>Feature sequence01 <1 505 gene locus_tag LOCUS_00010 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002368663.1:recombinase family protein 534 1091 gene locus_tag LOCUS_00020 534 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1156 1467 gene locus_tag LOCUS_00030 1156 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2352 1558 gene locus_tag LOCUS_00040 2352 1558 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_00040 2527 3300 gene locus_tag LOCUS_00050 2527 3300 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_00050 3699 4904 gene locus_tag LOCUS_00060 3699 4904 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_00060 4984 5175 gene locus_tag LOCUS_00070 4984 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5360 5782 gene locus_tag LOCUS_00080 gene rpsL 5360 5782 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_00080 5962 6432 gene locus_tag LOCUS_00090 gene rpsG 5962 6432 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_00090 6487 8562 gene locus_tag LOCUS_00100 gene fusA 6487 8562 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_00100 8667 9869 gene locus_tag LOCUS_00110 gene tuf 8667 9869 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_00110 10082 10801 gene locus_tag LOCUS_00120 10082 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10794 10949 gene locus_tag LOCUS_00130 10794 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11100 11273 gene locus_tag LOCUS_00140 11100 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12801 11278 gene locus_tag LOCUS_00150 gene gpmI 12801 11278 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00150 13686 12919 gene locus_tag LOCUS_00160 gene tpiA 13686 12919 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_00160 14892 13702 gene locus_tag LOCUS_00170 14892 13702 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_00170 15238 16320 gene locus_tag LOCUS_00180 gene serC 15238 16320 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_00180 16492 16310 gene locus_tag LOCUS_00190 16492 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16569 17693 gene locus_tag LOCUS_00200 16569 17693 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_00200 17798 18610 gene locus_tag LOCUS_00210 17798 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19451 18657 gene locus_tag LOCUS_00220 19451 18657 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_00220 19578 20084 gene locus_tag LOCUS_00230 19578 20084 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_00230 20087 20455 gene locus_tag LOCUS_00240 20087 20455 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_00240 20448 20861 gene locus_tag LOCUS_00250 20448 20861 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_00250 20939 22351 gene locus_tag LOCUS_00260 20939 22351 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_00260 22378 23472 gene locus_tag LOCUS_00270 22378 23472 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_00270 23486 24343 gene locus_tag LOCUS_00280 23486 24343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24524 25621 gene locus_tag LOCUS_00290 24524 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 25639 26940 gene locus_tag LOCUS_00300 25639 26940 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_00300 26985 27986 gene locus_tag LOCUS_00310 gene ldhA 26985 27986 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762229.1 protein_id gnl|my_center|LOCUS_00310 28121 28372 gene locus_tag LOCUS_00320 28121 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 28658 28455 gene locus_tag LOCUS_00330 28658 28455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30420 28972 gene locus_tag LOCUS_00340 30420 28972 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_00340 31786 30425 gene locus_tag LOCUS_00350 gene trkA 31786 30425 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_00350 32580 31933 gene locus_tag LOCUS_00360 32580 31933 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_00360 32745 32900 gene locus_tag LOCUS_00370 32745 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32937 33122 gene locus_tag LOCUS_00380 32937 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34217 34133 gene locus_tag LOCUS_t00010 34217 34133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34380 35840 gene locus_tag LOCUS_00390 gene putP 34380 35840 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_00390 36156 35899 gene locus_tag LOCUS_00400 36156 35899 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_00400 36414 37208 gene locus_tag LOCUS_00410 gene dapF 36414 37208 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_00410 37208 38392 gene locus_tag LOCUS_00420 37208 38392 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_00420 40041 38467 gene locus_tag LOCUS_00430 40041 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40726 40043 gene locus_tag LOCUS_00440 40726 40043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_00440 41613 40729 gene locus_tag LOCUS_00450 41613 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42733 41603 gene locus_tag LOCUS_00460 42733 41603 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_00460 42902 44167 gene locus_tag LOCUS_00470 42902 44167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44179 44550 gene locus_tag LOCUS_00480 44179 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46091 44997 gene locus_tag LOCUS_00490 gene tsf 46091 44997 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808080.1 protein_id gnl|my_center|LOCUS_00490 46886 46155 gene locus_tag LOCUS_00500 gene rpsB 46886 46155 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00500 48593 47040 gene locus_tag LOCUS_00510 48593 47040 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963652.1 protein_id gnl|my_center|LOCUS_00510 48827 50827 gene locus_tag LOCUS_00520 48827 50827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50865 52622 gene locus_tag LOCUS_00530 50865 52622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52636 53067 gene locus_tag LOCUS_00540 52636 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53440 54183 gene locus_tag LOCUS_00550 53440 54183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54176 55459 gene locus_tag LOCUS_00560 gene galK 54176 55459 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_00560 55600 57189 gene locus_tag LOCUS_00570 55600 57189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57202 58494 gene locus_tag LOCUS_00580 57202 58494 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_00580 58506 59570 gene locus_tag LOCUS_00590 58506 59570 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_00590 59612 60292 gene locus_tag LOCUS_00600 59612 60292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114933.1 protein_id gnl|my_center|LOCUS_00600 60881 61489 gene locus_tag LOCUS_00610 60881 61489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61646 62545 gene locus_tag LOCUS_00620 61646 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62642 63439 gene locus_tag LOCUS_00630 62642 63439 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900005.1 protein_id gnl|my_center|LOCUS_00630 63467 63949 gene locus_tag LOCUS_00640 63467 63949 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_00640 64763 64687 gene locus_tag LOCUS_t00020 64763 64687 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64949 67180 gene locus_tag LOCUS_00650 64949 67180 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_00650 67660 67208 gene locus_tag LOCUS_00660 67660 67208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69288 67660 gene locus_tag LOCUS_00670 69288 67660 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727217.1 protein_id gnl|my_center|LOCUS_00670 69456 70775 gene locus_tag LOCUS_00680 gene rmuC 69456 70775 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_00680 70781 73225 gene locus_tag LOCUS_00690 70781 73225 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_00690 73290 76775 gene locus_tag LOCUS_00700 73290 76775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77519 76827 gene locus_tag LOCUS_00710 77519 76827 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_00710 78007 77522 gene locus_tag LOCUS_00720 78007 77522 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_00720 78862 78017 gene locus_tag LOCUS_00730 78862 78017 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_00730 79727 78903 gene locus_tag LOCUS_00740 79727 78903 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_00740 81088 79853 gene locus_tag LOCUS_00750 81088 79853 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899014.1 protein_id gnl|my_center|LOCUS_00750 81308 82240 gene locus_tag LOCUS_00760 81308 82240 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_00760 84727 82427 gene locus_tag LOCUS_00770 84727 82427 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_00770 85529 84801 gene locus_tag LOCUS_00780 85529 84801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 86210 85641 gene locus_tag LOCUS_00790 86210 85641 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965525.1 protein_id gnl|my_center|LOCUS_00790 88510 86210 gene locus_tag LOCUS_00800 88510 86210 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_00800 88684 89919 gene locus_tag LOCUS_00810 88684 89919 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00810 89934 90602 gene locus_tag LOCUS_00820 gene cmk 89934 90602 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_00820 90981 91625 gene locus_tag LOCUS_00830 90981 91625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 91615 93639 gene locus_tag LOCUS_00840 91615 93639 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_00840 93910 94410 gene locus_tag LOCUS_00850 93910 94410 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_00850 94477 95289 gene locus_tag LOCUS_00860 94477 95289 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_00860 95302 95841 gene locus_tag LOCUS_00870 95302 95841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 95861 97519 gene locus_tag LOCUS_00880 gene araB 95861 97519 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_00880 97580 98401 gene locus_tag LOCUS_00890 gene rhaD 97580 98401 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 protein_id gnl|my_center|LOCUS_00890 98808 100223 gene locus_tag LOCUS_00900 98808 100223 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_00900 100226 102724 gene locus_tag LOCUS_00910 100226 102724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 103133 105403 gene locus_tag LOCUS_00920 103133 105403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 105634 106290 gene locus_tag LOCUS_00930 105634 106290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_00930 106303 106509 gene locus_tag LOCUS_00940 106303 106509 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_00940 106515 107573 gene locus_tag LOCUS_00950 106515 107573 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_00950 107573 108328 gene locus_tag LOCUS_00960 107573 108328 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_00960 108325 108864 gene locus_tag LOCUS_00970 108325 108864 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_00970 108857 109657 gene locus_tag LOCUS_00980 108857 109657 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_00980 109683 110765 gene locus_tag LOCUS_00990 109683 110765 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_00990 111082 111408 gene locus_tag LOCUS_01000 111082 111408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 111596 112153 gene locus_tag LOCUS_01010 111596 112153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 112286 113254 gene locus_tag LOCUS_01020 gene hprK 112286 113254 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_01020 113289 114233 gene locus_tag LOCUS_01030 gene glcK 113289 114233 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_01030 114305 115228 gene locus_tag LOCUS_01040 gene murB 114305 115228 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_01040 115766 116623 gene locus_tag LOCUS_01050 gene rapZ 115766 116623 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_01050 116639 117532 gene locus_tag LOCUS_01060 gene whiA 116639 117532 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_01060 117571 121077 gene locus_tag LOCUS_01070 117571 121077 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_01070 121173 122150 gene locus_tag LOCUS_01080 gene pfkA 121173 122150 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_01080 122164 124551 gene locus_tag LOCUS_01090 gene pcrA 122164 124551 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_01090 124646 125206 gene locus_tag LOCUS_01100 124646 125206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 125279 125944 gene locus_tag LOCUS_01110 125279 125944 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_01110 126107 126391 gene locus_tag LOCUS_01120 gene rpsF 126107 126391 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_01120 126404 126856 gene locus_tag LOCUS_01130 gene ssb 126404 126856 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722552.1 protein_id gnl|my_center|LOCUS_01130 126895 127140 gene locus_tag LOCUS_01140 gene rpsR 126895 127140 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_01140 127286 128080 gene locus_tag LOCUS_01150 127286 128080 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_01150 129927 128197 gene locus_tag LOCUS_01160 129927 128197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 130136 130732 gene locus_tag LOCUS_01170 130136 130732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 131041 130787 gene locus_tag LOCUS_01180 131041 130787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 132103 131213 gene locus_tag LOCUS_01190 gene dapA 132103 131213 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_01190 133263 132175 gene locus_tag LOCUS_01200 gene asd 133263 132175 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_01200 133446 134471 gene locus_tag LOCUS_01210 gene queA 133446 134471 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_01210 134483 135619 gene locus_tag LOCUS_01220 gene tgt 134483 135619 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_01220 135716 136138 gene locus_tag LOCUS_01230 135716 136138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 137393 136209 gene locus_tag LOCUS_01240 gene hydF 137393 136209 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_01240 138021 137749 gene locus_tag LOCUS_01250 138021 137749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138403 138116 gene locus_tag LOCUS_01260 138403 138116 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_01260 138557 139906 gene locus_tag LOCUS_01270 138557 139906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_01270 139923 140759 gene locus_tag LOCUS_01280 139923 140759 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_01280 140756 141598 gene locus_tag LOCUS_01290 140756 141598 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_01290 141602 142708 gene locus_tag LOCUS_01300 gene ugpC 141602 142708 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_01300 142958 144226 gene locus_tag LOCUS_01310 142958 144226 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_01310 144223 145497 gene locus_tag LOCUS_01320 144223 145497 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_01320 145512 146504 gene locus_tag LOCUS_01330 gene lgt 145512 146504 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_01330 146482 147330 gene locus_tag LOCUS_01340 gene folD 146482 147330 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_01340 147336 147584 gene locus_tag LOCUS_01350 147336 147584 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357306.1 protein_id gnl|my_center|LOCUS_01350 147605 148513 gene locus_tag LOCUS_01360 147605 148513 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794519.1 protein_id gnl|my_center|LOCUS_01360 148806 150302 gene locus_tag LOCUS_01370 148806 150302 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_01370 150330 151307 gene locus_tag LOCUS_01380 150330 151307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 151350 152372 gene locus_tag LOCUS_01390 151350 152372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152376 153362 gene locus_tag LOCUS_01400 152376 153362 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085629.1 protein_id gnl|my_center|LOCUS_01400 153536 155083 gene locus_tag LOCUS_01410 153536 155083 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_01410 155103 156488 gene locus_tag LOCUS_01420 155103 156488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 156504 156728 gene locus_tag LOCUS_01430 156504 156728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 158159 156786 gene locus_tag LOCUS_01440 158159 156786 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_01440 158823 158416 gene locus_tag LOCUS_01450 158823 158416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 160316 158820 gene locus_tag LOCUS_01460 160316 158820 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_01460 160608 161951 gene locus_tag LOCUS_01470 gene gdhA 160608 161951 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_01470 162512 163174 gene locus_tag LOCUS_01480 162512 163174 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_01480 163171 164040 gene locus_tag LOCUS_01490 163171 164040 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_01490 164057 164899 gene locus_tag LOCUS_01500 164057 164899 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272300.1 protein_id gnl|my_center|LOCUS_01500 164911 165456 gene locus_tag LOCUS_01510 164911 165456 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_01510 165476 166894 gene locus_tag LOCUS_01520 165476 166894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 166903 168138 gene locus_tag LOCUS_01530 166903 168138 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_01530 168159 169619 gene locus_tag LOCUS_01540 168159 169619 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_01540 169678 171900 gene locus_tag LOCUS_01550 169678 171900 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808242.1 protein_id gnl|my_center|LOCUS_01550 171948 172379 gene locus_tag LOCUS_01560 gene ruvX 171948 172379 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_01560 172363 173196 gene locus_tag LOCUS_01570 172363 173196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 173694 173335 gene locus_tag LOCUS_01580 173694 173335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 174041 173691 gene locus_tag LOCUS_01590 174041 173691 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_01590 174086 174802 gene locus_tag LOCUS_01600 gene cwlD 174086 174802 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_01600 174812 176185 gene locus_tag LOCUS_01610 gene radA 174812 176185 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_01610 177048 176389 gene locus_tag LOCUS_01620 177048 176389 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_01620 177461 178153 gene locus_tag LOCUS_01630 177461 178153 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_01630 178173 179171 gene locus_tag LOCUS_01640 178173 179171 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_01640 181208 179532 gene locus_tag LOCUS_01650 181208 179532 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_01650 184912 181220 gene locus_tag LOCUS_01660 184912 181220 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_01660 186182 184914 gene locus_tag LOCUS_01670 gene purD 186182 184914 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_01670 187409 186225 gene locus_tag LOCUS_01680 187409 186225 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01680 188156 187437 gene locus_tag LOCUS_01690 188156 187437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 188775 188158 gene locus_tag LOCUS_01700 gene purN 188775 188158 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_01700 189370 188759 gene locus_tag LOCUS_01710 189370 188759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 190407 189364 gene locus_tag LOCUS_01720 gene purM 190407 189364 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_01720 191852 190407 gene locus_tag LOCUS_01730 gene purF 191852 190407 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_01730 192575 191868 gene locus_tag LOCUS_01740 192575 191868 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_01740 193092 192604 gene locus_tag LOCUS_01750 gene purE 193092 192604 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544997.1 protein_id gnl|my_center|LOCUS_01750 193529 193987 gene locus_tag LOCUS_01760 193529 193987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 194567 194166 gene locus_tag LOCUS_01770 194567 194166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 195031 194588 gene locus_tag LOCUS_01780 195031 194588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 196083 195163 gene locus_tag LOCUS_01790 196083 195163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 196373 196086 gene locus_tag LOCUS_01800 196373 196086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 196587 196662 gene locus_tag LOCUS_t00030 196587 196662 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 196779 197213 gene locus_tag LOCUS_01810 196779 197213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 197362 197973 gene locus_tag LOCUS_01820 197362 197973 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_01820 198299 200926 gene locus_tag LOCUS_01830 198299 200926 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01830 201064 202335 gene locus_tag LOCUS_01840 201064 202335 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01840 202575 202913 gene locus_tag LOCUS_01850 202575 202913 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_01850 202897 203334 gene locus_tag LOCUS_01860 gene spoIIAB 202897 203334 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_01860 203331 203996 gene locus_tag LOCUS_01870 gene sigF 203331 203996 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965603.1 protein_id gnl|my_center|LOCUS_01870 204796 204116 gene locus_tag LOCUS_01880 204796 204116 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453991.1 protein_id gnl|my_center|LOCUS_01880 205549 204815 gene locus_tag LOCUS_01890 205549 204815 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_01890 205754 205942 gene locus_tag LOCUS_01900 205754 205942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 206088 206864 gene locus_tag LOCUS_01910 206088 206864 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_01910 206877 207557 gene locus_tag LOCUS_01920 206877 207557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_01920 207560 208996 gene locus_tag LOCUS_01930 207560 208996 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_01930 209012 209191 gene locus_tag LOCUS_01940 209012 209191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 209289 211049 gene locus_tag LOCUS_01950 209289 211049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 211175 211939 gene locus_tag LOCUS_01960 gene proB 211175 211939 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_01960 211947 213194 gene locus_tag LOCUS_01970 211947 213194 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_01970 213207 213995 gene locus_tag LOCUS_01980 gene proC 213207 213995 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_01980 214199 215938 gene locus_tag LOCUS_01990 214199 215938 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966681.1 protein_id gnl|my_center|LOCUS_01990 215960 217558 gene locus_tag LOCUS_02000 215960 217558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 217562 218113 gene locus_tag LOCUS_02010 217562 218113 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_02010 219570 218323 gene locus_tag LOCUS_02020 219570 218323 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834638.1 protein_id gnl|my_center|LOCUS_02020 220477 223080 gene locus_tag LOCUS_02030 220477 223080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 223394 223137 gene locus_tag LOCUS_02040 223394 223137 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_02040 223795 223457 gene locus_tag LOCUS_02050 223795 223457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 224139 223798 gene locus_tag LOCUS_02060 224139 223798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 224344 224126 gene locus_tag LOCUS_02070 224344 224126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 224409 224873 gene locus_tag LOCUS_02080 224409 224873 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_02080 224934 225437 gene locus_tag LOCUS_02090 224934 225437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 226317 225385 gene locus_tag LOCUS_02100 226317 225385 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_02100 226480 227235 gene locus_tag LOCUS_02110 226480 227235 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_02110 227374 227856 gene locus_tag LOCUS_02120 gene nuoE 227374 227856 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_02120 227859 229604 gene locus_tag LOCUS_02130 gene nuoF 227859 229604 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_02130 229617 231644 gene locus_tag LOCUS_02140 229617 231644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 231952 233070 gene locus_tag LOCUS_02150 231952 233070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_02150 233074 233901 gene locus_tag LOCUS_02160 233074 233901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_02160 233898 234731 gene locus_tag LOCUS_02170 233898 234731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_02170 234728 235927 gene locus_tag LOCUS_02180 234728 235927 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_02180 235972 237249 gene locus_tag LOCUS_02190 235972 237249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 237253 237969 gene locus_tag LOCUS_02200 237253 237969 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_02200 238304 238780 gene locus_tag LOCUS_02210 gene greA 238304 238780 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_02210 238855 240852 gene locus_tag LOCUS_02220 gene lysS 238855 240852 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_02220 241117 242001 gene locus_tag LOCUS_02230 241117 242001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 243187 242288 gene locus_tag LOCUS_02240 243187 242288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 243989 243261 gene locus_tag LOCUS_02250 243989 243261 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_02250 244759 244001 gene locus_tag LOCUS_02260 244759 244001 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence02 191 817 gene locus_tag LOCUS_02270 gene hisG 191 817 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_02270 810 2087 gene locus_tag LOCUS_02280 gene hisD 810 2087 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_02280 2087 3142 gene locus_tag LOCUS_02290 gene hisC 2087 3142 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_02290 3146 3715 gene locus_tag LOCUS_02300 3146 3715 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_02300 3712 4299 gene locus_tag LOCUS_02310 gene hisB 3712 4299 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_02310 4299 4907 gene locus_tag LOCUS_02320 gene hisH 4299 4907 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_02320 4938 5651 gene locus_tag LOCUS_02330 gene hisA 4938 5651 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_02330 5648 6406 gene locus_tag LOCUS_02340 gene hisF 5648 6406 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864484.1 protein_id gnl|my_center|LOCUS_02340 6409 7056 gene locus_tag LOCUS_02350 gene hisIE 6409 7056 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_02350 7833 7114 gene locus_tag LOCUS_02360 7833 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 7968 8189 gene locus_tag LOCUS_02370 7968 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8170 8922 gene locus_tag LOCUS_02380 8170 8922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_02380 8903 9547 gene locus_tag LOCUS_02390 8903 9547 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_02390 9924 10814 gene locus_tag LOCUS_02400 gene dapA 9924 10814 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_02400 10811 11548 gene locus_tag LOCUS_02410 gene dapB 10811 11548 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_02410 11575 12558 gene locus_tag LOCUS_02420 11575 12558 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_02420 12585 13880 gene locus_tag LOCUS_02430 gene lysA 12585 13880 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280679.1 protein_id gnl|my_center|LOCUS_02430 14411 15442 gene locus_tag LOCUS_02440 14411 15442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_02440 15466 16398 gene locus_tag LOCUS_02450 15466 16398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_02450 16398 17183 gene locus_tag LOCUS_02460 16398 17183 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_02460 17197 17691 gene locus_tag LOCUS_02470 17197 17691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_02470 17915 18595 gene locus_tag LOCUS_02480 17915 18595 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_02480 18774 19352 gene locus_tag LOCUS_02490 gene rpe 18774 19352 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_02490 19861 19349 gene locus_tag LOCUS_02500 19861 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 19991 20326 gene locus_tag LOCUS_02510 19991 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 20326 22188 gene locus_tag LOCUS_02520 20326 22188 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_02520 22194 23069 gene locus_tag LOCUS_02530 22194 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 23082 24692 gene locus_tag LOCUS_02540 23082 24692 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_02540 24754 25038 gene locus_tag LOCUS_02550 24754 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 25156 25290 gene locus_tag LOCUS_02560 25156 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 26000 25347 gene locus_tag LOCUS_02570 26000 25347 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_02570 26108 27115 gene locus_tag LOCUS_02580 gene trpS 26108 27115 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_02580 28446 27187 gene locus_tag LOCUS_02590 28446 27187 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733142.1 protein_id gnl|my_center|LOCUS_02590 28935 29882 gene locus_tag LOCUS_02600 28935 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 29954 30967 gene locus_tag LOCUS_02610 29954 30967 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_02610 31069 31887 gene locus_tag LOCUS_02620 31069 31887 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_02620 31884 32591 gene locus_tag LOCUS_02630 31884 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_02630 32593 34161 gene locus_tag LOCUS_02640 32593 34161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 34294 34785 gene locus_tag LOCUS_02650 34294 34785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 34779 35852 gene locus_tag LOCUS_02660 gene nusA 34779 35852 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_02660 35871 36140 gene locus_tag LOCUS_02670 35871 36140 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_02670 36133 36462 gene locus_tag LOCUS_02680 36133 36462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 36459 38816 gene locus_tag LOCUS_02690 36459 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 38827 39177 gene locus_tag LOCUS_02700 gene rbfA 38827 39177 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392565.1 protein_id gnl|my_center|LOCUS_02700 39177 40130 gene locus_tag LOCUS_02710 39177 40130 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_02710 40514 40185 gene locus_tag LOCUS_02720 40514 40185 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_02720 42138 40540 gene locus_tag LOCUS_02730 gene xylB 42138 40540 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_02730 42342 43820 gene locus_tag LOCUS_02740 gene hemL 42342 43820 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045295.1 protein_id gnl|my_center|LOCUS_02740 43842 45053 gene locus_tag LOCUS_02750 43842 45053 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682124.1 protein_id gnl|my_center|LOCUS_02750 45384 46766 gene locus_tag LOCUS_02760 45384 46766 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_02760 46818 48200 gene locus_tag LOCUS_02770 46818 48200 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_02770 48215 48589 gene locus_tag LOCUS_02780 48215 48589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 48590 49012 gene locus_tag LOCUS_02790 48590 49012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 49031 50224 gene locus_tag LOCUS_02800 49031 50224 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_02800 50365 51831 gene locus_tag LOCUS_02810 gene guaB 50365 51831 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_02810 52291 56235 gene locus_tag LOCUS_02820 52291 56235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 56409 57485 gene locus_tag LOCUS_02830 56409 57485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 57521 61654 gene locus_tag LOCUS_02840 57521 61654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 61913 63700 gene locus_tag LOCUS_02850 61913 63700 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_02850 63930 64160 gene locus_tag LOCUS_02860 63930 64160 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_02860 64491 64907 gene locus_tag LOCUS_02870 gene nusB 64491 64907 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_02870 64909 65832 gene locus_tag LOCUS_02880 64909 65832 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_02880 65829 67019 gene locus_tag LOCUS_02890 gene xseA 65829 67019 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_02890 67020 67217 gene locus_tag LOCUS_02900 67020 67217 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008194462.1 protein_id gnl|my_center|LOCUS_02900 67438 68283 gene locus_tag LOCUS_02910 67438 68283 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_02910 68312 70183 gene locus_tag LOCUS_02920 gene dxs 68312 70183 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_02920 70187 70996 gene locus_tag LOCUS_02930 70187 70996 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_02930 71011 71853 gene locus_tag LOCUS_02940 71011 71853 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_02940 71871 72320 gene locus_tag LOCUS_02950 71871 72320 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_02950 72351 74012 gene locus_tag LOCUS_02960 gene recN 72351 74012 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_02960 74140 75141 gene locus_tag LOCUS_02970 74140 75141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 75253 75744 gene locus_tag LOCUS_02980 75253 75744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 76384 75842 gene locus_tag LOCUS_02990 76384 75842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 76443 78032 gene locus_tag LOCUS_03000 76443 78032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 78045 79286 gene locus_tag LOCUS_03010 78045 79286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_03010 79358 79687 gene locus_tag LOCUS_03020 79358 79687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001999997.1 protein_id gnl|my_center|LOCUS_03020 79702 80271 gene locus_tag LOCUS_03030 79702 80271 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_03030 80401 81240 gene locus_tag LOCUS_03040 80401 81240 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_03040 82961 81336 gene locus_tag LOCUS_03050 82961 81336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 83416 84024 gene locus_tag LOCUS_03060 83416 84024 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_03060 84043 87507 gene locus_tag LOCUS_03070 gene mfd 84043 87507 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_03070 87927 87610 gene locus_tag LOCUS_03080 87927 87610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 88742 88032 gene locus_tag LOCUS_03090 88742 88032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 89475 88780 gene locus_tag LOCUS_03100 89475 88780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 91046 89460 gene locus_tag LOCUS_03110 91046 89460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 91891 91019 gene locus_tag LOCUS_03120 91891 91019 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_03120 93307 91967 gene locus_tag LOCUS_03130 93307 91967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 95518 93311 gene locus_tag LOCUS_03140 95518 93311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 95762 95511 gene locus_tag LOCUS_03150 95762 95511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 96065 98107 gene locus_tag LOCUS_03160 96065 98107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 98652 98122 gene locus_tag LOCUS_03170 98652 98122 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_03170 98673 98843 gene locus_tag LOCUS_03180 98673 98843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 98915 99772 gene locus_tag LOCUS_03190 98915 99772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 100102 100821 gene locus_tag LOCUS_03200 100102 100821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 100991 101542 gene locus_tag LOCUS_03210 100991 101542 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_03210 101566 101988 gene locus_tag LOCUS_03220 101566 101988 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_03220 102563 102336 gene locus_tag LOCUS_03230 102563 102336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 102940 102722 gene locus_tag LOCUS_03240 102940 102722 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_03240 105735 103276 gene locus_tag LOCUS_03250 gene clpC 105735 103276 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_03250 106910 105903 gene locus_tag LOCUS_03260 106910 105903 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_03260 107421 106903 gene locus_tag LOCUS_03270 gene mcsA 107421 106903 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_03270 107890 107441 gene locus_tag LOCUS_03280 107890 107441 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870147.1 protein_id gnl|my_center|LOCUS_03280 109798 108350 gene locus_tag LOCUS_03290 109798 108350 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_03290 110076 110324 gene locus_tag LOCUS_03300 110076 110324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 110645 111886 gene locus_tag LOCUS_03310 110645 111886 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_03310 112059 113978 gene locus_tag LOCUS_03320 112059 113978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 113975 114355 gene locus_tag LOCUS_03330 113975 114355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 114352 114561 gene locus_tag LOCUS_03340 114352 114561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 114739 115383 gene locus_tag LOCUS_03350 114739 115383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 115368 115610 gene locus_tag LOCUS_03360 115368 115610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 115597 117564 gene locus_tag LOCUS_03370 115597 117564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 117575 117793 gene locus_tag LOCUS_03380 117575 117793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 119239 117839 gene locus_tag LOCUS_03390 gene uxaC 119239 117839 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_03390 119369 119791 gene locus_tag LOCUS_03400 gene mscL 119369 119791 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_03400 119808 120455 gene locus_tag LOCUS_03410 119808 120455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 121270 120530 gene locus_tag LOCUS_03420 121270 120530 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_03420 121391 122404 gene locus_tag LOCUS_03430 121391 122404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 123018 122449 gene locus_tag LOCUS_03440 123018 122449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 124263 123040 gene locus_tag LOCUS_03450 gene tyrS 124263 123040 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_03450 124656 125327 gene locus_tag LOCUS_03460 gene trmB 124656 125327 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_03460 126367 125396 gene locus_tag LOCUS_03470 126367 125396 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_03470 127735 126371 gene locus_tag LOCUS_03480 127735 126371 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_03480 128016 127744 gene locus_tag LOCUS_03490 128016 127744 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_03490 130988 128013 gene locus_tag LOCUS_03500 130988 128013 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_03500 131155 132066 gene locus_tag LOCUS_03510 gene spoIIIAA 131155 132066 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_03510 132079 132579 gene locus_tag LOCUS_03520 132079 132579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 132589 132777 gene locus_tag LOCUS_03530 132589 132777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 132779 133168 gene locus_tag LOCUS_03540 132779 133168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 133170 134279 gene locus_tag LOCUS_03550 gene spoIIIAE 133170 134279 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_03550 134282 134746 gene locus_tag LOCUS_03560 134282 134746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 134743 135273 gene locus_tag LOCUS_03570 134743 135273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 135326 135868 gene locus_tag LOCUS_03580 135326 135868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 137284 135914 gene locus_tag LOCUS_03590 137284 135914 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_03590 138630 137464 gene locus_tag LOCUS_03600 138630 137464 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03600 139510 138647 gene locus_tag LOCUS_03610 gene argB 139510 138647 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_03610 140736 139522 gene locus_tag LOCUS_03620 gene argJ 140736 139522 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03620 141671 140742 gene locus_tag LOCUS_03630 gene argC 141671 140742 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_03630 143228 142158 gene locus_tag LOCUS_03640 gene mnmA 143228 142158 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_03640 143681 143232 gene locus_tag LOCUS_03650 gene nifU 143681 143232 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_03650 144864 143668 gene locus_tag LOCUS_03660 gene nifS 144864 143668 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_03660 145110 145604 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caaatttatcaatatccatcagagaaccgaaac 146070 145639 gene locus_tag LOCUS_03670 146070 145639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 149435 146031 gene locus_tag LOCUS_03680 149435 146031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 150234 150635 gene locus_tag LOCUS_03690 150234 150635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence03 1023 307 gene locus_tag LOCUS_03700 1023 307 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_03700 1652 1098 gene locus_tag LOCUS_03710 gene frr 1652 1098 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_03710 2383 1685 gene locus_tag LOCUS_03720 gene pyrH 2383 1685 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_03720 3069 2569 gene locus_tag LOCUS_03730 3069 2569 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_03730 3814 3074 gene locus_tag LOCUS_03740 3814 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6394 4013 gene locus_tag LOCUS_03750 6394 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6719 6519 gene locus_tag LOCUS_03760 6719 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_03760 7615 6716 gene locus_tag LOCUS_03770 7615 6716 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_03770 8526 7612 gene locus_tag LOCUS_03780 8526 7612 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_03780 8933 10747 gene locus_tag LOCUS_03790 8933 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 10834 13011 gene locus_tag LOCUS_03800 10834 13011 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_03800 13075 13605 gene locus_tag LOCUS_03810 13075 13605 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_03810 14473 13670 gene locus_tag LOCUS_03820 14473 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 15834 14584 gene locus_tag LOCUS_03830 15834 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 15941 16837 gene locus_tag LOCUS_03840 gene ldcB 15941 16837 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_03840 17409 16834 gene locus_tag LOCUS_03850 gene cap8M 17409 16834 CDS product type 8 capsular polysaccharide synthesis protein Cap8M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 protein_id gnl|my_center|LOCUS_03850 18781 17438 gene locus_tag LOCUS_03860 18781 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 19400 18798 gene locus_tag LOCUS_03870 19400 18798 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_03870 20527 19415 gene locus_tag LOCUS_03880 gene prfB 20527 19415 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_03880 20704 21651 gene locus_tag LOCUS_03890 20704 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21669 22556 gene locus_tag LOCUS_03900 gene galU 21669 22556 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831553.1 protein_id gnl|my_center|LOCUS_03900 23632 22619 gene locus_tag LOCUS_03910 23632 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 25168 23783 gene locus_tag LOCUS_03920 25168 23783 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_03920 25752 25222 gene locus_tag LOCUS_03930 gene pyrR 25752 25222 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729510.1 protein_id gnl|my_center|LOCUS_03930 26857 25982 gene locus_tag LOCUS_03940 26857 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 27041 27117 gene locus_tag LOCUS_t00040 27041 27117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27225 27917 gene locus_tag LOCUS_03950 27225 27917 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_03950 28869 27964 gene locus_tag LOCUS_03960 28869 27964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 29634 29116 gene locus_tag LOCUS_03970 29634 29116 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_03970 29772 31142 gene locus_tag LOCUS_03980 29772 31142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 31737 31249 gene locus_tag LOCUS_03990 31737 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 32593 31724 gene locus_tag LOCUS_04000 32593 31724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 33223 32609 gene locus_tag LOCUS_04010 33223 32609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 33851 33243 gene locus_tag LOCUS_04020 33851 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 34371 33844 gene locus_tag LOCUS_04030 34371 33844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 35015 34368 gene locus_tag LOCUS_04040 35015 34368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 35517 35008 gene locus_tag LOCUS_04050 35517 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 35932 35489 gene locus_tag LOCUS_04060 35932 35489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 36724 36095 gene locus_tag LOCUS_04070 36724 36095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 43892 36744 gene locus_tag LOCUS_04080 43892 36744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 46191 43972 gene locus_tag LOCUS_04090 46191 43972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 47783 46236 gene locus_tag LOCUS_04100 47783 46236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 48556 47831 gene locus_tag LOCUS_04110 48556 47831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 49650 48736 gene locus_tag LOCUS_04120 49650 48736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 51543 49801 gene locus_tag LOCUS_04130 51543 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 52303 51557 gene locus_tag LOCUS_04140 52303 51557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 53495 52530 gene locus_tag LOCUS_04150 53495 52530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703563.1 protein_id gnl|my_center|LOCUS_04150 56497 53612 gene locus_tag LOCUS_04160 56497 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 57273 56503 gene locus_tag LOCUS_04170 gene rlmB 57273 56503 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_04170 57465 59795 gene locus_tag LOCUS_04180 gene spoIIE 57465 59795 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_04180 61159 60257 gene locus_tag LOCUS_04190 61159 60257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 61669 61313 gene locus_tag LOCUS_04200 gene rplQ 61669 61313 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_04200 62676 61726 gene locus_tag LOCUS_04210 gene rpoA 62676 61726 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_04210 63315 62713 gene locus_tag LOCUS_04220 gene rpsD 63315 62713 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_04220 63746 63339 gene locus_tag LOCUS_04230 gene rpsK 63746 63339 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_04230 64129 63761 gene locus_tag LOCUS_04240 gene rpsM 64129 63761 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_04240 64530 64312 gene locus_tag LOCUS_04250 gene infA 64530 64312 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_04250 65293 64544 gene locus_tag LOCUS_04260 gene map 65293 64544 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_04260 65928 65296 gene locus_tag LOCUS_04270 65928 65296 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_04270 67271 65946 gene locus_tag LOCUS_04280 gene secY 67271 65946 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_04280 67716 67273 gene locus_tag LOCUS_04290 gene rplO 67716 67273 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_04290 67913 67734 gene locus_tag LOCUS_04300 gene rpmD 67913 67734 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_04300 68428 67928 gene locus_tag LOCUS_04310 gene rpsE 68428 67928 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_04310 68806 68447 gene locus_tag LOCUS_04320 gene rplR 68806 68447 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_04320 69376 68831 gene locus_tag LOCUS_04330 gene rplF 69376 68831 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_04330 69792 69394 gene locus_tag LOCUS_04340 gene rpsH 69792 69394 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_04340 70010 69825 gene locus_tag LOCUS_04350 70010 69825 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_04350 70565 70023 gene locus_tag LOCUS_04360 gene rplE 70565 70023 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_04360 70911 70585 gene locus_tag LOCUS_04370 gene rplX 70911 70585 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_04370 71295 70927 gene locus_tag LOCUS_04380 gene rplN 71295 70927 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_04380 71581 71324 gene locus_tag LOCUS_04390 gene rpsQ 71581 71324 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_04390 71805 71602 gene locus_tag LOCUS_04400 gene rpmC 71805 71602 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_04400 72230 71805 gene locus_tag LOCUS_04410 gene rplP 72230 71805 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_04410 72913 72230 gene locus_tag LOCUS_04420 gene rpsC 72913 72230 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_04420 73265 72933 gene locus_tag LOCUS_04430 gene rplV 73265 72933 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_04430 73570 73289 gene locus_tag LOCUS_04440 gene rpsS 73570 73289 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_04440 74425 73592 gene locus_tag LOCUS_04450 gene rplB 74425 73592 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_04450 74812 74516 gene locus_tag LOCUS_04460 gene rplW 74812 74516 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_04460 75432 74809 gene locus_tag LOCUS_04470 gene rplD 75432 74809 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_04470 76083 75451 gene locus_tag LOCUS_04480 gene rplC 76083 75451 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_04480 76459 76148 gene locus_tag LOCUS_04490 gene rpsJ 76459 76148 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_04490 79528 77120 gene locus_tag LOCUS_04500 gene leuS 79528 77120 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_04500 80094 79738 gene locus_tag LOCUS_04510 gene rsfS 80094 79738 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_04510 80681 80091 gene locus_tag LOCUS_04520 gene yqeK 80681 80091 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_04520 81529 80705 gene locus_tag LOCUS_04530 81529 80705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_04530 82223 81519 gene locus_tag LOCUS_04540 82223 81519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_04540 83750 82257 gene locus_tag LOCUS_04550 83750 82257 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_04550 84047 84122 gene locus_tag LOCUS_t00050 84047 84122 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84205 84675 gene locus_tag LOCUS_04560 84205 84675 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_04560 85056 86339 gene locus_tag LOCUS_04570 85056 86339 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786117.1 protein_id gnl|my_center|LOCUS_04570 87898 86432 gene locus_tag LOCUS_04580 87898 86432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 88314 88045 gene locus_tag LOCUS_04590 88314 88045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 88864 88307 gene locus_tag LOCUS_04600 88864 88307 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_04600 89409 88864 gene locus_tag LOCUS_04610 gene nudF 89409 88864 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_04610 89918 89484 gene locus_tag LOCUS_04620 89918 89484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_04620 90512 89955 gene locus_tag LOCUS_04630 gene efp 90512 89955 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_04630 91699 90650 gene locus_tag LOCUS_04640 91699 90650 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_04640 92734 91712 gene locus_tag LOCUS_04650 gene hemW 92734 91712 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_04650 94390 92861 gene locus_tag LOCUS_04660 94390 92861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_04660 96302 94491 gene locus_tag LOCUS_04670 gene lepA 96302 94491 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_04670 97521 96382 gene locus_tag LOCUS_04680 97521 96382 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_04680 99275 97545 gene locus_tag LOCUS_04690 99275 97545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 100087 99329 gene locus_tag LOCUS_04700 100087 99329 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_04700 101271 100108 gene locus_tag LOCUS_04710 101271 100108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 102466 101282 gene locus_tag LOCUS_04720 102466 101282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 103629 102481 gene locus_tag LOCUS_04730 103629 102481 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_04730 104782 103640 gene locus_tag LOCUS_04740 gene epsG 104782 103640 CDS product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 protein_id gnl|my_center|LOCUS_04740 105920 104808 gene locus_tag LOCUS_04750 105920 104808 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_04750 106606 105986 gene locus_tag LOCUS_04760 106606 105986 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_04760 108510 106636 gene locus_tag LOCUS_04770 108510 106636 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_04770 108780 109088 gene locus_tag LOCUS_04780 108780 109088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 109419 111350 gene locus_tag LOCUS_04790 gene glgB 109419 111350 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_04790 111364 112575 gene locus_tag LOCUS_04800 gene glgC 111364 112575 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_04800 112579 113688 gene locus_tag LOCUS_04810 gene glgD 112579 113688 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_04810 113736 115157 gene locus_tag LOCUS_04820 gene glgA 113736 115157 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_04820 115226 115906 gene locus_tag LOCUS_04830 gene cobC 115226 115906 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_04830 115930 116853 gene locus_tag LOCUS_04840 115930 116853 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_04840 116873 119086 gene locus_tag LOCUS_04850 116873 119086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 119099 120439 gene locus_tag LOCUS_04860 119099 120439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 120674 120598 gene locus_tag LOCUS_t00060 120674 120598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 120830 121585 gene locus_tag LOCUS_04870 120830 121585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 121598 122584 gene locus_tag LOCUS_04880 121598 122584 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_04880 122622 123482 gene locus_tag LOCUS_04890 gene mreC 122622 123482 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_04890 123484 124005 gene locus_tag LOCUS_04900 123484 124005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 124039 126099 gene locus_tag LOCUS_04910 124039 126099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 126121 126843 gene locus_tag LOCUS_04920 gene minD 126121 126843 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_04920 126853 128223 gene locus_tag LOCUS_04930 gene mnmE 126853 128223 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_04930 128240 130120 gene locus_tag LOCUS_04940 gene mnmG 128240 130120 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_04940 130110 130823 gene locus_tag LOCUS_04950 gene rsmG 130110 130823 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_04950 130930 131757 gene locus_tag LOCUS_04960 gene noc 130930 131757 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_04960 131892 132668 gene locus_tag LOCUS_04970 131892 132668 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04970 132671 133531 gene locus_tag LOCUS_04980 gene spo0J 132671 133531 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_04980 133550 134818 gene locus_tag LOCUS_04990 gene serS 133550 134818 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_04990 134941 135876 gene locus_tag LOCUS_05000 gene fba 134941 135876 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_05000 137916 135925 gene locus_tag LOCUS_05010 137916 135925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence04 306 13 gene locus_tag LOCUS_05020 306 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 829 308 gene locus_tag LOCUS_05030 829 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1089 826 gene locus_tag LOCUS_05040 1089 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 1392 1150 gene locus_tag LOCUS_05050 1392 1150 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_05050 1746 1474 gene locus_tag LOCUS_05060 gene hbs 1746 1474 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_05060 2628 1828 gene locus_tag LOCUS_05070 2628 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4419 2635 gene locus_tag LOCUS_05080 4419 2635 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048381.1 protein_id gnl|my_center|LOCUS_05080 5767 4853 gene locus_tag LOCUS_05090 5767 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7224 5779 gene locus_tag LOCUS_05100 7224 5779 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_05100 7853 7221 gene locus_tag LOCUS_05110 7853 7221 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_05110 8316 7855 gene locus_tag LOCUS_05120 gene dtd 8316 7855 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_05120 10619 8340 gene locus_tag LOCUS_05130 10619 8340 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_05130 12719 10665 gene locus_tag LOCUS_05140 12719 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13858 12737 gene locus_tag LOCUS_05150 13858 12737 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_05150 15283 13877 gene locus_tag LOCUS_05160 15283 13877 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_05160 17184 15412 gene locus_tag LOCUS_05170 17184 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 17338 17414 gene locus_tag LOCUS_t00070 17338 17414 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18792 17473 gene locus_tag LOCUS_05180 18792 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 19604 18792 gene locus_tag LOCUS_05190 19604 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19812 20369 gene locus_tag LOCUS_05200 19812 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20373 20975 gene locus_tag LOCUS_05210 20373 20975 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_05210 22285 21311 gene locus_tag LOCUS_05220 22285 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 23343 22387 gene locus_tag LOCUS_05230 23343 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 23574 24431 gene locus_tag LOCUS_05240 23574 24431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 24450 25460 gene locus_tag LOCUS_05250 24450 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 25914 25549 gene locus_tag LOCUS_05260 25914 25549 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_05260 26206 26418 gene locus_tag LOCUS_05270 26206 26418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 26483 26704 gene locus_tag LOCUS_05280 26483 26704 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05280 26792 29290 gene locus_tag LOCUS_05290 26792 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 31150 30281 gene locus_tag LOCUS_05300 31150 30281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_05300 31394 31759 gene locus_tag LOCUS_05310 31394 31759 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 protein_id gnl|my_center|LOCUS_05310 31763 32662 gene locus_tag LOCUS_05320 31763 32662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_05320 32637 35030 gene locus_tag LOCUS_05330 32637 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 35044 37581 gene locus_tag LOCUS_05340 35044 37581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 37855 38529 gene locus_tag LOCUS_05350 37855 38529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 38632 39279 gene locus_tag LOCUS_05360 38632 39279 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_05360 40172 39327 gene locus_tag LOCUS_05370 40172 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 41057 40179 gene locus_tag LOCUS_05380 41057 40179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 41402 41070 gene locus_tag LOCUS_05390 41402 41070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 42279 41389 gene locus_tag LOCUS_05400 42279 41389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 45445 42398 gene locus_tag LOCUS_05410 gene lacZ 45445 42398 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_05410 45663 47147 gene locus_tag LOCUS_05420 45663 47147 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_05420 47158 47850 gene locus_tag LOCUS_05430 47158 47850 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_05430 47918 49126 gene locus_tag LOCUS_05440 47918 49126 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203177.1 protein_id gnl|my_center|LOCUS_05440 49444 49253 gene locus_tag LOCUS_05450 49444 49253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 50333 49461 gene locus_tag LOCUS_05460 gene ispE 50333 49461 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_05460 50908 50468 gene locus_tag LOCUS_05470 50908 50468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 51040 51243 gene locus_tag LOCUS_05480 51040 51243 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_05480 51279 51920 gene locus_tag LOCUS_05490 51279 51920 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_05490 51908 52642 gene locus_tag LOCUS_05500 51908 52642 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_05500 52650 54404 gene locus_tag LOCUS_05510 52650 54404 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_05510 54406 56970 gene locus_tag LOCUS_05520 gene polA 54406 56970 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_05520 56977 57924 gene locus_tag LOCUS_05530 56977 57924 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_05530 57929 58792 gene locus_tag LOCUS_05540 57929 58792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 58789 59793 gene locus_tag LOCUS_05550 gene tsaD 58789 59793 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_05550 60001 59843 gene locus_tag LOCUS_05560 60001 59843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 61149 60019 gene locus_tag LOCUS_05570 61149 60019 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 protein_id gnl|my_center|LOCUS_05570 62440 61430 gene locus_tag LOCUS_05580 62440 61430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 64634 62445 gene locus_tag LOCUS_05590 64634 62445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 64713 65777 gene locus_tag LOCUS_05600 64713 65777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 65832 67034 gene locus_tag LOCUS_05610 65832 67034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 67415 67137 gene locus_tag LOCUS_05620 67415 67137 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_05620 68050 67493 gene locus_tag LOCUS_05630 68050 67493 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_05630 68339 69232 gene locus_tag LOCUS_05640 gene truB 68339 69232 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089682.1 protein_id gnl|my_center|LOCUS_05640 69246 70154 gene locus_tag LOCUS_05650 69246 70154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 70172 70654 gene locus_tag LOCUS_05660 70172 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 70856 70692 gene locus_tag LOCUS_05670 70856 70692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05670 70798 70980 gene locus_tag LOCUS_05680 70798 70980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 71749 71129 gene locus_tag LOCUS_05690 71749 71129 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_05690 72200 71949 gene locus_tag LOCUS_05700 gene secG 72200 71949 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557261.1 protein_id gnl|my_center|LOCUS_05700 74752 72515 gene locus_tag LOCUS_05710 gene gyrA 74752 72515 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656784.1 protein_id gnl|my_center|LOCUS_05710 76749 74767 gene locus_tag LOCUS_05720 gene gyrB 76749 74767 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_05720 77575 77000 gene locus_tag LOCUS_05730 gene eutD 77575 77000 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_05730 77736 78773 gene locus_tag LOCUS_05740 77736 78773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 78890 79459 gene locus_tag LOCUS_05750 78890 79459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 79621 81540 gene locus_tag LOCUS_05760 79621 81540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 81644 84997 gene locus_tag LOCUS_05770 gene addB 81644 84997 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_05770 84990 88502 gene locus_tag LOCUS_05780 gene addA 84990 88502 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_05780 88782 88561 gene locus_tag LOCUS_05790 88782 88561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 90283 88907 gene locus_tag LOCUS_05800 gene mgtE 90283 88907 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_05800 90671 92038 gene locus_tag LOCUS_05810 90671 92038 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_05810 92038 92784 gene locus_tag LOCUS_05820 92038 92784 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_05820 92789 93823 gene locus_tag LOCUS_05830 gene orr 92789 93823 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_05830 94864 93863 gene locus_tag LOCUS_05840 94864 93863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 95209 95284 gene locus_tag LOCUS_t00080 95209 95284 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 100642 95747 gene locus_tag LOCUS_05850 100642 95747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 101353 100910 gene locus_tag LOCUS_05860 gene rpiB 101353 100910 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716792.1 protein_id gnl|my_center|LOCUS_05860 102639 101677 gene locus_tag LOCUS_05870 gene alsB 102639 101677 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_05870 103638 102730 gene locus_tag LOCUS_05880 gene alsK 103638 102730 CDS product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171683.1 protein_id gnl|my_center|LOCUS_05880 104352 103669 gene locus_tag LOCUS_05890 gene alsE 104352 103669 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314355.1 protein_id gnl|my_center|LOCUS_05890 105354 104377 gene locus_tag LOCUS_05900 gene alsC 105354 104377 CDS product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 protein_id gnl|my_center|LOCUS_05900 106904 105378 gene locus_tag LOCUS_05910 gene alsA 106904 105378 CDS product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235240.1 protein_id gnl|my_center|LOCUS_05910 108028 107033 gene locus_tag LOCUS_05920 108028 107033 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721854.1 protein_id gnl|my_center|LOCUS_05920 108316 109089 gene locus_tag LOCUS_05930 gene rfbF 108316 109089 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_05930 109117 110169 gene locus_tag LOCUS_05940 gene rfbG 109117 110169 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_05940 110184 111518 gene locus_tag LOCUS_05950 gene rfbH 110184 111518 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_05950 111511 112044 gene locus_tag LOCUS_05960 111511 112044 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_05960 112025 113866 gene locus_tag LOCUS_05970 gene ilvB 112025 113866 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_05970 113871 114770 gene locus_tag LOCUS_05980 113871 114770 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_05980 114781 115740 gene locus_tag LOCUS_05990 114781 115740 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_05990 115733 117337 gene locus_tag LOCUS_06000 115733 117337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 118518 117385 gene locus_tag LOCUS_06010 118518 117385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 118762 118538 gene locus_tag LOCUS_06020 118762 118538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 119301 118759 gene locus_tag LOCUS_06030 119301 118759 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545794.1 protein_id gnl|my_center|LOCUS_06030 120523 119285 gene locus_tag LOCUS_06040 120523 119285 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_06040 120710 121984 gene locus_tag LOCUS_06050 120710 121984 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_06050 122168 123718 gene locus_tag LOCUS_06060 gene guaA 122168 123718 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_06060 123936 125006 gene locus_tag LOCUS_06070 123936 125006 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_06070 125018 125881 gene locus_tag LOCUS_06080 125018 125881 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_06080 125881 126627 gene locus_tag LOCUS_06090 125881 126627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 126646 127566 gene locus_tag LOCUS_06100 126646 127566 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861925.1 protein_id gnl|my_center|LOCUS_06100 127585 128133 gene locus_tag LOCUS_06110 127585 128133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 128696 128421 gene locus_tag LOCUS_06120 128696 128421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 128927 129697 gene locus_tag LOCUS_06130 128927 129697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 131028 129694 gene locus_tag LOCUS_06140 131028 129694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 131337 131173 gene locus_tag LOCUS_06150 131337 131173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence05 38 253 gene locus_tag LOCUS_06160 38 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 511 1932 gene locus_tag LOCUS_06170 511 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2118 2393 gene locus_tag LOCUS_06180 2118 2393 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_06180 2386 3471 gene locus_tag LOCUS_06190 2386 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3727 3581 gene locus_tag LOCUS_06200 3727 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4104 3724 gene locus_tag LOCUS_06210 4104 3724 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_06210 4479 4554 gene locus_tag LOCUS_t00090 4479 4554 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4683 5531 gene locus_tag LOCUS_06220 4683 5531 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_06220 5533 6369 gene locus_tag LOCUS_06230 5533 6369 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_06230 6385 7668 gene locus_tag LOCUS_06240 6385 7668 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_06240 7686 8603 gene locus_tag LOCUS_06250 gene metA 7686 8603 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_06250 8760 9338 gene locus_tag LOCUS_06260 8760 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9441 9698 gene locus_tag LOCUS_06270 gene spoIIID 9441 9698 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 protein_id gnl|my_center|LOCUS_06270 9703 11535 gene locus_tag LOCUS_06280 gene asnB 9703 11535 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_06280 11794 13107 gene locus_tag LOCUS_06290 11794 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13663 13315 gene locus_tag LOCUS_tm00010 13663 13315 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14131 13667 gene locus_tag LOCUS_06300 gene smpB 14131 13667 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_06300 14617 14150 gene locus_tag LOCUS_06310 14617 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15214 14621 gene locus_tag LOCUS_06320 gene rdgB 15214 14621 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066929.1 protein_id gnl|my_center|LOCUS_06320 16200 15211 gene locus_tag LOCUS_06330 16200 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 17511 16213 gene locus_tag LOCUS_06340 gene dnaA 17511 16213 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_06340 17764 17898 gene locus_tag LOCUS_06350 gene rpmH 17764 17898 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_06350 18115 18330 gene locus_tag LOCUS_06360 18115 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 18576 19556 gene locus_tag LOCUS_06370 18576 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 19607 20560 gene locus_tag LOCUS_06380 19607 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20663 22240 gene locus_tag LOCUS_06390 20663 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 23438 22305 gene locus_tag LOCUS_06400 23438 22305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 23995 24345 gene locus_tag LOCUS_06410 23995 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24329 26533 gene locus_tag LOCUS_06420 24329 26533 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06420 26535 27263 gene locus_tag LOCUS_06430 26535 27263 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_06430 27279 27845 gene locus_tag LOCUS_06440 27279 27845 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_06440 27849 28643 gene locus_tag LOCUS_06450 27849 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 28704 29738 gene locus_tag LOCUS_06460 28704 29738 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_06460 29741 30475 gene locus_tag LOCUS_06470 29741 30475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_06470 30567 31475 gene locus_tag LOCUS_06480 30567 31475 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022840.1 protein_id gnl|my_center|LOCUS_06480 31529 32299 gene locus_tag LOCUS_06490 gene sigG 31529 32299 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_06490 32400 33194 gene locus_tag LOCUS_06500 32400 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_06500 33439 34425 gene locus_tag LOCUS_06510 33439 34425 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_06510 35034 34399 gene locus_tag LOCUS_06520 35034 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 36887 35136 gene locus_tag LOCUS_06530 36887 35136 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_06530 37895 36990 gene locus_tag LOCUS_06540 gene trxB 37895 36990 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_06540 40276 37907 gene locus_tag LOCUS_06550 40276 37907 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_06550 41108 40416 gene locus_tag LOCUS_06560 41108 40416 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06560 41270 42106 gene locus_tag LOCUS_06570 41270 42106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 42093 43034 gene locus_tag LOCUS_06580 42093 43034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 44583 43117 gene locus_tag LOCUS_06590 44583 43117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 45581 44712 gene locus_tag LOCUS_06600 45581 44712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 46529 45594 gene locus_tag LOCUS_06610 46529 45594 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_06610 47544 46558 gene locus_tag LOCUS_06620 47544 46558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 48078 47680 gene locus_tag LOCUS_06630 48078 47680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 48294 48136 gene locus_tag LOCUS_06640 48294 48136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 49311 48301 gene locus_tag LOCUS_06650 gene spoVAD 49311 48301 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_06650 49760 49308 gene locus_tag LOCUS_06660 gene spoVAC 49760 49308 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_06660 50552 49869 gene locus_tag LOCUS_06670 50552 49869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 51487 50615 gene locus_tag LOCUS_06680 51487 50615 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_06680 51602 52177 gene locus_tag LOCUS_06690 51602 52177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 52190 53365 gene locus_tag LOCUS_06700 gene alr 52190 53365 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_06700 53370 53849 gene locus_tag LOCUS_06710 gene ybaK 53370 53849 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_06710 55658 53901 gene locus_tag LOCUS_06720 55658 53901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 56376 55831 gene locus_tag LOCUS_06730 56376 55831 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_06730 56784 56398 gene locus_tag LOCUS_06740 56784 56398 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_06740 56937 57350 gene locus_tag LOCUS_06750 56937 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 58448 57396 gene locus_tag LOCUS_06760 58448 57396 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_06760 59361 58462 gene locus_tag LOCUS_06770 59361 58462 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_06770 60867 59362 gene locus_tag LOCUS_06780 60867 59362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_06780 61686 61063 gene locus_tag LOCUS_06790 gene spoIIR 61686 61063 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_06790 62736 61741 gene locus_tag LOCUS_06800 62736 61741 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_06800 64515 62746 gene locus_tag LOCUS_06810 64515 62746 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_06810 64856 64512 gene locus_tag LOCUS_06820 64856 64512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 65850 64849 gene locus_tag LOCUS_06830 65850 64849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 67502 65853 gene locus_tag LOCUS_06840 67502 65853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582753.1 protein_id gnl|my_center|LOCUS_06840 69717 67516 gene locus_tag LOCUS_06850 69717 67516 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_06850 70884 69733 gene locus_tag LOCUS_06860 70884 69733 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_06860 71244 71092 gene locus_tag LOCUS_06870 71244 71092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 72200 71319 gene locus_tag LOCUS_06880 gene rsgA 72200 71319 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_06880 74358 72190 gene locus_tag LOCUS_06890 gene pknB 74358 72190 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_06890 75106 74378 gene locus_tag LOCUS_06900 gene prpC 75106 74378 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_06900 76161 75103 gene locus_tag LOCUS_06910 gene rlmN 76161 75103 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_06910 77475 76174 gene locus_tag LOCUS_06920 gene rsmB 77475 76174 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206580826.1 protein_id gnl|my_center|LOCUS_06920 78210 77488 gene locus_tag LOCUS_06930 78210 77488 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_06930 79146 78220 gene locus_tag LOCUS_06940 gene fmt 79146 78220 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_06940 79625 79167 gene locus_tag LOCUS_06950 gene def 79625 79167 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_06950 82130 79683 gene locus_tag LOCUS_06960 gene priA 82130 79683 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 protein_id gnl|my_center|LOCUS_06960 82399 82166 gene locus_tag LOCUS_06970 82399 82166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 83006 82392 gene locus_tag LOCUS_06980 gene gmk 83006 82392 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_06980 83265 82996 gene locus_tag LOCUS_06990 83265 82996 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_06990 84156 83278 gene locus_tag LOCUS_07000 84156 83278 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_07000 84544 84176 gene locus_tag LOCUS_07010 84544 84176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 85297 84554 gene locus_tag LOCUS_07020 85297 84554 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_07020 86406 85294 gene locus_tag LOCUS_07030 gene dacB 86406 85294 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_07030 86871 86455 gene locus_tag LOCUS_07040 gene ytfJ 86871 86455 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350003.1 protein_id gnl|my_center|LOCUS_07040 87557 86874 gene locus_tag LOCUS_07050 87557 86874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 88200 87574 gene locus_tag LOCUS_07060 gene scpB 88200 87574 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_07060 88939 88187 gene locus_tag LOCUS_07070 88939 88187 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_07070 89632 88952 gene locus_tag LOCUS_07080 89632 88952 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_07080 90491 89652 gene locus_tag LOCUS_07090 gene prmC 90491 89652 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_07090 91491 90478 gene locus_tag LOCUS_07100 91491 90478 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_07100 93004 91484 gene locus_tag LOCUS_07110 93004 91484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_07110 93747 93040 gene locus_tag LOCUS_07120 93747 93040 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_07120 95144 93744 gene locus_tag LOCUS_07130 95144 93744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 96608 95319 gene locus_tag LOCUS_07140 96608 95319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 97501 96605 gene locus_tag LOCUS_07150 gene cdaA 97501 96605 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_07150 98019 97546 gene locus_tag LOCUS_07160 gene ispF 98019 97546 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_07160 98609 98016 gene locus_tag LOCUS_07170 98609 98016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 99652 98606 gene locus_tag LOCUS_07180 99652 98606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 101808 99655 gene locus_tag LOCUS_07190 101808 99655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 102344 101805 gene locus_tag LOCUS_07200 102344 101805 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_07200 102742 102404 gene locus_tag LOCUS_07210 102742 102404 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_07210 105399 102760 gene locus_tag LOCUS_07220 gene alaS 105399 102760 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_07220 106381 105467 gene locus_tag LOCUS_07230 106381 105467 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_07230 108215 106356 gene locus_tag LOCUS_07240 108215 106356 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_07240 110843 108219 gene locus_tag LOCUS_07250 110843 108219 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_07250 111005 111859 gene locus_tag LOCUS_07260 111005 111859 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_07260 113190 112273 gene locus_tag LOCUS_07270 113190 112273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 114875 113202 gene locus_tag LOCUS_07280 gene malL 114875 113202 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_07280 115238 114948 gene locus_tag LOCUS_07290 115238 114948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 115413 116372 gene locus_tag LOCUS_07300 115413 116372 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_07300 116483 117967 gene locus_tag LOCUS_07310 gene spoIVA 116483 117967 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_07310 118059 119345 gene locus_tag LOCUS_07320 118059 119345 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_07320 120757 119468 gene locus_tag LOCUS_07330 120757 119468 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 protein_id gnl|my_center|LOCUS_07330 121714 120776 gene locus_tag LOCUS_07340 121714 120776 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_07340 122684 121872 gene locus_tag LOCUS_07350 gene rlmA 122684 121872 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_07350 123414 122686 gene locus_tag LOCUS_07360 123414 122686 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_07360 123799 123485 gene locus_tag LOCUS_07370 123799 123485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 124749 123976 gene locus_tag LOCUS_07380 124749 123976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence06 344 1198 gene locus_tag LOCUS_07390 344 1198 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 protein_id gnl|my_center|LOCUS_07390 1221 2369 gene locus_tag LOCUS_07400 1221 2369 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241785.1 protein_id gnl|my_center|LOCUS_07400 2473 3444 gene locus_tag LOCUS_07410 gene rseP 2473 3444 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_07410 3552 3908 gene locus_tag LOCUS_07420 3552 3908 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_07420 4024 5073 gene locus_tag LOCUS_07430 gene ispG 4024 5073 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_07430 5127 8930 gene locus_tag LOCUS_07440 5127 8930 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_07440 8947 9372 gene locus_tag LOCUS_07450 8947 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 9445 10215 gene locus_tag LOCUS_07460 9445 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10430 11038 gene locus_tag LOCUS_07470 10430 11038 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07470 13515 11086 gene locus_tag LOCUS_07480 13515 11086 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_07480 13913 13512 gene locus_tag LOCUS_07490 13913 13512 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243069.1 protein_id gnl|my_center|LOCUS_07490 15518 13929 gene locus_tag LOCUS_07500 15518 13929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_07500 16225 15518 gene locus_tag LOCUS_07510 16225 15518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_07510 16422 16219 gene locus_tag LOCUS_07520 16422 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 16821 16495 gene locus_tag LOCUS_07530 16821 16495 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965771.1 protein_id gnl|my_center|LOCUS_07530 17619 16972 gene locus_tag LOCUS_07540 17619 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 17764 18399 gene locus_tag LOCUS_07550 17764 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 19485 18442 gene locus_tag LOCUS_07560 19485 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 19527 19949 gene locus_tag LOCUS_07570 19527 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_07570 20065 22464 gene locus_tag LOCUS_07580 20065 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 22457 23929 gene locus_tag LOCUS_07590 22457 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 25321 24203 gene locus_tag LOCUS_07600 25321 24203 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_07600 25809 25318 gene locus_tag LOCUS_07610 25809 25318 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_07610 26566 25823 gene locus_tag LOCUS_07620 26566 25823 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_07620 26778 27959 gene locus_tag LOCUS_07630 26778 27959 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 protein_id gnl|my_center|LOCUS_07630 27970 31002 gene locus_tag LOCUS_07640 27970 31002 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_07640 31018 31890 gene locus_tag LOCUS_07650 31018 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 31890 33140 gene locus_tag LOCUS_07660 31890 33140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 33645 33496 gene locus_tag LOCUS_07670 33645 33496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 34591 33779 gene locus_tag LOCUS_07680 34591 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 34802 34578 gene locus_tag LOCUS_07690 34802 34578 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371297.1 protein_id gnl|my_center|LOCUS_07690 35476 34802 gene locus_tag LOCUS_07700 35476 34802 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860330.1 protein_id gnl|my_center|LOCUS_07700 36370 35498 gene locus_tag LOCUS_07710 36370 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 37242 37775 gene locus_tag LOCUS_07720 gene spoVT 37242 37775 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_07720 39023 38280 gene locus_tag LOCUS_07730 39023 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 40672 39080 gene locus_tag LOCUS_07740 40672 39080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 41930 40701 gene locus_tag LOCUS_07750 41930 40701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 42086 42673 gene locus_tag LOCUS_07760 gene lexA 42086 42673 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699857.1 protein_id gnl|my_center|LOCUS_07760 43089 42727 gene locus_tag LOCUS_07770 43089 42727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 43369 43605 gene locus_tag LOCUS_07780 43369 43605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 43612 43956 gene locus_tag LOCUS_07790 43612 43956 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_07790 44302 44928 gene locus_tag LOCUS_07800 gene cysE 44302 44928 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_07800 44929 46320 gene locus_tag LOCUS_07810 gene cysS 44929 46320 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_07810 47093 46557 gene locus_tag LOCUS_07820 47093 46557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 48682 47090 gene locus_tag LOCUS_07830 48682 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 49012 49536 gene locus_tag LOCUS_07840 gene infC 49012 49536 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_07840 49557 49754 gene locus_tag LOCUS_07850 gene rpmI 49557 49754 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_07850 49792 50148 gene locus_tag LOCUS_07860 gene rplT 49792 50148 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_07860 50256 51041 gene locus_tag LOCUS_07870 50256 51041 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_07870 51038 52228 gene locus_tag LOCUS_07880 51038 52228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 52241 54358 gene locus_tag LOCUS_07890 gene topA 52241 54358 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_07890 54359 55669 gene locus_tag LOCUS_07900 gene trmFO 54359 55669 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_07900 55659 56342 gene locus_tag LOCUS_07910 gene rnc 55659 56342 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_07910 56339 57346 gene locus_tag LOCUS_07920 56339 57346 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_07920 57343 60912 gene locus_tag LOCUS_07930 gene smc 57343 60912 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_07930 60923 62743 gene locus_tag LOCUS_07940 60923 62743 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_07940 64393 62825 gene locus_tag LOCUS_07950 64393 62825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 65175 64474 gene locus_tag LOCUS_07960 gene rplA 65175 64474 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_07960 65657 65232 gene locus_tag LOCUS_07970 gene rplK 65657 65232 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_07970 66353 65793 gene locus_tag LOCUS_07980 gene nusG 66353 65793 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_07980 66779 66378 gene locus_tag LOCUS_07990 66779 66378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 66947 66798 gene locus_tag LOCUS_08000 gene rpmG 66947 66798 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_08000 67433 67269 gene locus_tag LOCUS_08010 67433 67269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 67546 68406 gene locus_tag LOCUS_08020 67546 68406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 68407 69024 gene locus_tag LOCUS_08030 68407 69024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 69021 69635 gene locus_tag LOCUS_08040 69021 69635 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_08040 71690 69747 gene locus_tag LOCUS_08050 71690 69747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 71827 71958 gene locus_tag LOCUS_08060 71827 71958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 72645 72019 gene locus_tag LOCUS_08070 72645 72019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 72750 72956 gene locus_tag LOCUS_08080 72750 72956 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_08080 73832 73014 gene locus_tag LOCUS_08090 gene murI 73832 73014 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_08090 75191 73848 gene locus_tag LOCUS_08100 gene murD 75191 73848 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_08100 75399 77285 gene locus_tag LOCUS_08110 75399 77285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 78062 77343 gene locus_tag LOCUS_08120 78062 77343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 78195 78270 gene locus_tag LOCUS_t00100 78195 78270 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 78289 78373 gene locus_tag LOCUS_t00110 78289 78373 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 78940 78500 gene locus_tag LOCUS_08130 78940 78500 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_08130 79177 80400 gene locus_tag LOCUS_08140 79177 80400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 81797 80460 gene locus_tag LOCUS_08150 gene glnA 81797 80460 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_08150 82414 81827 gene locus_tag LOCUS_08160 gene yfbR 82414 81827 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813859.1 protein_id gnl|my_center|LOCUS_08160 82574 83545 gene locus_tag LOCUS_08170 82574 83545 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_08170 83560 84675 gene locus_tag LOCUS_08180 83560 84675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 84685 85620 gene locus_tag LOCUS_08190 gene prmA 84685 85620 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_08190 85610 86341 gene locus_tag LOCUS_08200 85610 86341 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_08200 86421 87629 gene locus_tag LOCUS_08210 86421 87629 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_08210 87792 87968 gene locus_tag LOCUS_08220 87792 87968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 88315 89037 gene locus_tag LOCUS_08230 88315 89037 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_08230 89056 90021 gene locus_tag LOCUS_08240 89056 90021 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_08240 90143 91210 gene locus_tag LOCUS_08250 90143 91210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_08250 91638 91303 gene locus_tag LOCUS_08260 91638 91303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 92003 93502 gene locus_tag LOCUS_08270 92003 93502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 93748 93578 gene locus_tag LOCUS_08280 93748 93578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 93885 94730 gene locus_tag LOCUS_08290 93885 94730 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08290 94755 95270 gene locus_tag LOCUS_08300 gene trmL 94755 95270 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_08300 95822 95319 gene locus_tag LOCUS_08310 95822 95319 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905359.1 protein_id gnl|my_center|LOCUS_08310 97503 95833 gene locus_tag LOCUS_08320 97503 95833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 97693 98787 gene locus_tag LOCUS_08330 gene ychF 97693 98787 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_08330 101241 98881 gene locus_tag LOCUS_08340 gene pheT 101241 98881 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_08340 102306 101254 gene locus_tag LOCUS_08350 gene pheS 102306 101254 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_08350 103618 102641 gene locus_tag LOCUS_08360 103618 102641 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_08360 104666 103779 gene locus_tag LOCUS_08370 104666 103779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_08370 104807 106093 gene locus_tag LOCUS_08380 104807 106093 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_08380 106090 106764 gene locus_tag LOCUS_08390 106090 106764 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_08390 106781 107602 gene locus_tag LOCUS_08400 106781 107602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence07 283 208 gene locus_tag LOCUS_t00120 283 208 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 496 1536 gene locus_tag LOCUS_08410 gene hydE 496 1536 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_08410 1539 2315 gene locus_tag LOCUS_08420 1539 2315 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_08420 2474 2899 gene locus_tag LOCUS_08430 2474 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3425 2943 gene locus_tag LOCUS_08440 3425 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4425 3409 gene locus_tag LOCUS_08450 4425 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4883 5737 gene locus_tag LOCUS_08460 4883 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6559 5792 gene locus_tag LOCUS_08470 gene tam 6559 5792 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_08470 6683 7342 gene locus_tag LOCUS_08480 gene tsaA 6683 7342 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_08480 7480 8625 gene locus_tag LOCUS_08490 gene fucO 7480 8625 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_08490 8768 9691 gene locus_tag LOCUS_08500 8768 9691 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_08500 9907 10425 gene locus_tag LOCUS_08510 9907 10425 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641760.1 protein_id gnl|my_center|LOCUS_08510 11594 10422 gene locus_tag LOCUS_08520 11594 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 11894 11604 gene locus_tag LOCUS_08530 11894 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 12035 13003 gene locus_tag LOCUS_08540 12035 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 13046 13264 gene locus_tag LOCUS_08550 13046 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 13279 14391 gene locus_tag LOCUS_08560 13279 14391 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_08560 15433 15651 gene locus_tag LOCUS_08570 15433 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15772 16146 gene locus_tag LOCUS_08580 15772 16146 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_08580 16165 17511 gene locus_tag LOCUS_08590 gene ffh 16165 17511 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_08590 17625 17867 gene locus_tag LOCUS_08600 gene rpsP 17625 17867 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_08600 17883 18119 gene locus_tag LOCUS_08610 17883 18119 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_08610 20009 18228 gene locus_tag LOCUS_08620 gene aspS 20009 18228 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_08620 21361 20009 gene locus_tag LOCUS_08630 gene hisS 21361 20009 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_08630 22162 21500 gene locus_tag LOCUS_08640 22162 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 22667 22263 gene locus_tag LOCUS_08650 gene mgsA 22667 22263 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_08650 24187 22685 gene locus_tag LOCUS_08660 24187 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074554.1 protein_id gnl|my_center|LOCUS_08660 26772 24232 gene locus_tag LOCUS_08670 gene gyrA 26772 24232 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_08670 28785 26788 gene locus_tag LOCUS_08680 gene gyrB 28785 26788 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_08680 29651 28788 gene locus_tag LOCUS_08690 29651 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 29935 31005 gene locus_tag LOCUS_08700 29935 31005 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_08700 31002 31424 gene locus_tag LOCUS_08710 31002 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 31625 33370 gene locus_tag LOCUS_08720 gene argS 31625 33370 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_08720 33472 35241 gene locus_tag LOCUS_08730 33472 35241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 37893 35485 gene locus_tag LOCUS_08740 37893 35485 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_08740 38240 38599 gene locus_tag LOCUS_08750 38240 38599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 38596 40626 gene locus_tag LOCUS_08760 38596 40626 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_08760 41921 40689 gene locus_tag LOCUS_08770 gene ytvI 41921 40689 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_08770 42097 43326 gene locus_tag LOCUS_08780 42097 43326 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_08780 43349 44557 gene locus_tag LOCUS_08790 43349 44557 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_08790 46455 44815 gene locus_tag LOCUS_08800 gene groL 46455 44815 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_08800 46755 46471 gene locus_tag LOCUS_08810 gene groES 46755 46471 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_08810 46965 47753 gene locus_tag LOCUS_08820 46965 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 47896 48309 gene locus_tag LOCUS_08830 47896 48309 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_08830 52106 48345 gene locus_tag LOCUS_08840 52106 48345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_08840 52807 52106 gene locus_tag LOCUS_08850 52807 52106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_08850 53058 54155 gene locus_tag LOCUS_08860 53058 54155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 54835 54293 gene locus_tag LOCUS_08870 gene yfcE 54835 54293 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_08870 55774 54839 gene locus_tag LOCUS_08880 55774 54839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_08880 56268 57392 gene locus_tag LOCUS_08890 gene recA 56268 57392 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_08890 57392 58024 gene locus_tag LOCUS_08900 gene recX 57392 58024 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454825.1 protein_id gnl|my_center|LOCUS_08900 58043 59374 gene locus_tag LOCUS_08910 gene rimO 58043 59374 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_08910 59414 59971 gene locus_tag LOCUS_08920 gene pgsA 59414 59971 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_08920 60002 60838 gene locus_tag LOCUS_08930 60002 60838 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_08930 60851 61753 gene locus_tag LOCUS_08940 60851 61753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 62179 61919 gene locus_tag LOCUS_08950 62179 61919 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_08950 62294 63985 gene locus_tag LOCUS_08960 62294 63985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 64045 65163 gene locus_tag LOCUS_08970 64045 65163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 66429 65221 gene locus_tag LOCUS_08980 66429 65221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 66921 68483 gene locus_tag LOCUS_08990 gene rny 66921 68483 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_08990 69909 68563 gene locus_tag LOCUS_09000 69909 68563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 70458 70027 gene locus_tag LOCUS_09010 70458 70027 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_09010 70730 70455 gene locus_tag LOCUS_09020 70730 70455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 71317 70769 gene locus_tag LOCUS_09030 71317 70769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 71489 72586 gene locus_tag LOCUS_09040 71489 72586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 72599 73711 gene locus_tag LOCUS_09050 72599 73711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 73723 74874 gene locus_tag LOCUS_09060 73723 74874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 74886 76685 gene locus_tag LOCUS_09070 74886 76685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 76682 77668 gene locus_tag LOCUS_09080 76682 77668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 77767 78462 gene locus_tag LOCUS_09090 77767 78462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 78583 79500 gene locus_tag LOCUS_09100 78583 79500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 79500 80228 gene locus_tag LOCUS_09110 79500 80228 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_09110 80360 81190 gene locus_tag LOCUS_09120 80360 81190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 82723 81296 gene locus_tag LOCUS_09130 82723 81296 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_09130 83907 82735 gene locus_tag LOCUS_09140 83907 82735 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_09140 85573 83900 gene locus_tag LOCUS_09150 85573 83900 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_09150 85784 85578 gene locus_tag LOCUS_09160 85784 85578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 86084 85845 gene locus_tag LOCUS_09170 86084 85845 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_09170 87105 86356 gene locus_tag LOCUS_09180 87105 86356 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_09180 89835 87118 gene locus_tag LOCUS_09190 gene adhE 89835 87118 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_09190 90508 89855 gene locus_tag LOCUS_09200 90508 89855 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582936.1 protein_id gnl|my_center|LOCUS_09200 91580 90654 gene locus_tag LOCUS_09210 91580 90654 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_09210 91738 92616 gene locus_tag LOCUS_09220 91738 92616 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_09220 96511 92699 gene locus_tag LOCUS_09230 96511 92699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 99042 96631 gene locus_tag LOCUS_09240 99042 96631 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_09240 99611 99045 gene locus_tag LOCUS_09250 99611 99045 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 protein_id gnl|my_center|LOCUS_09250 101006 99735 gene locus_tag LOCUS_09260 101006 99735 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_09260 101438 101025 gene locus_tag LOCUS_09270 101438 101025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence08 1491 124 gene locus_tag LOCUS_09280 1491 124 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_09280 1675 2367 gene locus_tag LOCUS_09290 1675 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2382 3047 gene locus_tag LOCUS_09300 gene deoC 2382 3047 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_09300 3073 4239 gene locus_tag LOCUS_09310 3073 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4263 5306 gene locus_tag LOCUS_09320 4263 5306 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_09320 5435 6136 gene locus_tag LOCUS_09330 5435 6136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_09330 6143 7648 gene locus_tag LOCUS_09340 6143 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 7760 9343 gene locus_tag LOCUS_09350 7760 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 9730 10815 gene locus_tag LOCUS_09360 9730 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 10836 11714 gene locus_tag LOCUS_09370 10836 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 11711 12637 gene locus_tag LOCUS_09380 gene ftsX 11711 12637 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_09380 12621 13943 gene locus_tag LOCUS_09390 12621 13943 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_09390 15326 14043 gene locus_tag LOCUS_09400 15326 14043 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431480.1 protein_id gnl|my_center|LOCUS_09400 17413 15338 gene locus_tag LOCUS_09410 17413 15338 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_09410 18389 17568 gene locus_tag LOCUS_09420 18389 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 19956 18586 gene locus_tag LOCUS_09430 19956 18586 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_09430 21444 19957 gene locus_tag LOCUS_09440 21444 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 21800 22429 gene locus_tag LOCUS_09450 gene nth 21800 22429 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_09450 22763 22497 gene locus_tag LOCUS_09460 22763 22497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 23221 24039 gene locus_tag LOCUS_09470 23221 24039 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_09470 24062 25780 gene locus_tag LOCUS_09480 24062 25780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_09480 25781 27529 gene locus_tag LOCUS_09490 25781 27529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_09490 27816 28031 gene locus_tag LOCUS_09500 27816 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 29338 28154 gene locus_tag LOCUS_09510 29338 28154 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775828.1 protein_id gnl|my_center|LOCUS_09510 30865 32298 gene locus_tag LOCUS_09520 30865 32298 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_09520 32353 32871 gene locus_tag LOCUS_09530 32353 32871 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_09530 32961 33083 gene locus_tag LOCUS_09540 32961 33083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 33769 33248 gene locus_tag LOCUS_09550 33769 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 36734 33873 gene locus_tag LOCUS_09560 36734 33873 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_09560 36942 36709 gene locus_tag LOCUS_09570 36942 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 37943 36948 gene locus_tag LOCUS_09580 37943 36948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 38143 38961 gene locus_tag LOCUS_09590 38143 38961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_09590 38975 40237 gene locus_tag LOCUS_09600 38975 40237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 40243 41421 gene locus_tag LOCUS_09610 40243 41421 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_09610 45059 41520 gene locus_tag LOCUS_09620 gene nifJ 45059 41520 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_09620 46471 45305 gene locus_tag LOCUS_09630 46471 45305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 46755 46567 gene locus_tag LOCUS_09640 gene rpmB 46755 46567 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_09640 48093 46882 gene locus_tag LOCUS_09650 48093 46882 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09650 48670 48194 gene locus_tag LOCUS_09660 48670 48194 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_09660 50589 48673 gene locus_tag LOCUS_09670 gene thrS 50589 48673 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_09670 51618 52319 gene locus_tag LOCUS_09680 51618 52319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_09680 52333 54612 gene locus_tag LOCUS_09690 52333 54612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307275.1 protein_id gnl|my_center|LOCUS_09690 54609 54749 gene locus_tag LOCUS_09700 54609 54749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 54724 54984 gene locus_tag LOCUS_09710 54724 54984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 55135 55827 gene locus_tag LOCUS_09720 55135 55827 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_09720 55827 57851 gene locus_tag LOCUS_09730 55827 57851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 57952 59037 gene locus_tag LOCUS_09740 57952 59037 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_09740 59289 59089 gene locus_tag LOCUS_09750 59289 59089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 59841 59302 gene locus_tag LOCUS_09760 59841 59302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 60618 59956 gene locus_tag LOCUS_09770 60618 59956 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_09770 61548 60736 gene locus_tag LOCUS_09780 61548 60736 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_09780 63184 61655 gene locus_tag LOCUS_09790 63184 61655 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_09790 63512 63309 gene locus_tag LOCUS_09800 63512 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 63731 64159 gene locus_tag LOCUS_09810 63731 64159 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_09810 64152 65615 gene locus_tag LOCUS_09820 64152 65615 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09820 65750 66334 gene locus_tag LOCUS_09830 65750 66334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 66336 66917 gene locus_tag LOCUS_09840 66336 66917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 66985 68781 gene locus_tag LOCUS_09850 gene fucI 66985 68781 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_09850 68885 70003 gene locus_tag LOCUS_09860 68885 70003 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_09860 70009 70701 gene locus_tag LOCUS_09870 70009 70701 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_09870 72088 70745 gene locus_tag LOCUS_09880 gene pyk 72088 70745 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_09880 72295 72459 gene locus_tag LOCUS_09890 72295 72459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 72440 74176 gene locus_tag LOCUS_09900 72440 74176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 74589 74665 gene locus_tag LOCUS_t00130 74589 74665 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 74675 74750 gene locus_tag LOCUS_t00140 74675 74750 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 75556 75296 gene locus_tag LOCUS_09910 75556 75296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 75756 76367 gene locus_tag LOCUS_09920 75756 76367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 77886 76552 gene locus_tag LOCUS_09930 77886 76552 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_09930 78211 79872 gene locus_tag LOCUS_09940 78211 79872 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_09940 79885 81537 gene locus_tag LOCUS_09950 79885 81537 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_09950 81552 82235 gene locus_tag LOCUS_09960 81552 82235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 82638 83135 gene locus_tag LOCUS_09970 82638 83135 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_09970 83151 83702 gene locus_tag LOCUS_09980 83151 83702 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_09980 83703 84077 gene locus_tag LOCUS_09990 83703 84077 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_09990 84090 85877 gene locus_tag LOCUS_10000 gene nuoF 84090 85877 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_10000 85892 87637 gene locus_tag LOCUS_10010 85892 87637 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_10010 89032 87770 gene locus_tag LOCUS_10020 gene estB 89032 87770 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986581.1 protein_id gnl|my_center|LOCUS_10020 89836 89252 gene locus_tag LOCUS_10030 gene ysxC 89836 89252 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_10030 92252 89847 gene locus_tag LOCUS_10040 gene lon 92252 89847 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_10040 92394 93224 gene locus_tag LOCUS_10050 92394 93224 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_10050 93234 93590 gene locus_tag LOCUS_10060 93234 93590 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_10060 93702 93794 gene locus_tag LOCUS_t00150 93702 93794 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 95030 93897 gene locus_tag LOCUS_10070 95030 93897 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_10070 95218 95027 gene locus_tag LOCUS_10080 95218 95027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 95978 95208 gene locus_tag LOCUS_10090 95978 95208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 97082 96831 gene locus_tag LOCUS_10100 97082 96831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 97278 97709 gene locus_tag LOCUS_10110 97278 97709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence09 1930 1328 gene locus_tag LOCUS_10120 1930 1328 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 protein_id gnl|my_center|LOCUS_10120 2901 2056 gene locus_tag LOCUS_10130 2901 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3012 4820 gene locus_tag LOCUS_10140 3012 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5689 4823 gene locus_tag LOCUS_10150 gene gpr 5689 4823 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_10150 5825 6079 gene locus_tag LOCUS_10160 gene rpsT 5825 6079 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726526.1 protein_id gnl|my_center|LOCUS_10160 6233 6427 gene locus_tag LOCUS_10170 6233 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6827 6474 gene locus_tag LOCUS_10180 gene spoVAE 6827 6474 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_10180 7352 6906 gene locus_tag LOCUS_10190 7352 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8227 7448 gene locus_tag LOCUS_10200 8227 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 8414 10171 gene locus_tag LOCUS_10210 8414 10171 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_10210 10451 11350 gene locus_tag LOCUS_10220 10451 11350 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_10220 11649 11479 gene locus_tag LOCUS_10230 11649 11479 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_10230 12707 11751 gene locus_tag LOCUS_10240 gene spoIID 12707 11751 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_10240 13310 12774 gene locus_tag LOCUS_10250 13310 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13914 13321 gene locus_tag LOCUS_10260 13914 13321 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_10260 14755 13898 gene locus_tag LOCUS_10270 14755 13898 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948007.1 protein_id gnl|my_center|LOCUS_10270 15217 14768 gene locus_tag LOCUS_10280 15217 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15372 16349 gene locus_tag LOCUS_10290 15372 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 16415 16900 gene locus_tag LOCUS_10300 16415 16900 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_10300 16893 17879 gene locus_tag LOCUS_10310 16893 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 18085 19725 gene locus_tag LOCUS_10320 18085 19725 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_10320 19798 19884 gene locus_tag LOCUS_t00160 19798 19884 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21420 20293 gene locus_tag LOCUS_10330 21420 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 23039 21432 gene locus_tag LOCUS_10340 23039 21432 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_10340 24218 23058 gene locus_tag LOCUS_10350 gene lysA 24218 23058 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496723.1 protein_id gnl|my_center|LOCUS_10350 24450 24220 gene locus_tag LOCUS_10360 24450 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 26020 24509 gene locus_tag LOCUS_10370 26020 24509 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_10370 27037 26081 gene locus_tag LOCUS_10380 27037 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 28720 27086 gene locus_tag LOCUS_10390 28720 27086 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_10390 30032 28809 gene locus_tag LOCUS_10400 30032 28809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 30742 30029 gene locus_tag LOCUS_10410 30742 30029 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_10410 31557 32408 gene locus_tag LOCUS_10420 31557 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 32471 33484 gene locus_tag LOCUS_10430 32471 33484 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_10430 33474 34184 gene locus_tag LOCUS_10440 33474 34184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_10440 34349 35173 gene locus_tag LOCUS_10450 34349 35173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 35178 36626 gene locus_tag LOCUS_10460 35178 36626 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_10460 36623 38185 gene locus_tag LOCUS_10470 36623 38185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 38216 38500 gene locus_tag LOCUS_10480 38216 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 38497 39558 gene locus_tag LOCUS_10490 38497 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 39551 39850 gene locus_tag LOCUS_10500 39551 39850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 39850 40635 gene locus_tag LOCUS_10510 39850 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 40632 42380 gene locus_tag LOCUS_10520 40632 42380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_10520 42373 43578 gene locus_tag LOCUS_10530 42373 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 43603 44820 gene locus_tag LOCUS_10540 43603 44820 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_10540 44855 45865 gene locus_tag LOCUS_10550 44855 45865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_10550 45855 46568 gene locus_tag LOCUS_10560 45855 46568 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286451.1 protein_id gnl|my_center|LOCUS_10560 46584 47780 gene locus_tag LOCUS_10570 46584 47780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 47797 49029 gene locus_tag LOCUS_10580 47797 49029 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924818.1 protein_id gnl|my_center|LOCUS_10580 49172 49657 gene locus_tag LOCUS_10590 49172 49657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 49659 50810 gene locus_tag LOCUS_10600 49659 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 50837 52162 gene locus_tag LOCUS_10610 50837 52162 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_10610 52174 52995 gene locus_tag LOCUS_10620 52174 52995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 53019 54302 gene locus_tag LOCUS_10630 53019 54302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 54299 55570 gene locus_tag LOCUS_10640 54299 55570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 55600 56763 gene locus_tag LOCUS_10650 55600 56763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 56779 57963 gene locus_tag LOCUS_10660 56779 57963 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296319.1 protein_id gnl|my_center|LOCUS_10660 57968 59131 gene locus_tag LOCUS_10670 57968 59131 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_10670 59128 60651 gene locus_tag LOCUS_10680 59128 60651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 60673 63684 gene locus_tag LOCUS_10690 60673 63684 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108144.1 protein_id gnl|my_center|LOCUS_10690 64616 63750 gene locus_tag LOCUS_10700 64616 63750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 65534 64710 gene locus_tag LOCUS_10710 65534 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 68580 65956 gene locus_tag LOCUS_10720 gene ppdK 68580 65956 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_10720 68834 70234 gene locus_tag LOCUS_10730 gene glmU 68834 70234 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048387.1 protein_id gnl|my_center|LOCUS_10730 70245 71000 gene locus_tag LOCUS_10740 70245 71000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 71074 71676 gene locus_tag LOCUS_10750 gene pth 71074 71676 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_10750 71929 72405 gene locus_tag LOCUS_10760 71929 72405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 72398 73666 gene locus_tag LOCUS_10770 72398 73666 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_10770 73729 74871 gene locus_tag LOCUS_10780 73729 74871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 74864 75829 gene locus_tag LOCUS_10790 74864 75829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 75842 76894 gene locus_tag LOCUS_10800 75842 76894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 76891 77274 gene locus_tag LOCUS_10810 76891 77274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 77276 77605 gene locus_tag LOCUS_10820 77276 77605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 77605 78438 gene locus_tag LOCUS_10830 77605 78438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 79652 78609 gene locus_tag LOCUS_10840 79652 78609 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645041.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence10 90 15 gene locus_tag LOCUS_t00170 90 15 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2177 195 gene locus_tag LOCUS_10850 gene ligA 2177 195 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_10850 2976 2353 gene locus_tag LOCUS_10860 2976 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3922 3041 gene locus_tag LOCUS_10870 3922 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5146 4031 gene locus_tag LOCUS_10880 gene rpoD 5146 4031 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_10880 6922 5162 gene locus_tag LOCUS_10890 gene dnaG 6922 5162 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_10890 7952 6948 gene locus_tag LOCUS_10900 7952 6948 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_10900 8650 8030 gene locus_tag LOCUS_10910 8650 8030 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_10910 8925 8722 gene locus_tag LOCUS_10920 gene rpmE 8925 8722 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_10920 9197 9089 gene locus_tag LOCUS_r00010 9197 9089 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9770 9282 gene locus_tag LOCUS_10930 9770 9282 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_10930 10616 9792 gene locus_tag LOCUS_10940 10616 9792 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_10940 11313 10609 gene locus_tag LOCUS_10950 11313 10609 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880369.1 protein_id gnl|my_center|LOCUS_10950 12260 11313 gene locus_tag LOCUS_10960 12260 11313 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_10960 12669 12250 gene locus_tag LOCUS_10970 12669 12250 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_10970 12816 13217 gene locus_tag LOCUS_10980 12816 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 14861 13266 gene locus_tag LOCUS_10990 14861 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 16509 14917 gene locus_tag LOCUS_11000 16509 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18164 16563 gene locus_tag LOCUS_11010 18164 16563 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_11010 18657 18190 gene locus_tag LOCUS_11020 18657 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 18907 18650 gene locus_tag LOCUS_11030 18907 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 20633 18897 gene locus_tag LOCUS_11040 20633 18897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_11040 21354 20647 gene locus_tag LOCUS_11050 21354 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 21631 21470 gene locus_tag LOCUS_11060 21631 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 23768 21852 gene locus_tag LOCUS_11070 23768 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 30322 23822 gene locus_tag LOCUS_11080 30322 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 34449 30868 gene locus_tag LOCUS_11090 34449 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 34875 36104 gene locus_tag LOCUS_11100 34875 36104 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_11100 36121 37428 gene locus_tag LOCUS_11110 36121 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 37432 38592 gene locus_tag LOCUS_11120 37432 38592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_11120 38695 39489 gene locus_tag LOCUS_11130 38695 39489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 39505 40416 gene locus_tag LOCUS_11140 39505 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 41476 40454 gene locus_tag LOCUS_11150 41476 40454 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355505.1 protein_id gnl|my_center|LOCUS_11150 42404 41508 gene locus_tag LOCUS_11160 42404 41508 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_11160 43351 42404 gene locus_tag LOCUS_11170 43351 42404 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_11170 44198 43320 gene locus_tag LOCUS_11180 gene rfbD 44198 43320 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_11180 44825 44208 gene locus_tag LOCUS_11190 gene rfbC 44825 44208 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_11190 45751 44804 gene locus_tag LOCUS_11200 gene rfbA 45751 44804 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_11200 46317 45781 gene locus_tag LOCUS_11210 46317 45781 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_11210 46802 46317 gene locus_tag LOCUS_11220 46802 46317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 48902 46833 gene locus_tag LOCUS_11230 48902 46833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 49909 48962 gene locus_tag LOCUS_11240 49909 48962 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_11240 50755 49913 gene locus_tag LOCUS_11250 50755 49913 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_11250 51690 50770 gene locus_tag LOCUS_11260 51690 50770 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_11260 52165 51683 gene locus_tag LOCUS_11270 gene lspA 52165 51683 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262002.1 protein_id gnl|my_center|LOCUS_11270 53376 52165 gene locus_tag LOCUS_11280 53376 52165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 53903 53430 gene locus_tag LOCUS_11290 gene sepF 53903 53430 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_11290 54648 53923 gene locus_tag LOCUS_11300 54648 53923 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_11300 55864 54626 gene locus_tag LOCUS_11310 55864 54626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 56811 55861 gene locus_tag LOCUS_11320 gene miaA 56811 55861 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_11320 59089 57146 gene locus_tag LOCUS_11330 gene mutL 59089 57146 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_11330 61726 59120 gene locus_tag LOCUS_11340 gene mutS 61726 59120 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_11340 62261 61851 gene locus_tag LOCUS_11350 62261 61851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 63738 62302 gene locus_tag LOCUS_11360 gene miaB 63738 62302 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_11360 63931 65520 gene locus_tag LOCUS_11370 63931 65520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 65523 66470 gene locus_tag LOCUS_11380 65523 66470 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence11 1 150 gene locus_tag LOCUS_11390 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 721 230 gene locus_tag LOCUS_11400 721 230 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_11400 2188 761 gene locus_tag LOCUS_11410 2188 761 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_11410 2995 2372 gene locus_tag LOCUS_11420 2995 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3665 3012 gene locus_tag LOCUS_11430 3665 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4384 3725 gene locus_tag LOCUS_11440 4384 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4537 4662 gene locus_tag LOCUS_11450 4537 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4826 5041 gene locus_tag LOCUS_11460 4826 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5319 5504 gene locus_tag LOCUS_11470 5319 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5537 5704 gene locus_tag LOCUS_11480 5537 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6122 5673 gene locus_tag LOCUS_11490 6122 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6452 6619 gene locus_tag LOCUS_11500 6452 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6658 6942 gene locus_tag LOCUS_11510 6658 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7025 7192 gene locus_tag LOCUS_11520 7025 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7158 7634 gene locus_tag LOCUS_11530 7158 7634 CDS product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323859.1 protein_id gnl|my_center|LOCUS_11530 7631 8401 gene locus_tag LOCUS_11540 7631 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8391 8939 gene locus_tag LOCUS_11550 8391 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8923 9228 gene locus_tag LOCUS_11560 8923 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9230 9637 gene locus_tag LOCUS_11570 gene ssb 9230 9637 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905962.1 protein_id gnl|my_center|LOCUS_11570 9648 9830 gene locus_tag LOCUS_11580 9648 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9840 10526 gene locus_tag LOCUS_11590 9840 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10530 10772 gene locus_tag LOCUS_11600 10530 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10756 11079 gene locus_tag LOCUS_11610 10756 11079 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976041.1 protein_id gnl|my_center|LOCUS_11610 11082 11378 gene locus_tag LOCUS_11620 11082 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11519 11953 gene locus_tag LOCUS_11630 11519 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11959 12255 gene locus_tag LOCUS_11640 11959 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 12248 12418 gene locus_tag LOCUS_11650 12248 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 12421 12867 gene locus_tag LOCUS_11660 12421 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 13040 14077 gene locus_tag LOCUS_11670 13040 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 14087 14464 gene locus_tag LOCUS_11680 14087 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14469 14633 gene locus_tag LOCUS_11690 14469 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 14728 15153 gene locus_tag LOCUS_11700 14728 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 15263 15469 gene locus_tag LOCUS_11710 15263 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 15466 15645 gene locus_tag LOCUS_11720 15466 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 15683 16096 gene locus_tag LOCUS_11730 15683 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 16080 17411 gene locus_tag LOCUS_11740 16080 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 17413 18825 gene locus_tag LOCUS_11750 17413 18825 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_11750 18825 20411 gene locus_tag LOCUS_11760 18825 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 20780 21358 gene locus_tag LOCUS_11770 20780 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 21365 22258 gene locus_tag LOCUS_11780 21365 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 22258 22611 gene locus_tag LOCUS_11790 22258 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 22616 22963 gene locus_tag LOCUS_11800 22616 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 22965 23399 gene locus_tag LOCUS_11810 22965 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23396 23821 gene locus_tag LOCUS_11820 23396 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 23827 24324 gene locus_tag LOCUS_11830 23827 24324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 24371 24850 gene locus_tag LOCUS_11840 24371 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 24852 25397 gene locus_tag LOCUS_11850 24852 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 25398 27977 gene locus_tag LOCUS_11860 25398 27977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 27977 28450 gene locus_tag LOCUS_11870 27977 28450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28447 31233 gene locus_tag LOCUS_11880 28447 31233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 31245 31607 gene locus_tag LOCUS_11890 31245 31607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 31600 33009 gene locus_tag LOCUS_11900 31600 33009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 33000 33275 gene locus_tag LOCUS_11910 33000 33275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 33262 33585 gene locus_tag LOCUS_11920 33262 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 33605 33724 gene locus_tag LOCUS_11930 33605 33724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 33733 33990 gene locus_tag LOCUS_11940 33733 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 34003 34272 gene locus_tag LOCUS_11950 34003 34272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 34275 35111 gene locus_tag LOCUS_11960 34275 35111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 35210 35623 gene locus_tag LOCUS_11970 35210 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 35616 36779 gene locus_tag LOCUS_11980 35616 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 37207 36845 gene locus_tag LOCUS_11990 37207 36845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 37668 37423 gene locus_tag LOCUS_12000 gene cotJB 37668 37423 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_12000 37898 37665 gene locus_tag LOCUS_12010 37898 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 38764 38060 gene locus_tag LOCUS_12020 38764 38060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 39580 38777 gene locus_tag LOCUS_12030 39580 38777 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_12030 41585 39651 gene locus_tag LOCUS_12040 41585 39651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_12040 43326 41578 gene locus_tag LOCUS_12050 43326 41578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12050 43786 43328 gene locus_tag LOCUS_12060 43786 43328 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 protein_id gnl|my_center|LOCUS_12060 44211 44086 gene locus_tag LOCUS_12070 44211 44086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 44547 46016 gene locus_tag LOCUS_12080 44547 46016 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_12080 46496 46422 gene locus_tag LOCUS_t00180 46496 46422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46618 46542 gene locus_tag LOCUS_t00190 46618 46542 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 46699 46623 gene locus_tag LOCUS_t00200 46699 46623 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46808 46735 gene locus_tag LOCUS_t00210 46808 46735 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47596 46940 gene locus_tag LOCUS_12090 47596 46940 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_12090 47984 47658 gene locus_tag LOCUS_12100 47984 47658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 49309 47975 gene locus_tag LOCUS_12110 49309 47975 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_12110 49756 49334 gene locus_tag LOCUS_12120 49756 49334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 50106 49756 gene locus_tag LOCUS_12130 50106 49756 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_12130 50279 52249 gene locus_tag LOCUS_12140 50279 52249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 53298 52291 gene locus_tag LOCUS_12150 53298 52291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 54353 53427 gene locus_tag LOCUS_12160 54353 53427 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_12160 55606 54428 gene locus_tag LOCUS_12170 gene rlmD 55606 54428 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_12170 56823 55603 gene locus_tag LOCUS_12180 56823 55603 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_12180 58988 56823 gene locus_tag LOCUS_12190 58988 56823 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_12190 59957 58992 gene locus_tag LOCUS_12200 59957 58992 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_12200 60946 59960 gene locus_tag LOCUS_12210 60946 59960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence12 478 248 gene locus_tag LOCUS_12220 478 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 594 430 gene locus_tag LOCUS_12230 594 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1149 682 gene locus_tag LOCUS_12240 1149 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1272 1487 gene locus_tag LOCUS_12250 1272 1487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286254.1 protein_id gnl|my_center|LOCUS_12250 2931 1540 gene locus_tag LOCUS_12260 2931 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3423 2980 gene locus_tag LOCUS_12270 3423 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4430 3429 gene locus_tag LOCUS_12280 gene rfbB 4430 3429 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_12280 4711 4526 gene locus_tag LOCUS_12290 4711 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6493 4712 gene locus_tag LOCUS_12300 6493 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7282 6611 gene locus_tag LOCUS_12310 7282 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8912 7482 gene locus_tag LOCUS_12320 8912 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9078 9590 gene locus_tag LOCUS_12330 9078 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9695 10393 gene locus_tag LOCUS_12340 9695 10393 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913210.1 protein_id gnl|my_center|LOCUS_12340 10564 11910 gene locus_tag LOCUS_12350 gene rlmD 10564 11910 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_12350 12023 12205 gene locus_tag LOCUS_12360 12023 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12293 12904 gene locus_tag LOCUS_12370 12293 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 13829 13014 gene locus_tag LOCUS_12380 13829 13014 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_12380 14523 13813 gene locus_tag LOCUS_12390 14523 13813 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046916.1 protein_id gnl|my_center|LOCUS_12390 15445 14591 gene locus_tag LOCUS_12400 15445 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 15991 15539 gene locus_tag LOCUS_12410 15991 15539 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894431.1 protein_id gnl|my_center|LOCUS_12410 17757 16018 gene locus_tag LOCUS_12420 17757 16018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_12420 19224 17863 gene locus_tag LOCUS_12430 19224 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 19422 19497 gene locus_tag LOCUS_t00220 19422 19497 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21635 19692 gene locus_tag LOCUS_12440 21635 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 22795 21698 gene locus_tag LOCUS_12450 22795 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 22887 23414 gene locus_tag LOCUS_12460 22887 23414 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 protein_id gnl|my_center|LOCUS_12460 24105 23539 gene locus_tag LOCUS_12470 24105 23539 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_12470 24996 24118 gene locus_tag LOCUS_12480 24996 24118 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_12480 25149 25631 gene locus_tag LOCUS_12490 25149 25631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 26830 25676 gene locus_tag LOCUS_12500 26830 25676 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_12500 27673 26843 gene locus_tag LOCUS_12510 27673 26843 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_12510 28619 27747 gene locus_tag LOCUS_12520 28619 27747 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_12520 29970 28609 gene locus_tag LOCUS_12530 29970 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 30553 30026 gene locus_tag LOCUS_12540 30553 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 32219 30690 gene locus_tag LOCUS_12550 32219 30690 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_12550 33645 32284 gene locus_tag LOCUS_12560 33645 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 33792 34751 gene locus_tag LOCUS_12570 gene manA 33792 34751 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_12570 36269 34803 gene locus_tag LOCUS_12580 36269 34803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_12580 37367 36381 gene locus_tag LOCUS_12590 37367 36381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 38238 37459 gene locus_tag LOCUS_12600 38238 37459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 39701 38280 gene locus_tag LOCUS_12610 gene spoVAF 39701 38280 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_12610 41099 39762 gene locus_tag LOCUS_12620 41099 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 41710 41099 gene locus_tag LOCUS_12630 41710 41099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 43216 41768 gene locus_tag LOCUS_12640 43216 41768 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_12640 44482 43235 gene locus_tag LOCUS_12650 44482 43235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 45761 44496 gene locus_tag LOCUS_12660 45761 44496 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_12660 47222 45846 gene locus_tag LOCUS_12670 gene pepV 47222 45846 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_12670 47410 47222 gene locus_tag LOCUS_12680 47410 47222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 48157 47510 gene locus_tag LOCUS_12690 48157 47510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388465.1 protein_id gnl|my_center|LOCUS_12690 48651 48160 gene locus_tag LOCUS_12700 gene coaD 48651 48160 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_12700 49199 48648 gene locus_tag LOCUS_12710 gene rsmD 49199 48648 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_12710 51092 49254 gene locus_tag LOCUS_12720 gene uvrC 51092 49254 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_12720 51786 51523 gene locus_tag LOCUS_12730 51786 51523 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_12730 52729 51989 gene locus_tag LOCUS_12740 gene trmD 52729 51989 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_12740 53240 52719 gene locus_tag LOCUS_12750 gene rimM 53240 52719 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_12750 55422 53245 gene locus_tag LOCUS_12760 55422 53245 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_12760 55637 56257 gene locus_tag LOCUS_12770 gene radC 55637 56257 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_12770 56289 56906 gene locus_tag LOCUS_12780 56289 56906 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_12780 56903 58234 gene locus_tag LOCUS_12790 56903 58234 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_12790 59054 58308 gene locus_tag LOCUS_12800 59054 58308 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_12800 59712 59041 gene locus_tag LOCUS_12810 59712 59041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12810 60546 59779 gene locus_tag LOCUS_12820 60546 59779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12820 >Feature sequence13 6906 5644 gene locus_tag LOCUS_12830 6906 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7933 6899 gene locus_tag LOCUS_12840 7933 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8122 8197 gene locus_tag LOCUS_t00230 8122 8197 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8667 8452 gene locus_tag LOCUS_12850 8667 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9301 8897 gene locus_tag LOCUS_12860 9301 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9398 9189 gene locus_tag LOCUS_12870 9398 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10108 9419 gene locus_tag LOCUS_12880 10108 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10764 10222 gene locus_tag LOCUS_12890 10764 10222 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_12890 10878 11315 gene locus_tag LOCUS_12900 10878 11315 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_12900 11333 11887 gene locus_tag LOCUS_12910 11333 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13156 11936 gene locus_tag LOCUS_12920 13156 11936 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303757.1 protein_id gnl|my_center|LOCUS_12920 15451 13592 gene locus_tag LOCUS_12930 15451 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 16239 15565 gene locus_tag LOCUS_12940 16239 15565 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_12940 16409 17914 gene locus_tag LOCUS_12950 16409 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111421.1 protein_id gnl|my_center|LOCUS_12950 18784 17999 gene locus_tag LOCUS_12960 18784 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 18950 19726 gene locus_tag LOCUS_12970 18950 19726 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_12970 19731 21341 gene locus_tag LOCUS_12980 19731 21341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 21341 23368 gene locus_tag LOCUS_12990 gene recG 21341 23368 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_12990 23632 25059 gene locus_tag LOCUS_13000 23632 25059 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_13000 25063 25944 gene locus_tag LOCUS_13010 25063 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 25957 26886 gene locus_tag LOCUS_13020 25957 26886 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_13020 26898 27686 gene locus_tag LOCUS_13030 gene queG 26898 27686 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_13030 27822 28145 gene locus_tag LOCUS_13040 27822 28145 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_13040 28145 29035 gene locus_tag LOCUS_13050 28145 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 29082 29948 gene locus_tag LOCUS_13060 29082 29948 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_13060 29955 32162 gene locus_tag LOCUS_13070 29955 32162 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_13070 32175 32405 gene locus_tag LOCUS_13080 32175 32405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 35513 32457 gene locus_tag LOCUS_13090 35513 32457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 37243 35528 gene locus_tag LOCUS_13100 37243 35528 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_13100 37622 38836 gene locus_tag LOCUS_13110 37622 38836 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_13110 38948 39589 gene locus_tag LOCUS_13120 38948 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 39840 39649 gene locus_tag LOCUS_13130 39840 39649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 42389 40110 gene locus_tag LOCUS_13140 42389 40110 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_13140 43028 42402 gene locus_tag LOCUS_13150 43028 42402 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_13150 43552 43031 gene locus_tag LOCUS_13160 43552 43031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 44754 43552 gene locus_tag LOCUS_13170 44754 43552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 45500 44751 gene locus_tag LOCUS_13180 gene truA 45500 44751 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_13180 46318 45497 gene locus_tag LOCUS_13190 46318 45497 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_13190 47191 46355 gene locus_tag LOCUS_13200 47191 46355 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_13200 48045 47191 gene locus_tag LOCUS_13210 48045 47191 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_13210 48927 48064 gene locus_tag LOCUS_13220 48927 48064 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_13220 50295 48943 gene locus_tag LOCUS_13230 gene glmM 50295 48943 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_13230 51381 50311 gene locus_tag LOCUS_13240 gene ruvB 51381 50311 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_13240 51987 51394 gene locus_tag LOCUS_13250 gene ruvA 51987 51394 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_13250 52661 52161 gene locus_tag LOCUS_13260 gene ruvC 52661 52161 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_13260 53986 52661 gene locus_tag LOCUS_13270 gene der 53986 52661 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_13270 55304 53988 gene locus_tag LOCUS_13280 55304 53988 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_13280 55848 55666 gene locus_tag LOCUS_13290 gene rpmF 55848 55666 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_13290 56388 55882 gene locus_tag LOCUS_13300 56388 55882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 57828 56584 gene locus_tag LOCUS_13310 gene rhaA 57828 56584 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_13310 59389 57842 gene locus_tag LOCUS_13320 59389 57842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208870.1 protein_id gnl|my_center|LOCUS_13320 59794 59540 gene locus_tag LOCUS_13330 59794 59540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence14 3094 2255 gene locus_tag LOCUS_13340 3094 2255 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_13340 3391 3113 gene locus_tag LOCUS_13350 3391 3113 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_13350 4484 3393 gene locus_tag LOCUS_13360 gene recF 4484 3393 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_13360 4746 4495 gene locus_tag LOCUS_13370 gene yaaA 4746 4495 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_13370 5860 4739 gene locus_tag LOCUS_13380 gene dnaN 5860 4739 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_13380 6695 6096 gene locus_tag LOCUS_13390 gene recR 6695 6096 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_13390 7030 6698 gene locus_tag LOCUS_13400 7030 6698 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_13400 8023 7049 gene locus_tag LOCUS_13410 8023 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 9624 8029 gene locus_tag LOCUS_13420 gene dnaX 9624 8029 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_13420 10544 9870 gene locus_tag LOCUS_13430 10544 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11848 10679 gene locus_tag LOCUS_13440 11848 10679 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_13440 12527 12096 gene locus_tag LOCUS_13450 12527 12096 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_13450 13838 12540 gene locus_tag LOCUS_13460 13838 12540 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_13460 14426 13854 gene locus_tag LOCUS_13470 14426 13854 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_13470 16168 14429 gene locus_tag LOCUS_13480 gene iorA 16168 14429 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_13480 17827 16190 gene locus_tag LOCUS_13490 17827 16190 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_13490 18369 18037 gene locus_tag LOCUS_13500 gene azlD 18369 18037 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_13500 19076 18366 gene locus_tag LOCUS_13510 gene azlC 19076 18366 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_13510 22433 19287 gene locus_tag LOCUS_13520 gene ileS 22433 19287 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_13520 23088 24872 gene locus_tag LOCUS_13530 23088 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 25200 25006 gene locus_tag LOCUS_13540 25200 25006 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_13540 25396 26322 gene locus_tag LOCUS_13550 gene cysK 25396 26322 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762272.1 protein_id gnl|my_center|LOCUS_13550 26342 26752 gene locus_tag LOCUS_13560 26342 26752 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_13560 27000 28310 gene locus_tag LOCUS_13570 27000 28310 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_13570 28313 28777 gene locus_tag LOCUS_13580 28313 28777 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_13580 28851 29504 gene locus_tag LOCUS_13590 28851 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 29651 31774 gene locus_tag LOCUS_13600 29651 31774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 31780 32481 gene locus_tag LOCUS_13610 31780 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 32483 33151 gene locus_tag LOCUS_13620 32483 33151 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_13620 34698 33208 gene locus_tag LOCUS_13630 34698 33208 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_13630 35524 34868 gene locus_tag LOCUS_13640 35524 34868 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_13640 35659 37638 gene locus_tag LOCUS_13650 35659 37638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 39712 37700 gene locus_tag LOCUS_13660 39712 37700 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_13660 40085 39705 gene locus_tag LOCUS_13670 40085 39705 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_13670 40249 40800 gene locus_tag LOCUS_13680 40249 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 42436 41090 gene locus_tag LOCUS_13690 42436 41090 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_13690 43191 42448 gene locus_tag LOCUS_13700 43191 42448 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_13700 43342 43428 gene locus_tag LOCUS_t00240 43342 43428 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43987 44793 gene locus_tag LOCUS_13710 43987 44793 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_13710 44771 45556 gene locus_tag LOCUS_13720 44771 45556 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_13720 45553 46869 gene locus_tag LOCUS_13730 45553 46869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 48545 46944 gene locus_tag LOCUS_13740 48545 46944 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_13740 49418 48558 gene locus_tag LOCUS_13750 49418 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 50902 49496 gene locus_tag LOCUS_13760 50902 49496 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_13760 52580 50994 gene locus_tag LOCUS_13770 52580 50994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 53652 52585 gene locus_tag LOCUS_13780 gene prfA 53652 52585 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_13780 53880 53695 gene locus_tag LOCUS_13790 53880 53695 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583198.1 protein_id gnl|my_center|LOCUS_13790 54050 54976 gene locus_tag LOCUS_13800 54050 54976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 55090 55947 gene locus_tag LOCUS_13810 55090 55947 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_13810 55963 56508 gene locus_tag LOCUS_13820 55963 56508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence15 1859 2077 gene locus_tag LOCUS_13830 1859 2077 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_13830 2819 2166 gene locus_tag LOCUS_13840 2819 2166 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_13840 3903 2926 gene locus_tag LOCUS_13850 3903 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4220 3927 gene locus_tag LOCUS_13860 4220 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5766 4249 gene locus_tag LOCUS_13870 5766 4249 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_13870 6446 5763 gene locus_tag LOCUS_13880 6446 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7709 6447 gene locus_tag LOCUS_13890 7709 6447 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_13890 8451 7699 gene locus_tag LOCUS_13900 8451 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9460 8444 gene locus_tag LOCUS_13910 9460 8444 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_13910 10475 9453 gene locus_tag LOCUS_13920 10475 9453 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_13920 10609 11703 gene locus_tag LOCUS_13930 10609 11703 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 protein_id gnl|my_center|LOCUS_13930 12198 12959 gene locus_tag LOCUS_13940 12198 12959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_13940 12959 15046 gene locus_tag LOCUS_13950 12959 15046 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_13950 15049 15522 gene locus_tag LOCUS_13960 15049 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 15519 15671 gene locus_tag LOCUS_13970 15519 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 17244 15835 gene locus_tag LOCUS_13980 17244 15835 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_13980 17912 17241 gene locus_tag LOCUS_13990 17912 17241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_13990 18642 18043 gene locus_tag LOCUS_14000 18642 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 18859 26796 gene locus_tag LOCUS_14010 18859 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 27385 27302 gene locus_tag LOCUS_t00250 27385 27302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27653 29074 gene locus_tag LOCUS_14020 27653 29074 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_14020 29237 29908 gene locus_tag LOCUS_14030 29237 29908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_14030 30058 30906 gene locus_tag LOCUS_14040 30058 30906 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_14040 32582 31605 gene locus_tag LOCUS_14050 32582 31605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_14050 33688 32582 gene locus_tag LOCUS_14060 33688 32582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_14060 35216 33681 gene locus_tag LOCUS_14070 35216 33681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_14070 36952 35714 gene locus_tag LOCUS_14080 36952 35714 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_14080 37577 37002 gene locus_tag LOCUS_14090 37577 37002 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_14090 38128 38841 gene locus_tag LOCUS_14100 38128 38841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_14100 39018 40811 gene locus_tag LOCUS_14110 gene glmS 39018 40811 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_14110 41130 42275 gene locus_tag LOCUS_14120 41130 42275 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_14120 42643 43578 gene locus_tag LOCUS_14130 42643 43578 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_14130 43922 45295 gene locus_tag LOCUS_14140 gene asnS 43922 45295 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_14140 45314 46321 gene locus_tag LOCUS_14150 gene asnA 45314 46321 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_14150 46692 46432 gene locus_tag LOCUS_14160 46692 46432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 48089 46689 gene locus_tag LOCUS_14170 gene atpD 48089 46689 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_14170 48914 48111 gene locus_tag LOCUS_14180 gene atpG 48914 48111 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_14180 50413 48920 gene locus_tag LOCUS_14190 gene atpA 50413 48920 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_14190 50940 50410 gene locus_tag LOCUS_14200 gene atpH 50940 50410 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_14200 51439 50924 gene locus_tag LOCUS_14210 51439 50924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 51743 51462 gene locus_tag LOCUS_14220 51743 51462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 52671 51763 gene locus_tag LOCUS_14230 52671 51763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 53085 52702 gene locus_tag LOCUS_14240 53085 52702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 53578 53285 gene locus_tag LOCUS_14250 53578 53285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 53839 53594 gene locus_tag LOCUS_14260 53839 53594 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_14260 54760 53942 gene locus_tag LOCUS_14270 54760 53942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 <55519 54829 gene locus_tag LOCUS_14280 <55519 54829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109303.1:DUF262 domain-containing protein >Feature sequence16 6951 6220 gene locus_tag LOCUS_14290 6951 6220 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_14290 7693 6914 gene locus_tag LOCUS_14300 gene capA 7693 6914 CDS product capsular polysaccharide type 5/8 biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446299.1 protein_id gnl|my_center|LOCUS_14300 8017 9150 gene locus_tag LOCUS_14310 8017 9150 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_14310 9191 10369 gene locus_tag LOCUS_14320 gene thiI 9191 10369 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_14320 10371 11612 gene locus_tag LOCUS_14330 10371 11612 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_14330 11624 12766 gene locus_tag LOCUS_14340 11624 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 12788 13294 gene locus_tag LOCUS_14350 12788 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 13316 14236 gene locus_tag LOCUS_14360 gene srtB 13316 14236 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_14360 14258 15343 gene locus_tag LOCUS_14370 14258 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 15356 16258 gene locus_tag LOCUS_14380 15356 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 17086 16304 gene locus_tag LOCUS_14390 17086 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 18923 17190 gene locus_tag LOCUS_14400 18923 17190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_14400 20696 18927 gene locus_tag LOCUS_14410 20696 18927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_14410 21437 20820 gene locus_tag LOCUS_14420 21437 20820 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_14420 21695 21955 gene locus_tag LOCUS_14430 21695 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 21945 22835 gene locus_tag LOCUS_14440 21945 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 23292 22903 gene locus_tag LOCUS_14450 23292 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 23491 24282 gene locus_tag LOCUS_14460 23491 24282 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_14460 24415 24930 gene locus_tag LOCUS_14470 24415 24930 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_14470 24931 26016 gene locus_tag LOCUS_14480 24931 26016 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_14480 26990 26064 gene locus_tag LOCUS_14490 26990 26064 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_14490 27156 27617 gene locus_tag LOCUS_14500 gene nrdR 27156 27617 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_14500 27633 28601 gene locus_tag LOCUS_14510 27633 28601 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_14510 28649 29923 gene locus_tag LOCUS_14520 28649 29923 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_14520 29928 31628 gene locus_tag LOCUS_14530 29928 31628 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_14530 31674 32084 gene locus_tag LOCUS_14540 31674 32084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 32141 33775 gene locus_tag LOCUS_14550 32141 33775 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_14550 33851 35446 gene locus_tag LOCUS_14560 33851 35446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 36259 35567 gene locus_tag LOCUS_14570 36259 35567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 37045 36374 gene locus_tag LOCUS_14580 37045 36374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 38586 37042 gene locus_tag LOCUS_14590 38586 37042 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_14590 38799 39707 gene locus_tag LOCUS_14600 38799 39707 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710555.1 protein_id gnl|my_center|LOCUS_14600 40834 39764 gene locus_tag LOCUS_14610 40834 39764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 41159 41284 gene locus_tag LOCUS_14620 41159 41284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 41483 41617 gene locus_tag LOCUS_14630 41483 41617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 41767 42018 gene locus_tag LOCUS_14640 41767 42018 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_14640 43380 42079 gene locus_tag LOCUS_14650 43380 42079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 43516 43908 gene locus_tag LOCUS_14660 43516 43908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 44087 45421 gene locus_tag LOCUS_14670 44087 45421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 45606 46433 gene locus_tag LOCUS_14680 45606 46433 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_14680 46447 47616 gene locus_tag LOCUS_14690 46447 47616 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_14690 47739 48908 gene locus_tag LOCUS_14700 47739 48908 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_14700 49024 49515 gene locus_tag LOCUS_14710 49024 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 49617 50867 gene locus_tag LOCUS_14720 49617 50867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 51746 51117 gene locus_tag LOCUS_14730 gene upp 51746 51117 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_14730 52216 51764 gene locus_tag LOCUS_14740 gene rpiB 52216 51764 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_14740 52922 52221 gene locus_tag LOCUS_14750 gene tsaB 52922 52221 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_14750 53353 52919 gene locus_tag LOCUS_14760 gene tsaE 53353 52919 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_14760 <54859 53581 gene locus_tag LOCUS_14770 <54859 53581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964665.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG >Feature sequence17 1121 267 gene locus_tag LOCUS_14780 1121 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1308 3329 gene locus_tag LOCUS_14790 1308 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3338 4351 gene locus_tag LOCUS_14800 3338 4351 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_14800 4356 5426 gene locus_tag LOCUS_14810 gene uxuA 4356 5426 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_14810 5431 6282 gene locus_tag LOCUS_14820 5431 6282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_14820 6298 7290 gene locus_tag LOCUS_14830 6298 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 7287 8303 gene locus_tag LOCUS_14840 7287 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8293 9390 gene locus_tag LOCUS_14850 8293 9390 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_14850 9404 12481 gene locus_tag LOCUS_14860 9404 12481 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_14860 12493 13134 gene locus_tag LOCUS_14870 12493 13134 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391958.1 protein_id gnl|my_center|LOCUS_14870 13162 14433 gene locus_tag LOCUS_14880 gene obgE 13162 14433 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_14880 14439 14831 gene locus_tag LOCUS_14890 14439 14831 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_14890 14843 15760 gene locus_tag LOCUS_14900 14843 15760 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 protein_id gnl|my_center|LOCUS_14900 15975 17600 gene locus_tag LOCUS_14910 15975 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 18726 17776 gene locus_tag LOCUS_14920 18726 17776 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584146.1 protein_id gnl|my_center|LOCUS_14920 18923 19651 gene locus_tag LOCUS_14930 18923 19651 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_14930 19966 20238 gene locus_tag LOCUS_14940 19966 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 20382 20606 gene locus_tag LOCUS_14950 20382 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20633 21016 gene locus_tag LOCUS_14960 20633 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 21653 21060 gene locus_tag LOCUS_14970 21653 21060 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_14970 22769 21933 gene locus_tag LOCUS_14980 22769 21933 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_14980 22913 23773 gene locus_tag LOCUS_14990 22913 23773 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_14990 23795 24226 gene locus_tag LOCUS_15000 23795 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 24251 24568 gene locus_tag LOCUS_15010 24251 24568 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014077.1 protein_id gnl|my_center|LOCUS_15010 25653 24613 gene locus_tag LOCUS_15020 25653 24613 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_15020 26728 25667 gene locus_tag LOCUS_15030 26728 25667 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_15030 27035 26742 gene locus_tag LOCUS_15040 27035 26742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 30266 27090 gene locus_tag LOCUS_15050 30266 27090 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_15050 31773 30415 gene locus_tag LOCUS_15060 31773 30415 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_15060 31841 32182 gene locus_tag LOCUS_15070 31841 32182 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_15070 32259 32633 gene locus_tag LOCUS_15080 32259 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 32803 33096 gene locus_tag LOCUS_15090 32803 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 33083 33739 gene locus_tag LOCUS_15100 33083 33739 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_15100 33831 35147 gene locus_tag LOCUS_15110 33831 35147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 35153 35383 gene locus_tag LOCUS_15120 35153 35383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 36182 35604 gene locus_tag LOCUS_15130 36182 35604 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_15130 36978 36175 gene locus_tag LOCUS_15140 gene dpsA 36978 36175 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_15140 37152 38531 gene locus_tag LOCUS_15150 gene murC 37152 38531 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_15150 38743 38883 gene locus_tag LOCUS_15160 38743 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 39172 40962 gene locus_tag LOCUS_15170 39172 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 41122 43773 gene locus_tag LOCUS_15180 41122 43773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 43801 45339 gene locus_tag LOCUS_15190 43801 45339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 45358 45954 gene locus_tag LOCUS_15200 45358 45954 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_15200 46304 48793 gene locus_tag LOCUS_15210 46304 48793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 50106 48892 gene locus_tag LOCUS_15220 50106 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 50413 50093 gene locus_tag LOCUS_15230 50413 50093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 50530 51069 gene locus_tag LOCUS_15240 50530 51069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 51399 51662 gene locus_tag LOCUS_15250 gene rpsO 51399 51662 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354983.1 protein_id gnl|my_center|LOCUS_15250 51850 54045 gene locus_tag LOCUS_15260 gene pnp 51850 54045 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence18 397 948 gene locus_tag LOCUS_15270 397 948 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309892.1 protein_id gnl|my_center|LOCUS_15270 4109 1029 gene locus_tag LOCUS_15280 4109 1029 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_15280 5459 4443 gene locus_tag LOCUS_15290 5459 4443 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892759.1 protein_id gnl|my_center|LOCUS_15290 6765 5476 gene locus_tag LOCUS_15300 6765 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9178 6851 gene locus_tag LOCUS_15310 9178 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9897 9193 gene locus_tag LOCUS_15320 9897 9193 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101843.1 protein_id gnl|my_center|LOCUS_15320 10084 10866 gene locus_tag LOCUS_15330 10084 10866 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_15330 10869 11498 gene locus_tag LOCUS_15340 10869 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 11997 13943 gene locus_tag LOCUS_15350 gene metG 11997 13943 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_15350 13943 14710 gene locus_tag LOCUS_15360 13943 14710 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_15360 15906 14896 gene locus_tag LOCUS_15370 15906 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 16103 17773 gene locus_tag LOCUS_15380 16103 17773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 19277 17841 gene locus_tag LOCUS_15390 gene proS 19277 17841 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_15390 19535 19299 gene locus_tag LOCUS_15400 gene acpP 19535 19299 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_15400 20890 19925 gene locus_tag LOCUS_15410 gene dusB 20890 19925 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_15410 22062 21088 gene locus_tag LOCUS_15420 gene bsh 22062 21088 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_15420 22549 22082 gene locus_tag LOCUS_15430 22549 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 23877 22570 gene locus_tag LOCUS_15440 23877 22570 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_15440 24344 24874 gene locus_tag LOCUS_15450 24344 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 25236 25493 gene locus_tag LOCUS_15460 25236 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 25889 27118 gene locus_tag LOCUS_15470 25889 27118 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_15470 27142 28512 gene locus_tag LOCUS_15480 gene argH 27142 28512 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_15480 28635 29618 gene locus_tag LOCUS_15490 gene argF 28635 29618 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_15490 29615 30700 gene locus_tag LOCUS_15500 gene carA 29615 30700 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_15500 30687 34739 gene locus_tag LOCUS_15510 gene carB 30687 34739 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_15510 35414 34890 gene locus_tag LOCUS_15520 35414 34890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 35605 36579 gene locus_tag LOCUS_15530 35605 36579 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_15530 36682 38226 gene locus_tag LOCUS_15540 36682 38226 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_15540 38239 38721 gene locus_tag LOCUS_15550 38239 38721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 39563 38970 gene locus_tag LOCUS_15560 39563 38970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 39806 40153 gene locus_tag LOCUS_15570 39806 40153 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_15570 41720 40197 gene locus_tag LOCUS_15580 41720 40197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849428.1 protein_id gnl|my_center|LOCUS_15580 41887 43512 gene locus_tag LOCUS_15590 41887 43512 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_15590 44327 43554 gene locus_tag LOCUS_15600 44327 43554 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_15600 45853 44330 gene locus_tag LOCUS_15610 45853 44330 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_15610 47796 45886 gene locus_tag LOCUS_15620 47796 45886 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_15620 48617 47913 gene locus_tag LOCUS_15630 48617 47913 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_15630 49046 50344 gene locus_tag LOCUS_15640 49046 50344 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_15640 50435 51220 gene locus_tag LOCUS_15650 50435 51220 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_15650 51220 51702 gene locus_tag LOCUS_15660 gene rlmH 51220 51702 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence19 1207 548 gene locus_tag LOCUS_15670 1207 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3302 1965 gene locus_tag LOCUS_15680 3302 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4032 3316 gene locus_tag LOCUS_15690 gene rgbR 4032 3316 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_15690 4254 5390 gene locus_tag LOCUS_15700 4254 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5387 10372 gene locus_tag LOCUS_15710 5387 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10432 11013 gene locus_tag LOCUS_15720 10432 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 11025 13898 gene locus_tag LOCUS_15730 11025 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 15012 18803 gene locus_tag LOCUS_15740 15012 18803 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_15740 18972 19307 gene locus_tag LOCUS_15750 18972 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 19582 19779 gene locus_tag LOCUS_15760 19582 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 20863 19889 gene locus_tag LOCUS_15770 20863 19889 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_15770 21044 21643 gene locus_tag LOCUS_15780 21044 21643 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_15780 21656 22210 gene locus_tag LOCUS_15790 21656 22210 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_15790 22226 25705 gene locus_tag LOCUS_15800 gene brxC 22226 25705 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_15800 26006 28660 gene locus_tag LOCUS_15810 26006 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 28684 29262 gene locus_tag LOCUS_15820 28684 29262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 29426 30367 gene locus_tag LOCUS_15830 29426 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 30408 31073 gene locus_tag LOCUS_15840 30408 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 31097 33670 gene locus_tag LOCUS_15850 gene pglZ 31097 33670 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_15850 33687 35813 gene locus_tag LOCUS_15860 gene brxL 33687 35813 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459233.1 protein_id gnl|my_center|LOCUS_15860 35816 38494 gene locus_tag LOCUS_15870 35816 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence20 331 558 gene locus_tag LOCUS_15880 331 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 833 760 gene locus_tag LOCUS_t00260 833 760 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1577 906 gene locus_tag LOCUS_15890 1577 906 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_15890 1777 3243 gene locus_tag LOCUS_15900 1777 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3269 4147 gene locus_tag LOCUS_15910 gene metF 3269 4147 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_15910 4152 4751 gene locus_tag LOCUS_15920 4152 4751 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_15920 4766 7138 gene locus_tag LOCUS_15930 4766 7138 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_15930 9242 7203 gene locus_tag LOCUS_15940 gene fusA 9242 7203 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_15940 11791 9470 gene locus_tag LOCUS_15950 11791 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 11959 12168 gene locus_tag LOCUS_15960 11959 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 12337 14052 gene locus_tag LOCUS_15970 12337 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 14303 14812 gene locus_tag LOCUS_15980 gene rplJ 14303 14812 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273085.1 protein_id gnl|my_center|LOCUS_15980 14868 15239 gene locus_tag LOCUS_15990 gene rplL 14868 15239 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_15990 15993 15301 gene locus_tag LOCUS_16000 15993 15301 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_16000 16088 16255 gene locus_tag LOCUS_16010 16088 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 17578 16355 gene locus_tag LOCUS_16020 17578 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 19171 17678 gene locus_tag LOCUS_16030 gene thrC 19171 17678 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_16030 19619 19254 gene locus_tag LOCUS_16040 19619 19254 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_16040 20229 19606 gene locus_tag LOCUS_16050 20229 19606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 21379 20510 gene locus_tag LOCUS_16060 gene ylqF 21379 20510 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_16060 22030 21449 gene locus_tag LOCUS_16070 gene lepB 22030 21449 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_16070 22660 22034 gene locus_tag LOCUS_16080 gene lepB 22660 22034 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_16080 23128 22781 gene locus_tag LOCUS_16090 gene rplS 23128 22781 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_16090 25013 23379 gene locus_tag LOCUS_16100 25013 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 25703 25029 gene locus_tag LOCUS_16110 25703 25029 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_16110 27534 25684 gene locus_tag LOCUS_16120 27534 25684 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_16120 28245 27559 gene locus_tag LOCUS_16130 28245 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 28772 29449 gene locus_tag LOCUS_16140 28772 29449 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_16140 29475 30134 gene locus_tag LOCUS_16150 29475 30134 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_16150 30329 32431 gene locus_tag LOCUS_16160 30329 32431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 32639 33091 gene locus_tag LOCUS_16170 32639 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 34403 33138 gene locus_tag LOCUS_16180 gene clpX 34403 33138 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_16180 35000 34419 gene locus_tag LOCUS_16190 gene clpP 35000 34419 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_16190 36463 35111 gene locus_tag LOCUS_16200 gene tig 36463 35111 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_16200 37085 38461 gene locus_tag LOCUS_16210 37085 38461 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_16210 38671 39324 gene locus_tag LOCUS_16220 gene thiT 38671 39324 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_16220 40487 39378 gene locus_tag LOCUS_16230 40487 39378 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011190792.1 protein_id gnl|my_center|LOCUS_16230 41787 40516 gene locus_tag LOCUS_16240 41787 40516 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_16240 41917 43302 gene locus_tag LOCUS_16250 41917 43302 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_16250 43510 43938 gene locus_tag LOCUS_16260 gene rplM 43510 43938 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_16260 43957 44355 gene locus_tag LOCUS_16270 gene rpsI 43957 44355 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence21 529 867 gene locus_tag LOCUS_16280 529 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2145 1033 gene locus_tag LOCUS_16290 2145 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4235 2352 gene locus_tag LOCUS_16300 gene htpG 4235 2352 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_16300 7732 4577 gene locus_tag LOCUS_16310 7732 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8188 9255 gene locus_tag LOCUS_16320 8188 9255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_16320 9274 9999 gene locus_tag LOCUS_16330 gene nagB 9274 9999 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 protein_id gnl|my_center|LOCUS_16330 13736 10122 gene locus_tag LOCUS_16340 gene rpoC 13736 10122 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_16340 17547 13819 gene locus_tag LOCUS_16350 gene rpoB 17547 13819 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_16350 17874 19406 gene locus_tag LOCUS_16360 gene uidB 17874 19406 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075831.1 protein_id gnl|my_center|LOCUS_16360 20043 19459 gene locus_tag LOCUS_16370 20043 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 21693 20674 gene locus_tag LOCUS_16380 21693 20674 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_16380 22888 21719 gene locus_tag LOCUS_16390 22888 21719 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_16390 24024 22915 gene locus_tag LOCUS_16400 24024 22915 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_16400 25588 24077 gene locus_tag LOCUS_16410 gene glpK 25588 24077 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_16410 26331 27362 gene locus_tag LOCUS_16420 26331 27362 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_16420 27359 27730 gene locus_tag LOCUS_16430 27359 27730 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_16430 27732 28256 gene locus_tag LOCUS_16440 27732 28256 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_16440 28292 29644 gene locus_tag LOCUS_16450 gene rsxC 28292 29644 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_16450 29641 30636 gene locus_tag LOCUS_16460 29641 30636 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_16460 30633 31193 gene locus_tag LOCUS_16470 30633 31193 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_16470 31193 31939 gene locus_tag LOCUS_16480 31193 31939 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_16480 31939 32538 gene locus_tag LOCUS_16490 gene rsxA 31939 32538 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_16490 32551 33351 gene locus_tag LOCUS_16500 32551 33351 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_16500 34326 33907 gene locus_tag LOCUS_16510 34326 33907 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_16510 35240 34323 gene locus_tag LOCUS_16520 gene pyrB 35240 34323 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_16520 35884 35237 gene locus_tag LOCUS_16530 gene pyrE 35884 35237 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_16530 36595 35897 gene locus_tag LOCUS_16540 gene pyrF 36595 35897 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_16540 37502 36588 gene locus_tag LOCUS_16550 37502 36588 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_16550 38227 37496 gene locus_tag LOCUS_16560 38227 37496 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_16560 39492 38224 gene locus_tag LOCUS_16570 39492 38224 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence22 3115 3201 gene locus_tag LOCUS_t00270 3115 3201 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4199 3420 gene locus_tag LOCUS_16580 4199 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 6062 4545 gene locus_tag LOCUS_16590 gene malQ 6062 4545 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_16590 6248 6769 gene locus_tag LOCUS_16600 6248 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7483 6830 gene locus_tag LOCUS_16610 7483 6830 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_16610 8495 7605 gene locus_tag LOCUS_16620 8495 7605 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_16620 10860 8479 gene locus_tag LOCUS_16630 10860 8479 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_16630 11638 10889 gene locus_tag LOCUS_16640 gene recO 11638 10889 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_16640 11744 11583 gene locus_tag LOCUS_16650 11744 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 12731 11844 gene locus_tag LOCUS_16660 gene era 12731 11844 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_16660 13237 12731 gene locus_tag LOCUS_16670 gene ybeY 13237 12731 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_16670 14199 13234 gene locus_tag LOCUS_16680 14199 13234 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16680 14423 14716 gene locus_tag LOCUS_16690 14423 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 14766 15731 gene locus_tag LOCUS_16700 14766 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 17321 15951 gene locus_tag LOCUS_16710 17321 15951 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_16710 18499 17807 gene locus_tag LOCUS_16720 18499 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 19075 18536 gene locus_tag LOCUS_16730 19075 18536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 19354 21018 gene locus_tag LOCUS_16740 19354 21018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 21015 22265 gene locus_tag LOCUS_16750 21015 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 22262 22891 gene locus_tag LOCUS_16760 22262 22891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_16760 23069 23452 gene locus_tag LOCUS_16770 23069 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 23498 24394 gene locus_tag LOCUS_16780 23498 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 24531 25172 gene locus_tag LOCUS_16790 24531 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 25198 26283 gene locus_tag LOCUS_16800 25198 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 26324 26767 gene locus_tag LOCUS_16810 26324 26767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 26816 27460 gene locus_tag LOCUS_16820 26816 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 27491 28147 gene locus_tag LOCUS_16830 27491 28147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 28212 28742 gene locus_tag LOCUS_16840 28212 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 28758 30053 gene locus_tag LOCUS_16850 28758 30053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 30115 30240 gene locus_tag LOCUS_16860 30115 30240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 30292 30684 gene locus_tag LOCUS_16870 30292 30684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 31981 30968 gene locus_tag LOCUS_16880 31981 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 32141 32719 gene locus_tag LOCUS_16890 32141 32719 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_16890 35232 32716 gene locus_tag LOCUS_16900 35232 32716 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_16900 36685 35219 gene locus_tag LOCUS_16910 36685 35219 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_16910 36892 36704 gene locus_tag LOCUS_16920 36892 36704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 37479 37252 gene locus_tag LOCUS_16930 37479 37252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 38134 37664 gene locus_tag LOCUS_16940 38134 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence23 441 1658 gene locus_tag LOCUS_16950 441 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1679 2740 gene locus_tag LOCUS_16960 1679 2740 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_16960 3927 4226 gene locus_tag LOCUS_16970 3927 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4449 5135 gene locus_tag LOCUS_16980 4449 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5229 5621 gene locus_tag LOCUS_16990 5229 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6770 5556 gene locus_tag LOCUS_17000 6770 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 7962 6772 gene locus_tag LOCUS_17010 7962 6772 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_17010 8045 8296 gene locus_tag LOCUS_17020 8045 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 8293 8544 gene locus_tag LOCUS_17030 8293 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 10054 8888 gene locus_tag LOCUS_17040 gene ftsZ 10054 8888 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_17040 11256 10255 gene locus_tag LOCUS_17050 11256 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 12512 11259 gene locus_tag LOCUS_17060 gene murA 12512 11259 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_17060 13701 12574 gene locus_tag LOCUS_17070 gene murG 13701 12574 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_17070 14935 13694 gene locus_tag LOCUS_17080 gene spoVE 14935 13694 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_17080 16390 15359 gene locus_tag LOCUS_17090 gene mraY 16390 15359 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_17090 17769 16414 gene locus_tag LOCUS_17100 17769 16414 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_17100 19208 17766 gene locus_tag LOCUS_17110 19208 17766 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_17110 21529 19247 gene locus_tag LOCUS_17120 21529 19247 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_17120 22126 21647 gene locus_tag LOCUS_17130 22126 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 23109 22186 gene locus_tag LOCUS_17140 gene rsmH 23109 22186 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_17140 23528 23109 gene locus_tag LOCUS_17150 gene mraZ 23528 23109 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052541.1 protein_id gnl|my_center|LOCUS_17150 23798 25096 gene locus_tag LOCUS_17160 23798 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 25097 25987 gene locus_tag LOCUS_17170 25097 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 28865 26043 gene locus_tag LOCUS_17180 gene uvrA 28865 26043 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_17180 30820 28865 gene locus_tag LOCUS_17190 gene uvrB 30820 28865 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_17190 31372 30977 gene locus_tag LOCUS_17200 31372 30977 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_17200 32317 31391 gene locus_tag LOCUS_17210 gene cysK 32317 31391 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_17210 33325 32690 gene locus_tag LOCUS_17220 33325 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 34508 33684 gene locus_tag LOCUS_17230 gene rsmI 34508 33684 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_17230 35239 34505 gene locus_tag LOCUS_17240 35239 34505 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_17240 36093 35323 gene locus_tag LOCUS_17250 36093 35323 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_17250 36533 36093 gene locus_tag LOCUS_17260 36533 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 36745 37071 gene locus_tag LOCUS_17270 36745 37071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 37129 38316 gene locus_tag LOCUS_17280 37129 38316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence24 1460 213 gene locus_tag LOCUS_17290 gene hflX 1460 213 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812294.1 protein_id gnl|my_center|LOCUS_17290 2474 1464 gene locus_tag LOCUS_17300 gene galE 2474 1464 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_17300 2561 3421 gene locus_tag LOCUS_17310 gene rsmA 2561 3421 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_17310 4041 3607 gene locus_tag LOCUS_17320 4041 3607 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935678.1 protein_id gnl|my_center|LOCUS_17320 4883 4062 gene locus_tag LOCUS_17330 4883 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 5386 4937 gene locus_tag LOCUS_17340 gene tadA 5386 4937 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_17340 6580 5399 gene locus_tag LOCUS_17350 6580 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6753 8492 gene locus_tag LOCUS_17360 6753 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_17360 9014 8697 gene locus_tag LOCUS_17370 9014 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9143 10153 gene locus_tag LOCUS_17380 9143 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 10748 10164 gene locus_tag LOCUS_17390 gene sigE 10748 10164 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_17390 11730 10693 gene locus_tag LOCUS_17400 gene spoIIGA 11730 10693 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_17400 12855 11842 gene locus_tag LOCUS_17410 12855 11842 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 protein_id gnl|my_center|LOCUS_17410 13034 13345 gene locus_tag LOCUS_17420 13034 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 13413 14459 gene locus_tag LOCUS_17430 13413 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 14471 16483 gene locus_tag LOCUS_17440 14471 16483 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_17440 16502 16975 gene locus_tag LOCUS_17450 16502 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 16985 17290 gene locus_tag LOCUS_17460 16985 17290 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_17460 17321 17908 gene locus_tag LOCUS_17470 17321 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 17926 19692 gene locus_tag LOCUS_17480 17926 19692 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_17480 19689 21059 gene locus_tag LOCUS_17490 19689 21059 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_17490 21092 21703 gene locus_tag LOCUS_17500 21092 21703 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_17500 21706 22251 gene locus_tag LOCUS_17510 21706 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 24844 22298 gene locus_tag LOCUS_17520 24844 22298 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_17520 25092 24937 gene locus_tag LOCUS_17530 25092 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 27434 25092 gene locus_tag LOCUS_17540 gene feoB 27434 25092 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_17540 28986 27559 gene locus_tag LOCUS_17550 28986 27559 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_17550 29121 29996 gene locus_tag LOCUS_17560 29121 29996 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_17560 30793 30134 gene locus_tag LOCUS_17570 30793 30134 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102032.1 protein_id gnl|my_center|LOCUS_17570 30950 32038 gene locus_tag LOCUS_17580 30950 32038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_17580 32064 32462 gene locus_tag LOCUS_17590 32064 32462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 32475 34310 gene locus_tag LOCUS_17600 32475 34310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 34568 34924 gene locus_tag LOCUS_17610 34568 34924 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_17610 37224 34948 gene locus_tag LOCUS_17620 37224 34948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence25 164 240 gene locus_tag LOCUS_t00280 164 240 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 885 490 gene locus_tag LOCUS_17630 885 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1961 1260 gene locus_tag LOCUS_17640 1961 1260 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_17640 2817 1972 gene locus_tag LOCUS_17650 2817 1972 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_17650 3997 2960 gene locus_tag LOCUS_17660 gene gap 3997 2960 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_17660 4305 5180 gene locus_tag LOCUS_17670 4305 5180 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_17670 5238 5915 gene locus_tag LOCUS_17680 5238 5915 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_17680 5912 6289 gene locus_tag LOCUS_17690 5912 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 6348 6779 gene locus_tag LOCUS_17700 6348 6779 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908545.1 protein_id gnl|my_center|LOCUS_17700 6776 7705 gene locus_tag LOCUS_17710 6776 7705 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_17710 9328 7775 gene locus_tag LOCUS_17720 9328 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10175 9393 gene locus_tag LOCUS_17730 10175 9393 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_17730 10848 10189 gene locus_tag LOCUS_17740 10848 10189 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120401.1 protein_id gnl|my_center|LOCUS_17740 11757 10936 gene locus_tag LOCUS_17750 11757 10936 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_17750 12196 11930 gene locus_tag LOCUS_17760 12196 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 12800 12267 gene locus_tag LOCUS_17770 12800 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 13431 12793 gene locus_tag LOCUS_17780 13431 12793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_17780 13640 13951 gene locus_tag LOCUS_17790 gene rplU 13640 13951 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_17790 13955 14278 gene locus_tag LOCUS_17800 13955 14278 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_17800 14271 14555 gene locus_tag LOCUS_17810 gene rpmA 14271 14555 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_17810 14681 15310 gene locus_tag LOCUS_17820 14681 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 15538 16245 gene locus_tag LOCUS_17830 15538 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 16742 16305 gene locus_tag LOCUS_17840 gene rnhA 16742 16305 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_17840 16976 18892 gene locus_tag LOCUS_17850 16976 18892 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_17850 18896 20890 gene locus_tag LOCUS_17860 18896 20890 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17860 20894 21337 gene locus_tag LOCUS_17870 gene rplI 20894 21337 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_17870 21359 22729 gene locus_tag LOCUS_17880 gene dnaB 21359 22729 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_17880 22719 24044 gene locus_tag LOCUS_17890 gene tilS 22719 24044 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_17890 24037 24579 gene locus_tag LOCUS_17900 gene hpt 24037 24579 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_17900 24595 26556 gene locus_tag LOCUS_17910 gene ftsH 24595 26556 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_17910 27180 26788 gene locus_tag LOCUS_17920 27180 26788 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_17920 27589 27170 gene locus_tag LOCUS_17930 27589 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 28238 27696 gene locus_tag LOCUS_17940 28238 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 28873 28700 gene locus_tag LOCUS_17950 28873 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 29403 28873 gene locus_tag LOCUS_17960 29403 28873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 29611 29408 gene locus_tag LOCUS_17970 29611 29408 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_17970 30103 29621 gene locus_tag LOCUS_17980 30103 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 31637 30441 gene locus_tag LOCUS_17990 gene rodA 31637 30441 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence26 913 50 gene locus_tag LOCUS_18000 913 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1275 1844 gene locus_tag LOCUS_18010 1275 1844 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_18010 1927 2002 gene locus_tag LOCUS_t00290 1927 2002 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3146 2142 gene locus_tag LOCUS_18020 3146 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3298 3567 gene locus_tag LOCUS_18030 3298 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3640 4746 gene locus_tag LOCUS_18040 3640 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 4867 6822 gene locus_tag LOCUS_18050 4867 6822 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285980.1 protein_id gnl|my_center|LOCUS_18050 8188 6947 gene locus_tag LOCUS_18060 8188 6947 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_18060 9128 8256 gene locus_tag LOCUS_18070 9128 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9387 9463 gene locus_tag LOCUS_t00300 9387 9463 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9467 9541 gene locus_tag LOCUS_t00310 9467 9541 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11040 9892 gene locus_tag LOCUS_18080 gene dnaJ 11040 9892 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_18080 12975 11113 gene locus_tag LOCUS_18090 gene dnaK 12975 11113 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_18090 13610 13053 gene locus_tag LOCUS_18100 13610 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 14654 13626 gene locus_tag LOCUS_18110 gene hrcA 14654 13626 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_18110 15136 15831 gene locus_tag LOCUS_18120 15136 15831 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_18120 16169 17560 gene locus_tag LOCUS_18130 16169 17560 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_18130 17607 17807 gene locus_tag LOCUS_18140 17607 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 17821 18135 gene locus_tag LOCUS_18150 gene trxA 17821 18135 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_18150 19397 18186 gene locus_tag LOCUS_18160 19397 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 21354 19417 gene locus_tag LOCUS_18170 21354 19417 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_18170 21529 23016 gene locus_tag LOCUS_18180 21529 23016 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_18180 23009 24583 gene locus_tag LOCUS_18190 23009 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 24585 25862 gene locus_tag LOCUS_18200 24585 25862 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_18200 26042 26521 gene locus_tag LOCUS_18210 26042 26521 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_18210 26637 27260 gene locus_tag LOCUS_18220 26637 27260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_18220 27331 29454 gene locus_tag LOCUS_18230 27331 29454 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_18230 29474 31147 gene locus_tag LOCUS_18240 29474 31147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence27 1084 1227 gene locus_tag LOCUS_18250 1084 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2076 1276 gene locus_tag LOCUS_18260 gene srtB 2076 1276 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_18260 3423 2113 gene locus_tag LOCUS_18270 3423 2113 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_18270 13060 3545 gene locus_tag LOCUS_18280 13060 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 14062 13097 gene locus_tag LOCUS_18290 14062 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 15424 14408 gene locus_tag LOCUS_18300 15424 14408 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_18300 16455 15445 gene locus_tag LOCUS_18310 16455 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 17566 16466 gene locus_tag LOCUS_18320 17566 16466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 18753 17572 gene locus_tag LOCUS_18330 18753 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 19942 18755 gene locus_tag LOCUS_18340 19942 18755 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_18340 21081 19945 gene locus_tag LOCUS_18350 21081 19945 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_18350 21768 21082 gene locus_tag LOCUS_18360 21768 21082 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_18360 22776 21787 gene locus_tag LOCUS_18370 22776 21787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 23480 22791 gene locus_tag LOCUS_18380 23480 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 24198 23506 gene locus_tag LOCUS_18390 24198 23506 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_18390 24959 24195 gene locus_tag LOCUS_18400 24959 24195 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 protein_id gnl|my_center|LOCUS_18400 25742 24975 gene locus_tag LOCUS_18410 25742 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 26608 25997 gene locus_tag LOCUS_18420 26608 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 27752 27231 gene locus_tag LOCUS_18430 27752 27231 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_18430 28375 28300 gene locus_tag LOCUS_t00320 28375 28300 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 28764 28655 gene locus_tag LOCUS_r00020 28764 28655 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 28881 28806 gene locus_tag LOCUS_t00330 28881 28806 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 28962 28887 gene locus_tag LOCUS_t00340 28962 28887 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 2435 1749 gene locus_tag LOCUS_18440 2435 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2962 3639 gene locus_tag LOCUS_18450 2962 3639 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_18450 3665 4324 gene locus_tag LOCUS_18460 3665 4324 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_18460 4519 6621 gene locus_tag LOCUS_18470 4519 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6829 7281 gene locus_tag LOCUS_18480 6829 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8593 7328 gene locus_tag LOCUS_18490 gene clpX 8593 7328 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_18490 9190 8609 gene locus_tag LOCUS_18500 gene clpP 9190 8609 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_18500 10653 9301 gene locus_tag LOCUS_18510 gene tig 10653 9301 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_18510 11275 12651 gene locus_tag LOCUS_18520 11275 12651 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_18520 12861 13514 gene locus_tag LOCUS_18530 gene thiT 12861 13514 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_18530 14677 13568 gene locus_tag LOCUS_18540 14677 13568 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011190792.1 protein_id gnl|my_center|LOCUS_18540 15977 14706 gene locus_tag LOCUS_18550 15977 14706 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_18550 16107 17492 gene locus_tag LOCUS_18560 16107 17492 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_18560 17700 18128 gene locus_tag LOCUS_18570 gene rplM 17700 18128 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_18570 18147 18545 gene locus_tag LOCUS_18580 gene rpsI 18147 18545 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_18580 20528 18996 gene locus_tag LOCUS_18590 20528 18996 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_18590 21794 20751 gene locus_tag LOCUS_18600 21794 20751 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 protein_id gnl|my_center|LOCUS_18600 22316 21798 gene locus_tag LOCUS_18610 22316 21798 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_18610 23750 22320 gene locus_tag LOCUS_18620 gene purB 23750 22320 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_18620 23878 24324 gene locus_tag LOCUS_18630 23878 24324 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_18630 24338 25153 gene locus_tag LOCUS_18640 24338 25153 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_18640 27073 25250 gene locus_tag LOCUS_18650 27073 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence29 1288 989 gene locus_tag LOCUS_18660 1288 989 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_18660 3009 1432 gene locus_tag LOCUS_18670 gene asnB 3009 1432 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_18670 5474 3378 gene locus_tag LOCUS_18680 5474 3378 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_18680 6502 5921 gene locus_tag LOCUS_18690 6502 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6735 7826 gene locus_tag LOCUS_18700 6735 7826 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_18700 7826 9331 gene locus_tag LOCUS_18710 7826 9331 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_18710 9399 10118 gene locus_tag LOCUS_18720 9399 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_18720 10137 11345 gene locus_tag LOCUS_18730 gene glnA 10137 11345 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_18730 11409 11993 gene locus_tag LOCUS_18740 11409 11993 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894637.1 protein_id gnl|my_center|LOCUS_18740 12008 13615 gene locus_tag LOCUS_18750 12008 13615 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_18750 15102 14023 gene locus_tag LOCUS_18760 15102 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 16142 15417 gene locus_tag LOCUS_18770 16142 15417 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_18770 17341 16163 gene locus_tag LOCUS_18780 17341 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 17465 17553 gene locus_tag LOCUS_t00350 17465 17553 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17618 17708 gene locus_tag LOCUS_t00360 17618 17708 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17902 19332 gene locus_tag LOCUS_18790 17902 19332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_18790 19343 20596 gene locus_tag LOCUS_18800 19343 20596 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 protein_id gnl|my_center|LOCUS_18800 20600 20965 gene locus_tag LOCUS_18810 20600 20965 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_18810 22257 21295 gene locus_tag LOCUS_18820 22257 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 22863 22264 gene locus_tag LOCUS_18830 22863 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 23350 23204 gene locus_tag LOCUS_18840 23350 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 23498 24175 gene locus_tag LOCUS_18850 23498 24175 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_18850 24280 25299 gene locus_tag LOCUS_18860 24280 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 25398 25841 gene locus_tag LOCUS_18870 25398 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence30 729 1907 gene locus_tag LOCUS_18880 gene metK 729 1907 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_18880 2202 3368 gene locus_tag LOCUS_18890 2202 3368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_18890 3540 4406 gene locus_tag LOCUS_18900 3540 4406 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_18900 4410 5549 gene locus_tag LOCUS_18910 4410 5549 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_18910 5552 6322 gene locus_tag LOCUS_18920 5552 6322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_18920 6327 7037 gene locus_tag LOCUS_18930 6327 7037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 protein_id gnl|my_center|LOCUS_18930 7360 9294 gene locus_tag LOCUS_18940 7360 9294 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_18940 9489 10658 gene locus_tag LOCUS_18950 9489 10658 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_18950 10677 11330 gene locus_tag LOCUS_18960 10677 11330 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_18960 11327 12082 gene locus_tag LOCUS_18970 11327 12082 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_18970 13927 12209 gene locus_tag LOCUS_18980 13927 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 16853 14214 gene locus_tag LOCUS_18990 gene ggaB 16853 14214 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_18990 17052 19106 gene locus_tag LOCUS_19000 17052 19106 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966642.1 protein_id gnl|my_center|LOCUS_19000 19425 19159 gene locus_tag LOCUS_19010 19425 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 20722 20039 gene locus_tag LOCUS_19020 gene sigK 20722 20039 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence31 118 561 gene locus_tag LOCUS_19030 118 561 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723740.1 protein_id gnl|my_center|LOCUS_19030 715 1560 gene locus_tag LOCUS_19040 715 1560 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_19040 1769 1539 gene locus_tag LOCUS_19050 1769 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2095 3210 gene locus_tag LOCUS_19060 2095 3210 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_19060 3229 4185 gene locus_tag LOCUS_19070 3229 4185 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_19070 4246 5991 gene locus_tag LOCUS_19080 4246 5991 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_19080 6625 6134 gene locus_tag LOCUS_19090 gene tnpA 6625 6134 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_19090 7987 6848 gene locus_tag LOCUS_19100 7987 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 10799 8058 gene locus_tag LOCUS_19110 gene secA 10799 8058 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_19110 11501 11001 gene locus_tag LOCUS_19120 11501 11001 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_19120 12787 11513 gene locus_tag LOCUS_19130 12787 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 13558 12800 gene locus_tag LOCUS_19140 13558 12800 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_19140 14173 15159 gene locus_tag LOCUS_19150 14173 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15334 16941 gene locus_tag LOCUS_19160 15334 16941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_19160 16972 17985 gene locus_tag LOCUS_19170 gene iolC 16972 17985 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 protein_id gnl|my_center|LOCUS_19170 18142 20073 gene locus_tag LOCUS_19180 gene iolD 18142 20073 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_19180 20126 21019 gene locus_tag LOCUS_19190 gene iolE 20126 21019 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_19190 21425 22933 gene locus_tag LOCUS_19200 21425 22933 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633345.1 protein_id gnl|my_center|LOCUS_19200 22952 23977 gene locus_tag LOCUS_19210 gene iolG 22952 23977 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence32 192 1487 gene locus_tag LOCUS_19220 192 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2583 1555 gene locus_tag LOCUS_19230 2583 1555 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_19230 3480 2608 gene locus_tag LOCUS_19240 3480 2608 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_19240 4687 3482 gene locus_tag LOCUS_19250 gene aroA 4687 3482 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_19250 5553 5101 gene locus_tag LOCUS_19260 gene aroQ 5553 5101 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_19260 6800 5550 gene locus_tag LOCUS_19270 6800 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7896 6805 gene locus_tag LOCUS_19280 gene aroC 7896 6805 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_19280 8915 7893 gene locus_tag LOCUS_19290 gene aroB 8915 7893 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289143.1 protein_id gnl|my_center|LOCUS_19290 10018 8915 gene locus_tag LOCUS_19300 gene pheA 10018 8915 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130282.1 protein_id gnl|my_center|LOCUS_19300 10597 11805 gene locus_tag LOCUS_19310 gene brnQ 10597 11805 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_19310 12280 11849 gene locus_tag LOCUS_19320 12280 11849 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_19320 13487 12282 gene locus_tag LOCUS_19330 gene ackA 13487 12282 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_19330 13619 14992 gene locus_tag LOCUS_19340 13619 14992 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_19340 15216 15974 gene locus_tag LOCUS_19350 15216 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 15989 17254 gene locus_tag LOCUS_19360 15989 17254 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_19360 17336 18205 gene locus_tag LOCUS_19370 17336 18205 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_19370 18205 19224 gene locus_tag LOCUS_19380 18205 19224 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_19380 19246 20052 gene locus_tag LOCUS_19390 19246 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 21605 20169 gene locus_tag LOCUS_19400 21605 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 21929 21738 gene locus_tag LOCUS_19410 21929 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence33 2884 2192 gene locus_tag LOCUS_19420 2884 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3441 2881 gene locus_tag LOCUS_19430 3441 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3757 3674 gene locus_tag LOCUS_t00370 3757 3674 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6413 3960 gene locus_tag LOCUS_19440 6413 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8004 6487 gene locus_tag LOCUS_19450 8004 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9500 8019 gene locus_tag LOCUS_19460 9500 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 9722 11242 gene locus_tag LOCUS_19470 9722 11242 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733826.1 protein_id gnl|my_center|LOCUS_19470 12026 11235 gene locus_tag LOCUS_19480 12026 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 13182 12427 gene locus_tag LOCUS_19490 gene spo0A 13182 12427 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_19490 14696 13482 gene locus_tag LOCUS_19500 gene spoIVB 14696 13482 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_19500 16076 14787 gene locus_tag LOCUS_19510 gene estB 16076 14787 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986581.1 protein_id gnl|my_center|LOCUS_19510 16586 16167 gene locus_tag LOCUS_19520 16586 16167 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392624.1 protein_id gnl|my_center|LOCUS_19520 16697 17812 gene locus_tag LOCUS_19530 16697 17812 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517080.1 protein_id gnl|my_center|LOCUS_19530 17885 18829 gene locus_tag LOCUS_19540 17885 18829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 19087 19623 gene locus_tag LOCUS_19550 19087 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 19620 20672 gene locus_tag LOCUS_19560 19620 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 20732 21775 gene locus_tag LOCUS_19570 20732 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 22122 22047 gene locus_tag LOCUS_t00380 22122 22047 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 2666 690 gene locus_tag LOCUS_19580 2666 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19580 3710 2676 gene locus_tag LOCUS_19590 3710 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19590 5060 4044 gene locus_tag LOCUS_19600 5060 4044 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892759.1 protein_id gnl|my_center|LOCUS_19600 6366 5077 gene locus_tag LOCUS_19610 6366 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 8779 6452 gene locus_tag LOCUS_19620 8779 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 9498 8794 gene locus_tag LOCUS_19630 9498 8794 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101843.1 protein_id gnl|my_center|LOCUS_19630 9685 10467 gene locus_tag LOCUS_19640 9685 10467 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_19640 10470 11099 gene locus_tag LOCUS_19650 10470 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 11494 13440 gene locus_tag LOCUS_19660 gene metG 11494 13440 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_19660 13440 14207 gene locus_tag LOCUS_19670 13440 14207 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_19670 15403 14393 gene locus_tag LOCUS_19680 15403 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 15600 17270 gene locus_tag LOCUS_19690 15600 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 18777 17338 gene locus_tag LOCUS_19700 gene proS 18777 17338 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_19700 19193 19969 gene locus_tag LOCUS_19710 19193 19969 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_19710 20003 20230 gene locus_tag LOCUS_19720 20003 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 20278 20760 gene locus_tag LOCUS_19730 20278 20760 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence35 210 10 gene locus_tag LOCUS_19740 210 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1676 573 gene locus_tag LOCUS_19750 1676 573 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_19750 2553 1699 gene locus_tag LOCUS_19760 2553 1699 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 protein_id gnl|my_center|LOCUS_19760 3724 3008 gene locus_tag LOCUS_19770 3724 3008 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_19770 4353 3799 gene locus_tag LOCUS_19780 gene frr 4353 3799 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_19780 5084 4386 gene locus_tag LOCUS_19790 gene pyrH 5084 4386 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_19790 5770 5270 gene locus_tag LOCUS_19800 5770 5270 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_19800 6515 5775 gene locus_tag LOCUS_19810 6515 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 9095 6714 gene locus_tag LOCUS_19820 9095 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 9420 9220 gene locus_tag LOCUS_19830 9420 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_19830 10316 9417 gene locus_tag LOCUS_19840 10316 9417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_19840 11227 10313 gene locus_tag LOCUS_19850 11227 10313 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_19850 11634 13448 gene locus_tag LOCUS_19860 11634 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 13535 15712 gene locus_tag LOCUS_19870 13535 15712 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_19870 15776 16306 gene locus_tag LOCUS_19880 15776 16306 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_19880 17174 16371 gene locus_tag LOCUS_19890 17174 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 18535 17285 gene locus_tag LOCUS_19900 18535 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 18642 19538 gene locus_tag LOCUS_19910 gene ldcB 18642 19538 CDS product LD-carboxypeptidase LdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399387.1 protein_id gnl|my_center|LOCUS_19910 20110 19535 gene locus_tag LOCUS_19920 gene cap8M 20110 19535 CDS product type 8 capsular polysaccharide synthesis protein Cap8M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence36 2116 1100 gene locus_tag LOCUS_19930 2116 1100 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892759.1 protein_id gnl|my_center|LOCUS_19930 3422 2133 gene locus_tag LOCUS_19940 3422 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 5835 3508 gene locus_tag LOCUS_19950 5835 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6554 5850 gene locus_tag LOCUS_19960 6554 5850 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101843.1 protein_id gnl|my_center|LOCUS_19960 6741 7523 gene locus_tag LOCUS_19970 6741 7523 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_19970 7526 8155 gene locus_tag LOCUS_19980 7526 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8654 10600 gene locus_tag LOCUS_19990 gene metG 8654 10600 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_19990 10600 11367 gene locus_tag LOCUS_20000 10600 11367 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_20000 12563 11553 gene locus_tag LOCUS_20010 12563 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 12760 14430 gene locus_tag LOCUS_20020 12760 14430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 15937 14498 gene locus_tag LOCUS_20030 gene proS 15937 14498 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_20030 16353 17129 gene locus_tag LOCUS_20040 16353 17129 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_20040 17163 17390 gene locus_tag LOCUS_20050 17163 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17438 17920 gene locus_tag LOCUS_20060 17438 17920 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence37 117 719 gene locus_tag LOCUS_20070 117 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 959 1297 gene locus_tag LOCUS_20080 959 1297 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_20080 1281 1718 gene locus_tag LOCUS_20090 gene spoIIAB 1281 1718 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_20090 1715 2380 gene locus_tag LOCUS_20100 gene sigF 1715 2380 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965603.1 protein_id gnl|my_center|LOCUS_20100 3180 2500 gene locus_tag LOCUS_20110 3180 2500 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453991.1 protein_id gnl|my_center|LOCUS_20110 3933 3199 gene locus_tag LOCUS_20120 3933 3199 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_20120 4138 4326 gene locus_tag LOCUS_20130 4138 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4472 5248 gene locus_tag LOCUS_20140 4472 5248 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_20140 5261 5941 gene locus_tag LOCUS_20150 5261 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_20150 5944 7380 gene locus_tag LOCUS_20160 5944 7380 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_20160 7396 7575 gene locus_tag LOCUS_20170 7396 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 7673 9433 gene locus_tag LOCUS_20180 7673 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 9559 10323 gene locus_tag LOCUS_20190 gene proB 9559 10323 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_20190 10331 11398 gene locus_tag LOCUS_20200 10331 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 11411 12199 gene locus_tag LOCUS_20210 gene proC 11411 12199 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_20210 12403 14142 gene locus_tag LOCUS_20220 12403 14142 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966681.1 protein_id gnl|my_center|LOCUS_20220 14164 15762 gene locus_tag LOCUS_20230 14164 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence38 <1 1669 gene locus_tag LOCUS_20240 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058116.1:translational GTPase TypA 1777 3051 gene locus_tag LOCUS_20250 gene glmU 1777 3051 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064394.1 protein_id gnl|my_center|LOCUS_20250 3095 4480 gene locus_tag LOCUS_20260 3095 4480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_20260 5588 5214 gene locus_tag LOCUS_20270 5588 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 6324 5581 gene locus_tag LOCUS_20280 6324 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7128 6697 gene locus_tag LOCUS_20290 7128 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8899 7142 gene locus_tag LOCUS_20300 8899 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 10937 8937 gene locus_tag LOCUS_20310 10937 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 11171 12724 gene locus_tag LOCUS_20320 11171 12724 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963652.1 protein_id gnl|my_center|LOCUS_20320 12878 13609 gene locus_tag LOCUS_20330 gene rpsB 12878 13609 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_20330 13673 14767 gene locus_tag LOCUS_20340 gene tsf 13673 14767 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808080.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence39 1961 429 gene locus_tag LOCUS_20350 1961 429 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_20350 3227 2184 gene locus_tag LOCUS_20360 3227 2184 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243644.1 protein_id gnl|my_center|LOCUS_20360 3749 3231 gene locus_tag LOCUS_20370 3749 3231 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_20370 5183 3753 gene locus_tag LOCUS_20380 gene purB 5183 3753 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_20380 5311 5757 gene locus_tag LOCUS_20390 5311 5757 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_20390 5771 6586 gene locus_tag LOCUS_20400 5771 6586 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_20400 8506 6683 gene locus_tag LOCUS_20410 8506 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 9235 8513 gene locus_tag LOCUS_20420 9235 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 9650 11470 gene locus_tag LOCUS_20430 gene typA 9650 11470 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_20430 11603 12487 gene locus_tag LOCUS_20440 11603 12487 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_20440 12480 13061 gene locus_tag LOCUS_20450 12480 13061 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence40 <1 1395 gene locus_tag LOCUS_20460 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965946.1:glutamine synthetase III 1764 3341 gene locus_tag LOCUS_20470 gene asnB 1764 3341 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_20470 3485 3784 gene locus_tag LOCUS_20480 3485 3784 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_20480 3777 4871 gene locus_tag LOCUS_20490 3777 4871 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075198.1 protein_id gnl|my_center|LOCUS_20490 4864 5490 gene locus_tag LOCUS_20500 gene hisG 4864 5490 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_20500 5483 6760 gene locus_tag LOCUS_20510 gene hisD 5483 6760 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_20510 6760 7815 gene locus_tag LOCUS_20520 gene hisC 6760 7815 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_20520 7819 8388 gene locus_tag LOCUS_20530 7819 8388 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_20530 8385 8972 gene locus_tag LOCUS_20540 gene hisB 8385 8972 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_20540 8972 9580 gene locus_tag LOCUS_20550 gene hisH 8972 9580 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_20550 9611 10324 gene locus_tag LOCUS_20560 gene hisA 9611 10324 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_20560 10321 11079 gene locus_tag LOCUS_20570 gene hisF 10321 11079 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864484.1 protein_id gnl|my_center|LOCUS_20570 11082 11729 gene locus_tag LOCUS_20580 gene hisIE 11082 11729 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_20580 12506 11787 gene locus_tag LOCUS_20590 12506 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 12641 12862 gene locus_tag LOCUS_20600 12641 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 12843 13595 gene locus_tag LOCUS_20610 12843 13595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence41 956 1483 gene locus_tag LOCUS_20620 956 1483 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 protein_id gnl|my_center|LOCUS_20620 2174 1608 gene locus_tag LOCUS_20630 2174 1608 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_20630 3065 2187 gene locus_tag LOCUS_20640 3065 2187 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_20640 3218 3700 gene locus_tag LOCUS_20650 3218 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4899 3745 gene locus_tag LOCUS_20660 4899 3745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_20660 5742 4912 gene locus_tag LOCUS_20670 5742 4912 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_20670 6688 5816 gene locus_tag LOCUS_20680 6688 5816 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_20680 8012 6678 gene locus_tag LOCUS_20690 8012 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8067 9146 gene locus_tag LOCUS_20700 8067 9146 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_20700 9148 9306 gene locus_tag LOCUS_20710 9148 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9322 11085 gene locus_tag LOCUS_20720 9322 11085 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_20720 11100 12284 gene locus_tag LOCUS_20730 11100 12284 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_20730 12300 13451 gene locus_tag LOCUS_20740 12300 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence42 <1 610 gene locus_tag LOCUS_20750 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358052.1:RNA polymerase sigma factor RpoD 719 1600 gene locus_tag LOCUS_20760 719 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1665 2288 gene locus_tag LOCUS_20770 1665 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2464 4446 gene locus_tag LOCUS_20780 gene ligA 2464 4446 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_20780 4551 4626 gene locus_tag LOCUS_t00390 4551 4626 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4630 4706 gene locus_tag LOCUS_t00400 4630 4706 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4718 4793 gene locus_tag LOCUS_t00410 4718 4793 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4797 4872 gene locus_tag LOCUS_t00420 4797 4872 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6187 5144 gene locus_tag LOCUS_20790 6187 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 7299 6247 gene locus_tag LOCUS_20800 7299 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 7832 7296 gene locus_tag LOCUS_20810 7832 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 9034 8090 gene locus_tag LOCUS_20820 9034 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 10222 9107 gene locus_tag LOCUS_20830 10222 9107 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517080.1 protein_id gnl|my_center|LOCUS_20830 10333 10752 gene locus_tag LOCUS_20840 10333 10752 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392624.1 protein_id gnl|my_center|LOCUS_20840 10843 11895 gene locus_tag LOCUS_20850 10843 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 11871 12233 gene locus_tag LOCUS_20860 11871 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence43 2413 1901 gene locus_tag LOCUS_20870 2413 1901 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_20870 2518 3672 gene locus_tag LOCUS_20880 2518 3672 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_20880 3685 4269 gene locus_tag LOCUS_20890 3685 4269 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948555.1 protein_id gnl|my_center|LOCUS_20890 5443 4310 gene locus_tag LOCUS_20900 5443 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6220 5477 gene locus_tag LOCUS_20910 6220 5477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_20910 7098 6238 gene locus_tag LOCUS_20920 7098 6238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_20920 7869 7108 gene locus_tag LOCUS_20930 7869 7108 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_20930 8587 7901 gene locus_tag LOCUS_20940 8587 7901 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_20940 10225 8819 gene locus_tag LOCUS_20950 10225 8819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_20950 11182 10319 gene locus_tag LOCUS_20960 11182 10319 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence44 250 164 gene locus_tag LOCUS_t00430 250 164 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1367 618 gene locus_tag LOCUS_20970 1367 618 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_20970 2644 1364 gene locus_tag LOCUS_20980 gene mtaB 2644 1364 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_20980 2768 3946 gene locus_tag LOCUS_20990 2768 3946 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_20990 4063 5400 gene locus_tag LOCUS_21000 4063 5400 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_21000 5480 5902 gene locus_tag LOCUS_21010 5480 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_21010 6244 7938 gene locus_tag LOCUS_21020 gene cdr 6244 7938 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 protein_id gnl|my_center|LOCUS_21020 9804 8131 gene locus_tag LOCUS_21030 9804 8131 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_21030 10389 10315 gene locus_tag LOCUS_t00440 10389 10315 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10673 10598 gene locus_tag LOCUS_t00450 10673 10598 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 1277 423 gene locus_tag LOCUS_21040 1277 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1735 2751 gene locus_tag LOCUS_21050 1735 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2735 3217 gene locus_tag LOCUS_21060 2735 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3686 3261 gene locus_tag LOCUS_21070 3686 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4621 3845 gene locus_tag LOCUS_21080 4621 3845 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_21080 5664 4624 gene locus_tag LOCUS_21090 gene hydE 5664 4624 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_21090 5877 5952 gene locus_tag LOCUS_t00460 5877 5952 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6553 7320 gene locus_tag LOCUS_21100 6553 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21100 7387 8058 gene locus_tag LOCUS_21110 7387 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21110 8045 8791 gene locus_tag LOCUS_21120 8045 8791 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_21120 9998 8865 gene locus_tag LOCUS_21130 9998 8865 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence46 <1 1311 gene locus_tag LOCUS_21140 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546793.1:2-isopropylmalate synthase 1314 3812 gene locus_tag LOCUS_21150 1314 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4221 6491 gene locus_tag LOCUS_21160 4221 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6722 7378 gene locus_tag LOCUS_21170 6722 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_21170 7391 7597 gene locus_tag LOCUS_21180 7391 7597 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_21180 7603 8661 gene locus_tag LOCUS_21190 7603 8661 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_21190 8661 9404 gene locus_tag LOCUS_21200 8661 9404 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence47 1441 374 gene locus_tag LOCUS_21210 gene prfA 1441 374 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_21210 1669 1484 gene locus_tag LOCUS_21220 1669 1484 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583198.1 protein_id gnl|my_center|LOCUS_21220 1839 2765 gene locus_tag LOCUS_21230 1839 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2879 3736 gene locus_tag LOCUS_21240 2879 3736 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_21240 3752 4297 gene locus_tag LOCUS_21250 3752 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4772 4629 gene locus_tag LOCUS_21260 4772 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 5084 5668 gene locus_tag LOCUS_21270 5084 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 7253 5721 gene locus_tag LOCUS_21280 gene uidB 7253 5721 CDS product glucuronide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075831.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence48 302 925 gene locus_tag LOCUS_21290 302 925 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_21290 996 3119 gene locus_tag LOCUS_21300 996 3119 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_21300 3139 4812 gene locus_tag LOCUS_21310 3139 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 5527 4835 gene locus_tag LOCUS_21320 5527 4835 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886565.1 protein_id gnl|my_center|LOCUS_21320 5651 6211 gene locus_tag LOCUS_21330 gene rpe 5651 6211 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_21330 6255 7145 gene locus_tag LOCUS_21340 6255 7145 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_21340 7230 7895 gene locus_tag LOCUS_21350 7230 7895 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_21350 8065 8781 gene locus_tag LOCUS_21360 gene pyrH 8065 8781 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence49 <1 678 gene locus_tag LOCUS_21370 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678782.1:DNA alkylation repair protein 2065 722 gene locus_tag LOCUS_21380 gene pyk 2065 722 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_21380 2272 2436 gene locus_tag LOCUS_21390 2272 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2417 4153 gene locus_tag LOCUS_21400 2417 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4566 4642 gene locus_tag LOCUS_t00470 4566 4642 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4652 4727 gene locus_tag LOCUS_t00480 4652 4727 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5533 5273 gene locus_tag LOCUS_21410 5533 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5733 6344 gene locus_tag LOCUS_21420 5733 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 <7721 6529 gene locus_tag LOCUS_21430 <7721 6529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986486.1:MATE family efflux transporter >Feature sequence50 2308 650 gene locus_tag LOCUS_21440 gene araB 2308 650 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_21440 2867 2328 gene locus_tag LOCUS_21450 2867 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3692 2880 gene locus_tag LOCUS_21460 3692 2880 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_21460 4259 3759 gene locus_tag LOCUS_21470 4259 3759 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_21470 5732 4530 gene locus_tag LOCUS_21480 5732 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 6928 6083 gene locus_tag LOCUS_21490 6928 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence51 260 808 gene locus_tag LOCUS_21500 260 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1371 1096 gene locus_tag LOCUS_21510 1371 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1602 2372 gene locus_tag LOCUS_21520 1602 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3703 2369 gene locus_tag LOCUS_21530 3703 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4012 3848 gene locus_tag LOCUS_21540 4012 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 <7341 4009 gene locus_tag LOCUS_21550 <7341 4009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein >Feature sequence52 <1 1424 gene locus_tag LOCUS_21560 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389627.1:discoidin domain-containing protein 2421 1567 gene locus_tag LOCUS_21570 2421 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2608 4629 gene locus_tag LOCUS_21580 2608 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4638 5651 gene locus_tag LOCUS_21590 4638 5651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_21590 5656 6726 gene locus_tag LOCUS_21600 gene uxuA 5656 6726 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence53 451 1029 gene locus_tag LOCUS_21610 451 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1047 1451 gene locus_tag LOCUS_21620 gene mgsA 1047 1451 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_21620 1552 2214 gene locus_tag LOCUS_21630 1552 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2353 3705 gene locus_tag LOCUS_21640 gene hisS 2353 3705 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_21640 3705 5495 gene locus_tag LOCUS_21650 gene aspS 3705 5495 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_21650 <6958 5559 gene locus_tag LOCUS_21660 <6958 5559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042515450.1:glycogen synthase GlgA >Feature sequence54 278 102 gene locus_tag LOCUS_21670 278 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 222 452 gene locus_tag LOCUS_21680 222 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1729 494 gene locus_tag LOCUS_21690 1729 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1980 2681 gene locus_tag LOCUS_21700 1980 2681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_21700 2681 6442 gene locus_tag LOCUS_21710 2681 6442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence55 <1 1614 gene locus_tag LOCUS_21720 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964991.1:translational GTPase TypA 1747 2631 gene locus_tag LOCUS_21730 1747 2631 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_21730 2624 3205 gene locus_tag LOCUS_21740 2624 3205 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_21740 5177 3426 gene locus_tag LOCUS_21750 5177 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5386 5195 gene locus_tag LOCUS_21760 5386 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6561 5386 gene locus_tag LOCUS_21770 6561 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence56 90 15 gene locus_tag LOCUS_t00490 90 15 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1068 187 gene locus_tag LOCUS_21780 gene hslO 1068 187 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_21780 1840 1070 gene locus_tag LOCUS_21790 1840 1070 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_21790 2133 1837 gene locus_tag LOCUS_21800 2133 1837 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 protein_id gnl|my_center|LOCUS_21800 3560 2217 gene locus_tag LOCUS_21810 3560 2217 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454855.1 protein_id gnl|my_center|LOCUS_21810 4978 3581 gene locus_tag LOCUS_21820 4978 3581 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence57 83 1159 gene locus_tag LOCUS_21830 83 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1165 1812 gene locus_tag LOCUS_21840 1165 1812 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_21840 2705 1860 gene locus_tag LOCUS_21850 2705 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3590 2712 gene locus_tag LOCUS_21860 3590 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3935 3603 gene locus_tag LOCUS_21870 3935 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4812 3922 gene locus_tag LOCUS_21880 4812 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 <5846 4931 gene locus_tag LOCUS_21890 <5846 4931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048694946.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence58 68 193 gene locus_tag LOCUS_21900 68 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 218 1552 gene locus_tag LOCUS_21910 218 1552 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_21910 1543 1869 gene locus_tag LOCUS_21920 1543 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1931 2587 gene locus_tag LOCUS_21930 1931 2587 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_21930 2719 2792 gene locus_tag LOCUS_t00500 2719 2792 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2828 2904 gene locus_tag LOCUS_t00510 2828 2904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2958 3034 gene locus_tag LOCUS_t00520 2958 3034 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3107 3181 gene locus_tag LOCUS_t00530 3107 3181 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5056 3587 gene locus_tag LOCUS_21940 5056 3587 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_21940 5392 5517 gene locus_tag LOCUS_21950 5392 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence59 81 428 gene locus_tag LOCUS_21960 gene rplS 81 428 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_21960 549 1175 gene locus_tag LOCUS_21970 gene lepB 549 1175 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_21970 1179 1760 gene locus_tag LOCUS_21980 gene lepB 1179 1760 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_21980 1830 2699 gene locus_tag LOCUS_21990 gene ylqF 1830 2699 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_21990 2875 3498 gene locus_tag LOCUS_22000 2875 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3485 3850 gene locus_tag LOCUS_22010 3485 3850 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_22010 3933 5426 gene locus_tag LOCUS_22020 gene thrC 3933 5426 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence60 367 242 gene locus_tag LOCUS_22030 367 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 703 2172 gene locus_tag LOCUS_22040 703 2172 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_22040 2652 2578 gene locus_tag LOCUS_t00540 2652 2578 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2801 2725 gene locus_tag LOCUS_t00550 2801 2725 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2882 2806 gene locus_tag LOCUS_t00560 2882 2806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2991 2918 gene locus_tag LOCUS_t00570 2991 2918 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3779 3123 gene locus_tag LOCUS_22050 3779 3123 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_22050 4167 3841 gene locus_tag LOCUS_22060 4167 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5492 4158 gene locus_tag LOCUS_22070 5492 4158 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_22070 5642 5517 gene locus_tag LOCUS_22080 5642 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence61 3628 2735 gene locus_tag LOCUS_22090 gene whiA 3628 2735 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_22090 4501 3644 gene locus_tag LOCUS_22100 gene rapZ 4501 3644 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence62 1440 580 gene locus_tag LOCUS_22110 gene rsmA 1440 580 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_22110 1527 2537 gene locus_tag LOCUS_22120 gene galE 1527 2537 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_22120 2541 3788 gene locus_tag LOCUS_22130 gene hflX 2541 3788 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812294.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence63 46 1617 gene locus_tag LOCUS_22140 46 1617 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_22140 1997 1641 gene locus_tag LOCUS_22150 1997 1641 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_22150 4090 2255 gene locus_tag LOCUS_22160 4090 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4501 4103 gene locus_tag LOCUS_22170 4501 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 <5078 4527 gene locus_tag LOCUS_22180 <5078 4527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989911.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence64 1006 191 gene locus_tag LOCUS_22190 gene rhaD 1006 191 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_22190 2244 1003 gene locus_tag LOCUS_22200 gene rhaA 2244 1003 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_22200 3805 2258 gene locus_tag LOCUS_22210 3805 2258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208870.1 protein_id gnl|my_center|LOCUS_22210 4210 3956 gene locus_tag LOCUS_22220 4210 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 4405 4286 gene locus_tag LOCUS_22230 4405 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence65 2287 986 gene locus_tag LOCUS_22240 2287 986 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_22240 3402 2305 gene locus_tag LOCUS_22250 3402 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4440 3583 gene locus_tag LOCUS_22260 4440 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence66 1722 715 gene locus_tag LOCUS_22270 1722 715 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_22270 2233 1715 gene locus_tag LOCUS_22280 gene mcsA 2233 1715 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_22280 2702 2253 gene locus_tag LOCUS_22290 2702 2253 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870147.1 protein_id gnl|my_center|LOCUS_22290 3581 3162 gene locus_tag LOCUS_22300 3581 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence67 <1 1548 gene locus_tag LOCUS_22310 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548498.1:polysaccharide biosynthesis protein 1555 2355 gene locus_tag LOCUS_22320 1555 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2437 2709 gene locus_tag LOCUS_22330 gene hbs 2437 2709 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_22330 2791 3033 gene locus_tag LOCUS_22340 2791 3033 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_22340 3094 3357 gene locus_tag LOCUS_22350 3094 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3354 3875 gene locus_tag LOCUS_22360 3354 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3877 4170 gene locus_tag LOCUS_22370 3877 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence68 1826 150 gene locus_tag LOCUS_22380 1826 150 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_22380 3649 1838 gene locus_tag LOCUS_22390 3649 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4202 3753 gene locus_tag LOCUS_22400 4202 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence69 3099 862 gene locus_tag LOCUS_22410 gene gyrA 3099 862 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656784.1 protein_id gnl|my_center|LOCUS_22410 <4397 3114 gene locus_tag LOCUS_22420 <4397 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434229.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence70 1202 1798 gene locus_tag LOCUS_22430 1202 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2107 1853 gene locus_tag LOCUS_22440 2107 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3169 2279 gene locus_tag LOCUS_22450 gene dapA 3169 2279 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_22450 <4317 3241 gene locus_tag LOCUS_22460 <4317 3241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963351.1:aspartate-semialdehyde dehydrogenase >Feature sequence71 <1 873 gene locus_tag LOCUS_22470 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666607.1:flavodoxin 1448 1221 gene locus_tag LOCUS_22480 1448 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1825 1607 gene locus_tag LOCUS_22490 1825 1607 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_22490 <4095 2161 gene locus_tag LOCUS_22500 <4095 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence72 1493 1636 gene locus_tag LOCUS_22510 1493 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2485 1685 gene locus_tag LOCUS_22520 gene srtB 2485 1685 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_22520 3832 2522 gene locus_tag LOCUS_22530 3832 2522 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence73 780 379 gene locus_tag LOCUS_22540 780 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1244 801 gene locus_tag LOCUS_22550 1244 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2296 1376 gene locus_tag LOCUS_22560 2296 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2586 2299 gene locus_tag LOCUS_22570 2586 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2800 2875 gene locus_tag LOCUS_t00580 2800 2875 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2992 3450 gene locus_tag LOCUS_22580 2992 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence74 527 291 gene locus_tag LOCUS_22590 gene acpP 527 291 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_22590 1882 917 gene locus_tag LOCUS_22600 gene dusB 1882 917 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_22600 3054 2080 gene locus_tag LOCUS_22610 gene bsh 3054 2080 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_22610 3541 3074 gene locus_tag LOCUS_22620 3541 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence75 777 2606 gene locus_tag LOCUS_22630 gene ftsH 777 2606 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_22630 2603 3154 gene locus_tag LOCUS_22640 2603 3154 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309892.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence76 <1 550 gene locus_tag LOCUS_22650 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209045.1:EscV/YscV/HrcV family type III secretion system export apparatus protein 1436 609 gene locus_tag LOCUS_22660 1436 609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_22660 2558 1440 gene locus_tag LOCUS_22670 2558 1440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_22670 <3394 2866 gene locus_tag LOCUS_22680 <3394 2866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:NAD(P)-binding protein >Feature sequence77 252 875 gene locus_tag LOCUS_22690 252 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 862 1227 gene locus_tag LOCUS_22700 862 1227 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_22700 1310 2803 gene locus_tag LOCUS_22710 gene thrC 1310 2803 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence78 1650 3098 gene locus_tag LOCUS_22720 gene hydG 1650 3098 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence79 2312 2061 gene locus_tag LOCUS_22730 2312 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence80 814 365 gene locus_tag LOCUS_22740 814 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1012 2187 gene locus_tag LOCUS_22750 1012 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2187 2378 gene locus_tag LOCUS_22760 2187 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence81 144 2345 gene locus_tag LOCUS_22770 144 2345 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence82 546 1724 gene locus_tag LOCUS_22780 546 1724 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence83 877 116 gene locus_tag LOCUS_22790 877 116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_22790 2466 1372 gene locus_tag LOCUS_22800 2466 1372 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence84 317 817 gene locus_tag LOCUS_22810 317 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 833 2029 gene locus_tag LOCUS_22820 833 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence85 2299 1025 gene locus_tag LOCUS_22830 2299 1025 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence86 1276 707 gene locus_tag LOCUS_22840 1276 707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_22840 1620 1291 gene locus_tag LOCUS_22850 1620 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001999997.1 protein_id gnl|my_center|LOCUS_22850 2852 1692 gene locus_tag LOCUS_22860 2852 1692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence87 1212 1287 gene locus_tag LOCUS_t00590 1212 1287 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2466 1750 gene locus_tag LOCUS_22870 2466 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence88 477 2066 gene locus_tag LOCUS_22880 477 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880