_04020 gene ansA 2818 1802 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_04020 4770 2920 gene locus_tag LOCUS_04030 gene sppA 4770 2920 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 protein_id gnl|my_center|LOCUS_04030 4945 5496 gene locus_tag LOCUS_04040 4945 5496 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339283.1 protein_id gnl|my_center|LOCUS_04040 5644 6687 gene locus_tag LOCUS_04050 gene selD 5644 6687 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 protein_id gnl|my_center|LOCUS_04050 6691 8637 gene locus_tag LOCUS_04060 gene topB 6691 8637 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 protein_id gnl|my_center|LOCUS_04060 8739 9020 gene locus_tag LOCUS_04070 8739 9020 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 protein_id gnl|my_center|LOCUS_04070 9393 8980 gene locus_tag LOCUS_04080 gene nudG 9393 8980 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 protein_id gnl|my_center|LOCUS_04080 10248 9442 gene locus_tag LOCUS_04090 gene xthA 10248 9442 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence033 1969 662 gene locus_tag LOCUS_04100 gene ygjG 1969 662 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297164.1 protein_id gnl|my_center|LOCUS_04100 2470 3357 gene locus_tag LOCUS_04110 gene dgcZ 2470 3357 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592774.1 protein_id gnl|my_center|LOCUS_04110 3549 5072 gene locus_tag LOCUS_04120 3549 5072 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 protein_id gnl|my_center|LOCUS_04120 5517 7064 gene locus_tag LOCUS_04130 5517 7064 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 protein_id gnl|my_center|LOCUS_04130 7633 7100 gene locus_tag LOCUS_04140 7633 7100 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 protein_id gnl|my_center|LOCUS_04140 7606 7785 gene locus_tag LOCUS_04150 7606 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 7876 8637 gene locus_tag LOCUS_04160 7876 8637 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence034 1245 703 gene locus_tag LOCUS_04170 gene ymdB 1245 703 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857411.1 protein_id gnl|my_center|LOCUS_04170 1622 1317 gene locus_tag LOCUS_04180 1622 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171415.1 protein_id gnl|my_center|LOCUS_04180 2301 1825 gene locus_tag LOCUS_04190 2301 1825 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705019.1 protein_id gnl|my_center|LOCUS_04190 2978 2412 gene locus_tag LOCUS_04200 2978 2412 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 protein_id gnl|my_center|LOCUS_04200 3740 3003 gene locus_tag LOCUS_04210 gene ycdX 3740 3003 CDS product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283664.1 protein_id gnl|my_center|LOCUS_04210 4754 3813 gene locus_tag LOCUS_04220 gene ghrA 4754 3813 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705016.1 protein_id gnl|my_center|LOCUS_04220 5811 4840 gene locus_tag LOCUS_04230 5811 4840 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046008.1 protein_id gnl|my_center|LOCUS_04230 8424 5884 gene locus_tag LOCUS_04240 8424 5884 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136459.1 protein_id gnl|my_center|LOCUS_04240 9137 8448 gene locus_tag LOCUS_04250 9137 8448 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044779.1 protein_id gnl|my_center|LOCUS_04250 9750 9217 gene locus_tag LOCUS_04260 9750 9217 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence035 1932 145 gene locus_tag LOCUS_04270 1932 145 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 protein_id gnl|my_center|LOCUS_04270 3839 2172 gene locus_tag LOCUS_04280 gene tsr 3839 2172 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 protein_id gnl|my_center|LOCUS_04280 5334 4135 gene locus_tag LOCUS_04290 5334 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 8546 5499 gene locus_tag LOCUS_04300 8546 5499 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268617.1 protein_id gnl|my_center|LOCUS_04300 <10266 9214 gene locus_tag LOCUS_04310 <10266 9214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195011.1:cytosine deaminase >Feature sequence036 709 26 gene locus_tag LOCUS_04320 709 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1976 702 gene locus_tag LOCUS_04330 1976 702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 protein_id gnl|my_center|LOCUS_04330 2649 1939 gene locus_tag LOCUS_04340 2649 1939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112804.1 protein_id gnl|my_center|LOCUS_04340 3534 2680 gene locus_tag LOCUS_04350 3534 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268633.1 protein_id gnl|my_center|LOCUS_04350 4334 4672 gene locus_tag LOCUS_04360 4334 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4809 5918 gene locus_tag LOCUS_04370 gene apbC 4809 5918 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 protein_id gnl|my_center|LOCUS_04370 6415 5975 gene locus_tag LOCUS_04380 6415 5975 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 protein_id gnl|my_center|LOCUS_04380 6508 8199 gene locus_tag LOCUS_04390 6508 8199 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 protein_id gnl|my_center|LOCUS_04390 8196 8921 gene locus_tag LOCUS_04400 gene btsR 8196 8921 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365746.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence037 426 596 gene locus_tag LOCUS_04410 426 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 593 1342 gene locus_tag LOCUS_04420 593 1342 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102000.1 protein_id gnl|my_center|LOCUS_04420 2679 1381 gene locus_tag LOCUS_04430 gene gntU 2679 1381 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 protein_id gnl|my_center|LOCUS_04430 3252 2725 gene locus_tag LOCUS_04440 gene gntK 3252 2725 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 protein_id gnl|my_center|LOCUS_04440 4389 3394 gene locus_tag LOCUS_04450 gene gntR 4389 3394 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730263.1 protein_id gnl|my_center|LOCUS_04450 5189 4494 gene locus_tag LOCUS_04460 5189 4494 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 protein_id gnl|my_center|LOCUS_04460 6351 5311 gene locus_tag LOCUS_04470 6351 5311 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236295.1 protein_id gnl|my_center|LOCUS_04470 6661 7158 gene locus_tag LOCUS_04480 gene yhhY 6661 7158 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301731.1 protein_id gnl|my_center|LOCUS_04480 9163 7397 gene locus_tag LOCUS_04490 gene ggt 9163 7397 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_04490 9289 9756 gene locus_tag LOCUS_04500 9289 9756 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825994.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence038 <1 1337 gene locus_tag LOCUS_04510 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367177.1:NAD(P)/FAD-dependent oxidoreductase 1522 2061 gene locus_tag LOCUS_04520 1522 2061 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 protein_id gnl|my_center|LOCUS_04520 3333 2704 gene locus_tag LOCUS_04530 3333 2704 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 protein_id gnl|my_center|LOCUS_04530 3585 3842 gene locus_tag LOCUS_04540 gene bhsA 3585 3842 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800153.1 protein_id gnl|my_center|LOCUS_04540 4871 3897 gene locus_tag LOCUS_04550 gene ldtC 4871 3897 CDS product L,D-transpeptidase LdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598225.1 protein_id gnl|my_center|LOCUS_04550 8452 5006 gene locus_tag LOCUS_04560 gene mfd 8452 5006 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 protein_id gnl|my_center|LOCUS_04560 8593 9792 gene locus_tag LOCUS_04570 gene lolC 8593 9792 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence039 780 2096 gene locus_tag LOCUS_04580 gene guaD 780 2096 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311109.1 protein_id gnl|my_center|LOCUS_04580 2917 2117 gene locus_tag LOCUS_04590 2917 2117 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705127.1 protein_id gnl|my_center|LOCUS_04590 3211 4869 gene locus_tag LOCUS_04600 3211 4869 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_04600 5153 5422 gene locus_tag LOCUS_04610 5153 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5435 6004 gene locus_tag LOCUS_04620 5435 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6051 6725 gene locus_tag LOCUS_04630 6051 6725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463381.1 protein_id gnl|my_center|LOCUS_04630 9893 6732 gene locus_tag LOCUS_04640 9893 6732 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804172.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence040 <1 803 gene locus_tag LOCUS_04650 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038418469.1:EAL domain-containing protein 1114 791 gene locus_tag LOCUS_04660 gene soxS 1114 791 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 protein_id gnl|my_center|LOCUS_04660 1201 1659 gene locus_tag LOCUS_04670 gene soxR 1201 1659 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 protein_id gnl|my_center|LOCUS_04670 1737 2405 gene locus_tag LOCUS_04680 1737 2405 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 protein_id gnl|my_center|LOCUS_04680 2719 4068 gene locus_tag LOCUS_04690 gene ghxP 2719 4068 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 protein_id gnl|my_center|LOCUS_04690 4208 5854 gene locus_tag LOCUS_04700 4208 5854 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402206.1 protein_id gnl|my_center|LOCUS_04700 7182 5887 gene locus_tag LOCUS_04710 7182 5887 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_04710 8977 7331 gene locus_tag LOCUS_04720 gene actP 8977 7331 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 protein_id gnl|my_center|LOCUS_04720 9291 8974 gene locus_tag LOCUS_04730 9291 8974 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095080.1 protein_id gnl|my_center|LOCUS_04730 <9972 9382 gene locus_tag LOCUS_04740 <9972 9382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000083869.1:acetate--CoA ligase >Feature sequence041 1597 2787 gene locus_tag LOCUS_04750 gene uxuA 1597 2787 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 protein_id gnl|my_center|LOCUS_04750 3424 2852 gene locus_tag LOCUS_04760 gene yeiP 3424 2852 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 protein_id gnl|my_center|LOCUS_04760 3616 3900 gene locus_tag LOCUS_04770 3616 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3931 4185 gene locus_tag LOCUS_04780 3931 4185 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 protein_id gnl|my_center|LOCUS_04780 5363 4182 gene locus_tag LOCUS_04790 gene setB 5363 4182 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706120.1 protein_id gnl|my_center|LOCUS_04790 5733 6866 gene locus_tag LOCUS_04800 gene fruB 5733 6866 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487246.1 protein_id gnl|my_center|LOCUS_04800 6863 7801 gene locus_tag LOCUS_04810 gene fruK 6863 7801 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500936.1 protein_id gnl|my_center|LOCUS_04810 7818 9515 gene locus_tag LOCUS_04820 gene fruA 7818 9515 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence042 535 1053 gene locus_tag LOCUS_04830 535 1053 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 protein_id gnl|my_center|LOCUS_04830 1120 1791 gene locus_tag LOCUS_04840 1120 1791 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 protein_id gnl|my_center|LOCUS_04840 1959 4385 gene locus_tag LOCUS_04850 1959 4385 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 protein_id gnl|my_center|LOCUS_04850 4409 5383 gene locus_tag LOCUS_04860 4409 5383 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097476.1 protein_id gnl|my_center|LOCUS_04860 5394 5903 gene locus_tag LOCUS_04870 5394 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 8074 5894 gene locus_tag LOCUS_04880 gene dinG 8074 5894 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218658.1 protein_id gnl|my_center|LOCUS_04880 8367 9212 gene locus_tag LOCUS_04890 gene licT 8367 9212 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence043 156 1835 gene locus_tag LOCUS_04900 gene eptB 156 1835 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269228.1 protein_id gnl|my_center|LOCUS_04900 1927 2003 gene locus_tag LOCUS_t00010 1927 2003 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2425 2060 gene locus_tag LOCUS_04910 2425 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3410 2508 gene locus_tag LOCUS_04920 3410 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4222 5802 gene locus_tag LOCUS_04930 4222 5802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 protein_id gnl|my_center|LOCUS_04930 5998 7017 gene locus_tag LOCUS_04940 gene dppB 5998 7017 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 protein_id gnl|my_center|LOCUS_04940 7027 7929 gene locus_tag LOCUS_04950 gene dppC 7027 7929 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084689.1 protein_id gnl|my_center|LOCUS_04950 7941 8936 gene locus_tag LOCUS_04960 gene dppD 7941 8936 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence044 1854 2222 gene locus_tag LOCUS_04970 1854 2222 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_04970 2331 2939 gene locus_tag LOCUS_04980 gene lexA 2331 2939 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_04980 3065 4372 gene locus_tag LOCUS_04990 gene dinF 3065 4372 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704041.1 protein_id gnl|my_center|LOCUS_04990 4580 4789 gene locus_tag LOCUS_05000 4580 4789 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_05000 5384 4869 gene locus_tag LOCUS_05010 gene zur 5384 4869 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 protein_id gnl|my_center|LOCUS_05010 5494 6000 gene locus_tag LOCUS_05020 5494 6000 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368759.1 protein_id gnl|my_center|LOCUS_05020 6149 6895 gene locus_tag LOCUS_05030 6149 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05030 7004 7429 gene locus_tag LOCUS_05040 7004 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 7574 8515 gene locus_tag LOCUS_05050 gene dusA 7574 8515 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 protein_id gnl|my_center|LOCUS_05050 8646 8906 gene locus_tag LOCUS_05060 gene pspG 8646 8906 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095061.1 protein_id gnl|my_center|LOCUS_05060 <9760 9087 gene locus_tag LOCUS_05070 <9760 9087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000235562.1:quinone oxidoreductase >Feature sequence045 267 782 gene locus_tag LOCUS_05080 267 782 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089295.1 protein_id gnl|my_center|LOCUS_05080 1206 820 gene locus_tag LOCUS_05090 1206 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517651.1 protein_id gnl|my_center|LOCUS_05090 1639 3549 gene locus_tag LOCUS_05100 1639 3549 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817438.1 protein_id gnl|my_center|LOCUS_05100 4371 3628 gene locus_tag LOCUS_05110 4371 3628 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704784.1 protein_id gnl|my_center|LOCUS_05110 5823 4606 gene locus_tag LOCUS_05120 5823 4606 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 protein_id gnl|my_center|LOCUS_05120 6224 6463 gene locus_tag LOCUS_05130 gene ycgZ 6224 6463 CDS product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367637.1 protein_id gnl|my_center|LOCUS_05130 6633 6932 gene locus_tag LOCUS_05140 6633 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367638.1 protein_id gnl|my_center|LOCUS_05140 6970 7248 gene locus_tag LOCUS_05150 6970 7248 CDS product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367639.1 protein_id gnl|my_center|LOCUS_05150 7382 8122 gene locus_tag LOCUS_05160 7382 8122 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391237.1 protein_id gnl|my_center|LOCUS_05160 8468 8157 gene locus_tag LOCUS_05170 8468 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9152 8490 gene locus_tag LOCUS_05180 9152 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9176 9496 gene locus_tag LOCUS_05190 9176 9496 CDS product darcynin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971550.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence046 972 520 gene locus_tag LOCUS_05200 972 520 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 protein_id gnl|my_center|LOCUS_05200 1644 2864 gene locus_tag LOCUS_05210 gene arcA 1644 2864 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095371.1 protein_id gnl|my_center|LOCUS_05210 2875 3786 gene locus_tag LOCUS_05220 2875 3786 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095370.1 protein_id gnl|my_center|LOCUS_05220 3823 4827 gene locus_tag LOCUS_05230 gene argF 3823 4827 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_05230 4876 6279 gene locus_tag LOCUS_05240 4876 6279 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514432.1 protein_id gnl|my_center|LOCUS_05240 6448 6927 gene locus_tag LOCUS_05250 6448 6927 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 protein_id gnl|my_center|LOCUS_05250 7181 8116 gene locus_tag LOCUS_05260 gene pyrB 7181 8116 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 protein_id gnl|my_center|LOCUS_05260 8127 8588 gene locus_tag LOCUS_05270 gene pyrI 8127 8588 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368555.1 protein_id gnl|my_center|LOCUS_05270 8662 9048 gene locus_tag LOCUS_05280 gene ridA 8662 9048 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047539.1 protein_id gnl|my_center|LOCUS_05280 <9674 9101 gene locus_tag LOCUS_05290 <9674 9101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000095186.1:YgiQ family radical SAM protein >Feature sequence047 2637 1336 gene locus_tag LOCUS_05300 gene ygiF 2637 1336 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046301.1 protein_id gnl|my_center|LOCUS_05300 2888 3502 gene locus_tag LOCUS_05310 2888 3502 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125344.1 protein_id gnl|my_center|LOCUS_05310 3589 4845 gene locus_tag LOCUS_05320 3589 4845 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 protein_id gnl|my_center|LOCUS_05320 5669 4851 gene locus_tag LOCUS_05330 gene bacA 5669 4851 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640212.1 protein_id gnl|my_center|LOCUS_05330 6156 5797 gene locus_tag LOCUS_05340 gene folB 6156 5797 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 protein_id gnl|my_center|LOCUS_05340 6264 6881 gene locus_tag LOCUS_05350 gene plsY 6264 6881 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272784.1 protein_id gnl|my_center|LOCUS_05350 7931 6918 gene locus_tag LOCUS_05360 gene tsaD 7931 6918 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 protein_id gnl|my_center|LOCUS_05360 8180 8395 gene locus_tag LOCUS_05370 gene rpsU 8180 8395 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence048 379 576 gene locus_tag LOCUS_05380 379 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1802 717 gene locus_tag LOCUS_05390 gene mltC 1802 717 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 protein_id gnl|my_center|LOCUS_05390 2119 1844 gene locus_tag LOCUS_05400 2119 1844 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 protein_id gnl|my_center|LOCUS_05400 3207 2122 gene locus_tag LOCUS_05410 gene mutY 3207 2122 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 protein_id gnl|my_center|LOCUS_05410 3360 4079 gene locus_tag LOCUS_05420 gene trmB 3360 4079 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 protein_id gnl|my_center|LOCUS_05420 4079 4405 gene locus_tag LOCUS_05430 4079 4405 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107559.1 protein_id gnl|my_center|LOCUS_05430 4456 5172 gene locus_tag LOCUS_05440 4456 5172 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 protein_id gnl|my_center|LOCUS_05440 5325 5678 gene locus_tag LOCUS_05450 5325 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5877 6065 gene locus_tag LOCUS_05460 5877 6065 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_05460 6082 6519 gene locus_tag LOCUS_05470 6082 6519 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_05470 7514 6549 gene locus_tag LOCUS_05480 gene yjiA 7514 6549 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368442.1 protein_id gnl|my_center|LOCUS_05480 7736 7533 gene locus_tag LOCUS_05490 7736 7533 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 protein_id gnl|my_center|LOCUS_05490 9469 7997 gene locus_tag LOCUS_05500 9469 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence049 <1 886 gene locus_tag LOCUS_05510 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095281.1:tRNA epoxyqueuosine(34) reductase QueG 899 1078 gene locus_tag LOCUS_05520 899 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1231 1156 gene locus_tag LOCUS_t00020 1231 1156 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1341 1266 gene locus_tag LOCUS_t00030 1341 1266 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2054 1509 gene locus_tag LOCUS_05530 gene orn 2054 1509 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_05530 2166 3212 gene locus_tag LOCUS_05540 gene rsgA 2166 3212 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_05540 3309 4271 gene locus_tag LOCUS_05550 gene asd 3309 4271 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934920.1 protein_id gnl|my_center|LOCUS_05550 4288 7620 gene locus_tag LOCUS_05560 gene mscM 4288 7620 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236760.1 protein_id gnl|my_center|LOCUS_05560 8760 7783 gene locus_tag LOCUS_05570 gene epmA 8760 7783 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence050 842 108 gene locus_tag LOCUS_05580 gene fabG 842 108 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_05580 1785 856 gene locus_tag LOCUS_05590 gene fabD 1785 856 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367191.1 protein_id gnl|my_center|LOCUS_05590 2756 1803 gene locus_tag LOCUS_05600 2756 1803 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 protein_id gnl|my_center|LOCUS_05600 3767 2763 gene locus_tag LOCUS_05610 gene plsX 3767 2763 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 protein_id gnl|my_center|LOCUS_05610 4043 3870 gene locus_tag LOCUS_05620 gene rpmF 4043 3870 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 protein_id gnl|my_center|LOCUS_05620 4616 4095 gene locus_tag LOCUS_05630 gene yceD 4616 4095 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 protein_id gnl|my_center|LOCUS_05630 4757 5344 gene locus_tag LOCUS_05640 4757 5344 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_05640 6118 5402 gene locus_tag LOCUS_05650 6118 5402 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762491.1 protein_id gnl|my_center|LOCUS_05650 7196 6243 gene locus_tag LOCUS_05660 gene rluC 7196 6243 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence051 505 1845 gene locus_tag LOCUS_05670 gene tssK 505 1845 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 protein_id gnl|my_center|LOCUS_05670 1896 2495 gene locus_tag LOCUS_05680 1896 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3444 4202 gene locus_tag LOCUS_05690 3444 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 4217 4708 gene locus_tag LOCUS_05700 gene hcp 4217 4708 CDS product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 protein_id gnl|my_center|LOCUS_05700 4860 7520 gene locus_tag LOCUS_05710 gene tssH 4860 7520 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705646.1 protein_id gnl|my_center|LOCUS_05710 7513 7689 gene locus_tag LOCUS_05720 7513 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7686 8066 gene locus_tag LOCUS_05730 7686 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 8060 8527 gene locus_tag LOCUS_05740 8060 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence052 <1 722 gene locus_tag LOCUS_05750 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017864221.1:citrate/2-methylcitrate synthase 1618 806 gene locus_tag LOCUS_05760 gene djlA 1618 806 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 protein_id gnl|my_center|LOCUS_05760 1802 4165 gene locus_tag LOCUS_05770 gene lptD 1802 4165 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 protein_id gnl|my_center|LOCUS_05770 4219 5505 gene locus_tag LOCUS_05780 gene surA 4219 5505 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 protein_id gnl|my_center|LOCUS_05780 5505 6500 gene locus_tag LOCUS_05790 gene pdxA 5505 6500 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_05790 6497 7318 gene locus_tag LOCUS_05800 gene rsmA 6497 7318 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065373.1 protein_id gnl|my_center|LOCUS_05800 7321 7698 gene locus_tag LOCUS_05810 gene apaG 7321 7698 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610896.1 protein_id gnl|my_center|LOCUS_05810 7703 8554 gene locus_tag LOCUS_05820 gene apaH 7703 8554 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257195.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence053 507 52 gene locus_tag LOCUS_05830 gene alaE 507 52 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 protein_id gnl|my_center|LOCUS_05830 1022 1330 gene locus_tag LOCUS_05840 1022 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1607 1428 gene locus_tag LOCUS_05850 1607 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098412.1 protein_id gnl|my_center|LOCUS_05850 1833 1991 gene locus_tag LOCUS_05860 1833 1991 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098410.1 protein_id gnl|my_center|LOCUS_05860 2256 4202 gene locus_tag LOCUS_05870 2256 4202 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 protein_id gnl|my_center|LOCUS_05870 4695 4327 gene locus_tag LOCUS_05880 4695 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 5040 5489 gene locus_tag LOCUS_05890 5040 5489 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816444.1 protein_id gnl|my_center|LOCUS_05890 5480 5827 gene locus_tag LOCUS_05900 5480 5827 CDS product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021466343.1 protein_id gnl|my_center|LOCUS_05900 6111 6398 gene locus_tag LOCUS_05910 6111 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6878 6666 gene locus_tag LOCUS_05920 6878 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7099 7284 gene locus_tag LOCUS_05930 7099 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7298 8215 gene locus_tag LOCUS_05940 7298 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence054 370 101 gene locus_tag LOCUS_05950 370 101 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369314.1 protein_id gnl|my_center|LOCUS_05950 956 360 gene locus_tag LOCUS_05960 gene rsmD 956 360 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 protein_id gnl|my_center|LOCUS_05960 1146 2699 gene locus_tag LOCUS_05970 gene ftsY 1146 2699 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118701.1 protein_id gnl|my_center|LOCUS_05970 2702 3370 gene locus_tag LOCUS_05980 gene ftsE 2702 3370 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 protein_id gnl|my_center|LOCUS_05980 3363 4418 gene locus_tag LOCUS_05990 gene ftsX 3363 4418 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 protein_id gnl|my_center|LOCUS_05990 4680 5537 gene locus_tag LOCUS_06000 gene rpoH 4680 5537 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920815.1 protein_id gnl|my_center|LOCUS_06000 7079 5586 gene locus_tag LOCUS_06010 7079 5586 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_06010 7198 8463 gene locus_tag LOCUS_06020 7198 8463 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence055 <1 1089 gene locus_tag LOCUS_06030 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368121.1:acyl-CoA dehydrogenase FadE 1177 1965 gene locus_tag LOCUS_06040 1177 1965 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_06040 2131 2055 gene locus_tag LOCUS_t00040 2131 2055 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2995 2264 gene locus_tag LOCUS_06050 gene dnaQ 2995 2264 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 protein_id gnl|my_center|LOCUS_06050 3048 3524 gene locus_tag LOCUS_06060 gene rnhA 3048 3524 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_06060 4237 3521 gene locus_tag LOCUS_06070 4237 3521 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704466.1 protein_id gnl|my_center|LOCUS_06070 4270 5025 gene locus_tag LOCUS_06080 gene gloB 4270 5025 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052743.1 protein_id gnl|my_center|LOCUS_06080 5319 6470 gene locus_tag LOCUS_06090 gene mltD 5319 6470 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 protein_id gnl|my_center|LOCUS_06090 7302 6532 gene locus_tag LOCUS_06100 7302 6532 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095685.1 protein_id gnl|my_center|LOCUS_06100 8041 7373 gene locus_tag LOCUS_06110 8041 7373 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence056 <1 599 gene locus_tag LOCUS_06120 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044679.1:beta-ketoacyl-ACP synthase II 708 1508 gene locus_tag LOCUS_06130 gene pabC 708 1508 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 protein_id gnl|my_center|LOCUS_06130 1528 2541 gene locus_tag LOCUS_06140 gene yceG 1528 2541 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 protein_id gnl|my_center|LOCUS_06140 2531 3169 gene locus_tag LOCUS_06150 gene tmk 2531 3169 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705040.1 protein_id gnl|my_center|LOCUS_06150 3169 4176 gene locus_tag LOCUS_06160 gene holB 3169 4176 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830395.1 protein_id gnl|my_center|LOCUS_06160 4187 4981 gene locus_tag LOCUS_06170 4187 4981 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 protein_id gnl|my_center|LOCUS_06170 5280 6713 gene locus_tag LOCUS_06180 gene ptsG 5280 6713 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 protein_id gnl|my_center|LOCUS_06180 <8997 6891 gene locus_tag LOCUS_06190 <8997 6891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097112.1:ferric-rhodotorulic acid/ferric-coprogen receptor FhuE >Feature sequence057 506 2170 gene locus_tag LOCUS_06200 506 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3603 2584 gene locus_tag LOCUS_06210 gene ahr 3603 2584 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 protein_id gnl|my_center|LOCUS_06210 4290 3712 gene locus_tag LOCUS_06220 4290 3712 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_06220 5306 4290 gene locus_tag LOCUS_06230 5306 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5566 5650 gene locus_tag LOCUS_t00050 5566 5650 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6182 6880 gene locus_tag LOCUS_06240 6182 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208561.1 protein_id gnl|my_center|LOCUS_06240 6883 7308 gene locus_tag LOCUS_06250 6883 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7986 8228 gene locus_tag LOCUS_06260 7986 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 <8911 8358 gene locus_tag LOCUS_06270 <8911 8358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000373992.1:bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase >Feature sequence058 2620 1184 gene locus_tag LOCUS_06280 gene aspA 2620 1184 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 protein_id gnl|my_center|LOCUS_06280 2958 3434 gene locus_tag LOCUS_06290 gene fxsA 2958 3434 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267445.1 protein_id gnl|my_center|LOCUS_06290 3571 3864 gene locus_tag LOCUS_06300 3571 3864 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_06300 3914 5557 gene locus_tag LOCUS_06310 gene groL 3914 5557 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_06310 5787 6152 gene locus_tag LOCUS_06320 5787 6152 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168693.1 protein_id gnl|my_center|LOCUS_06320 7439 6531 gene locus_tag LOCUS_06330 gene epmB 7439 6531 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_06330 7600 8166 gene locus_tag LOCUS_06340 gene efp 7600 8166 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 protein_id gnl|my_center|LOCUS_06340 8225 8356 gene locus_tag LOCUS_06350 8225 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8459 8605 gene locus_tag LOCUS_06360 gene ecnB 8459 8605 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence059 576 148 gene locus_tag LOCUS_06370 gene recX 576 148 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 protein_id gnl|my_center|LOCUS_06370 1779 715 gene locus_tag LOCUS_06380 gene recA 1779 715 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 protein_id gnl|my_center|LOCUS_06380 2365 1868 gene locus_tag LOCUS_06390 gene pncC 2365 1868 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_06390 3588 2506 gene locus_tag LOCUS_06400 gene mltB 3588 2506 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 protein_id gnl|my_center|LOCUS_06400 4426 3704 gene locus_tag LOCUS_06410 4426 3704 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 protein_id gnl|my_center|LOCUS_06410 5183 4413 gene locus_tag LOCUS_06420 5183 4413 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_06420 6018 5251 gene locus_tag LOCUS_06430 6018 5251 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_06430 6191 6403 gene locus_tag LOCUS_06440 6191 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8137 6470 gene locus_tag LOCUS_06450 8137 6470 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence060 35 331 gene locus_tag LOCUS_06460 gene fis 35 331 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_06460 655 2751 gene locus_tag LOCUS_06470 655 2751 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 protein_id gnl|my_center|LOCUS_06470 3444 2803 gene locus_tag LOCUS_06480 gene envR 3444 2803 CDS product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 protein_id gnl|my_center|LOCUS_06480 3825 4967 gene locus_tag LOCUS_06490 gene acrE 3825 4967 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160361.1 protein_id gnl|my_center|LOCUS_06490 4977 5939 gene locus_tag LOCUS_06500 4977 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 5936 8095 gene locus_tag LOCUS_06510 5936 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 8441 8665 gene locus_tag LOCUS_06520 8441 8665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825645.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence061 2847 1423 gene locus_tag LOCUS_06530 gene creC 2847 1423 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704331.1 protein_id gnl|my_center|LOCUS_06530 3539 2847 gene locus_tag LOCUS_06540 gene creB 3539 2847 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188676.1 protein_id gnl|my_center|LOCUS_06540 4052 3558 gene locus_tag LOCUS_06550 gene creA 4052 3558 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 protein_id gnl|my_center|LOCUS_06550 4248 5117 gene locus_tag LOCUS_06560 gene robA 4248 5117 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371679.1 protein_id gnl|my_center|LOCUS_06560 5761 5114 gene locus_tag LOCUS_06570 gene gpmB 5761 5114 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 protein_id gnl|my_center|LOCUS_06570 5818 6333 gene locus_tag LOCUS_06580 gene yjjX 5818 6333 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882672.1 protein_id gnl|my_center|LOCUS_06580 6653 6324 gene locus_tag LOCUS_06590 gene trpR 6653 6324 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095502.1 protein_id gnl|my_center|LOCUS_06590 <8667 6708 gene locus_tag LOCUS_06600 <8667 6708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095501.1:murein transglycosylase >Feature sequence062 <1 1523 gene locus_tag LOCUS_06610 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001315860.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase 1591 3018 gene locus_tag LOCUS_06620 gene hldE 1591 3018 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 protein_id gnl|my_center|LOCUS_06620 3434 3069 gene locus_tag LOCUS_06630 3434 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3849 4502 gene locus_tag LOCUS_06640 gene ribB 3849 4502 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502964.1 protein_id gnl|my_center|LOCUS_06640 5345 4569 gene locus_tag LOCUS_06650 gene zupT 5345 4569 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 protein_id gnl|my_center|LOCUS_06650 5537 6328 gene locus_tag LOCUS_06660 gene ygiD 5537 6328 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 protein_id gnl|my_center|LOCUS_06660 7516 6356 gene locus_tag LOCUS_06670 7516 6356 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 protein_id gnl|my_center|LOCUS_06670 8173 7520 gene locus_tag LOCUS_06680 8173 7520 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence063 <1 574 gene locus_tag LOCUS_06690 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004391091.1:30S ribosomal protein S1 689 973 gene locus_tag LOCUS_06700 gene ihfB 689 973 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 protein_id gnl|my_center|LOCUS_06700 1742 3436 gene locus_tag LOCUS_06710 1742 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3473 5221 gene locus_tag LOCUS_06720 gene msbA 3473 5221 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 protein_id gnl|my_center|LOCUS_06720 5218 6195 gene locus_tag LOCUS_06730 gene lpxK 5218 6195 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 protein_id gnl|my_center|LOCUS_06730 6230 7489 gene locus_tag LOCUS_06740 6230 7489 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 protein_id gnl|my_center|LOCUS_06740 7515 7697 gene locus_tag LOCUS_06750 gene ycaR 7515 7697 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367465.1 protein_id gnl|my_center|LOCUS_06750 7694 8440 gene locus_tag LOCUS_06760 gene kdsB 7694 8440 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence064 1714 1034 gene locus_tag LOCUS_06770 gene flgD 1714 1034 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020493.1 protein_id gnl|my_center|LOCUS_06770 2130 1726 gene locus_tag LOCUS_06780 gene flgC 2130 1726 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 protein_id gnl|my_center|LOCUS_06780 2557 2144 gene locus_tag LOCUS_06790 gene flgB 2557 2144 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_06790 2711 3370 gene locus_tag LOCUS_06800 gene flgA 2711 3370 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 protein_id gnl|my_center|LOCUS_06800 3467 3760 gene locus_tag LOCUS_06810 gene flgM 3467 3760 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 protein_id gnl|my_center|LOCUS_06810 3764 4189 gene locus_tag LOCUS_06820 gene flgN 3764 4189 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 protein_id gnl|my_center|LOCUS_06820 5882 4347 gene locus_tag LOCUS_06830 gene murJ 5882 4347 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367200.1 protein_id gnl|my_center|LOCUS_06830 6921 5998 gene locus_tag LOCUS_06840 6921 5998 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736158.1 protein_id gnl|my_center|LOCUS_06840 7577 6924 gene locus_tag LOCUS_06850 7577 6924 CDS product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877111.1 protein_id gnl|my_center|LOCUS_06850 8172 7588 gene locus_tag LOCUS_06860 gene rimJ 8172 7588 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367203.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence065 1781 1185 gene locus_tag LOCUS_06870 gene rnhB 1781 1185 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 protein_id gnl|my_center|LOCUS_06870 2920 1778 gene locus_tag LOCUS_06880 gene lpxB 2920 1778 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 protein_id gnl|my_center|LOCUS_06880 3708 2920 gene locus_tag LOCUS_06890 gene lpxA 3708 2920 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 protein_id gnl|my_center|LOCUS_06890 4167 3712 gene locus_tag LOCUS_06900 gene fabZ 4167 3712 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 protein_id gnl|my_center|LOCUS_06900 5309 4284 gene locus_tag LOCUS_06910 gene lpxD 5309 4284 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139265.1 protein_id gnl|my_center|LOCUS_06910 5885 5313 gene locus_tag LOCUS_06920 gene skp 5885 5313 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 protein_id gnl|my_center|LOCUS_06920 8344 5930 gene locus_tag LOCUS_06930 gene bamA 8344 5930 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence066 2097 1174 gene locus_tag LOCUS_06940 2097 1174 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704926.1 protein_id gnl|my_center|LOCUS_06940 2597 2232 gene locus_tag LOCUS_06950 2597 2232 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384139.1 protein_id gnl|my_center|LOCUS_06950 3739 2753 gene locus_tag LOCUS_06960 gene yqjG 3739 2753 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531180.1 protein_id gnl|my_center|LOCUS_06960 4207 3815 gene locus_tag LOCUS_06970 4207 3815 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 protein_id gnl|my_center|LOCUS_06970 4822 5499 gene locus_tag LOCUS_06980 4822 5499 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 protein_id gnl|my_center|LOCUS_06980 5632 6330 gene locus_tag LOCUS_06990 5632 6330 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096699.1 protein_id gnl|my_center|LOCUS_06990 6399 7091 gene locus_tag LOCUS_07000 6399 7091 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 protein_id gnl|my_center|LOCUS_07000 7160 7807 gene locus_tag LOCUS_07010 7160 7807 CDS product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence067 2480 48 gene locus_tag LOCUS_07020 gene metL 2480 48 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 protein_id gnl|my_center|LOCUS_07020 3644 2490 gene locus_tag LOCUS_07030 gene metB 3644 2490 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 protein_id gnl|my_center|LOCUS_07030 3925 4242 gene locus_tag LOCUS_07040 gene metJ 3925 4242 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 protein_id gnl|my_center|LOCUS_07040 4547 4335 gene locus_tag LOCUS_07050 gene rpmE 4547 4335 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 protein_id gnl|my_center|LOCUS_07050 4751 6946 gene locus_tag LOCUS_07060 gene priA 4751 6946 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301269.1 protein_id gnl|my_center|LOCUS_07060 7194 8138 gene locus_tag LOCUS_07070 gene cytR 7194 8138 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368928.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence068 1484 222 gene locus_tag LOCUS_07080 1484 222 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 protein_id gnl|my_center|LOCUS_07080 2478 1546 gene locus_tag LOCUS_07090 2478 1546 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298359.1 protein_id gnl|my_center|LOCUS_07090 3794 2475 gene locus_tag LOCUS_07100 3794 2475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 protein_id gnl|my_center|LOCUS_07100 5223 3931 gene locus_tag LOCUS_07110 5223 3931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706561.1 protein_id gnl|my_center|LOCUS_07110 6693 5545 gene locus_tag LOCUS_07120 gene dgoD 6693 5545 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 protein_id gnl|my_center|LOCUS_07120 7307 6690 gene locus_tag LOCUS_07130 7307 6690 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 protein_id gnl|my_center|LOCUS_07130 8175 7291 gene locus_tag LOCUS_07140 gene dgoK 8175 7291 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127091.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence069 390 1472 gene locus_tag LOCUS_07150 390 1472 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 protein_id gnl|my_center|LOCUS_07150 2418 1366 gene locus_tag LOCUS_07160 2418 1366 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992380.1 protein_id gnl|my_center|LOCUS_07160 2913 2596 gene locus_tag LOCUS_07170 2913 2596 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 protein_id gnl|my_center|LOCUS_07170 3181 2918 gene locus_tag LOCUS_07180 3181 2918 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 protein_id gnl|my_center|LOCUS_07180 4673 3540 gene locus_tag LOCUS_07190 gene thiH 4673 3540 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095007.1 protein_id gnl|my_center|LOCUS_07190 5440 4670 gene locus_tag LOCUS_07200 gene thiG 5440 4670 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704009.1 protein_id gnl|my_center|LOCUS_07200 5642 5442 gene locus_tag LOCUS_07210 gene thiS 5642 5442 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035896383.1 protein_id gnl|my_center|LOCUS_07210 6363 5632 gene locus_tag LOCUS_07220 6363 5632 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095010.1 protein_id gnl|my_center|LOCUS_07220 7006 6374 gene locus_tag LOCUS_07230 gene thiE 7006 6374 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284655.1 protein_id gnl|my_center|LOCUS_07230 <8201 7006 gene locus_tag LOCUS_07240 <8201 7006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276897.1:phosphomethylpyrimidine synthase ThiC >Feature sequence070 283 1221 gene locus_tag LOCUS_07250 283 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703463.1 protein_id gnl|my_center|LOCUS_07250 1443 1769 gene locus_tag LOCUS_07260 1443 1769 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_07260 1892 3367 gene locus_tag LOCUS_07270 1892 3367 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098720.1 protein_id gnl|my_center|LOCUS_07270 3833 3420 gene locus_tag LOCUS_07280 gene arsC 3833 3420 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065782.1 protein_id gnl|my_center|LOCUS_07280 5161 3878 gene locus_tag LOCUS_07290 gene arsB 5161 3878 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 protein_id gnl|my_center|LOCUS_07290 5584 5249 gene locus_tag LOCUS_07300 5584 5249 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095199.1 protein_id gnl|my_center|LOCUS_07300 6561 5674 gene locus_tag LOCUS_07310 6561 5674 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098830.1 protein_id gnl|my_center|LOCUS_07310 7464 6586 gene locus_tag LOCUS_07320 7464 6586 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence071 833 1657 gene locus_tag LOCUS_07330 833 1657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754737.1 protein_id gnl|my_center|LOCUS_07330 2420 1641 gene locus_tag LOCUS_07340 gene puuD 2420 1641 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831700.1 protein_id gnl|my_center|LOCUS_07340 2697 2371 gene locus_tag LOCUS_07350 2697 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2687 3982 gene locus_tag LOCUS_07360 gene gabT 2687 3982 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_07360 4171 5532 gene locus_tag LOCUS_07370 gene plaP 4171 5532 CDS product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178807.1 protein_id gnl|my_center|LOCUS_07370 7143 5716 gene locus_tag LOCUS_07380 gene sbcB 7143 5716 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980584.1 protein_id gnl|my_center|LOCUS_07380 <8110 7222 gene locus_tag LOCUS_07390 <8110 7222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706023.1:acyltransferase >Feature sequence072 975 1538 gene locus_tag LOCUS_07400 975 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2235 2795 gene locus_tag LOCUS_07410 2235 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2853 3428 gene locus_tag LOCUS_07420 2853 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3699 5099 gene locus_tag LOCUS_07430 3699 5099 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 protein_id gnl|my_center|LOCUS_07430 5221 6903 gene locus_tag LOCUS_07440 5221 6903 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 protein_id gnl|my_center|LOCUS_07440 7135 6968 gene locus_tag LOCUS_07450 7135 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 <8080 7200 gene locus_tag LOCUS_07460 <8080 7200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099362.1:fatty acid biosynthesis protein FabY >Feature sequence073 2569 611 gene locus_tag LOCUS_07470 2569 611 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990051.1 protein_id gnl|my_center|LOCUS_07470 2978 3721 gene locus_tag LOCUS_07480 2978 3721 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 protein_id gnl|my_center|LOCUS_07480 4393 3734 gene locus_tag LOCUS_07490 4393 3734 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_07490 4839 5660 gene locus_tag LOCUS_07500 gene dapB 4839 5660 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704365.1 protein_id gnl|my_center|LOCUS_07500 6233 7276 gene locus_tag LOCUS_07510 gene carA 6233 7276 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence074 <1 538 gene locus_tag LOCUS_07520 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704779.1:molybdate ABC transporter substrate-binding protein 535 1227 gene locus_tag LOCUS_07530 gene modB 535 1227 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 protein_id gnl|my_center|LOCUS_07530 1227 2285 gene locus_tag LOCUS_07540 gene modC 1227 2285 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097513.1 protein_id gnl|my_center|LOCUS_07540 3100 2282 gene locus_tag LOCUS_07550 3100 2282 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704781.1 protein_id gnl|my_center|LOCUS_07550 3252 4253 gene locus_tag LOCUS_07560 gene pgl 3252 4253 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 protein_id gnl|my_center|LOCUS_07560 5747 4440 gene locus_tag LOCUS_07570 5747 4440 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 protein_id gnl|my_center|LOCUS_07570 6336 5860 gene locus_tag LOCUS_07580 6336 5860 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 protein_id gnl|my_center|LOCUS_07580 7030 6350 gene locus_tag LOCUS_07590 7030 6350 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_07590 <7937 7098 gene locus_tag LOCUS_07600 <7937 7098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000205503.1:adenosylmethionine--8-amino-7-oxononanoate transaminase >Feature sequence075 1915 3564 gene locus_tag LOCUS_07610 gene pgi 1915 3564 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 protein_id gnl|my_center|LOCUS_07610 3946 4194 gene locus_tag LOCUS_07620 3946 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4263 4898 gene locus_tag LOCUS_07630 4263 4898 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 protein_id gnl|my_center|LOCUS_07630 4898 5632 gene locus_tag LOCUS_07640 4898 5632 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 protein_id gnl|my_center|LOCUS_07640 5632 7728 gene locus_tag LOCUS_07650 5632 7728 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence076 <1 1602 gene locus_tag LOCUS_07660 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098320.1:translation elongation factor 4 1617 2582 gene locus_tag LOCUS_07670 gene lepB 1617 2582 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 protein_id gnl|my_center|LOCUS_07670 2754 3434 gene locus_tag LOCUS_07680 gene rnc 2754 3434 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 protein_id gnl|my_center|LOCUS_07680 3431 4336 gene locus_tag LOCUS_07690 gene era 3431 4336 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 protein_id gnl|my_center|LOCUS_07690 4346 5083 gene locus_tag LOCUS_07700 gene recO 4346 5083 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370291.1 protein_id gnl|my_center|LOCUS_07700 5158 5889 gene locus_tag LOCUS_07710 gene pdxJ 5158 5889 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_07710 5889 6269 gene locus_tag LOCUS_07720 gene acpS 5889 6269 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986023.1 protein_id gnl|my_center|LOCUS_07720 6526 6266 gene locus_tag LOCUS_07730 gene yfhL 6526 6266 CDS product 4Fe-4S dicluster ferredoxin YfhL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196283.1 protein_id gnl|my_center|LOCUS_07730 7431 6583 gene locus_tag LOCUS_07740 7431 6583 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence077 1236 82 gene locus_tag LOCUS_07750 1236 82 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 protein_id gnl|my_center|LOCUS_07750 2214 1426 gene locus_tag LOCUS_07760 gene fabI 2214 1426 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_07760 3141 2335 gene locus_tag LOCUS_07770 gene sapF 3141 2335 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_07770 4135 3143 gene locus_tag LOCUS_07780 gene sapD 4135 3143 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 protein_id gnl|my_center|LOCUS_07780 5025 4135 gene locus_tag LOCUS_07790 gene sapC 5025 4135 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096395.1 protein_id gnl|my_center|LOCUS_07790 5977 5012 gene locus_tag LOCUS_07800 gene sapB 5977 5012 CDS product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366265.1 protein_id gnl|my_center|LOCUS_07800 7614 5974 gene locus_tag LOCUS_07810 gene sapA 7614 5974 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence078 <1 1345 gene locus_tag LOCUS_07820 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096858.1:methyl-accepting chemotaxis protein 1624 1412 gene locus_tag LOCUS_07830 1624 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 1797 2564 gene locus_tag LOCUS_07840 1797 2564 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705157.1 protein_id gnl|my_center|LOCUS_07840 2632 3402 gene locus_tag LOCUS_07850 2632 3402 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_07850 3389 4111 gene locus_tag LOCUS_07860 3389 4111 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705159.1 protein_id gnl|my_center|LOCUS_07860 4227 5309 gene locus_tag LOCUS_07870 gene mltB 4227 5309 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 protein_id gnl|my_center|LOCUS_07870 5450 5947 gene locus_tag LOCUS_07880 gene pncC 5450 5947 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_07880 6036 7100 gene locus_tag LOCUS_07890 gene recA 6036 7100 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 protein_id gnl|my_center|LOCUS_07890 7239 7667 gene locus_tag LOCUS_07900 gene recX 7239 7667 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence079 <1 1617 gene locus_tag LOCUS_07910 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099375.1:ribosome-dependent GTPase TypA 2388 1702 gene locus_tag LOCUS_07920 gene ompL 2388 1702 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 protein_id gnl|my_center|LOCUS_07920 3893 2463 gene locus_tag LOCUS_07930 3893 2463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 protein_id gnl|my_center|LOCUS_07930 5348 3942 gene locus_tag LOCUS_07940 5348 3942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 protein_id gnl|my_center|LOCUS_07940 6253 5381 gene locus_tag LOCUS_07950 6253 5381 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_07950 7642 6266 gene locus_tag LOCUS_07960 7642 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence080 3950 1062 gene locus_tag LOCUS_07970 gene ptrA 3950 1062 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 protein_id gnl|my_center|LOCUS_07970 7427 4056 gene locus_tag LOCUS_07980 gene recC 7427 4056 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703323.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence081 27 114 gene locus_tag LOCUS_t00060 27 114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 412 1998 gene locus_tag LOCUS_07990 gene tssA 412 1998 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705644.1 protein_id gnl|my_center|LOCUS_07990 2027 2485 gene locus_tag LOCUS_08000 gene tssE 2027 2485 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096444.1 protein_id gnl|my_center|LOCUS_08000 2509 3846 gene locus_tag LOCUS_08010 2509 3846 CDS product VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096445.1 protein_id gnl|my_center|LOCUS_08010 4913 4011 gene locus_tag LOCUS_08020 4913 4011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050861.1 protein_id gnl|my_center|LOCUS_08020 4986 5873 gene locus_tag LOCUS_08030 4986 5873 CDS product HARLDQ motif MBL-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083230.1 protein_id gnl|my_center|LOCUS_08030 6136 5909 gene locus_tag LOCUS_08040 6136 5909 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143120.1 protein_id gnl|my_center|LOCUS_08040 6758 6162 gene locus_tag LOCUS_08050 gene wrbA 6758 6162 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097202.1 protein_id gnl|my_center|LOCUS_08050 7131 7331 gene locus_tag LOCUS_08060 7131 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence082 <1 1073 gene locus_tag LOCUS_08070 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000951805.1:ribulokinase 1084 2586 gene locus_tag LOCUS_08080 gene araA 1084 2586 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 protein_id gnl|my_center|LOCUS_08080 2672 3367 gene locus_tag LOCUS_08090 gene araD 2672 3367 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_08090 3501 5861 gene locus_tag LOCUS_08100 gene polB 3501 5861 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence083 1021 170 gene locus_tag LOCUS_08110 gene murI 1021 170 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 protein_id gnl|my_center|LOCUS_08110 2819 966 gene locus_tag LOCUS_08120 gene btuB 2819 966 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 protein_id gnl|my_center|LOCUS_08120 3191 4291 gene locus_tag LOCUS_08130 gene trmA 3191 4291 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187008.1 protein_id gnl|my_center|LOCUS_08130 4678 4319 gene locus_tag LOCUS_08140 4678 4319 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 protein_id gnl|my_center|LOCUS_08140 5327 4689 gene locus_tag LOCUS_08150 gene fabR 5327 4689 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368907.1 protein_id gnl|my_center|LOCUS_08150 5521 6921 gene locus_tag LOCUS_08160 gene sthA 5521 6921 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 protein_id gnl|my_center|LOCUS_08160 <7481 6904 gene locus_tag LOCUS_08170 <7481 6904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001025919.1:DNA-binding transcriptional regulator OxyR >Feature sequence084 1801 1049 gene locus_tag LOCUS_08180 gene nagD 1801 1049 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 protein_id gnl|my_center|LOCUS_08180 2073 1864 gene locus_tag LOCUS_08190 2073 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08190 3084 2200 gene locus_tag LOCUS_08200 3084 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08200 4241 3093 gene locus_tag LOCUS_08210 gene nagA 4241 3093 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367708.1 protein_id gnl|my_center|LOCUS_08210 5063 4263 gene locus_tag LOCUS_08220 gene nagB 5063 4263 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 protein_id gnl|my_center|LOCUS_08220 5381 7405 gene locus_tag LOCUS_08230 gene nagE 5381 7405 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence085 1412 579 gene locus_tag LOCUS_08240 gene ppsR 1412 579 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 protein_id gnl|my_center|LOCUS_08240 1745 4123 gene locus_tag LOCUS_08250 gene ppsA 1745 4123 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069408.1 protein_id gnl|my_center|LOCUS_08250 4342 5730 gene locus_tag LOCUS_08260 4342 5730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence086 922 1173 gene locus_tag LOCUS_08270 922 1173 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856804.1 protein_id gnl|my_center|LOCUS_08270 2298 1249 gene locus_tag LOCUS_08280 gene sohB 2298 1249 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 protein_id gnl|my_center|LOCUS_08280 2557 3318 gene locus_tag LOCUS_08290 2557 3318 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366220.1 protein_id gnl|my_center|LOCUS_08290 3315 3905 gene locus_tag LOCUS_08300 gene cobO 3315 3905 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278878.1 protein_id gnl|my_center|LOCUS_08300 5045 3960 gene locus_tag LOCUS_08310 gene rluB 5045 3960 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291217.1 protein_id gnl|my_center|LOCUS_08310 5792 5172 gene locus_tag LOCUS_08320 5792 5172 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077250.1 protein_id gnl|my_center|LOCUS_08320 6667 5789 gene locus_tag LOCUS_08330 gene rnm 6667 5789 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence087 <1 1257 gene locus_tag LOCUS_08340 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000420536.1:DNA helicase IV 1717 1259 gene locus_tag LOCUS_08350 gene mgsA 1717 1259 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 protein_id gnl|my_center|LOCUS_08350 1878 2285 gene locus_tag LOCUS_08360 1878 2285 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_08360 2636 2319 gene locus_tag LOCUS_08370 gene hspQ 2636 2319 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 protein_id gnl|my_center|LOCUS_08370 3886 2696 gene locus_tag LOCUS_08380 gene rlmI 3886 2696 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_08380 3975 4256 gene locus_tag LOCUS_08390 gene yccX 3975 4256 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704915.1 protein_id gnl|my_center|LOCUS_08390 4588 4253 gene locus_tag LOCUS_08400 gene tusE 4588 4253 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 protein_id gnl|my_center|LOCUS_08400 5349 4690 gene locus_tag LOCUS_08410 gene yccA 5349 4690 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704916.1 protein_id gnl|my_center|LOCUS_08410 5609 7234 gene locus_tag LOCUS_08420 5609 7234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence088 1899 559 gene locus_tag LOCUS_08430 1899 559 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_08430 2829 1921 gene locus_tag LOCUS_08440 gene galU 2829 1921 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419830.1 protein_id gnl|my_center|LOCUS_08440 4044 3031 gene locus_tag LOCUS_08450 gene rssB 4044 3031 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193432.1 protein_id gnl|my_center|LOCUS_08450 4525 4857 gene locus_tag LOCUS_08460 4525 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4908 5750 gene locus_tag LOCUS_08470 gene purU 4908 5750 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705100.1 protein_id gnl|my_center|LOCUS_08470 6088 6172 gene locus_tag LOCUS_t00070 6088 6172 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6384 6468 gene locus_tag LOCUS_t00080 6384 6468 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 <7350 6657 gene locus_tag LOCUS_08480 <7350 6657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035567.1:SDR family oxidoreductase >Feature sequence089 223 546 gene locus_tag LOCUS_08490 223 546 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 protein_id gnl|my_center|LOCUS_08490 543 1373 gene locus_tag LOCUS_08500 gene amiD 543 1373 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255167.1 protein_id gnl|my_center|LOCUS_08500 2451 1435 gene locus_tag LOCUS_08510 2451 1435 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367508.1 protein_id gnl|my_center|LOCUS_08510 3588 2581 gene locus_tag LOCUS_08520 gene ltaE 3588 2581 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566376.1 protein_id gnl|my_center|LOCUS_08520 5341 3623 gene locus_tag LOCUS_08530 gene poxB 5341 3623 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815381.1 protein_id gnl|my_center|LOCUS_08530 6602 5634 gene locus_tag LOCUS_08540 gene hcr 6602 5634 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178644.1 protein_id gnl|my_center|LOCUS_08540 <7321 6613 gene locus_tag LOCUS_08550 <7321 6613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097332.1:hydroxylamine reductase >Feature sequence090 542 120 gene locus_tag LOCUS_08560 542 120 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095067.1 protein_id gnl|my_center|LOCUS_08560 2335 653 gene locus_tag LOCUS_08570 2335 653 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 protein_id gnl|my_center|LOCUS_08570 3949 2756 gene locus_tag LOCUS_08580 gene tyrB 3949 2756 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 protein_id gnl|my_center|LOCUS_08580 5437 4358 gene locus_tag LOCUS_08590 gene alr 5437 4358 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147297.1 protein_id gnl|my_center|LOCUS_08590 6938 5598 gene locus_tag LOCUS_08600 gene dnaB 6938 5598 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence091 1297 1935 gene locus_tag LOCUS_08610 1297 1935 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 protein_id gnl|my_center|LOCUS_08610 2358 2164 gene locus_tag LOCUS_08620 2358 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2726 4354 gene locus_tag LOCUS_08630 gene oppA 2726 4354 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096270.1 protein_id gnl|my_center|LOCUS_08630 4438 5358 gene locus_tag LOCUS_08640 gene oppB 4438 5358 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 protein_id gnl|my_center|LOCUS_08640 5373 6281 gene locus_tag LOCUS_08650 gene oppC 5373 6281 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence092 2395 1667 gene locus_tag LOCUS_08660 gene yfiH 2395 1667 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 protein_id gnl|my_center|LOCUS_08660 3372 2392 gene locus_tag LOCUS_08670 gene rluD 3372 2392 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079130.1 protein_id gnl|my_center|LOCUS_08670 3502 4239 gene locus_tag LOCUS_08680 gene bamD 3502 4239 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 protein_id gnl|my_center|LOCUS_08680 5497 4292 gene locus_tag LOCUS_08690 5497 4292 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038190.1 protein_id gnl|my_center|LOCUS_08690 5844 6185 gene locus_tag LOCUS_08700 gene raiA 5844 6185 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178449.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence093 804 1796 gene locus_tag LOCUS_08710 gene xylF 804 1796 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_08710 1864 3405 gene locus_tag LOCUS_08720 1864 3405 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 protein_id gnl|my_center|LOCUS_08720 3383 4573 gene locus_tag LOCUS_08730 gene xylH 3383 4573 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_08730 4672 5850 gene locus_tag LOCUS_08740 4672 5850 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 protein_id gnl|my_center|LOCUS_08740 6564 5995 gene locus_tag LOCUS_08750 6564 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence094 1622 2197 gene locus_tag LOCUS_08760 gene rpoE 1622 2197 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_08760 2229 2879 gene locus_tag LOCUS_08770 gene rseA 2229 2879 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098323.1 protein_id gnl|my_center|LOCUS_08770 2879 3832 gene locus_tag LOCUS_08780 gene rseB 2879 3832 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 protein_id gnl|my_center|LOCUS_08780 3829 4308 gene locus_tag LOCUS_08790 gene rseC 3829 4308 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 protein_id gnl|my_center|LOCUS_08790 4508 6307 gene locus_tag LOCUS_08800 gene lepA 4508 6307 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence095 1187 36 gene locus_tag LOCUS_08810 gene yiaY 1187 36 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369197.1 protein_id gnl|my_center|LOCUS_08810 2777 1398 gene locus_tag LOCUS_08820 2777 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2676 3053 gene locus_tag LOCUS_08830 2676 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 3105 3278 gene locus_tag LOCUS_08840 gene rpmF 3105 3278 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 protein_id gnl|my_center|LOCUS_08840 3381 4385 gene locus_tag LOCUS_08850 gene plsX 3381 4385 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 protein_id gnl|my_center|LOCUS_08850 4392 5345 gene locus_tag LOCUS_08860 4392 5345 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 protein_id gnl|my_center|LOCUS_08860 5363 6292 gene locus_tag LOCUS_08870 gene fabD 5363 6292 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367191.1 protein_id gnl|my_center|LOCUS_08870 6306 7040 gene locus_tag LOCUS_08880 gene fabG 6306 7040 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence096 <1 578 gene locus_tag LOCUS_08890 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096070.1:MFS transporter 578 1717 gene locus_tag LOCUS_08900 578 1717 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 protein_id gnl|my_center|LOCUS_08900 2320 2946 gene locus_tag LOCUS_08910 2320 2946 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704343.1 protein_id gnl|my_center|LOCUS_08910 4746 3013 gene locus_tag LOCUS_08920 gene argS 4746 3013 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 protein_id gnl|my_center|LOCUS_08920 4932 5495 gene locus_tag LOCUS_08930 4932 5495 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024793.1 protein_id gnl|my_center|LOCUS_08930 5645 6187 gene locus_tag LOCUS_08940 5645 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence097 181 1710 gene locus_tag LOCUS_08950 gene nnr 181 1710 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295189.1 protein_id gnl|my_center|LOCUS_08950 1703 2161 gene locus_tag LOCUS_08960 gene tsaE 1703 2161 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_08960 2178 3524 gene locus_tag LOCUS_08970 gene amiB 2178 3524 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 protein_id gnl|my_center|LOCUS_08970 3534 5441 gene locus_tag LOCUS_08980 gene mutL 3534 5441 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 protein_id gnl|my_center|LOCUS_08980 5479 6384 gene locus_tag LOCUS_08990 gene miaA 5479 6384 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 protein_id gnl|my_center|LOCUS_08990 6485 6793 gene locus_tag LOCUS_09000 gene hfq 6485 6793 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368633.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence098 87 776 gene locus_tag LOCUS_09010 gene phoB 87 776 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 protein_id gnl|my_center|LOCUS_09010 799 2112 gene locus_tag LOCUS_09020 gene phoR 799 2112 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 protein_id gnl|my_center|LOCUS_09020 2511 3830 gene locus_tag LOCUS_09030 gene brnQ 2511 3830 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 protein_id gnl|my_center|LOCUS_09030 3901 5268 gene locus_tag LOCUS_09040 gene proY 3901 5268 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence099 830 120 gene locus_tag LOCUS_09050 gene plsC 830 120 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369660.1 protein_id gnl|my_center|LOCUS_09050 3367 1097 gene locus_tag LOCUS_09060 gene parC 3367 1097 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_09060 3567 4148 gene locus_tag LOCUS_09070 3567 4148 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703509.1 protein_id gnl|my_center|LOCUS_09070 4180 4494 gene locus_tag LOCUS_09080 4180 4494 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369654.1 protein_id gnl|my_center|LOCUS_09080 6738 4558 gene locus_tag LOCUS_09090 gene katG 6738 4558 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108110.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence100 2 1432 gene locus_tag LOCUS_09100 2 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1495 2175 gene locus_tag LOCUS_09110 gene yrfG 1495 2175 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 protein_id gnl|my_center|LOCUS_09110 2175 2576 gene locus_tag LOCUS_09120 gene hslR 2175 2576 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703665.1 protein_id gnl|my_center|LOCUS_09120 2600 3478 gene locus_tag LOCUS_09130 gene hslO 2600 3478 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 protein_id gnl|my_center|LOCUS_09130 4168 3527 gene locus_tag LOCUS_09140 4168 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4368 4138 gene locus_tag LOCUS_09150 4368 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4830 4372 gene locus_tag LOCUS_09160 gene mraZ 4830 4372 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 protein_id gnl|my_center|LOCUS_09160 6414 5410 gene locus_tag LOCUS_09170 gene cra 6414 5410 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence101 <1 734 gene locus_tag LOCUS_09180 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705342.1:PLP-dependent aminotransferase family protein 1427 1924 gene locus_tag LOCUS_09190 gene tssB 1427 1924 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366297.1 protein_id gnl|my_center|LOCUS_09190 1959 2741 gene locus_tag LOCUS_09200 1959 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2719 4089 gene locus_tag LOCUS_09210 2719 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4271 6040 gene locus_tag LOCUS_09220 gene tssF 4271 6040 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence102 710 1072 gene locus_tag LOCUS_09230 710 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1000 1009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2739 1162 gene locus_tag LOCUS_09240 2739 1162 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_09240 3236 2889 gene locus_tag LOCUS_09250 3236 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3375 3668 gene locus_tag LOCUS_09260 3375 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3864 4583 gene locus_tag LOCUS_09270 3864 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5770 4571 gene locus_tag LOCUS_09280 5770 4571 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803798.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence103 2 304 gene locus_tag LOCUS_09290 2 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 355 1185 gene locus_tag LOCUS_09300 gene frlC 355 1185 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847833.1 protein_id gnl|my_center|LOCUS_09300 1182 1967 gene locus_tag LOCUS_09310 gene frlD 1182 1967 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 protein_id gnl|my_center|LOCUS_09310 2069 2800 gene locus_tag LOCUS_09320 gene frlR 2069 2800 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052755.1 protein_id gnl|my_center|LOCUS_09320 2953 3123 gene locus_tag LOCUS_09330 2953 3123 CDS product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472323.1 protein_id gnl|my_center|LOCUS_09330 4212 3208 gene locus_tag LOCUS_09340 gene trpS 4212 3208 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_09340 4963 4205 gene locus_tag LOCUS_09350 gene gph 4963 4205 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038040.1 protein_id gnl|my_center|LOCUS_09350 5633 4956 gene locus_tag LOCUS_09360 gene rpe 5633 4956 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369389.1 protein_id gnl|my_center|LOCUS_09360 6496 5678 gene locus_tag LOCUS_09370 gene dam 6496 5678 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence104 2162 1749 gene locus_tag LOCUS_09380 2162 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3148 2159 gene locus_tag LOCUS_09390 3148 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034790757.1 protein_id gnl|my_center|LOCUS_09390 3582 3211 gene locus_tag LOCUS_09400 3582 3211 CDS product T6SS amidase immunity protein Tai4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096183.1 protein_id gnl|my_center|LOCUS_09400 3971 3603 gene locus_tag LOCUS_09410 3971 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4501 4019 gene locus_tag LOCUS_09420 4501 4019 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366565.1 protein_id gnl|my_center|LOCUS_09420 5252 4758 gene locus_tag LOCUS_09430 5252 4758 CDS product type VI secretion system amidase effector protein Tae4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315890.1 protein_id gnl|my_center|LOCUS_09430 5650 5249 gene locus_tag LOCUS_09440 5650 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6280 5861 gene locus_tag LOCUS_09450 6280 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence105 1861 710 gene locus_tag LOCUS_09460 gene ftsZ 1861 710 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501978.1 protein_id gnl|my_center|LOCUS_09460 3181 1925 gene locus_tag LOCUS_09470 gene ftsA 3181 1925 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 protein_id gnl|my_center|LOCUS_09470 4008 3178 gene locus_tag LOCUS_09480 gene ftsQ 4008 3178 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 protein_id gnl|my_center|LOCUS_09480 4930 4010 gene locus_tag LOCUS_09490 gene ddlB 4930 4010 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 protein_id gnl|my_center|LOCUS_09490 6389 4923 gene locus_tag LOCUS_09500 gene murC 6389 4923 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence106 509 357 gene locus_tag LOCUS_09510 509 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 571 1200 gene locus_tag LOCUS_09520 571 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1340 1600 gene locus_tag LOCUS_09530 1340 1600 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367923.1 protein_id gnl|my_center|LOCUS_09530 2282 1773 gene locus_tag LOCUS_09540 2282 1773 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136183.1 protein_id gnl|my_center|LOCUS_09540 3013 2402 gene locus_tag LOCUS_09550 gene maa 3013 2402 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 protein_id gnl|my_center|LOCUS_09550 3380 3162 gene locus_tag LOCUS_09560 3380 3162 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367918.1 protein_id gnl|my_center|LOCUS_09560 3781 3407 gene locus_tag LOCUS_09570 gene tomB 3781 3407 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 protein_id gnl|my_center|LOCUS_09570 <6733 4244 gene locus_tag LOCUS_09580 <6733 4244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704610.1:multidrug efflux RND transporter permease subunit AcrB >Feature sequence107 <1 743 gene locus_tag LOCUS_09590 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968037.1:type 1 glutamine amidotransferase domain-containing protein 773 1453 gene locus_tag LOCUS_09600 773 1453 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095764.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 1900 1661 gene locus_tag LOCUS_09610 1900 1661 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 protein_id gnl|my_center|LOCUS_09610 3136 2054 gene locus_tag LOCUS_09620 3136 2054 CDS product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 protein_id gnl|my_center|LOCUS_09620 3824 4522 gene locus_tag LOCUS_09630 3824 4522 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097750.1 protein_id gnl|my_center|LOCUS_09630 4583 6016 gene locus_tag LOCUS_09640 4583 6016 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705987.1 protein_id gnl|my_center|LOCUS_09640 6000 6497 gene locus_tag LOCUS_09650 gene vsr 6000 6497 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228686.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence108 110 934 gene locus_tag LOCUS_09660 110 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 966 1289 gene locus_tag LOCUS_09670 966 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2072 1323 gene locus_tag LOCUS_09680 gene dsbG 2072 1323 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704726.1 protein_id gnl|my_center|LOCUS_09680 4090 2069 gene locus_tag LOCUS_09690 4090 2069 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703424.1 protein_id gnl|my_center|LOCUS_09690 4562 4137 gene locus_tag LOCUS_09700 4562 4137 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369786.1 protein_id gnl|my_center|LOCUS_09700 4900 4640 gene locus_tag LOCUS_09710 4900 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5228 5617 gene locus_tag LOCUS_09720 5228 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5720 6241 gene locus_tag LOCUS_09730 5720 6241 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097663.1 protein_id gnl|my_center|LOCUS_09730 6359 6604 gene locus_tag LOCUS_09740 6359 6604 CDS product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368794.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence109 2 1990 gene locus_tag LOCUS_09750 2 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2060 3325 gene locus_tag LOCUS_09760 2060 3325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705302.1 protein_id gnl|my_center|LOCUS_09760 3537 5237 gene locus_tag LOCUS_09770 3537 5237 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096532.1 protein_id gnl|my_center|LOCUS_09770 5546 5289 gene locus_tag LOCUS_09780 5546 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence110 475 1761 gene locus_tag LOCUS_09790 475 1761 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 protein_id gnl|my_center|LOCUS_09790 1961 3451 gene locus_tag LOCUS_09800 1961 3451 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 protein_id gnl|my_center|LOCUS_09800 4470 3538 gene locus_tag LOCUS_09810 gene kdgK 4470 3538 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037562.1 protein_id gnl|my_center|LOCUS_09810 4703 5476 gene locus_tag LOCUS_09820 gene pdeH 4703 5476 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595629.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence111 95 580 gene locus_tag LOCUS_09830 gene ptsN 95 580 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 protein_id gnl|my_center|LOCUS_09830 645 1499 gene locus_tag LOCUS_09840 gene rapZ 645 1499 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 protein_id gnl|my_center|LOCUS_09840 1496 1768 gene locus_tag LOCUS_09850 gene npr 1496 1768 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 protein_id gnl|my_center|LOCUS_09850 2505 1780 gene locus_tag LOCUS_09860 gene mtgA 2505 1780 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047098.1 protein_id gnl|my_center|LOCUS_09860 3155 2502 gene locus_tag LOCUS_09870 gene elbB 3155 2502 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 protein_id gnl|my_center|LOCUS_09870 5731 3392 gene locus_tag LOCUS_09880 gene arcB 5731 3392 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 protein_id gnl|my_center|LOCUS_09880 <6535 5843 gene locus_tag LOCUS_09890 <6535 5843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097533874.1:TIGR01212 family radical SAM protein >Feature sequence112 2847 1966 gene locus_tag LOCUS_09900 2847 1966 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175305.1 protein_id gnl|my_center|LOCUS_09900 2950 3480 gene locus_tag LOCUS_09910 2950 3480 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175304.1 protein_id gnl|my_center|LOCUS_09910 5152 3491 gene locus_tag LOCUS_09920 gene treC 5152 3491 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095358.1 protein_id gnl|my_center|LOCUS_09920 6478 5213 gene locus_tag LOCUS_09930 gene treB 6478 5213 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence113 309 959 gene locus_tag LOCUS_09940 309 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1063 3594 gene locus_tag LOCUS_09950 gene mrcB 1063 3594 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 protein_id gnl|my_center|LOCUS_09950 3869 6061 gene locus_tag LOCUS_09960 gene fhuA 3869 6061 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence114 541 29 gene locus_tag LOCUS_09970 gene ompX 541 29 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 protein_id gnl|my_center|LOCUS_09970 891 1778 gene locus_tag LOCUS_09980 gene rhtA 891 1778 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119538.1 protein_id gnl|my_center|LOCUS_09980 2094 2597 gene locus_tag LOCUS_09990 gene dps 2094 2597 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 protein_id gnl|my_center|LOCUS_09990 2973 3716 gene locus_tag LOCUS_10000 gene glnH 2973 3716 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097464.1 protein_id gnl|my_center|LOCUS_10000 3800 4459 gene locus_tag LOCUS_10010 gene glnP 3800 4459 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367581.1 protein_id gnl|my_center|LOCUS_10010 4456 5178 gene locus_tag LOCUS_10020 gene glnQ 4456 5178 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097465.1 protein_id gnl|my_center|LOCUS_10020 5233 5478 gene locus_tag LOCUS_10030 5233 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence115 136 1383 gene locus_tag LOCUS_10040 136 1383 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 protein_id gnl|my_center|LOCUS_10040 1808 1428 gene locus_tag LOCUS_10050 gene panD 1808 1428 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 protein_id gnl|my_center|LOCUS_10050 2760 1906 gene locus_tag LOCUS_10060 gene panC 2760 1906 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095627.1 protein_id gnl|my_center|LOCUS_10060 3567 2773 gene locus_tag LOCUS_10070 gene panB 3567 2773 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095628.1 protein_id gnl|my_center|LOCUS_10070 4134 3655 gene locus_tag LOCUS_10080 gene folK 4134 3655 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704426.1 protein_id gnl|my_center|LOCUS_10080 5477 4131 gene locus_tag LOCUS_10090 gene pcnB 5477 4131 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174643.1 protein_id gnl|my_center|LOCUS_10090 <6449 5584 gene locus_tag LOCUS_10100 <6449 5584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937424.1:tRNA glutamyl-Q(34) synthetase GluQRS >Feature sequence116 1245 1580 gene locus_tag LOCUS_10110 1245 1580 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 protein_id gnl|my_center|LOCUS_10110 2268 2888 gene locus_tag LOCUS_10120 gene phnH 2268 2888 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171627.1 protein_id gnl|my_center|LOCUS_10120 3148 2885 gene locus_tag LOCUS_10130 3148 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5628 3313 gene locus_tag LOCUS_10140 5628 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_10140 <6383 5628 gene locus_tag LOCUS_10150 <6383 5628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275415.1:ATP-binding protein >Feature sequence117 1208 27 gene locus_tag LOCUS_10160 gene rlpA 1208 27 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097591.1 protein_id gnl|my_center|LOCUS_10160 2331 1219 gene locus_tag LOCUS_10170 gene mrdB 2331 1219 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_10170 4234 2333 gene locus_tag LOCUS_10180 gene mrdA 4234 2333 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 protein_id gnl|my_center|LOCUS_10180 4727 4260 gene locus_tag LOCUS_10190 gene rlmH 4727 4260 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367732.1 protein_id gnl|my_center|LOCUS_10190 5204 4731 gene locus_tag LOCUS_10200 5204 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6011 5352 gene locus_tag LOCUS_10210 gene nadD 6011 5352 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420893.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence118 509 42 gene locus_tag LOCUS_10220 509 42 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704034.1 protein_id gnl|my_center|LOCUS_10220 1150 509 gene locus_tag LOCUS_10230 1150 509 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_10230 2248 1358 gene locus_tag LOCUS_10240 gene malG 2248 1358 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252081.1 protein_id gnl|my_center|LOCUS_10240 3804 2260 gene locus_tag LOCUS_10250 gene malF 3804 2260 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 protein_id gnl|my_center|LOCUS_10250 5260 4070 gene locus_tag LOCUS_10260 gene malE 5260 4070 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368772.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence119 2467 809 gene locus_tag LOCUS_10270 gene flgK 2467 809 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097132.1 protein_id gnl|my_center|LOCUS_10270 3508 2543 gene locus_tag LOCUS_10280 gene flgJ 3508 2543 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 protein_id gnl|my_center|LOCUS_10280 4605 3508 gene locus_tag LOCUS_10290 4605 3508 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097134.1 protein_id gnl|my_center|LOCUS_10290 5316 4618 gene locus_tag LOCUS_10300 gene flgH 5316 4618 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 protein_id gnl|my_center|LOCUS_10300 6155 5373 gene locus_tag LOCUS_10310 gene flgG 6155 5373 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500810.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence120 823 590 gene locus_tag LOCUS_10320 823 590 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 protein_id gnl|my_center|LOCUS_10320 1819 956 gene locus_tag LOCUS_10330 1819 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490841.1 protein_id gnl|my_center|LOCUS_10330 5203 1979 gene locus_tag LOCUS_10340 gene carB 5203 1979 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 protein_id gnl|my_center|LOCUS_10340 <6282 5221 gene locus_tag LOCUS_10350 <6282 5221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000597260.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence121 477 277 gene locus_tag LOCUS_10360 477 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 871 533 gene locus_tag LOCUS_10370 871 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1180 998 gene locus_tag LOCUS_10380 1180 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1418 1095 gene locus_tag LOCUS_10390 1418 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 1870 1415 gene locus_tag LOCUS_10400 1870 1415 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 protein_id gnl|my_center|LOCUS_10400 2126 2605 gene locus_tag LOCUS_10410 2126 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4151 2724 gene locus_tag LOCUS_10420 gene patD 4151 2724 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 protein_id gnl|my_center|LOCUS_10420 4975 4169 gene locus_tag LOCUS_10430 4975 4169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 protein_id gnl|my_center|LOCUS_10430 5909 4965 gene locus_tag LOCUS_10440 5909 4965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251335.1 protein_id gnl|my_center|LOCUS_10440 6255 5911 gene locus_tag LOCUS_10450 6255 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence122 358 1059 gene locus_tag LOCUS_10460 358 1059 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 protein_id gnl|my_center|LOCUS_10460 1095 1271 gene locus_tag LOCUS_10470 1095 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2872 2012 gene locus_tag LOCUS_10480 gene rsmI 2872 2012 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098896.1 protein_id gnl|my_center|LOCUS_10480 2935 4995 gene locus_tag LOCUS_10490 2935 4995 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249248.1 protein_id gnl|my_center|LOCUS_10490 4953 5348 gene locus_tag LOCUS_10500 4953 5348 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057282.1 protein_id gnl|my_center|LOCUS_10500 5375 6199 gene locus_tag LOCUS_10510 5375 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence123 1778 3337 gene locus_tag LOCUS_10520 gene mltF 1778 3337 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 protein_id gnl|my_center|LOCUS_10520 3348 3728 gene locus_tag LOCUS_10530 3348 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4432 3797 gene locus_tag LOCUS_10540 gene yfhb 4432 3797 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098310.1 protein_id gnl|my_center|LOCUS_10540 5803 4436 gene locus_tag LOCUS_10550 5803 4436 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence124 1480 518 gene locus_tag LOCUS_10560 gene manX 1480 518 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 protein_id gnl|my_center|LOCUS_10560 1943 3502 gene locus_tag LOCUS_10570 gene yoaE 1943 3502 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096133.1 protein_id gnl|my_center|LOCUS_10570 5104 3506 gene locus_tag LOCUS_10580 5104 3506 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 protein_id gnl|my_center|LOCUS_10580 <6198 5236 gene locus_tag LOCUS_10590 <6198 5236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419892.1:L-serine ammonia-lyase >Feature sequence125 1017 496 gene locus_tag LOCUS_10600 gene pgpA 1017 496 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154063.1 protein_id gnl|my_center|LOCUS_10600 2104 992 gene locus_tag LOCUS_10610 gene thiL 2104 992 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742109.1 protein_id gnl|my_center|LOCUS_10610 2578 2159 gene locus_tag LOCUS_10620 gene nusB 2578 2159 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367993.1 protein_id gnl|my_center|LOCUS_10620 3070 2600 gene locus_tag LOCUS_10630 gene ribE 3070 2600 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_10630 4261 3158 gene locus_tag LOCUS_10640 gene ribD 4261 3158 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_10640 4714 4265 gene locus_tag LOCUS_10650 gene nrdR 4714 4265 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_10650 4869 5429 gene locus_tag LOCUS_10660 4869 5429 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence126 1130 84 gene locus_tag LOCUS_10670 gene potD 1130 84 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759310.1 protein_id gnl|my_center|LOCUS_10670 1939 1127 gene locus_tag LOCUS_10680 gene potC 1939 1127 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580316.1 protein_id gnl|my_center|LOCUS_10680 2793 1936 gene locus_tag LOCUS_10690 gene potB 2793 1936 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705059.1 protein_id gnl|my_center|LOCUS_10690 3895 2777 gene locus_tag LOCUS_10700 gene potA 3895 2777 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705060.1 protein_id gnl|my_center|LOCUS_10700 4213 5442 gene locus_tag LOCUS_10710 gene pepT 4213 5442 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359463.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence127 <1 629 gene locus_tag LOCUS_10720 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000877709.1:U32 family peptidase 782 1792 gene locus_tag LOCUS_10730 782 1792 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 protein_id gnl|my_center|LOCUS_10730 3386 1836 gene locus_tag LOCUS_10740 3386 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3619 4287 gene locus_tag LOCUS_10750 gene budA 3619 4287 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705188.1 protein_id gnl|my_center|LOCUS_10750 4309 5988 gene locus_tag LOCUS_10760 gene alsS 4309 5988 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097652.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence128 436 1476 gene locus_tag LOCUS_10770 gene galM 436 1476 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 protein_id gnl|my_center|LOCUS_10770 1684 2436 gene locus_tag LOCUS_10780 gene gpmA 1684 2436 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_10780 3691 2639 gene locus_tag LOCUS_10790 gene aroG 3691 2639 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 protein_id gnl|my_center|LOCUS_10790 4016 4408 gene locus_tag LOCUS_10800 4016 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4536 5498 gene locus_tag LOCUS_10810 gene zitB 4536 5498 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_10810 <6152 5495 gene locus_tag LOCUS_10820 <6152 5495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000345406.1:nicotinamide riboside transporter PnuC >Feature sequence129 1732 170 gene locus_tag LOCUS_10830 gene cueO 1732 170 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 protein_id gnl|my_center|LOCUS_10830 1818 2566 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtacggcagtgaac 2966 3292 gene locus_tag LOCUS_10840 2966 3292 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 protein_id gnl|my_center|LOCUS_10840 3401 4267 gene locus_tag LOCUS_10850 gene speE 3401 4267 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818422.1 protein_id gnl|my_center|LOCUS_10850 4282 5076 gene locus_tag LOCUS_10860 gene speD 4282 5076 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 protein_id gnl|my_center|LOCUS_10860 5470 5105 gene locus_tag LOCUS_10870 gene yacL 5470 5105 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 protein_id gnl|my_center|LOCUS_10870 5654 6034 gene locus_tag LOCUS_10880 5654 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045361668.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence130 1530 2519 gene locus_tag LOCUS_10890 1530 2519 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 protein_id gnl|my_center|LOCUS_10890 2574 2996 gene locus_tag LOCUS_10900 gene hslJ 2574 2996 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 protein_id gnl|my_center|LOCUS_10900 3263 2997 gene locus_tag LOCUS_10910 3263 2997 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200680.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence131 1079 342 gene locus_tag LOCUS_10920 gene dnaC 1079 342 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368406.1 protein_id gnl|my_center|LOCUS_10920 1627 1082 gene locus_tag LOCUS_10930 gene dnaT 1627 1082 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368405.1 protein_id gnl|my_center|LOCUS_10930 2278 1850 gene locus_tag LOCUS_10940 2278 1850 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_10940 2814 2359 gene locus_tag LOCUS_10950 2814 2359 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_10950 3368 2880 gene locus_tag LOCUS_10960 3368 2880 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095466.1 protein_id gnl|my_center|LOCUS_10960 4120 3344 gene locus_tag LOCUS_10970 4120 3344 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368403.1 protein_id gnl|my_center|LOCUS_10970 4635 5351 gene locus_tag LOCUS_10980 4635 5351 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 protein_id gnl|my_center|LOCUS_10980 5315 5968 gene locus_tag LOCUS_10990 gene bglJ 5315 5968 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005106344.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence132 1328 2263 gene locus_tag LOCUS_11000 gene lrhA 1328 2263 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 protein_id gnl|my_center|LOCUS_11000 2882 3331 gene locus_tag LOCUS_11010 gene nuoA 2882 3331 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014171000.1 protein_id gnl|my_center|LOCUS_11010 3347 4021 gene locus_tag LOCUS_11020 gene nuoB 3347 4021 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 protein_id gnl|my_center|LOCUS_11020 4109 5920 gene locus_tag LOCUS_11030 gene nuoC 4109 5920 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247878.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence133 2322 727 gene locus_tag LOCUS_11040 2322 727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 protein_id gnl|my_center|LOCUS_11040 2440 3669 gene locus_tag LOCUS_11050 gene pepT 2440 3669 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705572.1 protein_id gnl|my_center|LOCUS_11050 3961 3680 gene locus_tag LOCUS_11060 3961 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4354 4064 gene locus_tag LOCUS_11070 4354 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5453 5917 gene locus_tag LOCUS_11080 5453 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence134 637 35 gene locus_tag LOCUS_11090 637 35 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_11090 1517 675 gene locus_tag LOCUS_11100 1517 675 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_11100 2959 1616 gene locus_tag LOCUS_11110 2959 1616 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096042.1 protein_id gnl|my_center|LOCUS_11110 3660 3160 gene locus_tag LOCUS_11120 3660 3160 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179469.1 protein_id gnl|my_center|LOCUS_11120 3942 4499 gene locus_tag LOCUS_11130 3942 4499 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 protein_id gnl|my_center|LOCUS_11130 4555 5061 gene locus_tag LOCUS_11140 4555 5061 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence135 614 276 gene locus_tag LOCUS_11150 gene glnK 614 276 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367937.1 protein_id gnl|my_center|LOCUS_11150 2624 846 gene locus_tag LOCUS_11160 2624 846 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 protein_id gnl|my_center|LOCUS_11160 4392 2617 gene locus_tag LOCUS_11170 4392 2617 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367939.1 protein_id gnl|my_center|LOCUS_11170 4911 4450 gene locus_tag LOCUS_11180 gene decR 4911 4450 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence136 2615 1587 gene locus_tag LOCUS_11190 2615 1587 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096882.1 protein_id gnl|my_center|LOCUS_11190 2790 4379 gene locus_tag LOCUS_11200 gene malX 2790 4379 CDS product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705244.1 protein_id gnl|my_center|LOCUS_11200 4393 5562 gene locus_tag LOCUS_11210 4393 5562 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705243.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence137 100 1779 gene locus_tag LOCUS_11220 gene dauA 100 1779 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705081.1 protein_id gnl|my_center|LOCUS_11220 2827 1781 gene locus_tag LOCUS_11230 2827 1781 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096228.1 protein_id gnl|my_center|LOCUS_11230 3235 2960 gene locus_tag LOCUS_11240 gene ychH 3235 2960 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 protein_id gnl|my_center|LOCUS_11240 3503 4087 gene locus_tag LOCUS_11250 gene pth 3503 4087 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 protein_id gnl|my_center|LOCUS_11250 4227 5318 gene locus_tag LOCUS_11260 gene ychF 4227 5318 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096225.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence138 2 748 gene locus_tag LOCUS_11270 2 748 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 protein_id gnl|my_center|LOCUS_11270 838 1020 gene locus_tag LOCUS_11280 838 1020 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097745.1 protein_id gnl|my_center|LOCUS_11280 1223 2566 gene locus_tag LOCUS_11290 gene dgcQ 1223 2566 CDS product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097744.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11290 2576 2881 gene locus_tag LOCUS_11300 2576 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11300 3700 2885 gene locus_tag LOCUS_11310 3700 2885 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 protein_id gnl|my_center|LOCUS_11310 4215 4003 gene locus_tag LOCUS_11320 4215 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4339 4527 gene locus_tag LOCUS_11330 gene dsrB 4339 4527 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 protein_id gnl|my_center|LOCUS_11330 5319 4696 gene locus_tag LOCUS_11340 gene rcsA 5319 4696 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence139 <1 707 gene locus_tag LOCUS_11350 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000979852.1:alkyl hydroperoxide reductase subunit F 1361 933 gene locus_tag LOCUS_11360 gene uspG 1361 933 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295855.1 protein_id gnl|my_center|LOCUS_11360 1604 2845 gene locus_tag LOCUS_11370 1604 2845 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 protein_id gnl|my_center|LOCUS_11370 3323 2913 gene locus_tag LOCUS_11380 gene rnk 3323 2913 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089748.1 protein_id gnl|my_center|LOCUS_11380 4851 3475 gene locus_tag LOCUS_11390 4851 3475 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371412.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence140 3632 2328 gene locus_tag LOCUS_11400 3632 2328 CDS product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705878.1 protein_id gnl|my_center|LOCUS_11400 3612 3998 gene locus_tag LOCUS_11410 3612 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4898 4002 gene locus_tag LOCUS_11420 4898 4002 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705880.1 protein_id gnl|my_center|LOCUS_11420 5274 4936 gene locus_tag LOCUS_11430 5274 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5837 5406 gene locus_tag LOCUS_11440 5837 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence141 <1 834 gene locus_tag LOCUS_11450 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000042501.1:excinuclease ABC subunit UvrB 1967 1059 gene locus_tag LOCUS_11460 gene yvcK 1967 1059 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 protein_id gnl|my_center|LOCUS_11460 2312 3301 gene locus_tag LOCUS_11470 gene moaA 2312 3301 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001408763.1 protein_id gnl|my_center|LOCUS_11470 3323 3835 gene locus_tag LOCUS_11480 gene moaB 3323 3835 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 protein_id gnl|my_center|LOCUS_11480 3839 4324 gene locus_tag LOCUS_11490 gene moaC 3839 4324 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 protein_id gnl|my_center|LOCUS_11490 4317 4562 gene locus_tag LOCUS_11500 gene moaD 4317 4562 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598619.1 protein_id gnl|my_center|LOCUS_11500 4564 5016 gene locus_tag LOCUS_11510 gene moaE 4564 5016 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence142 473 649 gene locus_tag LOCUS_11520 473 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 949 692 gene locus_tag LOCUS_11530 949 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1593 1518 gene locus_tag LOCUS_t00090 1593 1518 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1719 2225 gene locus_tag LOCUS_11540 gene mug 1719 2225 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 protein_id gnl|my_center|LOCUS_11540 2520 2278 gene locus_tag LOCUS_11550 2520 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4787 2943 gene locus_tag LOCUS_11560 gene rpoD 4787 2943 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 protein_id gnl|my_center|LOCUS_11560 <5774 5027 gene locus_tag LOCUS_11570 <5774 5027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098776.1:DNA primase >Feature sequence143 712 1110 gene locus_tag LOCUS_11580 712 1110 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_11580 1406 1831 gene locus_tag LOCUS_11590 1406 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3305 1941 gene locus_tag LOCUS_11600 gene mnmE 3305 1941 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703904.1 protein_id gnl|my_center|LOCUS_11600 5058 3406 gene locus_tag LOCUS_11610 gene yidC 5058 3406 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099419.1 protein_id gnl|my_center|LOCUS_11610 5641 5282 gene locus_tag LOCUS_11620 gene rnpA 5641 5282 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence144 1839 727 gene locus_tag LOCUS_11630 gene potF 1839 727 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_11630 2677 2198 gene locus_tag LOCUS_11640 2677 2198 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367528.1 protein_id gnl|my_center|LOCUS_11640 3660 2758 gene locus_tag LOCUS_11650 gene rimK 3660 2758 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097373.1 protein_id gnl|my_center|LOCUS_11650 4460 3738 gene locus_tag LOCUS_11660 gene nfsA 4460 3738 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189165.1 protein_id gnl|my_center|LOCUS_11660 4859 4590 gene locus_tag LOCUS_11670 4859 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence145 2549 354 gene locus_tag LOCUS_11680 2549 354 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 protein_id gnl|my_center|LOCUS_11680 3894 2572 gene locus_tag LOCUS_11690 3894 2572 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097825.1 protein_id gnl|my_center|LOCUS_11690 5636 3891 gene locus_tag LOCUS_11700 5636 3891 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097824.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence146 291 821 gene locus_tag LOCUS_11710 291 821 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 protein_id gnl|my_center|LOCUS_11710 935 1456 gene locus_tag LOCUS_11720 935 1456 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 protein_id gnl|my_center|LOCUS_11720 1491 2003 gene locus_tag LOCUS_11730 1491 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3633 2080 gene locus_tag LOCUS_11740 3633 2080 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 protein_id gnl|my_center|LOCUS_11740 4911 3733 gene locus_tag LOCUS_11750 gene manA 4911 3733 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence147 481 1500 gene locus_tag LOCUS_11760 gene epd 481 1500 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369761.1 protein_id gnl|my_center|LOCUS_11760 1577 2740 gene locus_tag LOCUS_11770 gene pgk 1577 2740 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 protein_id gnl|my_center|LOCUS_11770 2837 3913 gene locus_tag LOCUS_11780 gene fbaA 2837 3913 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 protein_id gnl|my_center|LOCUS_11780 4104 5042 gene locus_tag LOCUS_11790 4104 5042 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence148 716 1123 gene locus_tag LOCUS_11800 716 1123 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_11800 1148 1891 gene locus_tag LOCUS_11810 1148 1891 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 protein_id gnl|my_center|LOCUS_11810 1943 2479 gene locus_tag LOCUS_11820 1943 2479 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096282.1 protein_id gnl|my_center|LOCUS_11820 2711 4900 gene locus_tag LOCUS_11830 2711 4900 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 protein_id gnl|my_center|LOCUS_11830 5062 5463 gene locus_tag LOCUS_11840 gene yciA 5062 5463 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence149 492 286 gene locus_tag LOCUS_11850 492 286 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 protein_id gnl|my_center|LOCUS_11850 820 1377 gene locus_tag LOCUS_11860 820 1377 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704190.1 protein_id gnl|my_center|LOCUS_11860 2110 1367 gene locus_tag LOCUS_11870 gene cysQ 2110 1367 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886919.1 protein_id gnl|my_center|LOCUS_11870 2332 4275 gene locus_tag LOCUS_11880 2332 4275 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 protein_id gnl|my_center|LOCUS_11880 4847 4467 gene locus_tag LOCUS_11890 4847 4467 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095320.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence150 980 291 gene locus_tag LOCUS_11900 gene mtnC 980 291 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 protein_id gnl|my_center|LOCUS_11900 1591 977 gene locus_tag LOCUS_11910 1591 977 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704721.1 protein_id gnl|my_center|LOCUS_11910 1728 2888 gene locus_tag LOCUS_11920 1728 2888 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164518318.1 protein_id gnl|my_center|LOCUS_11920 3845 2883 gene locus_tag LOCUS_11930 3845 2883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 protein_id gnl|my_center|LOCUS_11930 4337 4900 gene locus_tag LOCUS_11940 gene ahpC 4337 4900 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence151 679 1068 gene locus_tag LOCUS_11950 679 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1240 1686 gene locus_tag LOCUS_11960 1240 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2617 1697 gene locus_tag LOCUS_11970 2617 1697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162859.1 protein_id gnl|my_center|LOCUS_11970 3758 2838 gene locus_tag LOCUS_11980 3758 2838 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096683.1 protein_id gnl|my_center|LOCUS_11980 3850 4326 gene locus_tag LOCUS_11990 3850 4326 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence152 946 545 gene locus_tag LOCUS_12000 gene rbfA 946 545 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918248.1 protein_id gnl|my_center|LOCUS_12000 3793 1082 gene locus_tag LOCUS_12010 gene infB 3793 1082 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 protein_id gnl|my_center|LOCUS_12010 5305 3818 gene locus_tag LOCUS_12020 gene nusA 5305 3818 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence153 19 807 gene locus_tag LOCUS_12030 19 807 CDS product TagK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168541.1 protein_id gnl|my_center|LOCUS_12030 819 1622 gene locus_tag LOCUS_12040 819 1622 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209685.1 protein_id gnl|my_center|LOCUS_12040 1632 2114 gene locus_tag LOCUS_12050 1632 2114 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209686.1 protein_id gnl|my_center|LOCUS_12050 3695 2592 gene locus_tag LOCUS_12060 3695 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4426 3728 gene locus_tag LOCUS_12070 4426 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 <5506 4691 gene locus_tag LOCUS_12080 <5506 4691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130633.1:YbdK family carboxylate-amine ligase >Feature sequence154 2118 1444 gene locus_tag LOCUS_12090 2118 1444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 protein_id gnl|my_center|LOCUS_12090 2891 2100 gene locus_tag LOCUS_12100 2891 2100 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705346.1 protein_id gnl|my_center|LOCUS_12100 3691 2888 gene locus_tag LOCUS_12110 3691 2888 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366692.1 protein_id gnl|my_center|LOCUS_12110 4750 3713 gene locus_tag LOCUS_12120 4750 3713 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence155 2181 1213 gene locus_tag LOCUS_12130 2181 1213 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098834.1 protein_id gnl|my_center|LOCUS_12130 3445 2447 gene locus_tag LOCUS_12140 3445 2447 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 protein_id gnl|my_center|LOCUS_12140 4221 3529 gene locus_tag LOCUS_12150 4221 3529 CDS product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942548.1 protein_id gnl|my_center|LOCUS_12150 4758 4246 gene locus_tag LOCUS_12160 4758 4246 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333820.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence156 462 220 gene locus_tag LOCUS_12170 462 220 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 protein_id gnl|my_center|LOCUS_12170 1917 568 gene locus_tag LOCUS_12180 gene accC 1917 568 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 protein_id gnl|my_center|LOCUS_12180 2404 1928 gene locus_tag LOCUS_12190 gene accB 2404 1928 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 protein_id gnl|my_center|LOCUS_12190 2878 2426 gene locus_tag LOCUS_12200 gene aroQ 2878 2426 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 protein_id gnl|my_center|LOCUS_12200 3712 3110 gene locus_tag LOCUS_12210 gene msrQ 3712 3110 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 protein_id gnl|my_center|LOCUS_12210 4717 3713 gene locus_tag LOCUS_12220 gene msrP 4717 3713 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740067.1 protein_id gnl|my_center|LOCUS_12220 5432 4821 gene locus_tag LOCUS_12230 5432 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence157 1845 1426 gene locus_tag LOCUS_12240 gene rbsD 1845 1426 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 protein_id gnl|my_center|LOCUS_12240 3909 2038 gene locus_tag LOCUS_12250 gene kup 3909 2038 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368994.1 protein_id gnl|my_center|LOCUS_12250 4130 5383 gene locus_tag LOCUS_12260 gene ravA 4130 5383 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703921.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence158 330 680 gene locus_tag LOCUS_12270 330 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 protein_id gnl|my_center|LOCUS_12270 898 677 gene locus_tag LOCUS_12280 898 677 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703165.1 protein_id gnl|my_center|LOCUS_12280 2427 949 gene locus_tag LOCUS_12290 gene der 2427 949 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370328.1 protein_id gnl|my_center|LOCUS_12290 3729 2548 gene locus_tag LOCUS_12300 gene bamB 3729 2548 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098274.1 protein_id gnl|my_center|LOCUS_12300 4360 3740 gene locus_tag LOCUS_12310 gene yfgM 4360 3740 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409208.1 protein_id gnl|my_center|LOCUS_12310 <5401 4396 gene locus_tag LOCUS_12320 <5401 4396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001107178.1:histidine--tRNA ligase >Feature sequence159 <1 1500 gene locus_tag LOCUS_12330 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704173.1:ribonuclease R 1582 2313 gene locus_tag LOCUS_12340 gene rlmB 1582 2313 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 protein_id gnl|my_center|LOCUS_12340 2470 2868 gene locus_tag LOCUS_12350 2470 2868 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 protein_id gnl|my_center|LOCUS_12350 2890 3546 gene locus_tag LOCUS_12360 2890 3546 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101639.1 protein_id gnl|my_center|LOCUS_12360 3547 4734 gene locus_tag LOCUS_12370 3547 4734 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943948.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence160 1009 311 gene locus_tag LOCUS_12380 gene cpxR 1009 311 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 protein_id gnl|my_center|LOCUS_12380 1158 1667 gene locus_tag LOCUS_12390 gene cpxP 1158 1667 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_12390 1845 2747 gene locus_tag LOCUS_12400 gene fieF 1845 2747 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_12400 2937 4541 gene locus_tag LOCUS_12410 2937 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4592 5167 gene locus_tag LOCUS_12420 4592 5167 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 protein_id gnl|my_center|LOCUS_12420 5284 5359 gene locus_tag LOCUS_t00100 5284 5359 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence161 1541 1819 gene locus_tag LOCUS_12430 1541 1819 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503385.1 protein_id gnl|my_center|LOCUS_12430 2321 1881 gene locus_tag LOCUS_12440 2321 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3447 2401 gene locus_tag LOCUS_12450 3447 2401 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_12450 4331 3795 gene locus_tag LOCUS_12460 gene ssb1 4331 3795 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174387.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence162 1146 250 gene locus_tag LOCUS_12470 gene xerD 1146 250 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 protein_id gnl|my_center|LOCUS_12470 1248 1769 gene locus_tag LOCUS_12480 gene fldB 1248 1769 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 protein_id gnl|my_center|LOCUS_12480 2199 1783 gene locus_tag LOCUS_12490 2199 1783 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 protein_id gnl|my_center|LOCUS_12490 2446 2180 gene locus_tag LOCUS_12500 gene sdhE 2446 2180 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 protein_id gnl|my_center|LOCUS_12500 2724 3713 gene locus_tag LOCUS_12510 gene ygfZ 2724 3713 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 protein_id gnl|my_center|LOCUS_12510 4471 3818 gene locus_tag LOCUS_12520 4471 3818 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806429.1 protein_id gnl|my_center|LOCUS_12520 4928 4614 gene locus_tag LOCUS_12530 gene yqfB 4928 4614 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence163 <1 951 gene locus_tag LOCUS_12540 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001299447.1:site-specific integrase 1043 967 gene locus_tag LOCUS_t00110 1043 967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1252 2118 gene locus_tag LOCUS_12550 gene folD 1252 2118 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367875.1 protein_id gnl|my_center|LOCUS_12550 2120 2332 gene locus_tag LOCUS_12560 gene ybcJ 2120 2332 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095928.1 protein_id gnl|my_center|LOCUS_12560 2654 4108 gene locus_tag LOCUS_12570 2654 4108 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 protein_id gnl|my_center|LOCUS_12570 4173 5189 gene locus_tag LOCUS_12580 gene malI 4173 5189 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence164 1399 1103 gene locus_tag LOCUS_12590 1399 1103 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 protein_id gnl|my_center|LOCUS_12590 1516 2223 gene locus_tag LOCUS_12600 1516 2223 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350228.1 protein_id gnl|my_center|LOCUS_12600 2836 2276 gene locus_tag LOCUS_12610 gene speG 2836 2276 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366764.1 protein_id gnl|my_center|LOCUS_12610 3232 2903 gene locus_tag LOCUS_12620 3232 2903 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366763.1 protein_id gnl|my_center|LOCUS_12620 3348 3695 gene locus_tag LOCUS_12630 3348 3695 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314753.1 protein_id gnl|my_center|LOCUS_12630 3830 5044 gene locus_tag LOCUS_12640 gene rspA 3830 5044 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence165 2839 1418 gene locus_tag LOCUS_12650 2839 1418 CDS product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 protein_id gnl|my_center|LOCUS_12650 3171 4748 gene locus_tag LOCUS_12660 3171 4748 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 protein_id gnl|my_center|LOCUS_12660 4796 5041 gene locus_tag LOCUS_12670 gene ydcY 4796 5041 CDS product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence166 <1 564 gene locus_tag LOCUS_12680 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095814.1:pyrroline-5-carboxylate reductase 2020 602 gene locus_tag LOCUS_12690 gene araE 2020 602 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253635.1 protein_id gnl|my_center|LOCUS_12690 2934 2674 gene locus_tag LOCUS_12700 gene iraP 2934 2674 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518423.1 protein_id gnl|my_center|LOCUS_12700 4351 3158 gene locus_tag LOCUS_12710 4351 3158 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_12710 <5219 4513 gene locus_tag LOCUS_12720 <5219 4513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095808.1:extensin family protein >Feature sequence167 1542 691 gene locus_tag LOCUS_12730 1542 691 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080790.1 protein_id gnl|my_center|LOCUS_12730 2888 1596 gene locus_tag LOCUS_12740 2888 1596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096408.1 protein_id gnl|my_center|LOCUS_12740 4615 2900 gene locus_tag LOCUS_12750 4615 2900 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_12750 5029 4790 gene locus_tag LOCUS_12760 gene pspD 5029 4790 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097607.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence168 <1 951 gene locus_tag LOCUS_12770 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703430.1:2-octaprenyl-6-methoxyphenyl hydroxylase 962 2164 gene locus_tag LOCUS_12780 gene ubiI 962 2164 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703429.1 protein_id gnl|my_center|LOCUS_12780 2587 3684 gene locus_tag LOCUS_12790 gene gcvT 2587 3684 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028158.1 protein_id gnl|my_center|LOCUS_12790 3708 4097 gene locus_tag LOCUS_12800 gene gcvH 3708 4097 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence169 <1 1517 gene locus_tag LOCUS_12810 <1 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097446.1:glycoside hydrolase family 31 protein 2263 4407 gene locus_tag LOCUS_12820 2263 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5108 4488 gene locus_tag LOCUS_12830 5108 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence170 150 1568 gene locus_tag LOCUS_12840 150 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2495 1617 gene locus_tag LOCUS_12850 gene hslO 2495 1617 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 protein_id gnl|my_center|LOCUS_12850 2920 2519 gene locus_tag LOCUS_12860 gene hslR 2920 2519 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703665.1 protein_id gnl|my_center|LOCUS_12860 3600 2920 gene locus_tag LOCUS_12870 gene yrfG 3600 2920 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 protein_id gnl|my_center|LOCUS_12870 5093 3663 gene locus_tag LOCUS_12880 5093 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence171 763 1641 gene locus_tag LOCUS_12890 763 1641 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368979.1 protein_id gnl|my_center|LOCUS_12890 2294 1668 gene locus_tag LOCUS_12900 gene dsbA 2294 1668 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725369.1 protein_id gnl|my_center|LOCUS_12900 3305 2319 gene locus_tag LOCUS_12910 gene srkA 3305 2319 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065497.1 protein_id gnl|my_center|LOCUS_12910 3651 3382 gene locus_tag LOCUS_12920 3651 3382 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_12920 3718 4296 gene locus_tag LOCUS_12930 gene mobA 3718 4296 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052184.1 protein_id gnl|my_center|LOCUS_12930 4296 4829 gene locus_tag LOCUS_12940 gene mobB 4296 4829 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence172 4090 344 gene locus_tag LOCUS_12950 4090 344 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096256.1 protein_id gnl|my_center|LOCUS_12950 5065 4508 gene locus_tag LOCUS_12960 5065 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence173 952 233 gene locus_tag LOCUS_12970 gene ydiV 952 233 CDS product anti-FlhDC factor YdiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561998.1 protein_id gnl|my_center|LOCUS_12970 2093 1104 gene locus_tag LOCUS_12980 2093 1104 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174679.1 protein_id gnl|my_center|LOCUS_12980 3473 2157 gene locus_tag LOCUS_12990 3473 2157 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817337.1 protein_id gnl|my_center|LOCUS_12990 4807 3581 gene locus_tag LOCUS_13000 4807 3581 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060779496.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence174 1739 825 gene locus_tag LOCUS_13010 1739 825 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 protein_id gnl|my_center|LOCUS_13010 2622 1732 gene locus_tag LOCUS_13020 2622 1732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 protein_id gnl|my_center|LOCUS_13020 3231 4373 gene locus_tag LOCUS_13030 gene wzz(fepE) 3231 4373 CDS product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098569.1 protein_id gnl|my_center|LOCUS_13030 4753 4430 gene locus_tag LOCUS_13040 4753 4430 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence175 2217 802 gene locus_tag LOCUS_13050 gene murE 2217 802 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 protein_id gnl|my_center|LOCUS_13050 4042 2276 gene locus_tag LOCUS_13060 4042 2276 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 protein_id gnl|my_center|LOCUS_13060 4423 4058 gene locus_tag LOCUS_13070 gene ftsL 4423 4058 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625651.1 protein_id gnl|my_center|LOCUS_13070 <5027 4420 gene locus_tag LOCUS_13080 <5027 4420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000970440.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence176 1287 1012 gene locus_tag LOCUS_13090 gene ychH 1287 1012 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823874.1 protein_id gnl|my_center|LOCUS_13090 1555 2139 gene locus_tag LOCUS_13100 gene pth 1555 2139 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 protein_id gnl|my_center|LOCUS_13100 2279 3370 gene locus_tag LOCUS_13110 gene ychF 2279 3370 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096225.1 protein_id gnl|my_center|LOCUS_13110 3588 4259 gene locus_tag LOCUS_13120 gene yecA 3588 4259 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_13120 <5021 4358 gene locus_tag LOCUS_13130 <5021 4358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183353796.1:DUF3750 domain-containing protein >Feature sequence177 87 1037 gene locus_tag LOCUS_13140 87 1037 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769959.1 protein_id gnl|my_center|LOCUS_13140 1037 1882 gene locus_tag LOCUS_13150 1037 1882 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969445.1 protein_id gnl|my_center|LOCUS_13150 1886 3001 gene locus_tag LOCUS_13160 gene malK 1886 3001 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 protein_id gnl|my_center|LOCUS_13160 3011 4666 gene locus_tag LOCUS_13170 3011 4666 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263560.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence178 881 1618 gene locus_tag LOCUS_13180 881 1618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_13180 1915 2112 gene locus_tag LOCUS_13190 1915 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 protein_id gnl|my_center|LOCUS_13190 2114 3091 gene locus_tag LOCUS_13200 2114 3091 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 protein_id gnl|my_center|LOCUS_13200 3088 4452 gene locus_tag LOCUS_13210 gene wzyE 3088 4452 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055143.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence179 >Feature sequence180 1138 713 gene locus_tag LOCUS_13220 1138 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704919.1 protein_id gnl|my_center|LOCUS_13220 2521 1307 gene locus_tag LOCUS_13230 2521 1307 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_13230 3378 3043 gene locus_tag LOCUS_13240 3378 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3526 4500 gene locus_tag LOCUS_13250 gene uvsE 3526 4500 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence181 715 1044 gene locus_tag LOCUS_13260 715 1044 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 protein_id gnl|my_center|LOCUS_13260 1041 1838 gene locus_tag LOCUS_13270 gene truC 1041 1838 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 protein_id gnl|my_center|LOCUS_13270 1842 2291 gene locus_tag LOCUS_13280 1842 2291 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098525.1 protein_id gnl|my_center|LOCUS_13280 <5004 2326 gene locus_tag LOCUS_13290 <5004 2326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000186405.1:two-component sensor histidine kinase BarA >Feature sequence182 950 672 gene locus_tag LOCUS_13300 950 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1853 1368 gene locus_tag LOCUS_13310 gene dsbB 1853 1368 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 protein_id gnl|my_center|LOCUS_13310 3600 2038 gene locus_tag LOCUS_13320 gene nhaB 3600 2038 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705843.1 protein_id gnl|my_center|LOCUS_13320 3782 4531 gene locus_tag LOCUS_13330 gene fadR 3782 4531 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence183 4929 949 gene locus_tag LOCUS_13340 gene magD 4929 949 CDS product alpha-2-macroglobulin MagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112866.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence184 <1 817 gene locus_tag LOCUS_13350 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419180.1:FAD-binding and (Fe-S)-binding domain-containing protein 814 1224 gene locus_tag LOCUS_13360 gene menI 814 1224 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096973.1 protein_id gnl|my_center|LOCUS_13360 3478 3855 gene locus_tag LOCUS_13370 gene sufA 3478 3855 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705128.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence185 253 1371 gene locus_tag LOCUS_13380 253 1371 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 protein_id gnl|my_center|LOCUS_13380 1535 3232 gene locus_tag LOCUS_13390 1535 3232 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 protein_id gnl|my_center|LOCUS_13390 3426 3926 gene locus_tag LOCUS_13400 3426 3926 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096661.1 protein_id gnl|my_center|LOCUS_13400 <4919 4047 gene locus_tag LOCUS_13410 <4919 4047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004184894.1:alkene reductase >Feature sequence186 2206 734 gene locus_tag LOCUS_13420 gene rhaB 2206 734 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 protein_id gnl|my_center|LOCUS_13420 2505 3344 gene locus_tag LOCUS_13430 gene rhaS 2505 3344 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 protein_id gnl|my_center|LOCUS_13430 3416 4267 gene locus_tag LOCUS_13440 gene rhaR 3416 4267 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013291.1 protein_id gnl|my_center|LOCUS_13440 <4880 4264 gene locus_tag LOCUS_13450 <4880 4264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000063537.1:L-rhamnose/proton symporter RhaT >Feature sequence187 375 2699 gene locus_tag LOCUS_13460 gene yicI 375 2699 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703824.1 protein_id gnl|my_center|LOCUS_13460 4046 2748 gene locus_tag LOCUS_13470 gene avtA 4046 2748 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 protein_id gnl|my_center|LOCUS_13470 4834 4178 gene locus_tag LOCUS_13480 4834 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence188 2078 876 gene locus_tag LOCUS_13490 gene ackA 2078 876 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 protein_id gnl|my_center|LOCUS_13490 2413 2868 gene locus_tag LOCUS_13500 gene yfbV 2413 2868 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365578.1 protein_id gnl|my_center|LOCUS_13500 2955 3449 gene locus_tag LOCUS_13510 2955 3449 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426124.1 protein_id gnl|my_center|LOCUS_13510 3462 4121 gene locus_tag LOCUS_13520 3462 4121 CDS product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence189 136 798 gene locus_tag LOCUS_13530 136 798 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 protein_id gnl|my_center|LOCUS_13530 798 1121 gene locus_tag LOCUS_13540 798 1121 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 protein_id gnl|my_center|LOCUS_13540 1383 1174 gene locus_tag LOCUS_13550 1383 1174 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 protein_id gnl|my_center|LOCUS_13550 2332 1514 gene locus_tag LOCUS_13560 gene fdhD 2332 1514 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703936.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence190 <1 722 gene locus_tag LOCUS_13570 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705576.1:glucan biosynthesis protein 876 1436 gene locus_tag LOCUS_13580 gene rimL 876 1436 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140890.1 protein_id gnl|my_center|LOCUS_13580 2413 1433 gene locus_tag LOCUS_13590 gene ydcK 2413 1433 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 protein_id gnl|my_center|LOCUS_13590 2561 3154 gene locus_tag LOCUS_13600 gene tehB 2561 3154 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 protein_id gnl|my_center|LOCUS_13600 3370 3591 gene locus_tag LOCUS_13610 3370 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence191 1144 26 gene locus_tag LOCUS_13620 gene ispG 1144 26 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_13620 2187 1171 gene locus_tag LOCUS_13630 gene rodZ 2187 1171 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090832.1 protein_id gnl|my_center|LOCUS_13630 3772 2606 gene locus_tag LOCUS_13640 3772 2606 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 protein_id gnl|my_center|LOCUS_13640 4384 3953 gene locus_tag LOCUS_13650 gene ndk 4384 3953 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963841.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence192 854 1882 gene locus_tag LOCUS_13660 854 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3086 2916 gene locus_tag LOCUS_13670 3086 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3660 3349 gene locus_tag LOCUS_13680 gene fliE 3660 3349 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence193 <1 1075 gene locus_tag LOCUS_13690 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096830.1:APC family permease 3589 1514 gene locus_tag LOCUS_13700 gene flhA 3589 1514 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301446.1 protein_id gnl|my_center|LOCUS_13700 4692 3682 gene locus_tag LOCUS_13710 gene hypE 4692 3682 CDS product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059947.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence194 <1 1111 gene locus_tag LOCUS_13720 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123330.1:exopolyphosphatase 3383 1146 gene locus_tag LOCUS_13730 3383 1146 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 protein_id gnl|my_center|LOCUS_13730 3787 3942 gene locus_tag LOCUS_13740 3787 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence195 1201 1839 gene locus_tag LOCUS_13750 gene msrA 1201 1839 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295196.1 protein_id gnl|my_center|LOCUS_13750 1945 3360 gene locus_tag LOCUS_13760 1945 3360 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705141.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence196 475 1761 gene locus_tag LOCUS_13770 475 1761 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 protein_id gnl|my_center|LOCUS_13770 1961 3148 gene locus_tag LOCUS_13780 1961 3148 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 protein_id gnl|my_center|LOCUS_13780 3271 3098 gene locus_tag LOCUS_13790 3271 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3603 3298 gene locus_tag LOCUS_13800 3603 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171415.1 protein_id gnl|my_center|LOCUS_13800 4282 3806 gene locus_tag LOCUS_13810 4282 3806 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705019.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence197 1305 238 gene locus_tag LOCUS_13820 gene purK 1305 238 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815551.1 protein_id gnl|my_center|LOCUS_13820 1811 1302 gene locus_tag LOCUS_13830 gene purE 1811 1302 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367880.1 protein_id gnl|my_center|LOCUS_13830 2666 1944 gene locus_tag LOCUS_13840 gene lpxH 2666 1944 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_13840 3164 2670 gene locus_tag LOCUS_13850 gene ppiB 3164 2670 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256006.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence198 1064 537 gene locus_tag LOCUS_13860 1064 537 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056988.1 protein_id gnl|my_center|LOCUS_13860 3630 1141 gene locus_tag LOCUS_13870 3630 1141 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703285.1 protein_id gnl|my_center|LOCUS_13870 4403 3726 gene locus_tag LOCUS_13880 4403 3726 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703286.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence199 774 43 gene locus_tag LOCUS_13890 gene rstA 774 43 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 protein_id gnl|my_center|LOCUS_13890 1149 850 gene locus_tag LOCUS_13900 1149 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13900 1572 1192 gene locus_tag LOCUS_13910 1572 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13910 2984 1602 gene locus_tag LOCUS_13920 2984 1602 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412353.1 protein_id gnl|my_center|LOCUS_13920 4113 3169 gene locus_tag LOCUS_13930 gene ydgH 4113 3169 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence200 742 2088 gene locus_tag LOCUS_13940 742 2088 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 protein_id gnl|my_center|LOCUS_13940 2828 2118 gene locus_tag LOCUS_13950 gene fhuF 2828 2118 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331596.1 protein_id gnl|my_center|LOCUS_13950 4088 3021 gene locus_tag LOCUS_13960 4088 3021 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 protein_id gnl|my_center|LOCUS_13960 4285 4566 gene locus_tag LOCUS_13970 4285 4566 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005104580.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence201 1807 935 gene locus_tag LOCUS_13980 1807 935 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_13980 3718 1820 gene locus_tag LOCUS_13990 3718 1820 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099371.1 protein_id gnl|my_center|LOCUS_13990 <4552 3900 gene locus_tag LOCUS_14000 <4552 3900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001167549.1:aldose-1-epimerase >Feature sequence202 179 1288 gene locus_tag LOCUS_14010 gene mnmA 179 1288 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295972.1 protein_id gnl|my_center|LOCUS_14010 1343 1972 gene locus_tag LOCUS_14020 gene hflD 1343 1972 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097081.1 protein_id gnl|my_center|LOCUS_14020 1990 3360 gene locus_tag LOCUS_14030 gene purB 1990 3360 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419121.1 protein_id gnl|my_center|LOCUS_14030 3515 4186 gene locus_tag LOCUS_14040 gene phoP 3515 4186 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence203 362 802 gene locus_tag LOCUS_14050 362 802 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370259.1 protein_id gnl|my_center|LOCUS_14050 856 2223 gene locus_tag LOCUS_14060 856 2223 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703197.1 protein_id gnl|my_center|LOCUS_14060 2422 3492 gene locus_tag LOCUS_14070 gene aroF 2422 3492 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence204 12 1220 gene locus_tag LOCUS_14080 12 1220 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 protein_id gnl|my_center|LOCUS_14080 2656 1277 gene locus_tag LOCUS_14090 gene mpl 2656 1277 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219848.1 protein_id gnl|my_center|LOCUS_14090 2832 3830 gene locus_tag LOCUS_14100 gene fbp 2832 3830 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence205 1607 291 gene locus_tag LOCUS_14110 gene pepP 1607 291 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 protein_id gnl|my_center|LOCUS_14110 2215 1631 gene locus_tag LOCUS_14120 2215 1631 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 protein_id gnl|my_center|LOCUS_14120 2371 2700 gene locus_tag LOCUS_14130 gene zapA 2371 2700 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 protein_id gnl|my_center|LOCUS_14130 3062 3538 gene locus_tag LOCUS_14140 3062 3538 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621084.1 protein_id gnl|my_center|LOCUS_14140 <4494 3625 gene locus_tag LOCUS_14150 <4494 3625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098629.1:phosphoglycerate dehydrogenase >Feature sequence206 457 1065 gene locus_tag LOCUS_14160 gene dmsD 457 1065 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 protein_id gnl|my_center|LOCUS_14160 1412 1062 gene locus_tag LOCUS_14170 1412 1062 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366825.1 protein_id gnl|my_center|LOCUS_14170 1726 2439 gene locus_tag LOCUS_14180 gene osmY 1726 2439 CDS product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 protein_id gnl|my_center|LOCUS_14180 2456 3361 gene locus_tag LOCUS_14190 gene osmX 2456 3361 CDS product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 protein_id gnl|my_center|LOCUS_14190 3371 4018 gene locus_tag LOCUS_14200 gene osmW 3371 4018 CDS product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379676.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence207 59 1609 gene locus_tag LOCUS_14210 59 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1594 2991 gene locus_tag LOCUS_14220 1594 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2988 3425 gene locus_tag LOCUS_14230 2988 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence208 <1 568 gene locus_tag LOCUS_14240 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367451.1:asparagine--tRNA ligase 1103 2203 gene locus_tag LOCUS_14250 gene ompK35 1103 2203 CDS product porin OmpK35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367453.1 protein_id gnl|my_center|LOCUS_14250 2389 3579 gene locus_tag LOCUS_14260 2389 3579 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097288.1 protein_id gnl|my_center|LOCUS_14260 4285 3638 gene locus_tag LOCUS_14270 4285 3638 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367455.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence209 1083 169 gene locus_tag LOCUS_14280 gene panE 1083 169 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705818.1 protein_id gnl|my_center|LOCUS_14280 1236 1727 gene locus_tag LOCUS_14290 1236 1727 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 protein_id gnl|my_center|LOCUS_14290 3156 1792 gene locus_tag LOCUS_14300 3156 1792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 protein_id gnl|my_center|LOCUS_14300 4215 3328 gene locus_tag LOCUS_14310 gene cyoE 4215 3328 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence210 1672 893 gene locus_tag LOCUS_14320 gene cmoM 1672 893 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 protein_id gnl|my_center|LOCUS_14320 1805 2584 gene locus_tag LOCUS_14330 gene elyC 1805 2584 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097297.1 protein_id gnl|my_center|LOCUS_14330 3454 2561 gene locus_tag LOCUS_14340 3454 2561 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 protein_id gnl|my_center|LOCUS_14340 3967 3545 gene locus_tag LOCUS_14350 3967 3545 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082428.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence211 1123 521 gene locus_tag LOCUS_14360 1123 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2226 1441 gene locus_tag LOCUS_14370 2226 1441 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090120423.1 protein_id gnl|my_center|LOCUS_14370 3987 2449 gene locus_tag LOCUS_14380 3987 2449 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096554.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence212 416 2740 gene locus_tag LOCUS_14390 416 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2826 3107 gene locus_tag LOCUS_14400 2826 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103650.1 protein_id gnl|my_center|LOCUS_14400 3932 3126 gene locus_tag LOCUS_14410 gene rna 3932 3126 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence213 121 1053 gene locus_tag LOCUS_14420 gene dusC 121 1053 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 protein_id gnl|my_center|LOCUS_14420 1979 1056 gene locus_tag LOCUS_14430 1979 1056 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764458.1 protein_id gnl|my_center|LOCUS_14430 2055 3011 gene locus_tag LOCUS_14440 2055 3011 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089704.1 protein_id gnl|my_center|LOCUS_14440 3304 4077 gene locus_tag LOCUS_14450 3304 4077 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence214 <1 1294 gene locus_tag LOCUS_14460 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095490.1:thymidine phosphorylase 1347 2570 gene locus_tag LOCUS_14470 gene deoB 1347 2570 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 protein_id gnl|my_center|LOCUS_14470 2644 3363 gene locus_tag LOCUS_14480 gene deoD 2644 3363 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 protein_id gnl|my_center|LOCUS_14480 <4283 3538 gene locus_tag LOCUS_14490 <4283 3538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095493.1:lipoate--protein ligase LplA >Feature sequence215 <1 3373 gene locus_tag LOCUS_14500 <1 3373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572763.1:chromosome partition protein MukB >Feature sequence216 282 1148 gene locus_tag LOCUS_14510 gene yghU 282 1148 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_14510 2035 1199 gene locus_tag LOCUS_14520 gene kduI 2035 1199 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367870.1 protein_id gnl|my_center|LOCUS_14520 2426 3430 gene locus_tag LOCUS_14530 gene kdgT 2426 3430 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704632.1 protein_id gnl|my_center|LOCUS_14530 <4263 3482 gene locus_tag LOCUS_14540 <4263 3482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029882903.1:diguanylate cyclase regulator RdcB family protein >Feature sequence217 <1 873 gene locus_tag LOCUS_14550 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000098886.1:cyclopropane fatty acyl phospholipid synthase 1068 2387 gene locus_tag LOCUS_14560 1068 2387 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171888.1 protein_id gnl|my_center|LOCUS_14560 2441 3826 gene locus_tag LOCUS_14570 2441 3826 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171891.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence218 1089 127 gene locus_tag LOCUS_14580 gene pfkA 1089 127 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 protein_id gnl|my_center|LOCUS_14580 2181 1279 gene locus_tag LOCUS_14590 gene fieF 2181 1279 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_14590 2868 2359 gene locus_tag LOCUS_14600 gene cpxP 2868 2359 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_14600 3017 3715 gene locus_tag LOCUS_14610 gene cpxR 3017 3715 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence219 580 1371 gene locus_tag LOCUS_14620 gene kdgR 580 1371 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262179.1 protein_id gnl|my_center|LOCUS_14620 1667 1428 gene locus_tag LOCUS_14630 1667 1428 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705933.1 protein_id gnl|my_center|LOCUS_14630 1826 1969 gene locus_tag LOCUS_14640 gene mgrB 1826 1969 CDS product PhoP/PhoQ regulator MgrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096124.1 protein_id gnl|my_center|LOCUS_14640 2039 2326 gene locus_tag LOCUS_14650 2039 2326 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006860.1 protein_id gnl|my_center|LOCUS_14650 2347 3354 gene locus_tag LOCUS_14660 2347 3354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence220 695 519 gene locus_tag LOCUS_14670 695 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1432 731 gene locus_tag LOCUS_14680 1432 731 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 protein_id gnl|my_center|LOCUS_14680 1535 2434 gene locus_tag LOCUS_14690 gene yhaJ 1535 2434 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041009.1 protein_id gnl|my_center|LOCUS_14690 3468 2431 gene locus_tag LOCUS_14700 3468 2431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 protein_id gnl|my_center|LOCUS_14700 <4222 3473 gene locus_tag LOCUS_14710 <4222 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096552.1:sucrose-6-phosphate hydrolase >Feature sequence221 2301 832 gene locus_tag LOCUS_14720 2301 832 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368522.1 protein_id gnl|my_center|LOCUS_14720 2921 2298 gene locus_tag LOCUS_14730 2921 2298 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368521.1 protein_id gnl|my_center|LOCUS_14730 3489 3899 gene locus_tag LOCUS_14740 3489 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence222 <1 728 gene locus_tag LOCUS_14750 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000118383.1:acetyl-CoA carboxylase, carboxyltransferase subunit beta 799 2067 gene locus_tag LOCUS_14760 gene folC 799 2067 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 protein_id gnl|my_center|LOCUS_14760 2057 2779 gene locus_tag LOCUS_14770 gene dedD 2057 2779 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 protein_id gnl|my_center|LOCUS_14770 3012 3497 gene locus_tag LOCUS_14780 gene cvpA 3012 3497 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence223 <1 820 gene locus_tag LOCUS_14790 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295307.1:Tol-Pal system beta propeller repeat protein TolB 855 1373 gene locus_tag LOCUS_14800 gene pal 855 1373 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 protein_id gnl|my_center|LOCUS_14800 1383 2180 gene locus_tag LOCUS_14810 gene cpoB 1383 2180 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097561.1 protein_id gnl|my_center|LOCUS_14810 2345 2420 gene locus_tag LOCUS_t00120 2345 2420 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2517 2592 gene locus_tag LOCUS_t00130 2517 2592 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3024 4076 gene locus_tag LOCUS_14820 gene nadA 3024 4076 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence224 251 1009 gene locus_tag LOCUS_14830 gene bioC 251 1009 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704796.1 protein_id gnl|my_center|LOCUS_14830 1002 1685 gene locus_tag LOCUS_14840 gene bioD 1002 1685 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704797.1 protein_id gnl|my_center|LOCUS_14840 2389 1682 gene locus_tag LOCUS_14850 2389 1682 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence225 <1 604 gene locus_tag LOCUS_14860 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098921.1:ATP-dependent zinc metalloprotease FtsH 695 1543 gene locus_tag LOCUS_14870 gene folP 695 1543 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 protein_id gnl|my_center|LOCUS_14870 1536 2873 gene locus_tag LOCUS_14880 gene glmM 1536 2873 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071140.1 protein_id gnl|my_center|LOCUS_14880 3091 3429 gene locus_tag LOCUS_14890 gene secG 3091 3429 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 protein_id gnl|my_center|LOCUS_14890 3472 3558 gene locus_tag LOCUS_t00140 3472 3558 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3618 3694 gene locus_tag LOCUS_t00150 3618 3694 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3878 4141 gene locus_tag LOCUS_14900 3878 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence226 3650 2085 gene locus_tag LOCUS_14910 gene mdoG 3650 2085 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097164.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence227 258 1286 gene locus_tag LOCUS_14920 gene murB 258 1286 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016664.1 protein_id gnl|my_center|LOCUS_14920 1283 2245 gene locus_tag LOCUS_14930 gene birA 1283 2245 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 protein_id gnl|my_center|LOCUS_14930 3232 2282 gene locus_tag LOCUS_14940 gene coaA 3232 2282 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368830.1 protein_id gnl|my_center|LOCUS_14940 3784 3859 gene locus_tag LOCUS_t00160 3784 3859 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3869 3953 gene locus_tag LOCUS_t00170 3869 3953 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4062 4134 gene locus_tag LOCUS_t00180 4062 4134 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence228 1165 410 gene locus_tag LOCUS_14950 gene mlaA 1165 410 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 protein_id gnl|my_center|LOCUS_14950 2388 1189 gene locus_tag LOCUS_14960 gene ccmI 2388 1189 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 protein_id gnl|my_center|LOCUS_14960 2846 2385 gene locus_tag LOCUS_14970 2846 2385 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 protein_id gnl|my_center|LOCUS_14970 3400 2843 gene locus_tag LOCUS_14980 gene dsbE 3400 2843 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828299.1 protein_id gnl|my_center|LOCUS_14980 <4132 3397 gene locus_tag LOCUS_14990 <4132 3397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005158627.1:heme lyase CcmF/NrfE family subunit >Feature sequence229 315 977 gene locus_tag LOCUS_15000 gene pmrA 315 977 CDS product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098925.1 protein_id gnl|my_center|LOCUS_15000 974 2038 gene locus_tag LOCUS_15010 gene pmrB 974 2038 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098926.1 protein_id gnl|my_center|LOCUS_15010 3272 2100 gene locus_tag LOCUS_15020 gene cgtA 3272 2100 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098927.1 protein_id gnl|my_center|LOCUS_15020 <4131 3289 gene locus_tag LOCUS_15030 <4131 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369509.1:DMT family transporter >Feature sequence230 1174 548 gene locus_tag LOCUS_15040 gene yfcG 1174 548 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 protein_id gnl|my_center|LOCUS_15040 1319 1963 gene locus_tag LOCUS_15050 gene yfcF 1319 1963 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042442.1 protein_id gnl|my_center|LOCUS_15050 2023 2574 gene locus_tag LOCUS_15060 gene yfcE 2023 2574 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098124.1 protein_id gnl|my_center|LOCUS_15060 2629 3213 gene locus_tag LOCUS_15070 gene yfcD 2629 3213 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 protein_id gnl|my_center|LOCUS_15070 3856 3269 gene locus_tag LOCUS_15080 3856 3269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence231 1343 309 gene locus_tag LOCUS_15090 1343 309 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 protein_id gnl|my_center|LOCUS_15090 1853 1437 gene locus_tag LOCUS_15100 gene sufE 1853 1437 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729470.1 protein_id gnl|my_center|LOCUS_15100 3085 1865 gene locus_tag LOCUS_15110 gene sufS 3085 1865 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705131.1 protein_id gnl|my_center|LOCUS_15110 <4090 3082 gene locus_tag LOCUS_15120 <4090 3082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096954.1:Fe-S cluster assembly protein SufD >Feature sequence232 2021 621 gene locus_tag LOCUS_15130 gene mmuP 2021 621 CDS product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704529.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence233 432 1463 gene locus_tag LOCUS_15140 gene apbE 432 1463 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406066.1 protein_id gnl|my_center|LOCUS_15140 1536 2600 gene locus_tag LOCUS_15150 gene ada 1536 2600 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706139.1 protein_id gnl|my_center|LOCUS_15150 2600 3244 gene locus_tag LOCUS_15160 gene alkB 2600 3244 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884975.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence234 1719 820 gene locus_tag LOCUS_15170 gene ispA 1719 820 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_15170 1964 1722 gene locus_tag LOCUS_15180 gene xseB 1964 1722 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_15180 2176 3624 gene locus_tag LOCUS_15190 gene thiI 2176 3624 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668665.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence235 2331 1201 gene locus_tag LOCUS_15200 gene rffA 2331 1201 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_15200 3020 2337 gene locus_tag LOCUS_15210 gene rffC 3020 2337 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099274.1 protein_id gnl|my_center|LOCUS_15210 <4047 3042 gene locus_tag LOCUS_15220 <4047 3042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000006621.1:UDP-N-acetyl-D-mannosamine dehydrogenase >Feature sequence236 35 1843 gene locus_tag LOCUS_15230 35 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119847.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence237 227 1000 gene locus_tag LOCUS_15240 gene yaaA 227 1000 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 protein_id gnl|my_center|LOCUS_15240 2341 1052 gene locus_tag LOCUS_15250 gene thrC 2341 1052 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781055.1 protein_id gnl|my_center|LOCUS_15250 3274 2345 gene locus_tag LOCUS_15260 gene thrB 3274 2345 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 protein_id gnl|my_center|LOCUS_15260 <4002 3276 gene locus_tag LOCUS_15270 <4002 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095509.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence238 1978 1532 gene locus_tag LOCUS_15280 1978 1532 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence239 1678 161 gene locus_tag LOCUS_15290 gene purF 1678 161 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334231.1 protein_id gnl|my_center|LOCUS_15290 2203 1718 gene locus_tag LOCUS_15300 gene cvpA 2203 1718 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_15300 3158 2436 gene locus_tag LOCUS_15310 gene dedD 3158 2436 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 protein_id gnl|my_center|LOCUS_15310 <3965 3148 gene locus_tag LOCUS_15320 <3965 3148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098137.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase >Feature sequence240 297 788 gene locus_tag LOCUS_15330 297 788 CDS product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 protein_id gnl|my_center|LOCUS_15330 1782 835 gene locus_tag LOCUS_15340 1782 835 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705008.1 protein_id gnl|my_center|LOCUS_15340 2082 3662 gene locus_tag LOCUS_15350 2082 3662 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096554.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence241 790 1740 gene locus_tag LOCUS_15360 gene tal 790 1740 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 protein_id gnl|my_center|LOCUS_15360 1761 3755 gene locus_tag LOCUS_15370 gene tkt 1761 3755 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence242 2119 917 gene locus_tag LOCUS_15380 gene pncB 2119 917 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 protein_id gnl|my_center|LOCUS_15380 2118 2273 gene locus_tag LOCUS_15390 2118 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence243 1596 2414 gene locus_tag LOCUS_15400 gene cof 1596 2414 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113040.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence244 <1 670 gene locus_tag LOCUS_15410 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000565566.1:adenosine deaminase 1683 685 gene locus_tag LOCUS_15420 1683 685 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169841.1 protein_id gnl|my_center|LOCUS_15420 2877 1834 gene locus_tag LOCUS_15430 2877 1834 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282537.1 protein_id gnl|my_center|LOCUS_15430 3511 3726 gene locus_tag LOCUS_15440 gene ydgT 3511 3726 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence245 2324 1104 gene locus_tag LOCUS_15450 gene sbmA 2324 1104 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 protein_id gnl|my_center|LOCUS_15450 3037 2501 gene locus_tag LOCUS_15460 3037 2501 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095802.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence246 <1 1101 gene locus_tag LOCUS_15470 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098102.1:NADH-quinone oxidoreductase subunit M 1108 2565 gene locus_tag LOCUS_15480 gene nuoN 1108 2565 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156669.1 protein_id gnl|my_center|LOCUS_15480 3532 2618 gene locus_tag LOCUS_15490 gene rnz 3532 2618 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence247 1752 1423 gene locus_tag LOCUS_15500 1752 1423 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 protein_id gnl|my_center|LOCUS_15500 2326 1757 gene locus_tag LOCUS_15510 2326 1757 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329246.1 protein_id gnl|my_center|LOCUS_15510 2587 2450 gene locus_tag LOCUS_15520 2587 2450 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366503.1 protein_id gnl|my_center|LOCUS_15520 3597 2587 gene locus_tag LOCUS_15530 gene cydB 3597 2587 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence248 82 7 gene locus_tag LOCUS_t00190 82 7 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 914 195 gene locus_tag LOCUS_15540 914 195 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_15540 1460 3598 gene locus_tag LOCUS_15550 1460 3598 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence249 330 836 gene locus_tag LOCUS_15560 330 836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368548.1 protein_id gnl|my_center|LOCUS_15560 1691 885 gene locus_tag LOCUS_15570 1691 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 protein_id gnl|my_center|LOCUS_15570 2500 1736 gene locus_tag LOCUS_15580 gene miaE 2500 1736 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095379.1 protein_id gnl|my_center|LOCUS_15580 2967 2548 gene locus_tag LOCUS_15590 gene rraB 2967 2548 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence250 634 1908 gene locus_tag LOCUS_15600 gene tyrS 634 1908 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 protein_id gnl|my_center|LOCUS_15600 1983 2843 gene locus_tag LOCUS_15610 gene pdxY 1983 2843 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789751.1 protein_id gnl|my_center|LOCUS_15610 3492 2884 gene locus_tag LOCUS_15620 gene gstA 3492 2884 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705228.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence251 994 11 gene locus_tag LOCUS_15630 gene dusB 994 11 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 protein_id gnl|my_center|LOCUS_15630 2435 1554 gene locus_tag LOCUS_15640 gene prmA 2435 1554 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145849.1 protein_id gnl|my_center|LOCUS_15640 3658 2444 gene locus_tag LOCUS_15650 gene panF 3658 2444 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence252 2842 1469 gene locus_tag LOCUS_15660 gene cysG 2842 1469 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099066.1 protein_id gnl|my_center|LOCUS_15660 3529 3203 gene locus_tag LOCUS_15670 gene nirD 3529 3203 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence253 <1 872 gene locus_tag LOCUS_15680 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000811046.1:3-deoxy-8-phosphooctulonate synthase 2226 1123 gene locus_tag LOCUS_15690 gene chaA 2226 1123 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 protein_id gnl|my_center|LOCUS_15690 2501 2731 gene locus_tag LOCUS_15700 gene chaB 2501 2731 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 protein_id gnl|my_center|LOCUS_15700 2949 3647 gene locus_tag LOCUS_15710 2949 3647 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705085.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence254 1143 295 gene locus_tag LOCUS_15720 1143 295 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 protein_id gnl|my_center|LOCUS_15720 1579 1818 gene locus_tag LOCUS_15730 gene zapB 1579 1818 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208953.1 protein_id gnl|my_center|LOCUS_15730 2378 1869 gene locus_tag LOCUS_15740 gene rraA 2378 1869 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 protein_id gnl|my_center|LOCUS_15740 3379 2447 gene locus_tag LOCUS_15750 gene menA 3379 2447 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence255 386 1066 gene locus_tag LOCUS_15760 386 1066 CDS product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024742.1 protein_id gnl|my_center|LOCUS_15760 1156 3219 gene locus_tag LOCUS_15770 gene ptrB 1156 3219 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936951.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence256 <1 746 gene locus_tag LOCUS_15780 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein 2512 1316 gene locus_tag LOCUS_15790 gene hemY 2512 1316 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_15790 <3580 2512 gene locus_tag LOCUS_15800 <3580 2512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000138976.1:uroporphyrinogen-III C-methyltransferase >Feature sequence257 1731 403 gene locus_tag LOCUS_15810 1731 403 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 protein_id gnl|my_center|LOCUS_15810 3040 2006 gene locus_tag LOCUS_15820 gene yhjD 3040 2006 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence258 2186 51 gene locus_tag LOCUS_15830 gene nrdD 2186 51 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 protein_id gnl|my_center|LOCUS_15830 3364 2483 gene locus_tag LOCUS_15840 3364 2483 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175305.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence259 1014 295 gene locus_tag LOCUS_15850 gene sdhB 1014 295 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235263.1 protein_id gnl|my_center|LOCUS_15850 2736 1027 gene locus_tag LOCUS_15860 gene sdhA 2736 1027 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_15860 3141 2794 gene locus_tag LOCUS_15870 gene sdhD 3141 2794 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254365.1 protein_id gnl|my_center|LOCUS_15870 3536 3135 gene locus_tag LOCUS_15880 gene sdhC 3536 3135 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence260 109 708 gene locus_tag LOCUS_15890 109 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2688 721 gene locus_tag LOCUS_15900 2688 721 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_15900 <3546 2700 gene locus_tag LOCUS_15910 <3546 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094945.1:MFS transporter >Feature sequence261 235 1392 gene locus_tag LOCUS_15920 235 1392 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_15920 1389 2960 gene locus_tag LOCUS_15930 1389 2960 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence262 2426 1167 gene locus_tag LOCUS_15940 gene rho 2426 1167 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_15940 3111 2782 gene locus_tag LOCUS_15950 gene trxA 3111 2782 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004386384.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence263 1641 841 gene locus_tag LOCUS_15960 gene nagB 1641 841 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence264 805 1470 gene locus_tag LOCUS_15970 gene acrR 805 1470 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence265 2023 1211 gene locus_tag LOCUS_15980 gene yidA 2023 1211 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985545.1 protein_id gnl|my_center|LOCUS_15980 <3460 2318 gene locus_tag LOCUS_15990 <3460 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000072072.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence266 181 531 gene locus_tag LOCUS_16000 181 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 639 712 gene locus_tag LOCUS_t00200 639 712 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1252 1872 gene locus_tag LOCUS_16010 1252 1872 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 protein_id gnl|my_center|LOCUS_16010 1994 2653 gene locus_tag LOCUS_16020 1994 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence267 544 221 gene locus_tag LOCUS_16030 gene mliC 544 221 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178044.1 protein_id gnl|my_center|LOCUS_16030 1466 603 gene locus_tag LOCUS_16040 1466 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1578 2195 gene locus_tag LOCUS_16050 1578 2195 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704818.1 protein_id gnl|my_center|LOCUS_16050 2288 2554 gene locus_tag LOCUS_16060 2288 2554 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_16060 2814 3074 gene locus_tag LOCUS_16070 gene ybiJ 2814 3074 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence268 538 1008 gene locus_tag LOCUS_16080 gene argR 538 1008 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369474.1 protein_id gnl|my_center|LOCUS_16080 1373 1636 gene locus_tag LOCUS_16090 gene yhcN 1373 1636 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 protein_id gnl|my_center|LOCUS_16090 1748 2017 gene locus_tag LOCUS_16100 gene yhcN 1748 2017 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098974.1 protein_id gnl|my_center|LOCUS_16100 2360 2088 gene locus_tag LOCUS_16110 2360 2088 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028769.1 protein_id gnl|my_center|LOCUS_16110 <3405 2406 gene locus_tag LOCUS_16120 <3405 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098976.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence269 2307 2426 gene locus_tag LOCUS_16130 2307 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence270 2 355 gene locus_tag LOCUS_16140 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 352 1038 gene locus_tag LOCUS_16150 352 1038 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366856.1 protein_id gnl|my_center|LOCUS_16150 1035 1670 gene locus_tag LOCUS_16160 gene nth 1035 1670 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence271 258 746 gene locus_tag LOCUS_16170 gene mreD 258 746 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 protein_id gnl|my_center|LOCUS_16170 756 1331 gene locus_tag LOCUS_16180 756 1331 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_16180 1337 2806 gene locus_tag LOCUS_16190 gene rng 1337 2806 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence272 <1 509 gene locus_tag LOCUS_16200 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120727113.1:multidrug efflux MATE transporter EmmdR >Feature sequence273 205 579 gene locus_tag LOCUS_16210 205 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 576 923 gene locus_tag LOCUS_16220 576 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1262 1678 gene locus_tag LOCUS_16230 1262 1678 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640517.1 protein_id gnl|my_center|LOCUS_16230 2739 1804 gene locus_tag LOCUS_16240 2739 1804 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence274 837 406 gene locus_tag LOCUS_16250 837 406 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098089.1 protein_id gnl|my_center|LOCUS_16250 1832 852 gene locus_tag LOCUS_16260 1832 852 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence275 <1 1268 gene locus_tag LOCUS_16270 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367239.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase 1796 1326 gene locus_tag LOCUS_16280 1796 1326 CDS product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209803.1 protein_id gnl|my_center|LOCUS_16280 2635 1793 gene locus_tag LOCUS_16290 2635 1793 CDS product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214774.1 protein_id gnl|my_center|LOCUS_16290 <3382 2752 gene locus_tag LOCUS_16300 <3382 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000191701.1:HTH-type transcriptional regulator RutR >Feature sequence276 2108 687 gene locus_tag LOCUS_16310 2108 687 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705561.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence277 39 665 gene locus_tag LOCUS_16320 gene rluE 39 665 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 protein_id gnl|my_center|LOCUS_16320 676 1125 gene locus_tag LOCUS_16330 gene nudJ 676 1125 CDS product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476093.1 protein_id gnl|my_center|LOCUS_16330 1394 3343 gene locus_tag LOCUS_16340 1394 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence278 292 675 gene locus_tag LOCUS_16350 gene grcA 292 675 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098327.1 protein_id gnl|my_center|LOCUS_16350 2085 751 gene locus_tag LOCUS_16360 gene srmB 2085 751 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 protein_id gnl|my_center|LOCUS_16360 2214 2951 gene locus_tag LOCUS_16370 gene trmN 2214 2951 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297411.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence279 609 265 gene locus_tag LOCUS_16380 609 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 942 622 gene locus_tag LOCUS_16390 942 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 <3337 1222 gene locus_tag LOCUS_16400 <3337 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368747.1:excinuclease ABC subunit UvrA >Feature sequence280 98 739 gene locus_tag LOCUS_16410 gene cheZ 98 739 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 protein_id gnl|my_center|LOCUS_16410 974 2020 gene locus_tag LOCUS_16420 gene flhB 974 2020 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence281 656 12 gene locus_tag LOCUS_16430 gene nfsB 656 12 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351450.1 protein_id gnl|my_center|LOCUS_16430 918 1148 gene locus_tag LOCUS_16440 gene pptA 918 1148 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 protein_id gnl|my_center|LOCUS_16440 2098 1193 gene locus_tag LOCUS_16450 2098 1193 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 protein_id gnl|my_center|LOCUS_16450 2681 2172 gene locus_tag LOCUS_16460 2681 2172 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence282 <1 613 gene locus_tag LOCUS_16470 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097429.1:PQQ-dependent sugar dehydrogenase 1240 614 gene locus_tag LOCUS_16480 gene gstB 1240 614 CDS product glutathione S-transferase GstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061831.1 protein_id gnl|my_center|LOCUS_16480 1487 2698 gene locus_tag LOCUS_16490 gene dacC 1487 2698 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 protein_id gnl|my_center|LOCUS_16490 <3329 2726 gene locus_tag LOCUS_16500 <3329 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000450106.1:DNA-binding transcriptional repressor DeoR >Feature sequence283 1354 2253 gene locus_tag LOCUS_16510 gene lysO 1354 2253 CDS product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491136.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence284 416 1027 gene locus_tag LOCUS_16520 gene iprA 416 1027 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295335.1 protein_id gnl|my_center|LOCUS_16520 3098 1080 gene locus_tag LOCUS_16530 3098 1080 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence285 <1 871 gene locus_tag LOCUS_16540 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098002.1:multidrug ABC transporter permease/ATP-binding protein 2410 947 gene locus_tag LOCUS_16550 2410 947 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712888.1 protein_id gnl|my_center|LOCUS_16550 2758 2546 gene locus_tag LOCUS_16560 2758 2546 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266187.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence286 1 627 gene locus_tag LOCUS_16570 1 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 696 2714 gene locus_tag LOCUS_16580 gene ligA 696 2714 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 protein_id gnl|my_center|LOCUS_16580 2716 2931 gene locus_tag LOCUS_16590 2716 2931 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence287 1470 955 gene locus_tag LOCUS_16600 gene hscB 1470 955 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 protein_id gnl|my_center|LOCUS_16600 1875 1552 gene locus_tag LOCUS_16610 gene iscA 1875 1552 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_16610 2286 1900 gene locus_tag LOCUS_16620 gene iscU 2286 1900 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331704.1 protein_id gnl|my_center|LOCUS_16620 <3271 2315 gene locus_tag LOCUS_16630 <3271 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295373.1:cysteine desulfurase >Feature sequence288 715 1461 gene locus_tag LOCUS_16640 715 1461 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097055.1 protein_id gnl|my_center|LOCUS_16640 2462 1575 gene locus_tag LOCUS_16650 2462 1575 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097054.1 protein_id gnl|my_center|LOCUS_16650 <3250 2539 gene locus_tag LOCUS_16660 <3250 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000153502.1:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence289 700 1113 gene locus_tag LOCUS_16670 gene yedD 700 1113 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 protein_id gnl|my_center|LOCUS_16670 1818 1456 gene locus_tag LOCUS_16680 gene fliT 1818 1456 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096006.1 protein_id gnl|my_center|LOCUS_16680 2228 1818 gene locus_tag LOCUS_16690 gene fliS 2228 1818 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096007.1 protein_id gnl|my_center|LOCUS_16690 <3247 2238 gene locus_tag LOCUS_16700 <3247 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096008.1:flagellar filament capping protein FliD >Feature sequence290 606 809 gene locus_tag LOCUS_16710 gene bcsR 606 809 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369237.1 protein_id gnl|my_center|LOCUS_16710 806 1534 gene locus_tag LOCUS_16720 gene bcsQ 806 1534 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369238.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence291 575 1150 gene locus_tag LOCUS_16730 gene nudK 575 1150 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098216.1 protein_id gnl|my_center|LOCUS_16730 1280 2323 gene locus_tag LOCUS_16740 1280 2323 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence292 443 1096 gene locus_tag LOCUS_16750 gene yghB 443 1096 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_16750 2018 1125 gene locus_tag LOCUS_16760 2018 1125 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence293 1571 432 gene locus_tag LOCUS_16770 gene dnaJ 1571 432 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_16770 <3232 1656 gene locus_tag LOCUS_16780 <3232 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000516126.1:molecular chaperone DnaK >Feature sequence294 <1 1674 gene locus_tag LOCUS_16790 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095026.1:methionine synthase >Feature sequence295 347 1198 gene locus_tag LOCUS_16800 347 1198 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 protein_id gnl|my_center|LOCUS_16800 1259 1717 gene locus_tag LOCUS_16810 1259 1717 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 protein_id gnl|my_center|LOCUS_16810 2093 2656 gene locus_tag LOCUS_16820 gene mntP 2093 2656 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 protein_id gnl|my_center|LOCUS_16820 <3221 2653 gene locus_tag LOCUS_16830 <3221 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096129.1:23S rRNA (guanine(745)-N(1))-methyltransferase >Feature sequence296 3049 1658 gene locus_tag LOCUS_16840 3049 1658 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence297 <1 704 gene locus_tag LOCUS_16850 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096268.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 1577 1062 gene locus_tag LOCUS_16860 gene tdk 1577 1062 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068097.1 protein_id gnl|my_center|LOCUS_16860 2209 2622 gene locus_tag LOCUS_16870 gene hns 2209 2622 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence298 465 1550 gene locus_tag LOCUS_16880 465 1550 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_16880 2370 1657 gene locus_tag LOCUS_16890 2370 1657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence299 1857 937 gene locus_tag LOCUS_16900 gene cyoA 1857 937 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence300 <1 568 gene locus_tag LOCUS_16910 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000861334.1:peptidylprolyl isomerase 842 624 gene locus_tag LOCUS_16920 842 624 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703644.1 protein_id gnl|my_center|LOCUS_16920 1055 1882 gene locus_tag LOCUS_16930 gene fkpA 1055 1882 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 protein_id gnl|my_center|LOCUS_16930 2057 2779 gene locus_tag LOCUS_16940 2057 2779 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091472.1 protein_id gnl|my_center|LOCUS_16940 2779 3165 gene locus_tag LOCUS_16950 gene tusD 2779 3165 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence301 <1 1077 gene locus_tag LOCUS_16960 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000454718.1:TerC family protein 2979 1138 gene locus_tag LOCUS_16970 gene asmA 2979 1138 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097885.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence302 <1 723 gene locus_tag LOCUS_16980 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368914.1:acetylornithine deacetylase >Feature sequence303 <1 750 gene locus_tag LOCUS_16990 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000841107.1:alpha-ketoglutarate permease 1097 747 gene locus_tag LOCUS_17000 1097 747 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 protein_id gnl|my_center|LOCUS_17000 2482 1124 gene locus_tag LOCUS_17010 gene pssA 2482 1124 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_17010 <3166 2592 gene locus_tag LOCUS_17020 <3166 2592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000082656.1:protein lysine acetyltransferase >Feature sequence304 570 88 gene locus_tag LOCUS_17030 570 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2263 635 gene locus_tag LOCUS_17040 gene eptA 2263 635 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096920.1 protein_id gnl|my_center|LOCUS_17040 2468 2707 gene locus_tag LOCUS_17050 2468 2707 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798795.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence305 >Feature sequence306 <1 938 gene locus_tag LOCUS_17060 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001272624.1:murein hydrolase activator NlpD 998 1990 gene locus_tag LOCUS_17070 gene rpoS 998 1990 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098493.1 protein_id gnl|my_center|LOCUS_17070 2419 2045 gene locus_tag LOCUS_17080 2419 2045 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703291.1 protein_id gnl|my_center|LOCUS_17080 <3141 2419 gene locus_tag LOCUS_17090 <3141 2419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000222405.1:MFS transporter >Feature sequence307 1428 1748 gene locus_tag LOCUS_17100 1428 1748 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214609.1 protein_id gnl|my_center|LOCUS_17100 1738 2022 gene locus_tag LOCUS_17110 1738 2022 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097683.1 protein_id gnl|my_center|LOCUS_17110 2413 2051 gene locus_tag LOCUS_17120 2413 2051 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369186.1 protein_id gnl|my_center|LOCUS_17120 <3133 2542 gene locus_tag LOCUS_17130 <3133 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000137244.1:glycerol kinase GlpK >Feature sequence308 <1 1596 gene locus_tag LOCUS_17140 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098421.1:class 1b ribonucleoside-diphosphate reductase subunit alpha 1606 2568 gene locus_tag LOCUS_17150 gene nrdF 1606 2568 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777898.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence309 612 1847 gene locus_tag LOCUS_17160 612 1847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_17160 2029 2292 gene locus_tag LOCUS_17170 2029 2292 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214785.1 protein_id gnl|my_center|LOCUS_17170 2307 2687 gene locus_tag LOCUS_17180 2307 2687 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097626.1 protein_id gnl|my_center|LOCUS_17180 2895 2698 gene locus_tag LOCUS_17190 2895 2698 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097627.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence310 1679 1002 gene locus_tag LOCUS_17200 gene kdpE 1679 1002 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367692.1 protein_id gnl|my_center|LOCUS_17200 <3107 1676 gene locus_tag LOCUS_17210 <3107 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097556.1:two-component system sensor histidine kinase KdpD >Feature sequence311 1527 643 gene locus_tag LOCUS_17220 gene tal 1527 643 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130175.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence312 822 2042 gene locus_tag LOCUS_17230 822 2042 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338013.1 protein_id gnl|my_center|LOCUS_17230 2057 2971 gene locus_tag LOCUS_17240 2057 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence313 1425 442 gene locus_tag LOCUS_17250 gene zntB 1425 442 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 protein_id gnl|my_center|LOCUS_17250 1668 1465 gene locus_tag LOCUS_17260 1668 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1920 1747 gene locus_tag LOCUS_17270 1920 1747 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 protein_id gnl|my_center|LOCUS_17270 2173 2445 gene locus_tag LOCUS_17280 2173 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2519 2710 gene locus_tag LOCUS_17290 2519 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence314 73 1140 gene locus_tag LOCUS_17300 gene rffT 73 1140 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217257.1 protein_id gnl|my_center|LOCUS_17300 1137 2501 gene locus_tag LOCUS_17310 gene wzyE 1137 2501 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055143.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence315 32 427 gene locus_tag LOCUS_17320 32 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 405 1223 gene locus_tag LOCUS_17330 gene thiK 405 1223 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705044.1 protein_id gnl|my_center|LOCUS_17330 1241 2266 gene locus_tag LOCUS_17340 gene nagZ 1241 2266 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 protein_id gnl|my_center|LOCUS_17340 2304 2846 gene locus_tag LOCUS_17350 gene ycfP 2304 2846 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587943.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence316 398 168 gene locus_tag LOCUS_17360 398 168 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 protein_id gnl|my_center|LOCUS_17360 545 919 gene locus_tag LOCUS_17370 gene yobA 545 919 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 protein_id gnl|my_center|LOCUS_17370 924 1793 gene locus_tag LOCUS_17380 gene copD 924 1793 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 protein_id gnl|my_center|LOCUS_17380 1808 2146 gene locus_tag LOCUS_17390 1808 2146 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence317 462 1268 gene locus_tag LOCUS_17400 gene rna 462 1268 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 protein_id gnl|my_center|LOCUS_17400 1568 1287 gene locus_tag LOCUS_17410 1568 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103650.1 protein_id gnl|my_center|LOCUS_17410 3021 1654 gene locus_tag LOCUS_17420 3021 1654 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence318 2811 76 gene locus_tag LOCUS_17430 gene nuoG 2811 76 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518099.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence319 357 1643 gene locus_tag LOCUS_17440 gene gltA 357 1643 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785832.1 protein_id gnl|my_center|LOCUS_17440 2583 1792 gene locus_tag LOCUS_17450 gene nei 2583 1792 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence320 366 154 gene locus_tag LOCUS_17460 gene marB 366 154 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366734.1 protein_id gnl|my_center|LOCUS_17460 811 437 gene locus_tag LOCUS_17470 gene marA 811 437 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091199.1 protein_id gnl|my_center|LOCUS_17470 1267 830 gene locus_tag LOCUS_17480 gene marR 1267 830 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799375.1 protein_id gnl|my_center|LOCUS_17480 2710 1511 gene locus_tag LOCUS_17490 2710 1511 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence321 1885 506 gene locus_tag LOCUS_17500 1885 506 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 protein_id gnl|my_center|LOCUS_17500 2351 2046 gene locus_tag LOCUS_17510 2351 2046 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 protein_id gnl|my_center|LOCUS_17510 <3002 2487 gene locus_tag LOCUS_17520 <3002 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703869.1:PTS cellobiose transporter subunit IIC >Feature sequence322 1068 1598 gene locus_tag LOCUS_17530 gene thpR 1068 1598 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 protein_id gnl|my_center|LOCUS_17530 1608 2312 gene locus_tag LOCUS_17540 gene sfsA 1608 2312 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 protein_id gnl|my_center|LOCUS_17540 2491 2946 gene locus_tag LOCUS_17550 gene dksA 2491 2946 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence323 <1 605 gene locus_tag LOCUS_17560 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000639226.1:DUF72 domain-containing protein 673 1068 gene locus_tag LOCUS_17570 673 1068 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 protein_id gnl|my_center|LOCUS_17570 1109 1852 gene locus_tag LOCUS_17580 gene cmoA 1109 1852 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 protein_id gnl|my_center|LOCUS_17580 1849 2820 gene locus_tag LOCUS_17590 gene cmoB 1849 2820 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence324 2929 311 gene locus_tag LOCUS_17600 2929 311 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence325 829 1434 gene locus_tag LOCUS_17610 829 1434 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_17610 2310 1627 gene locus_tag LOCUS_17620 2310 1627 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419689.1 protein_id gnl|my_center|LOCUS_17620 2623 2390 gene locus_tag LOCUS_17630 gene yedF 2623 2390 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence326 449 1276 gene locus_tag LOCUS_17640 449 1276 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 protein_id gnl|my_center|LOCUS_17640 1689 2708 gene locus_tag LOCUS_17650 1689 2708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703304.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence327 2479 641 gene locus_tag LOCUS_17660 gene nuoL 2479 641 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 protein_id gnl|my_center|LOCUS_17660 2778 2476 gene locus_tag LOCUS_17670 gene nuoK 2778 2476 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence328 1 537 gene locus_tag LOCUS_17680 gene rnt 1 537 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096924.1 protein_id gnl|my_center|LOCUS_17680 955 608 gene locus_tag LOCUS_17690 gene grxD 955 608 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_17690 1301 2119 gene locus_tag LOCUS_17700 1301 2119 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096925.1 protein_id gnl|my_center|LOCUS_17700 <2859 2188 gene locus_tag LOCUS_17710 <2859 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096927.1:MFS transporter >Feature sequence329 <1 868 gene locus_tag LOCUS_17720 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000189584.1:esterase FrsA 926 1315 gene locus_tag LOCUS_17730 gene crl 926 1315 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174682.1 protein_id gnl|my_center|LOCUS_17730 2510 1437 gene locus_tag LOCUS_17740 gene phoE 2510 1437 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749881.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence330 53 1084 gene locus_tag LOCUS_17750 gene adhP 53 1084 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_17750 1253 2299 gene locus_tag LOCUS_17760 1253 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 <2844 2301 gene locus_tag LOCUS_17770 <2844 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705622.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence331 1171 2145 gene locus_tag LOCUS_17780 1171 2145 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence332 <2837 1865 gene locus_tag LOCUS_17790 <2837 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000025858.1:UDP-forming cellulose synthase catalytic subunit >Feature sequence333 311 1645 gene locus_tag LOCUS_17800 gene shiA 311 1645 CDS product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097831.1 protein_id gnl|my_center|LOCUS_17800 2641 1688 gene locus_tag LOCUS_17810 gene cbl 2641 1688 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence334 >Feature sequence335 >Feature sequence336 1234 794 gene locus_tag LOCUS_17820 gene sulA 1234 794 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 protein_id gnl|my_center|LOCUS_17820 1518 2132 gene locus_tag LOCUS_17830 1518 2132 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 protein_id gnl|my_center|LOCUS_17830 <2812 2123 gene locus_tag LOCUS_17840 <2812 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000875044.1:YccS family putative transporter >Feature sequence337 1892 1092 gene locus_tag LOCUS_17850 gene otsB 1892 1092 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 protein_id gnl|my_center|LOCUS_17850 <2789 2069 gene locus_tag LOCUS_17860 <2789 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096046.1:L-arabinose ABC transporter permease AraH >Feature sequence338 621 833 gene locus_tag LOCUS_17870 621 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1188 1883 gene locus_tag LOCUS_17880 gene aqpZ 1188 1883 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 protein_id gnl|my_center|LOCUS_17880 <2786 2169 gene locus_tag LOCUS_17890 <2786 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015366942.1:(S)-acetoin forming diacetyl reductase >Feature sequence339 158 556 gene locus_tag LOCUS_17900 158 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 protein_id gnl|my_center|LOCUS_17900 529 1254 gene locus_tag LOCUS_17910 529 1254 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095431.1 protein_id gnl|my_center|LOCUS_17910 1336 2157 gene locus_tag LOCUS_17920 1336 2157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095407.1 protein_id gnl|my_center|LOCUS_17920 <2778 2204 gene locus_tag LOCUS_17930 <2778 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242943.1:PTS beta-glucoside transporter subunit IIABC >Feature sequence340 726 196 gene locus_tag LOCUS_17940 726 196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 protein_id gnl|my_center|LOCUS_17940 1023 2231 gene locus_tag LOCUS_17950 1023 2231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence341 1535 324 gene locus_tag LOCUS_17960 gene csiE 1535 324 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 protein_id gnl|my_center|LOCUS_17960 1730 2377 gene locus_tag LOCUS_17970 1730 2377 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence342 >Feature sequence343 442 230 gene locus_tag LOCUS_17980 442 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 696 535 gene locus_tag LOCUS_17990 696 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1289 693 gene locus_tag LOCUS_18000 1289 693 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 protein_id gnl|my_center|LOCUS_18000 1450 1286 gene locus_tag LOCUS_18010 1450 1286 CDS product DUF1317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149539.1 protein_id gnl|my_center|LOCUS_18010 1755 1447 gene locus_tag LOCUS_18020 1755 1447 CDS product PerC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228938.1 protein_id gnl|my_center|LOCUS_18020 2014 1766 gene locus_tag LOCUS_18030 2014 1766 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675390.1 protein_id gnl|my_center|LOCUS_18030 <2738 2060 gene locus_tag LOCUS_18040 <2738 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268007.1:recombinase RecT >Feature sequence344 <2736 242 gene locus_tag LOCUS_18050 <2736 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098544.1:exodeoxyribonuclease V subunit beta >Feature sequence345 423 1037 gene locus_tag LOCUS_18060 423 1037 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 protein_id gnl|my_center|LOCUS_18060 <2724 1088 gene locus_tag LOCUS_18070 <2724 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095537.1:glutathione-regulated potassium-efflux system protein KefC >Feature sequence346 206 1258 gene locus_tag LOCUS_18080 gene wzzE 206 1258 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 protein_id gnl|my_center|LOCUS_18080 1361 2446 gene locus_tag LOCUS_18090 gene wecB 1361 2446 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340422.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence347 46 1035 gene locus_tag LOCUS_18100 46 1035 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 protein_id gnl|my_center|LOCUS_18100 1140 1907 gene locus_tag LOCUS_18110 1140 1907 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence348 2 442 gene locus_tag LOCUS_18120 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence349 1068 202 gene locus_tag LOCUS_18130 gene ispE 1068 202 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096230.1 protein_id gnl|my_center|LOCUS_18130 1691 1068 gene locus_tag LOCUS_18140 gene lolB 1691 1068 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130678.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence350 131 448 gene locus_tag LOCUS_18150 gene sugE 131 448 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_18150 984 445 gene locus_tag LOCUS_18160 gene blc 984 445 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238369.1 protein_id gnl|my_center|LOCUS_18160 1460 1101 gene locus_tag LOCUS_18170 gene frdD 1460 1101 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609663.1 protein_id gnl|my_center|LOCUS_18170 1866 1471 gene locus_tag LOCUS_18180 gene frdC 1866 1471 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 protein_id gnl|my_center|LOCUS_18180 2612 1866 gene locus_tag LOCUS_18190 gene frdB 2612 1866 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence351 336 1625 gene locus_tag LOCUS_18200 336 1625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 protein_id gnl|my_center|LOCUS_18200 <2671 1847 gene locus_tag LOCUS_18210 <2671 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000603518.1:2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD >Feature sequence352 885 1652 gene locus_tag LOCUS_18220 gene puuD 885 1652 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798760.1 protein_id gnl|my_center|LOCUS_18220 1677 2234 gene locus_tag LOCUS_18230 gene puuR 1677 2234 CDS product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096835.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence353 538 1260 gene locus_tag LOCUS_18240 gene cheR 538 1260 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 protein_id gnl|my_center|LOCUS_18240 1257 2306 gene locus_tag LOCUS_18250 gene cheB 1257 2306 CDS product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence354 1355 495 gene locus_tag LOCUS_18260 1355 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1585 2346 gene locus_tag LOCUS_18270 1585 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence355 <1 949 gene locus_tag LOCUS_18280 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095666.1:acetyl-CoA carboxylase carboxyl transferase subunit alpha >Feature sequence356 <1 949 gene locus_tag LOCUS_18290 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001289141.1:aspartate-semialdehyde dehydrogenase 949 1761 gene locus_tag LOCUS_18300 gene truA 949 1761 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 protein_id gnl|my_center|LOCUS_18300 1787 2446 gene locus_tag LOCUS_18310 1787 2446 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence357 82 528 gene locus_tag LOCUS_18320 82 528 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807626.1 protein_id gnl|my_center|LOCUS_18320 1251 973 gene locus_tag LOCUS_18330 1251 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2154 1669 gene locus_tag LOCUS_18340 gene dsbB 2154 1669 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943475.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence358 976 1152 gene locus_tag LOCUS_18350 976 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence359 1 837 gene locus_tag LOCUS_18360 1 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2364 868 gene locus_tag LOCUS_18370 2364 868 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence360 1480 1962 gene locus_tag LOCUS_18380 1480 1962 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 protein_id gnl|my_center|LOCUS_18380 <2598 2007 gene locus_tag LOCUS_18390 <2598 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097581.1:amino acid ABC transporter ATP-binding protein >Feature sequence361 667 2283 gene locus_tag LOCUS_18400 667 2283 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094793.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence362 250 1023 gene locus_tag LOCUS_18410 gene hisP 250 1023 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293609.1 protein_id gnl|my_center|LOCUS_18410 1695 1051 gene locus_tag LOCUS_18420 1695 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2392 1688 gene locus_tag LOCUS_18430 2392 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence363 446 123 gene locus_tag LOCUS_18440 446 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1066 455 gene locus_tag LOCUS_18450 gene ruvA 1066 455 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365989.1 protein_id gnl|my_center|LOCUS_18450 1733 1212 gene locus_tag LOCUS_18460 gene ruvC 1733 1212 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096083.1 protein_id gnl|my_center|LOCUS_18460 <2561 1822 gene locus_tag LOCUS_18470 <2561 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015365987.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence364 <1 769 gene locus_tag LOCUS_18480 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000746460.1:macrolide transporter subunit MacA >Feature sequence365 17 511 gene locus_tag LOCUS_18490 gene lrp 17 511 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 protein_id gnl|my_center|LOCUS_18490