>Feature sequence001 784 26 gene locus_tag LOCUS_00010 784 26 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579984.1 protein_id gnl|my_center|LOCUS_00010 992 1079 gene locus_tag LOCUS_t00010 992 1079 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1351 1166 gene locus_tag LOCUS_00020 1351 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1605 1423 gene locus_tag LOCUS_00030 1605 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2779 1790 gene locus_tag LOCUS_00040 2779 1790 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_00040 3470 3063 gene locus_tag LOCUS_00050 3470 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5035 3728 gene locus_tag LOCUS_00060 5035 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6347 5022 gene locus_tag LOCUS_00070 6347 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7240 6365 gene locus_tag LOCUS_00080 7240 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7479 9293 gene locus_tag LOCUS_00090 gene ftsH 7479 9293 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_00090 9359 10879 gene locus_tag LOCUS_00100 9359 10879 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_00100 10876 11604 gene locus_tag LOCUS_00110 10876 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11929 11672 gene locus_tag LOCUS_00120 11929 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11970 12389 gene locus_tag LOCUS_00130 11970 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14309 12534 gene locus_tag LOCUS_00140 14309 12534 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_00140 15406 14675 gene locus_tag LOCUS_00150 15406 14675 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_00150 16152 15484 gene locus_tag LOCUS_00160 16152 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18264 16534 gene locus_tag LOCUS_00170 18264 16534 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_00170 18787 18269 gene locus_tag LOCUS_00180 18787 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19615 20733 gene locus_tag LOCUS_00190 19615 20733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_00190 20730 21623 gene locus_tag LOCUS_00200 20730 21623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_00200 21625 23598 gene locus_tag LOCUS_00210 21625 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23703 24155 gene locus_tag LOCUS_00220 23703 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24360 25748 gene locus_tag LOCUS_00230 24360 25748 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_00230 25970 26512 gene locus_tag LOCUS_00240 25970 26512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26628 26443 gene locus_tag LOCUS_00250 26628 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29504 26841 gene locus_tag LOCUS_00260 gene ppdK 29504 26841 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_00260 29982 31841 gene locus_tag LOCUS_00270 29982 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32076 33956 gene locus_tag LOCUS_00280 32076 33956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34095 34358 gene locus_tag LOCUS_00290 34095 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34431 35078 gene locus_tag LOCUS_00300 34431 35078 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_00300 35240 36541 gene locus_tag LOCUS_00310 35240 36541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36777 38663 gene locus_tag LOCUS_00320 36777 38663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39587 38754 gene locus_tag LOCUS_00330 39587 38754 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_00330 39807 40268 gene locus_tag LOCUS_00340 39807 40268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40432 41865 gene locus_tag LOCUS_00350 40432 41865 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947791.1 protein_id gnl|my_center|LOCUS_00350 41867 43339 gene locus_tag LOCUS_00360 41867 43339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43336 44319 gene locus_tag LOCUS_00370 43336 44319 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989659.1 protein_id gnl|my_center|LOCUS_00370 44341 45312 gene locus_tag LOCUS_00380 44341 45312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45317 46849 gene locus_tag LOCUS_00390 45317 46849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46858 47994 gene locus_tag LOCUS_00400 46858 47994 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876000.1 protein_id gnl|my_center|LOCUS_00400 47991 48380 gene locus_tag LOCUS_00410 gene tagD 47991 48380 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_00410 48606 49946 gene locus_tag LOCUS_00420 gene spoVB 48606 49946 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_00420 >Feature sequence002 461 1981 gene locus_tag LOCUS_00430 461 1981 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_00430 2015 3181 gene locus_tag LOCUS_00440 2015 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 3178 4287 gene locus_tag LOCUS_00450 3178 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5979 4348 gene locus_tag LOCUS_00460 5979 4348 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_00460 6854 6114 gene locus_tag LOCUS_00470 6854 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7696 7031 gene locus_tag LOCUS_00480 7696 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7860 8660 gene locus_tag LOCUS_00490 7860 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9558 8854 gene locus_tag LOCUS_00500 9558 8854 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_00500 10628 9555 gene locus_tag LOCUS_00510 10628 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 11811 11041 gene locus_tag LOCUS_00520 11811 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 13243 11825 gene locus_tag LOCUS_00530 13243 11825 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_00530 14299 13505 gene locus_tag LOCUS_00540 14299 13505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_00540 15242 14301 gene locus_tag LOCUS_00550 15242 14301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563799.1 protein_id gnl|my_center|LOCUS_00550 16276 15314 gene locus_tag LOCUS_00560 16276 15314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_00560 16679 17917 gene locus_tag LOCUS_00570 gene estA 16679 17917 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948553.1 protein_id gnl|my_center|LOCUS_00570 17984 18265 gene locus_tag LOCUS_00580 17984 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 18265 19845 gene locus_tag LOCUS_00590 18265 19845 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_00590 20358 19894 gene locus_tag LOCUS_00600 20358 19894 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_00600 20761 20471 gene locus_tag LOCUS_00610 20761 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 20850 21023 gene locus_tag LOCUS_00620 20850 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 24448 21194 gene locus_tag LOCUS_00630 24448 21194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 24592 25113 gene locus_tag LOCUS_00640 24592 25113 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_00640 25970 25188 gene locus_tag LOCUS_00650 25970 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 26066 26623 gene locus_tag LOCUS_00660 26066 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 27611 26673 gene locus_tag LOCUS_00670 gene arcC 27611 26673 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_00670 28722 27616 gene locus_tag LOCUS_00680 gene aguA 28722 27616 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262731.1 protein_id gnl|my_center|LOCUS_00680 30114 28735 gene locus_tag LOCUS_00690 30114 28735 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262732.1 protein_id gnl|my_center|LOCUS_00690 31155 30139 gene locus_tag LOCUS_00700 gene ptcA 31155 30139 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_00700 31610 32809 gene locus_tag LOCUS_00710 31610 32809 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 protein_id gnl|my_center|LOCUS_00710 32825 34435 gene locus_tag LOCUS_00720 32825 34435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 34451 34624 gene locus_tag LOCUS_00730 34451 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 34642 34908 gene locus_tag LOCUS_00740 34642 34908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 35086 37770 gene locus_tag LOCUS_00750 35086 37770 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_00750 37770 38111 gene locus_tag LOCUS_00760 gene hypA 37770 38111 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_00760 39610 38216 gene locus_tag LOCUS_00770 gene asnS 39610 38216 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_00770 40637 39750 gene locus_tag LOCUS_00780 40637 39750 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_00780 40967 40704 gene locus_tag LOCUS_00790 gene rpsT 40967 40704 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_00790 41155 42012 gene locus_tag LOCUS_00800 gene gpr 41155 42012 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_00800 42159 42974 gene locus_tag LOCUS_00810 gene soj 42159 42974 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_00810 42967 43851 gene locus_tag LOCUS_00820 42967 43851 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence003 609 1634 gene locus_tag LOCUS_00830 gene pheS 609 1634 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_00830 1651 4032 gene locus_tag LOCUS_00840 gene pheT 1651 4032 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_00840 4249 4407 gene locus_tag LOCUS_00850 4249 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 4649 4392 gene locus_tag LOCUS_00860 4649 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4788 4715 gene locus_tag LOCUS_t00020 4788 4715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5627 4914 gene locus_tag LOCUS_00870 5627 4914 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_00870 5749 6411 gene locus_tag LOCUS_00880 5749 6411 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_00880 6434 7093 gene locus_tag LOCUS_00890 6434 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 8352 7147 gene locus_tag LOCUS_00900 8352 7147 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_00900 8626 8817 gene locus_tag LOCUS_00910 8626 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 8985 8897 gene locus_tag LOCUS_t00030 8985 8897 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9125 9034 gene locus_tag LOCUS_t00040 9125 9034 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9270 9917 gene locus_tag LOCUS_00920 9270 9917 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_00920 10842 9949 gene locus_tag LOCUS_00930 10842 9949 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_00930 13274 10848 gene locus_tag LOCUS_00940 gene pcrA 13274 10848 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_00940 13391 14041 gene locus_tag LOCUS_00950 13391 14041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_00950 15456 14101 gene locus_tag LOCUS_00960 gene trkA 15456 14101 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_00960 15720 18662 gene locus_tag LOCUS_00970 15720 18662 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_00970 18735 19646 gene locus_tag LOCUS_00980 18735 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 20296 19688 gene locus_tag LOCUS_00990 20296 19688 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_00990 21884 20304 gene locus_tag LOCUS_01000 gene asnB 21884 20304 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_01000 24305 22212 gene locus_tag LOCUS_01010 24305 22212 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_01010 24725 25312 gene locus_tag LOCUS_01020 24725 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 25325 26932 gene locus_tag LOCUS_01030 25325 26932 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_01030 26935 28368 gene locus_tag LOCUS_01040 gene purB 26935 28368 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_01040 28390 29664 gene locus_tag LOCUS_01050 28390 29664 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254838.1 protein_id gnl|my_center|LOCUS_01050 31076 29730 gene locus_tag LOCUS_01060 31076 29730 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_01060 31544 31191 gene locus_tag LOCUS_01070 31544 31191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 31453 32457 gene locus_tag LOCUS_01080 gene plcA 31453 32457 CDS product phosphatidylinositol diacylglycerol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095605.1 protein_id gnl|my_center|LOCUS_01080 34488 32533 gene locus_tag LOCUS_01090 gene lysS 34488 32533 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_01090 34984 34499 gene locus_tag LOCUS_01100 gene greA 34984 34499 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_01100 36236 35031 gene locus_tag LOCUS_01110 36236 35031 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_01110 37573 36350 gene locus_tag LOCUS_01120 37573 36350 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_01120 38497 37586 gene locus_tag LOCUS_01130 gene ftsX 38497 37586 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963820.1 protein_id gnl|my_center|LOCUS_01130 39149 38457 gene locus_tag LOCUS_01140 gene ftsE 39149 38457 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_01140 40289 39195 gene locus_tag LOCUS_01150 40289 39195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 41175 40462 gene locus_tag LOCUS_01160 41175 40462 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_01160 41258 41704 gene locus_tag LOCUS_01170 41258 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 43138 41780 gene locus_tag LOCUS_01180 43138 41780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 <44332 43391 gene locus_tag LOCUS_01190 <44332 43391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence004 57 1541 gene locus_tag LOCUS_01200 57 1541 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_01200 1706 2368 gene locus_tag LOCUS_01210 1706 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2399 4939 gene locus_tag LOCUS_01220 2399 4939 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680008.1 protein_id gnl|my_center|LOCUS_01220 4950 5321 gene locus_tag LOCUS_01230 4950 5321 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_01230 5343 7421 gene locus_tag LOCUS_01240 5343 7421 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_01240 8343 7606 gene locus_tag LOCUS_01250 8343 7606 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_01250 9652 8357 gene locus_tag LOCUS_01260 9652 8357 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_01260 10131 9649 gene locus_tag LOCUS_01270 10131 9649 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 protein_id gnl|my_center|LOCUS_01270 11298 10255 gene locus_tag LOCUS_01280 11298 10255 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 protein_id gnl|my_center|LOCUS_01280 11553 12611 gene locus_tag LOCUS_01290 11553 12611 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_01290 12637 13362 gene locus_tag LOCUS_01300 12637 13362 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_01300 13331 14080 gene locus_tag LOCUS_01310 13331 14080 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_01310 14545 14135 gene locus_tag LOCUS_01320 14545 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14972 14562 gene locus_tag LOCUS_01330 gene ruvX 14972 14562 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221192.1 protein_id gnl|my_center|LOCUS_01330 16239 14953 gene locus_tag LOCUS_01340 16239 14953 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_01340 16381 17319 gene locus_tag LOCUS_01350 16381 17319 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_01350 17399 18838 gene locus_tag LOCUS_01360 17399 18838 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_01360 20351 19116 gene locus_tag LOCUS_01370 20351 19116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_01370 20874 21728 gene locus_tag LOCUS_01380 20874 21728 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860969.1 protein_id gnl|my_center|LOCUS_01380 21800 22810 gene locus_tag LOCUS_01390 21800 22810 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027269.1 protein_id gnl|my_center|LOCUS_01390 22880 23830 gene locus_tag LOCUS_01400 22880 23830 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_01400 25287 23980 gene locus_tag LOCUS_01410 25287 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 25858 25301 gene locus_tag LOCUS_01420 25858 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 29249 25875 gene locus_tag LOCUS_01430 29249 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 29890 29267 gene locus_tag LOCUS_01440 29890 29267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 30873 30103 gene locus_tag LOCUS_01450 30873 30103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 31610 30960 gene locus_tag LOCUS_01460 31610 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 32296 31730 gene locus_tag LOCUS_01470 32296 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 32808 34334 gene locus_tag LOCUS_01480 32808 34334 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_01480 34373 34606 gene locus_tag LOCUS_01490 34373 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 34606 35790 gene locus_tag LOCUS_01500 34606 35790 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_01500 35787 37391 gene locus_tag LOCUS_01510 35787 37391 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_01510 37407 38513 gene locus_tag LOCUS_01520 37407 38513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 39075 38635 gene locus_tag LOCUS_01530 gene dut 39075 38635 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_01530 39605 39066 gene locus_tag LOCUS_01540 gene nrdG 39605 39066 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_01540 41847 39673 gene locus_tag LOCUS_01550 gene nrdD 41847 39673 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_01550 43102 42083 gene locus_tag LOCUS_01560 gene galE 43102 42083 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence005 565 1101 gene locus_tag LOCUS_01570 565 1101 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_01570 2203 1175 gene locus_tag LOCUS_01580 gene rfbB 2203 1175 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_01580 3098 2196 gene locus_tag LOCUS_01590 gene rfbA 3098 2196 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 protein_id gnl|my_center|LOCUS_01590 4300 3113 gene locus_tag LOCUS_01600 4300 3113 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684076.1 protein_id gnl|my_center|LOCUS_01600 4568 4359 gene locus_tag LOCUS_01610 4568 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6112 4853 gene locus_tag LOCUS_01620 6112 4853 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_01620 7281 6109 gene locus_tag LOCUS_01630 gene thiI 7281 6109 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_01630 7656 7312 gene locus_tag LOCUS_01640 7656 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 9208 7685 gene locus_tag LOCUS_01650 9208 7685 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_01650 11066 9273 gene locus_tag LOCUS_01660 gene aspS 11066 9273 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_01660 12492 11134 gene locus_tag LOCUS_01670 gene hisS 12492 11134 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_01670 12917 12516 gene locus_tag LOCUS_01680 gene mgsA 12917 12516 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_01680 15017 12951 gene locus_tag LOCUS_01690 15017 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 15570 15055 gene locus_tag LOCUS_01700 15570 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 16420 15572 gene locus_tag LOCUS_01710 gene mreC 16420 15572 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_01710 16989 16417 gene locus_tag LOCUS_01720 16989 16417 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_01720 19103 17010 gene locus_tag LOCUS_01730 19103 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 19229 20227 gene locus_tag LOCUS_01740 19229 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 20240 21220 gene locus_tag LOCUS_01750 20240 21220 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_01750 21217 22260 gene locus_tag LOCUS_01760 21217 22260 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_01760 23397 22552 gene locus_tag LOCUS_01770 23397 22552 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_01770 24842 23460 gene locus_tag LOCUS_01780 24842 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 25052 25963 gene locus_tag LOCUS_01790 25052 25963 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01790 26087 26773 gene locus_tag LOCUS_01800 26087 26773 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_01800 28299 26827 gene locus_tag LOCUS_01810 gene malQ 28299 26827 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143306.1 protein_id gnl|my_center|LOCUS_01810 28845 28306 gene locus_tag LOCUS_01820 28845 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29560 28934 gene locus_tag LOCUS_01830 29560 28934 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_01830 29683 30177 gene locus_tag LOCUS_01840 29683 30177 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_01840 30255 31376 gene locus_tag LOCUS_01850 gene prfB 30255 31376 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_01850 32643 31468 gene locus_tag LOCUS_01860 32643 31468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 32773 33087 gene locus_tag LOCUS_01870 32773 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 33335 35344 gene locus_tag LOCUS_01880 gene feoB 33335 35344 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_01880 36286 35402 gene locus_tag LOCUS_01890 36286 35402 CDS product pseudouridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208146.1 protein_id gnl|my_center|LOCUS_01890 38694 36283 gene locus_tag LOCUS_01900 38694 36283 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_01900 39832 38729 gene locus_tag LOCUS_01910 gene glgD 39832 38729 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_01910 41027 39858 gene locus_tag LOCUS_01920 41027 39858 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418638.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence006 616 242 gene locus_tag LOCUS_01930 gene rplL 616 242 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_01930 1201 656 gene locus_tag LOCUS_01940 gene rplJ 1201 656 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_01940 2226 1570 gene locus_tag LOCUS_01950 2226 1570 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 protein_id gnl|my_center|LOCUS_01950 3000 2233 gene locus_tag LOCUS_01960 gene murI 3000 2233 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_01960 3041 3406 gene locus_tag LOCUS_01970 3041 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5391 3481 gene locus_tag LOCUS_01980 5391 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6003 5563 gene locus_tag LOCUS_01990 6003 5563 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_01990 6584 6000 gene locus_tag LOCUS_02000 6584 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7468 6581 gene locus_tag LOCUS_02010 7468 6581 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_02010 7977 7456 gene locus_tag LOCUS_02020 7977 7456 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645538.1 protein_id gnl|my_center|LOCUS_02020 10358 7974 gene locus_tag LOCUS_02030 10358 7974 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_02030 11111 10398 gene locus_tag LOCUS_02040 11111 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 12246 11149 gene locus_tag LOCUS_02050 12246 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 13053 12283 gene locus_tag LOCUS_02060 gene truA 13053 12283 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_02060 13853 13050 gene locus_tag LOCUS_02070 13853 13050 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_02070 14713 13847 gene locus_tag LOCUS_02080 14713 13847 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_02080 15587 14751 gene locus_tag LOCUS_02090 15587 14751 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_02090 16463 15603 gene locus_tag LOCUS_02100 16463 15603 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_02100 18249 16675 gene locus_tag LOCUS_02110 18249 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 18405 19097 gene locus_tag LOCUS_02120 gene yycF 18405 19097 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_02120 19101 20573 gene locus_tag LOCUS_02130 19101 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 20570 21037 gene locus_tag LOCUS_02140 20570 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 21071 22144 gene locus_tag LOCUS_02150 21071 22144 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_02150 22226 22789 gene locus_tag LOCUS_02160 gene efp 22226 22789 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_02160 24348 23128 gene locus_tag LOCUS_02170 24348 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_02170 24648 24523 gene locus_tag LOCUS_02180 24648 24523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 24937 25878 gene locus_tag LOCUS_02190 24937 25878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 26046 28127 gene locus_tag LOCUS_02200 26046 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 28761 28186 gene locus_tag LOCUS_02210 28761 28186 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_02210 30270 28918 gene locus_tag LOCUS_02220 30270 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 30815 31204 gene locus_tag LOCUS_02230 30815 31204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 31201 31437 gene locus_tag LOCUS_02240 31201 31437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 31434 31643 gene locus_tag LOCUS_02250 31434 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 31656 33038 gene locus_tag LOCUS_02260 31656 33038 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_02260 33140 34945 gene locus_tag LOCUS_02270 33140 34945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 34967 35497 gene locus_tag LOCUS_02280 34967 35497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 35494 35892 gene locus_tag LOCUS_02290 35494 35892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 35895 37109 gene locus_tag LOCUS_02300 35895 37109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 37176 37454 gene locus_tag LOCUS_02310 37176 37454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 37457 38308 gene locus_tag LOCUS_02320 37457 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 38321 38905 gene locus_tag LOCUS_02330 38321 38905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 38902 39168 gene locus_tag LOCUS_02340 38902 39168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 39165 39578 gene locus_tag LOCUS_02350 39165 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 39578 40279 gene locus_tag LOCUS_02360 39578 40279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 >Feature sequence007 455 1438 gene locus_tag LOCUS_02370 455 1438 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_02370 1546 2313 gene locus_tag LOCUS_02380 1546 2313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_02380 2306 4327 gene locus_tag LOCUS_02390 2306 4327 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_02390 5997 4384 gene locus_tag LOCUS_02400 5997 4384 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_02400 6288 7484 gene locus_tag LOCUS_02410 6288 7484 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_02410 7484 9022 gene locus_tag LOCUS_02420 7484 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9039 9200 gene locus_tag LOCUS_02430 9039 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9200 9907 gene locus_tag LOCUS_02440 9200 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10566 9985 gene locus_tag LOCUS_02450 10566 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 10725 12176 gene locus_tag LOCUS_02460 10725 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12173 13153 gene locus_tag LOCUS_02470 12173 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 14325 13207 gene locus_tag LOCUS_02480 14325 13207 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_02480 14941 14429 gene locus_tag LOCUS_02490 14941 14429 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_02490 16405 14945 gene locus_tag LOCUS_02500 16405 14945 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_02500 16603 17433 gene locus_tag LOCUS_02510 16603 17433 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_02510 17433 18371 gene locus_tag LOCUS_02520 17433 18371 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_02520 18667 19743 gene locus_tag LOCUS_02530 18667 19743 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906249.1 protein_id gnl|my_center|LOCUS_02530 21099 20038 gene locus_tag LOCUS_02540 21099 20038 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_02540 21659 21183 gene locus_tag LOCUS_02550 21659 21183 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_02550 21777 23024 gene locus_tag LOCUS_02560 21777 23024 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_02560 23604 23074 gene locus_tag LOCUS_02570 23604 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 23845 24372 gene locus_tag LOCUS_02580 23845 24372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 24511 24924 gene locus_tag LOCUS_02590 gene fur 24511 24924 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131709.1 protein_id gnl|my_center|LOCUS_02590 24917 25867 gene locus_tag LOCUS_02600 24917 25867 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_02600 25870 26577 gene locus_tag LOCUS_02610 25870 26577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_02610 26574 27398 gene locus_tag LOCUS_02620 26574 27398 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_02620 28170 27445 gene locus_tag LOCUS_02630 gene sigE 28170 27445 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_02630 29020 28184 gene locus_tag LOCUS_02640 29020 28184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 29225 30700 gene locus_tag LOCUS_02650 29225 30700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 30697 31254 gene locus_tag LOCUS_02660 30697 31254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 31247 31747 gene locus_tag LOCUS_02670 31247 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 31744 32634 gene locus_tag LOCUS_02680 31744 32634 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_02680 32607 34217 gene locus_tag LOCUS_02690 32607 34217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 34202 34903 gene locus_tag LOCUS_02700 34202 34903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 35827 34949 gene locus_tag LOCUS_02710 35827 34949 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_02710 37536 35845 gene locus_tag LOCUS_02720 37536 35845 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_02720 <38214 37533 gene locus_tag LOCUS_02730 <38214 37533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005278296.1:HTH-type transcriptional regulator CysB >Feature sequence008 592 179 gene locus_tag LOCUS_02740 592 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1622 579 gene locus_tag LOCUS_02750 1622 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2576 1764 gene locus_tag LOCUS_02760 2576 1764 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_02760 3177 2590 gene locus_tag LOCUS_02770 gene rsxA 3177 2590 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_02770 3868 3179 gene locus_tag LOCUS_02780 3868 3179 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_02780 4454 3882 gene locus_tag LOCUS_02790 4454 3882 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_02790 5505 4447 gene locus_tag LOCUS_02800 5505 4447 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_02800 6818 5502 gene locus_tag LOCUS_02810 gene rsxC 6818 5502 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_02810 7163 8863 gene locus_tag LOCUS_02820 7163 8863 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_02820 10358 8922 gene locus_tag LOCUS_02830 gene proS 10358 8922 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_02830 10916 10458 gene locus_tag LOCUS_02840 10916 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11131 12093 gene locus_tag LOCUS_02850 11131 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 12090 12293 gene locus_tag LOCUS_02860 12090 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 12771 12343 gene locus_tag LOCUS_02870 12771 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12882 13328 gene locus_tag LOCUS_02880 12882 13328 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_02880 14185 13565 gene locus_tag LOCUS_02890 gene purN 14185 13565 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_02890 16420 14195 gene locus_tag LOCUS_02900 16420 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 16568 17731 gene locus_tag LOCUS_02910 16568 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 17718 19763 gene locus_tag LOCUS_02920 17718 19763 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_02920 19760 20038 gene locus_tag LOCUS_02930 19760 20038 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_02930 20040 20423 gene locus_tag LOCUS_02940 20040 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 20574 21494 gene locus_tag LOCUS_02950 20574 21494 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_02950 21635 22909 gene locus_tag LOCUS_02960 21635 22909 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_02960 22911 23351 gene locus_tag LOCUS_02970 22911 23351 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_02970 23722 23489 gene locus_tag LOCUS_02980 23722 23489 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_02980 23814 23951 gene locus_tag LOCUS_02990 23814 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 24021 25367 gene locus_tag LOCUS_03000 24021 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 25811 29134 gene locus_tag LOCUS_03010 gene addB 25811 29134 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816091.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence009 764 135 gene locus_tag LOCUS_03020 764 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1052 789 gene locus_tag LOCUS_03030 1052 789 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_03030 2613 1369 gene locus_tag LOCUS_03040 2613 1369 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_03040 3350 2610 gene locus_tag LOCUS_03050 3350 2610 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_03050 3734 5029 gene locus_tag LOCUS_03060 3734 5029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_03060 5058 5258 gene locus_tag LOCUS_03070 5058 5258 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423406.1 protein_id gnl|my_center|LOCUS_03070 5270 6322 gene locus_tag LOCUS_03080 gene vorB 5270 6322 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890635.1 protein_id gnl|my_center|LOCUS_03080 6323 7060 gene locus_tag LOCUS_03090 6323 7060 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454726.1 protein_id gnl|my_center|LOCUS_03090 7057 7587 gene locus_tag LOCUS_03100 7057 7587 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_03100 7684 9126 gene locus_tag LOCUS_03110 7684 9126 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_03110 9163 10389 gene locus_tag LOCUS_03120 9163 10389 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_03120 10415 11404 gene locus_tag LOCUS_03130 10415 11404 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 protein_id gnl|my_center|LOCUS_03130 11712 12815 gene locus_tag LOCUS_03140 11712 12815 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_03140 14441 12864 gene locus_tag LOCUS_03150 14441 12864 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063660.1 protein_id gnl|my_center|LOCUS_03150 14659 14880 gene locus_tag LOCUS_03160 14659 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 15048 14767 gene locus_tag LOCUS_03170 15048 14767 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03170 15554 15123 gene locus_tag LOCUS_03180 15554 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 16348 16118 gene locus_tag LOCUS_03190 16348 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 17435 16716 gene locus_tag LOCUS_03200 17435 16716 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130794.1 protein_id gnl|my_center|LOCUS_03200 17757 18014 gene locus_tag LOCUS_03210 17757 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 18166 18567 gene locus_tag LOCUS_03220 18166 18567 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966444.1 protein_id gnl|my_center|LOCUS_03220 18752 19276 gene locus_tag LOCUS_03230 18752 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 19301 21493 gene locus_tag LOCUS_03240 gene copA 19301 21493 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_03240 21475 21759 gene locus_tag LOCUS_03250 21475 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 21987 21802 gene locus_tag LOCUS_03260 21987 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 22106 22369 gene locus_tag LOCUS_03270 22106 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 23178 22417 gene locus_tag LOCUS_03280 23178 22417 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_03280 24109 23255 gene locus_tag LOCUS_03290 24109 23255 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114712.1 protein_id gnl|my_center|LOCUS_03290 24314 25708 gene locus_tag LOCUS_03300 24314 25708 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_03300 25772 27061 gene locus_tag LOCUS_03310 25772 27061 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_03310 27188 27757 gene locus_tag LOCUS_03320 27188 27757 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_03320 28065 29980 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcaccccgtgcggggtgcgac >Feature sequence010 845 597 gene locus_tag LOCUS_03330 845 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1002 2129 gene locus_tag LOCUS_03340 1002 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2135 3172 gene locus_tag LOCUS_03350 2135 3172 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_03350 3176 4036 gene locus_tag LOCUS_03360 3176 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6802 4379 gene locus_tag LOCUS_03370 6802 4379 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074696.1 protein_id gnl|my_center|LOCUS_03370 8099 7494 gene locus_tag LOCUS_03380 8099 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 8348 11122 gene locus_tag LOCUS_03390 8348 11122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_03390 11187 11531 gene locus_tag LOCUS_03400 11187 11531 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675609.1 protein_id gnl|my_center|LOCUS_03400 11626 12822 gene locus_tag LOCUS_03410 gene fldC 11626 12822 CDS product phenyllactyl-CoA dehydratase subunit FldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048236.1 protein_id gnl|my_center|LOCUS_03410 12822 14387 gene locus_tag LOCUS_03420 12822 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14406 14585 gene locus_tag LOCUS_03430 14406 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 14715 15134 gene locus_tag LOCUS_03440 14715 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 15165 16916 gene locus_tag LOCUS_03450 15165 16916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681349.1 protein_id gnl|my_center|LOCUS_03450 16909 18798 gene locus_tag LOCUS_03460 16909 18798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681347.1 protein_id gnl|my_center|LOCUS_03460 18872 19291 gene locus_tag LOCUS_03470 18872 19291 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_03470 19510 20256 gene locus_tag LOCUS_03480 gene sufC 19510 20256 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_03480 20273 21679 gene locus_tag LOCUS_03490 gene sufB 20273 21679 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_03490 21707 22648 gene locus_tag LOCUS_03500 gene sufD 21707 22648 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_03500 22638 23852 gene locus_tag LOCUS_03510 22638 23852 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_03510 23842 24276 gene locus_tag LOCUS_03520 23842 24276 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_03520 24407 24976 gene locus_tag LOCUS_03530 24407 24976 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_03530 25079 26296 gene locus_tag LOCUS_03540 25079 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 26405 26770 gene locus_tag LOCUS_03550 26405 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03550 26760 27944 gene locus_tag LOCUS_03560 26760 27944 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_03560 27979 29349 gene locus_tag LOCUS_03570 27979 29349 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence011 329 538 gene locus_tag LOCUS_03580 329 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03580 787 1521 gene locus_tag LOCUS_03590 gene rpsB 787 1521 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_03590 1587 2498 gene locus_tag LOCUS_03600 gene tsf 1587 2498 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_03600 2774 3634 gene locus_tag LOCUS_03610 2774 3634 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_03610 3853 3668 gene locus_tag LOCUS_03620 3853 3668 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_03620 5119 3857 gene locus_tag LOCUS_03630 5119 3857 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_03630 5204 5872 gene locus_tag LOCUS_03640 gene nth 5204 5872 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_03640 5869 6546 gene locus_tag LOCUS_03650 gene tsaA 5869 6546 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03650 7374 6550 gene locus_tag LOCUS_03660 7374 6550 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_03660 7692 7432 gene locus_tag LOCUS_03670 7692 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8083 7808 gene locus_tag LOCUS_03680 8083 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8978 8247 gene locus_tag LOCUS_03690 8978 8247 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_03690 10566 9067 gene locus_tag LOCUS_03700 10566 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10785 10630 gene locus_tag LOCUS_03710 10785 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11734 10850 gene locus_tag LOCUS_03720 gene rsgA 11734 10850 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_03720 13450 11762 gene locus_tag LOCUS_03730 gene pknB 13450 11762 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_03730 14196 13471 gene locus_tag LOCUS_03740 14196 13471 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_03740 15241 14210 gene locus_tag LOCUS_03750 gene rlmN 15241 14210 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_03750 16566 15238 gene locus_tag LOCUS_03760 gene rsmB 16566 15238 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_03760 17492 16569 gene locus_tag LOCUS_03770 gene fmt 17492 16569 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_03770 17998 17498 gene locus_tag LOCUS_03780 gene def 17998 17498 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_03780 20466 18013 gene locus_tag LOCUS_03790 gene priA 20466 18013 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861610.1 protein_id gnl|my_center|LOCUS_03790 20718 20521 gene locus_tag LOCUS_03800 20718 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 21326 20715 gene locus_tag LOCUS_03810 gene gmk 21326 20715 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_03810 21586 21323 gene locus_tag LOCUS_03820 21586 21323 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_03820 22477 21599 gene locus_tag LOCUS_03830 22477 21599 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_03830 22906 22496 gene locus_tag LOCUS_03840 22906 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 24161 22911 gene locus_tag LOCUS_03850 24161 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 25035 24121 gene locus_tag LOCUS_03860 gene cdaA 25035 24121 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_03860 26264 25143 gene locus_tag LOCUS_03870 26264 25143 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_03870 26518 26261 gene locus_tag LOCUS_03880 26518 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 27054 26575 gene locus_tag LOCUS_03890 gene ispF 27054 26575 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_03890 27776 27051 gene locus_tag LOCUS_03900 gene ispD 27776 27051 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_03900 <29776 27917 gene locus_tag LOCUS_03910 <29776 27917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965152.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 >Feature sequence012 1015 560 gene locus_tag LOCUS_03920 1015 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_03920 1648 1091 gene locus_tag LOCUS_03930 1648 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2150 2353 gene locus_tag LOCUS_03940 2150 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2357 2977 gene locus_tag LOCUS_03950 2357 2977 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241777.1 protein_id gnl|my_center|LOCUS_03950 3088 3462 gene locus_tag LOCUS_03960 3088 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4071 3995 gene locus_tag LOCUS_t00050 4071 3995 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4196 5248 gene locus_tag LOCUS_03970 4196 5248 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_03970 4949 4855 gene locus_tag LOCUS_t00060 4949 4855 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5241 5777 gene locus_tag LOCUS_03980 5241 5777 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657895.1 protein_id gnl|my_center|LOCUS_03980 5774 7831 gene locus_tag LOCUS_03990 gene recG 5774 7831 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_03990 9025 8258 gene locus_tag LOCUS_04000 9025 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9716 9291 gene locus_tag LOCUS_04010 9716 9291 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_04010 10306 9713 gene locus_tag LOCUS_04020 10306 9713 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_04020 11498 10512 gene locus_tag LOCUS_04030 11498 10512 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_04030 11737 11662 gene locus_tag LOCUS_t00070 11737 11662 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12904 12233 gene locus_tag LOCUS_04040 gene radC 12904 12233 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_04040 13919 12891 gene locus_tag LOCUS_04050 gene tsaD 13919 12891 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_04050 14374 13916 gene locus_tag LOCUS_04060 gene rimI 14374 13916 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_04060 16935 14374 gene locus_tag LOCUS_04070 gene polA 16935 14374 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_04070 18917 16956 gene locus_tag LOCUS_04080 gene uvrB 18917 16956 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_04080 19372 19076 gene locus_tag LOCUS_04090 19372 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 19709 19533 gene locus_tag LOCUS_04100 19709 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 21093 19852 gene locus_tag LOCUS_04110 21093 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 21396 22058 gene locus_tag LOCUS_04120 21396 22058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 23352 22117 gene locus_tag LOCUS_04130 23352 22117 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_04130 24870 23473 gene locus_tag LOCUS_04140 24870 23473 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence013 338 150 gene locus_tag LOCUS_04150 gene rpmB 338 150 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_04150 599 1543 gene locus_tag LOCUS_04160 gene hprK 599 1543 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_04160 1565 2482 gene locus_tag LOCUS_04170 gene murB 1565 2482 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_04170 2235 2158 gene locus_tag LOCUS_t00080 2235 2158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2487 3350 gene locus_tag LOCUS_04180 gene rapZ 2487 3350 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_04180 3363 4262 gene locus_tag LOCUS_04190 gene whiA 3363 4262 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_04190 4275 7793 gene locus_tag LOCUS_04200 4275 7793 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_04200 7925 9220 gene locus_tag LOCUS_04210 7925 9220 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_04210 9217 10503 gene locus_tag LOCUS_04220 9217 10503 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_04220 10777 11787 gene locus_tag LOCUS_04230 10777 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 11891 13936 gene locus_tag LOCUS_04240 11891 13936 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_04240 14084 14641 gene locus_tag LOCUS_04250 14084 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 14748 14527 gene locus_tag LOCUS_04260 14748 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 15352 14756 gene locus_tag LOCUS_04270 15352 14756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810701.1 protein_id gnl|my_center|LOCUS_04270 16095 15349 gene locus_tag LOCUS_04280 16095 15349 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_04280 17090 16092 gene locus_tag LOCUS_04290 17090 16092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_04290 17515 17994 gene locus_tag LOCUS_04300 gene nuoE 17515 17994 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_04300 17994 19877 gene locus_tag LOCUS_04310 17994 19877 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416938.1 protein_id gnl|my_center|LOCUS_04310 19881 21578 gene locus_tag LOCUS_04320 19881 21578 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_04320 22256 21666 gene locus_tag LOCUS_04330 22256 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 23670 22390 gene locus_tag LOCUS_04340 23670 22390 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_04340 23833 24846 gene locus_tag LOCUS_04350 23833 24846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence014 746 540 gene locus_tag LOCUS_04360 746 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2120 762 gene locus_tag LOCUS_04370 2120 762 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963801.1 protein_id gnl|my_center|LOCUS_04370 2402 2133 gene locus_tag LOCUS_04380 2402 2133 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_04380 3005 2415 gene locus_tag LOCUS_04390 gene yfbR 3005 2415 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813851.1 protein_id gnl|my_center|LOCUS_04390 3176 5002 gene locus_tag LOCUS_04400 gene typA 3176 5002 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_04400 5216 5482 gene locus_tag LOCUS_04410 gene rpsO 5216 5482 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_04410 5689 7812 gene locus_tag LOCUS_04420 gene pnp 5689 7812 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_04420 7882 9129 gene locus_tag LOCUS_04430 7882 9129 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_04430 10329 9322 gene locus_tag LOCUS_04440 10329 9322 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_04440 11658 10348 gene locus_tag LOCUS_04450 11658 10348 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_04450 12808 11672 gene locus_tag LOCUS_04460 12808 11672 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_04460 13611 12985 gene locus_tag LOCUS_04470 13611 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 14343 13726 gene locus_tag LOCUS_04480 14343 13726 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_04480 14800 14357 gene locus_tag LOCUS_04490 gene dtd 14800 14357 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_04490 17115 14797 gene locus_tag LOCUS_04500 17115 14797 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_04500 19178 17163 gene locus_tag LOCUS_04510 gene recJ 19178 17163 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_04510 19390 19476 gene locus_tag LOCUS_t00090 19390 19476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19585 20709 gene locus_tag LOCUS_04520 19585 20709 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817429.1 protein_id gnl|my_center|LOCUS_04520 21804 20767 gene locus_tag LOCUS_04530 21804 20767 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_04530 22245 21916 gene locus_tag LOCUS_04540 gene azlD 22245 21916 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_04540 22946 22242 gene locus_tag LOCUS_04550 22946 22242 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_04550 <24342 23082 gene locus_tag LOCUS_04560 <24342 23082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262172.1:sodium-dependent transporter >Feature sequence015 850 1122 gene locus_tag LOCUS_04570 850 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1133 2368 gene locus_tag LOCUS_04580 gene yqfD 1133 2368 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_04580 2391 3383 gene locus_tag LOCUS_04590 2391 3383 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04590 3380 3868 gene locus_tag LOCUS_04600 gene ybeY 3380 3868 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_04600 3879 4769 gene locus_tag LOCUS_04610 gene era 3879 4769 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04610 4835 4975 gene locus_tag LOCUS_04620 4835 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4989 5735 gene locus_tag LOCUS_04630 4989 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 5737 6729 gene locus_tag LOCUS_04640 gene ansA 5737 6729 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_04640 6742 8076 gene locus_tag LOCUS_04650 6742 8076 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_04650 8311 10953 gene locus_tag LOCUS_04660 8311 10953 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_04660 11009 11872 gene locus_tag LOCUS_04670 11009 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 12240 11824 gene locus_tag LOCUS_04680 12240 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 12316 13074 gene locus_tag LOCUS_04690 12316 13074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_04690 13067 13882 gene locus_tag LOCUS_04700 13067 13882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_04700 13879 14862 gene locus_tag LOCUS_04710 13879 14862 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_04710 15777 14926 gene locus_tag LOCUS_04720 15777 14926 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_04720 16598 15921 gene locus_tag LOCUS_04730 16598 15921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_04730 17595 16603 gene locus_tag LOCUS_04740 17595 16603 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_04740 18802 17960 gene locus_tag LOCUS_04750 18802 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 19047 21773 gene locus_tag LOCUS_04760 19047 21773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_04760 21794 22138 gene locus_tag LOCUS_04770 21794 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 22949 22425 gene locus_tag LOCUS_04780 22949 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence016 846 310 gene locus_tag LOCUS_04790 846 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1782 1099 gene locus_tag LOCUS_04800 1782 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2046 3797 gene locus_tag LOCUS_04810 2046 3797 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_04810 4052 4996 gene locus_tag LOCUS_04820 gene argC 4052 4996 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_04820 5010 6221 gene locus_tag LOCUS_04830 gene argJ 5010 6221 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_04830 6240 7130 gene locus_tag LOCUS_04840 gene argB 6240 7130 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_04840 7111 8277 gene locus_tag LOCUS_04850 7111 8277 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04850 8292 9290 gene locus_tag LOCUS_04860 gene argF 8292 9290 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_04860 9287 10354 gene locus_tag LOCUS_04870 9287 10354 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288877.1 protein_id gnl|my_center|LOCUS_04870 10344 14372 gene locus_tag LOCUS_04880 gene carB 10344 14372 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_04880 14922 14437 gene locus_tag LOCUS_04890 14922 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15874 15020 gene locus_tag LOCUS_04900 gene noc 15874 15020 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_04900 16199 16423 gene locus_tag LOCUS_04910 16199 16423 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_04910 17159 16512 gene locus_tag LOCUS_04920 17159 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18771 17344 gene locus_tag LOCUS_04930 18771 17344 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_04930 20823 18904 gene locus_tag LOCUS_04940 20823 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 21923 20820 gene locus_tag LOCUS_04950 21923 20820 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_04950 22693 21920 gene locus_tag LOCUS_04960 22693 21920 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence017 592 849 gene locus_tag LOCUS_04970 592 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2848 1097 gene locus_tag LOCUS_04980 2848 1097 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_04980 4257 3034 gene locus_tag LOCUS_04990 4257 3034 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_04990 5632 4259 gene locus_tag LOCUS_05000 5632 4259 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_05000 6303 5629 gene locus_tag LOCUS_05010 6303 5629 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_05010 6813 6472 gene locus_tag LOCUS_05020 gene rplQ 6813 6472 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_05020 7798 6848 gene locus_tag LOCUS_05030 7798 6848 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_05030 8505 7879 gene locus_tag LOCUS_05040 gene rpsD 8505 7879 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05040 8927 8526 gene locus_tag LOCUS_05050 gene rpsK 8927 8526 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_05050 9310 8942 gene locus_tag LOCUS_05060 gene rpsM 9310 8942 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_05060 9772 9554 gene locus_tag LOCUS_05070 gene infA 9772 9554 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_05070 10566 9811 gene locus_tag LOCUS_05080 gene map 10566 9811 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_05080 11198 10563 gene locus_tag LOCUS_05090 11198 10563 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_05090 12513 11215 gene locus_tag LOCUS_05100 gene secY 12513 11215 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_05100 12955 12515 gene locus_tag LOCUS_05110 gene rplO 12955 12515 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_05110 13152 12970 gene locus_tag LOCUS_05120 13152 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13696 13166 gene locus_tag LOCUS_05130 gene rpsE 13696 13166 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_05130 14073 13714 gene locus_tag LOCUS_05140 gene rplR 14073 13714 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865622.1 protein_id gnl|my_center|LOCUS_05140 14629 14090 gene locus_tag LOCUS_05150 gene rplF 14629 14090 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_05150 15043 14645 gene locus_tag LOCUS_05160 gene rpsH 15043 14645 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_05160 15694 15509 gene locus_tag LOCUS_05170 15694 15509 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_05170 16264 15710 gene locus_tag LOCUS_05180 gene rplE 16264 15710 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_05180 16588 16283 gene locus_tag LOCUS_05190 gene rplX 16588 16283 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_05190 16974 16603 gene locus_tag LOCUS_05200 gene rplN 16974 16603 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_05200 17250 16987 gene locus_tag LOCUS_05210 gene rpsQ 17250 16987 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_05210 17459 17265 gene locus_tag LOCUS_05220 gene rpmC 17459 17265 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_05220 17889 17461 gene locus_tag LOCUS_05230 gene rplP 17889 17461 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_05230 18767 17889 gene locus_tag LOCUS_05240 18767 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 19132 18785 gene locus_tag LOCUS_05250 gene rplV 19132 18785 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_05250 19420 19145 gene locus_tag LOCUS_05260 gene rpsS 19420 19145 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_05260 20271 19435 gene locus_tag LOCUS_05270 gene rplB 20271 19435 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_05270 20583 20287 gene locus_tag LOCUS_05280 gene rplW 20583 20287 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_05280 21206 20583 gene locus_tag LOCUS_05290 gene rplD 21206 20583 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_05290 21944 21225 gene locus_tag LOCUS_05300 gene rplC 21944 21225 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence018 999 127 gene locus_tag LOCUS_05310 gene rsmA 999 127 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_05310 2296 1010 gene locus_tag LOCUS_05320 2296 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2786 2301 gene locus_tag LOCUS_05330 gene rimM 2786 2301 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640383.1 protein_id gnl|my_center|LOCUS_05330 3086 2856 gene locus_tag LOCUS_05340 3086 2856 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_05340 3344 3102 gene locus_tag LOCUS_05350 gene rpsP 3344 3102 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_05350 4793 3408 gene locus_tag LOCUS_05360 gene ffh 4793 3408 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05360 5149 4799 gene locus_tag LOCUS_05370 5149 4799 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392480.1 protein_id gnl|my_center|LOCUS_05370 5308 12438 gene locus_tag LOCUS_05380 5308 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 12501 13790 gene locus_tag LOCUS_05390 12501 13790 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_05390 13780 15069 gene locus_tag LOCUS_05400 13780 15069 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_05400 15050 15916 gene locus_tag LOCUS_05410 gene lgt 15050 15916 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_05410 15955 16512 gene locus_tag LOCUS_05420 15955 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 16901 16500 gene locus_tag LOCUS_05430 16901 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 17051 17377 gene locus_tag LOCUS_05440 17051 17377 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_05440 19247 17439 gene locus_tag LOCUS_05450 19247 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 20101 19259 gene locus_tag LOCUS_05460 20101 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 20338 20129 gene locus_tag LOCUS_05470 20338 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 20425 20500 gene locus_tag LOCUS_t00100 20425 20500 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20521 20605 gene locus_tag LOCUS_t00110 20521 20605 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 21053 20886 gene locus_tag LOCUS_05480 21053 20886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence019 1963 1196 gene locus_tag LOCUS_05490 gene fabG 1963 1196 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_05490 2828 2241 gene locus_tag LOCUS_05500 2828 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4065 2821 gene locus_tag LOCUS_05510 4065 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6315 4324 gene locus_tag LOCUS_05520 6315 4324 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004800524.1 protein_id gnl|my_center|LOCUS_05520 6936 8861 gene locus_tag LOCUS_05530 6936 8861 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_05530 8892 9425 gene locus_tag LOCUS_05540 8892 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 9525 10592 gene locus_tag LOCUS_05550 9525 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 10654 11148 gene locus_tag LOCUS_05560 10654 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 11156 11710 gene locus_tag LOCUS_05570 11156 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 11830 12885 gene locus_tag LOCUS_05580 11830 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 13007 14596 gene locus_tag LOCUS_05590 gene putP 13007 14596 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 protein_id gnl|my_center|LOCUS_05590 14618 15466 gene locus_tag LOCUS_05600 14618 15466 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_05600 15463 16332 gene locus_tag LOCUS_05610 15463 16332 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_05610 16329 17249 gene locus_tag LOCUS_05620 16329 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17275 18162 gene locus_tag LOCUS_05630 17275 18162 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_05630 18159 19262 gene locus_tag LOCUS_05640 18159 19262 CDS product NAD/NADP octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891455.1 protein_id gnl|my_center|LOCUS_05640 19241 20242 gene locus_tag LOCUS_05650 19241 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence020 552 418 gene locus_tag LOCUS_05660 gene rpmH 552 418 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966999.1 protein_id gnl|my_center|LOCUS_05660 1264 680 gene locus_tag LOCUS_05670 gene thiT 1264 680 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869028.1 protein_id gnl|my_center|LOCUS_05670 2478 1477 gene locus_tag LOCUS_05680 2478 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4324 2768 gene locus_tag LOCUS_05690 4324 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5079 4321 gene locus_tag LOCUS_05700 gene phnC 5079 4321 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258841.1 protein_id gnl|my_center|LOCUS_05700 6124 5084 gene locus_tag LOCUS_05710 6124 5084 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_05710 7424 7119 gene locus_tag LOCUS_05720 7424 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7798 7439 gene locus_tag LOCUS_05730 7798 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8165 8413 gene locus_tag LOCUS_05740 gene spoIIID 8165 8413 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_05740 8497 9519 gene locus_tag LOCUS_05750 gene spoVAD 8497 9519 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_05750 9516 9878 gene locus_tag LOCUS_05760 gene spoVAE 9516 9878 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_05760 10501 9962 gene locus_tag LOCUS_05770 10501 9962 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_05770 11249 10503 gene locus_tag LOCUS_05780 11249 10503 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_05780 12329 11250 gene locus_tag LOCUS_05790 12329 11250 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_05790 12554 12345 gene locus_tag LOCUS_05800 12554 12345 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_05800 13343 12615 gene locus_tag LOCUS_05810 13343 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_05810 14360 13557 gene locus_tag LOCUS_05820 14360 13557 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_05820 15190 14477 gene locus_tag LOCUS_05830 gene sigF 15190 14477 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_05830 15621 15187 gene locus_tag LOCUS_05840 gene spoIIAB 15621 15187 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_05840 15950 15615 gene locus_tag LOCUS_05850 gene spoIIAA 15950 15615 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 protein_id gnl|my_center|LOCUS_05850 18680 16056 gene locus_tag LOCUS_05860 18680 16056 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_05860 19783 18977 gene locus_tag LOCUS_05870 19783 18977 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816742.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence021 271 38 gene locus_tag LOCUS_05880 271 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 873 439 gene locus_tag LOCUS_05890 873 439 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245055.1 protein_id gnl|my_center|LOCUS_05890 1865 1044 gene locus_tag LOCUS_05900 gene rlmA 1865 1044 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_05900 2648 1926 gene locus_tag LOCUS_05910 2648 1926 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101161.1 protein_id gnl|my_center|LOCUS_05910 3411 2635 gene locus_tag LOCUS_05920 3411 2635 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_05920 4272 3484 gene locus_tag LOCUS_05930 4272 3484 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_05930 4555 4920 gene locus_tag LOCUS_05940 4555 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5571 4960 gene locus_tag LOCUS_05950 5571 4960 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_05950 8473 5591 gene locus_tag LOCUS_05960 8473 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 12544 8579 gene locus_tag LOCUS_05970 12544 8579 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_05970 13610 12552 gene locus_tag LOCUS_05980 gene ispG 13610 12552 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_05980 14719 13673 gene locus_tag LOCUS_05990 gene rseP 14719 13673 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_05990 15880 14732 gene locus_tag LOCUS_06000 15880 14732 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460412.1 protein_id gnl|my_center|LOCUS_06000 16723 15893 gene locus_tag LOCUS_06010 16723 15893 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_06010 17498 16764 gene locus_tag LOCUS_06020 17498 16764 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_06020 18152 17598 gene locus_tag LOCUS_06030 gene frr 18152 17598 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_06030 18907 18188 gene locus_tag LOCUS_06040 gene pyrH 18907 18188 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042663.1 protein_id gnl|my_center|LOCUS_06040 19154 19014 gene locus_tag LOCUS_06050 19154 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 19170 19511 gene locus_tag LOCUS_06060 19170 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence022 537 199 gene locus_tag LOCUS_06070 537 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1384 572 gene locus_tag LOCUS_06080 1384 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 1709 2635 gene locus_tag LOCUS_06090 gene prmA 1709 2635 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_06090 4403 3114 gene locus_tag LOCUS_06100 4403 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5986 4499 gene locus_tag LOCUS_06110 5986 4499 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_06110 6676 5987 gene locus_tag LOCUS_06120 6676 5987 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_06120 6892 7899 gene locus_tag LOCUS_06130 gene aroC 6892 7899 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06130 7914 8933 gene locus_tag LOCUS_06140 7914 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8926 10047 gene locus_tag LOCUS_06150 8926 10047 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949044.1 protein_id gnl|my_center|LOCUS_06150 10189 11121 gene locus_tag LOCUS_06160 10189 11121 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429006.1 protein_id gnl|my_center|LOCUS_06160 11275 11559 gene locus_tag LOCUS_06170 11275 11559 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_06170 11592 13220 gene locus_tag LOCUS_06180 gene groL 11592 13220 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_06180 13895 13338 gene locus_tag LOCUS_06190 13895 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 15951 14410 gene locus_tag LOCUS_06200 gene rny 15951 14410 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_06200 16222 18000 gene locus_tag LOCUS_06210 16222 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 18035 18475 gene locus_tag LOCUS_06220 gene rpiB 18035 18475 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_06220 18504 19586 gene locus_tag LOCUS_06230 18504 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence023 1689 865 gene locus_tag LOCUS_06240 1689 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2582 1809 gene locus_tag LOCUS_06250 2582 1809 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_06250 3242 2595 gene locus_tag LOCUS_06260 3242 2595 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_06260 4139 3321 gene locus_tag LOCUS_06270 4139 3321 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_06270 4366 6243 gene locus_tag LOCUS_06280 gene mnmG 4366 6243 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_06280 5865 5960 gene locus_tag LOCUS_t00120 5865 5960 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6440 6763 gene locus_tag LOCUS_06290 6440 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6756 7649 gene locus_tag LOCUS_06300 6756 7649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_06300 7624 9495 gene locus_tag LOCUS_06310 7624 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9692 11170 gene locus_tag LOCUS_06320 9692 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 12943 11492 gene locus_tag LOCUS_06330 12943 11492 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_06330 13387 13941 gene locus_tag LOCUS_06340 13387 13941 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_06340 14012 14815 gene locus_tag LOCUS_06350 14012 14815 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_06350 15302 14853 gene locus_tag LOCUS_06360 gene tadA 15302 14853 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_06360 16380 15379 gene locus_tag LOCUS_06370 gene pta 16380 15379 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_06370 16568 16879 gene locus_tag LOCUS_06380 16568 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 16876 18678 gene locus_tag LOCUS_06390 gene lepA 16876 18678 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_06390 18693 18944 gene locus_tag LOCUS_06400 18693 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence024 1118 708 gene locus_tag LOCUS_06410 gene rpsI 1118 708 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_06410 1564 1136 gene locus_tag LOCUS_06420 gene rplM 1564 1136 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_06420 1781 2506 gene locus_tag LOCUS_06430 1781 2506 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_06430 2827 2594 gene locus_tag LOCUS_06440 2827 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3113 2793 gene locus_tag LOCUS_06450 3113 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3469 3230 gene locus_tag LOCUS_06460 3469 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5668 3695 gene locus_tag LOCUS_06470 5668 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7216 5909 gene locus_tag LOCUS_06480 7216 5909 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199804.1 protein_id gnl|my_center|LOCUS_06480 7533 8675 gene locus_tag LOCUS_06490 7533 8675 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_06490 8672 9475 gene locus_tag LOCUS_06500 8672 9475 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_06500 9509 10075 gene locus_tag LOCUS_06510 9509 10075 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_06510 10139 11578 gene locus_tag LOCUS_06520 10139 11578 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_06520 13029 11638 gene locus_tag LOCUS_06530 13029 11638 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956936.1 protein_id gnl|my_center|LOCUS_06530 14069 13338 gene locus_tag LOCUS_06540 14069 13338 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_06540 14166 14654 gene locus_tag LOCUS_06550 14166 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 14769 14861 gene locus_tag LOCUS_t00130 14769 14861 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15726 15025 gene locus_tag LOCUS_06560 15726 15025 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_06560 17701 15719 gene locus_tag LOCUS_06570 17701 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 18022 17753 gene locus_tag LOCUS_06580 18022 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence025 1179 487 gene locus_tag LOCUS_06590 gene sleB 1179 487 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_06590 3000 1255 gene locus_tag LOCUS_06600 gene thrS 3000 1255 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_06600 3426 3716 gene locus_tag LOCUS_06610 3426 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4868 3771 gene locus_tag LOCUS_06620 gene ychF 4868 3771 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_06620 5887 5009 gene locus_tag LOCUS_06630 5887 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6507 6725 gene locus_tag LOCUS_06640 6507 6725 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_06640 7377 6847 gene locus_tag LOCUS_06650 7377 6847 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_06650 9492 7492 gene locus_tag LOCUS_06660 9492 7492 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_06660 10829 9489 gene locus_tag LOCUS_06670 10829 9489 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_06670 11377 10835 gene locus_tag LOCUS_06680 11377 10835 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_06680 12443 11475 gene locus_tag LOCUS_06690 12443 11475 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_06690 14163 12604 gene locus_tag LOCUS_06700 14163 12604 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_06700 14613 15797 gene locus_tag LOCUS_06710 14613 15797 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_06710 15911 17527 gene locus_tag LOCUS_06720 15911 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence026 162 25 gene locus_tag LOCUS_06730 162 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 439 1758 gene locus_tag LOCUS_06740 439 1758 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06740 1789 2946 gene locus_tag LOCUS_06750 1789 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2960 3796 gene locus_tag LOCUS_06760 2960 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4674 3844 gene locus_tag LOCUS_06770 4674 3844 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_06770 6022 4676 gene locus_tag LOCUS_06780 6022 4676 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_06780 6625 6134 gene locus_tag LOCUS_06790 6625 6134 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_06790 7293 6628 gene locus_tag LOCUS_06800 7293 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 8186 7425 gene locus_tag LOCUS_06810 8186 7425 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_06810 8748 8323 gene locus_tag LOCUS_06820 8748 8323 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_06820 8972 9184 gene locus_tag LOCUS_06830 8972 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9198 9422 gene locus_tag LOCUS_06840 9198 9422 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_06840 9499 11982 gene locus_tag LOCUS_06850 9499 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 12022 12201 gene locus_tag LOCUS_06860 12022 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12395 13276 gene locus_tag LOCUS_06870 12395 13276 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_06870 14683 13331 gene locus_tag LOCUS_06880 14683 13331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_06880 16038 15244 gene locus_tag LOCUS_06890 16038 15244 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_06890 16602 16126 gene locus_tag LOCUS_06900 16602 16126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_06900 16749 17642 gene locus_tag LOCUS_06910 16749 17642 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence027 171 2786 gene locus_tag LOCUS_06920 171 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2776 3243 gene locus_tag LOCUS_06930 2776 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3245 5005 gene locus_tag LOCUS_06940 3245 5005 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_06940 5414 5049 gene locus_tag LOCUS_06950 5414 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5621 6127 gene locus_tag LOCUS_06960 5621 6127 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_06960 6167 6691 gene locus_tag LOCUS_06970 6167 6691 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989773.1 protein_id gnl|my_center|LOCUS_06970 6823 8097 gene locus_tag LOCUS_06980 6823 8097 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_06980 8252 8920 gene locus_tag LOCUS_06990 gene sdaAB 8252 8920 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_06990 8917 9795 gene locus_tag LOCUS_07000 gene sdaAA 8917 9795 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_07000 9936 10889 gene locus_tag LOCUS_07010 9936 10889 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_07010 10901 12241 gene locus_tag LOCUS_07020 10901 12241 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_07020 12331 13086 gene locus_tag LOCUS_07030 12331 13086 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246182.1 protein_id gnl|my_center|LOCUS_07030 13099 14343 gene locus_tag LOCUS_07040 gene dprA 13099 14343 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_07040 14349 16688 gene locus_tag LOCUS_07050 gene topA 14349 16688 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence028 <1 724 gene locus_tag LOCUS_07060 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015963.1:sodium-dependent transporter 1821 799 gene locus_tag LOCUS_07070 1821 799 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438242.1 protein_id gnl|my_center|LOCUS_07070 1981 2490 gene locus_tag LOCUS_07080 1981 2490 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_07080 4152 2554 gene locus_tag LOCUS_07090 4152 2554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_07090 4859 4146 gene locus_tag LOCUS_07100 4859 4146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131171868.1 protein_id gnl|my_center|LOCUS_07100 5158 6366 gene locus_tag LOCUS_07110 gene ilvA 5158 6366 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_07110 6382 6753 gene locus_tag LOCUS_07120 6382 6753 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_07120 6979 7233 gene locus_tag LOCUS_07130 6979 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8711 7407 gene locus_tag LOCUS_07140 8711 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9013 8708 gene locus_tag LOCUS_07150 9013 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9287 9871 gene locus_tag LOCUS_07160 9287 9871 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 protein_id gnl|my_center|LOCUS_07160 11246 9984 gene locus_tag LOCUS_07170 11246 9984 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_07170 11398 11862 gene locus_tag LOCUS_07180 11398 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13106 11922 gene locus_tag LOCUS_07190 13106 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 16662 13144 gene locus_tag LOCUS_07200 gene mfd 16662 13144 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence029 1174 182 gene locus_tag LOCUS_07210 1174 182 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_07210 1866 1195 gene locus_tag LOCUS_07220 1866 1195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_07220 2661 1957 gene locus_tag LOCUS_07230 2661 1957 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_07230 2847 3671 gene locus_tag LOCUS_07240 2847 3671 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_07240 3656 4513 gene locus_tag LOCUS_07250 3656 4513 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_07250 4510 5298 gene locus_tag LOCUS_07260 4510 5298 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_07260 5328 5888 gene locus_tag LOCUS_07270 5328 5888 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_07270 5881 6468 gene locus_tag LOCUS_07280 5881 6468 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_07280 10929 6682 gene locus_tag LOCUS_07290 10929 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 11566 11378 gene locus_tag LOCUS_07300 11566 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 11870 12775 gene locus_tag LOCUS_07310 11870 12775 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_07310 13087 12848 gene locus_tag LOCUS_07320 gene rpsR 13087 12848 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_07320 13582 13112 gene locus_tag LOCUS_07330 gene ssb 13582 13112 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_07330 13891 13595 gene locus_tag LOCUS_07340 gene rpsF 13891 13595 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_07340 14876 13998 gene locus_tag LOCUS_07350 14876 13998 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_07350 <16688 15052 gene locus_tag LOCUS_07360 <16688 15052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965527.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence030 85 1077 gene locus_tag LOCUS_07370 85 1077 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_07370 3355 1346 gene locus_tag LOCUS_07380 gene ftsH 3355 1346 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_07380 3941 3393 gene locus_tag LOCUS_07390 gene hpt 3941 3393 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_07390 5253 3922 gene locus_tag LOCUS_07400 gene tilS 5253 3922 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_07400 6592 5243 gene locus_tag LOCUS_07410 gene dnaB 6592 5243 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_07410 7071 6622 gene locus_tag LOCUS_07420 gene rplI 7071 6622 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_07420 9117 7090 gene locus_tag LOCUS_07430 9117 7090 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_07430 9243 10250 gene locus_tag LOCUS_07440 9243 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11149 10496 gene locus_tag LOCUS_07450 11149 10496 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_07450 12562 11189 gene locus_tag LOCUS_07460 12562 11189 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_07460 14337 12559 gene locus_tag LOCUS_07470 14337 12559 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_07470 14663 14349 gene locus_tag LOCUS_07480 14663 14349 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_07480 15657 14656 gene locus_tag LOCUS_07490 15657 14656 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_07490 16339 15737 gene locus_tag LOCUS_07500 16339 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence031 <1 717 gene locus_tag LOCUS_07510 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941934.1:energy-coupling factor ABC transporter permease 821 1621 gene locus_tag LOCUS_07520 gene cbiQ 821 1621 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_07520 1634 2374 gene locus_tag LOCUS_07530 1634 2374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_07530 2443 3366 gene locus_tag LOCUS_07540 2443 3366 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 protein_id gnl|my_center|LOCUS_07540 4915 3698 gene locus_tag LOCUS_07550 4915 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6439 4937 gene locus_tag LOCUS_07560 6439 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6512 7048 gene locus_tag LOCUS_07570 6512 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 7054 8775 gene locus_tag LOCUS_07580 7054 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9206 10987 gene locus_tag LOCUS_07590 9206 10987 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384371.1 protein_id gnl|my_center|LOCUS_07590 11024 12337 gene locus_tag LOCUS_07600 11024 12337 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966105.1 protein_id gnl|my_center|LOCUS_07600 12567 12479 gene locus_tag LOCUS_t00140 12567 12479 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13872 12637 gene locus_tag LOCUS_07610 13872 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence032 340 1212 gene locus_tag LOCUS_07620 340 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1848 1261 gene locus_tag LOCUS_07630 1848 1261 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_07630 3241 1877 gene locus_tag LOCUS_07640 3241 1877 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_07640 4271 3423 gene locus_tag LOCUS_07650 4271 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5167 4382 gene locus_tag LOCUS_07660 5167 4382 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_07660 6971 5298 gene locus_tag LOCUS_07670 6971 5298 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_07670 7087 8043 gene locus_tag LOCUS_07680 7087 8043 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_07680 8836 8093 gene locus_tag LOCUS_07690 8836 8093 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_07690 9417 8857 gene locus_tag LOCUS_07700 9417 8857 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390032.1 protein_id gnl|my_center|LOCUS_07700 10159 9428 gene locus_tag LOCUS_07710 10159 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12027 10156 gene locus_tag LOCUS_07720 gene abc-f 12027 10156 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_07720 13345 12041 gene locus_tag LOCUS_07730 13345 12041 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_07730 15036 13342 gene locus_tag LOCUS_07740 15036 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 15170 15520 gene locus_tag LOCUS_07750 15170 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence033 1015 524 gene locus_tag LOCUS_07760 1015 524 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_07760 2008 1112 gene locus_tag LOCUS_07770 2008 1112 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_07770 2231 2013 gene locus_tag LOCUS_07780 2231 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4122 2692 gene locus_tag LOCUS_07790 4122 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4320 4126 gene locus_tag LOCUS_07800 4320 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6107 4317 gene locus_tag LOCUS_07810 6107 4317 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102374990.1 protein_id gnl|my_center|LOCUS_07810 6284 6964 gene locus_tag LOCUS_07820 6284 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6948 8192 gene locus_tag LOCUS_07830 6948 8192 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_07830 8189 10966 gene locus_tag LOCUS_07840 8189 10966 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_07840 11756 11433 gene locus_tag LOCUS_07850 11756 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 11758 11919 gene locus_tag LOCUS_07860 11758 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 11964 13730 gene locus_tag LOCUS_07870 11964 13730 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 13788 14432 gene locus_tag LOCUS_07880 gene cas5c 13788 14432 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence034 1862 114 gene locus_tag LOCUS_07890 1862 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3068 1863 gene locus_tag LOCUS_07900 3068 1863 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_07900 3433 3714 gene locus_tag LOCUS_07910 3433 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3738 3926 gene locus_tag LOCUS_07920 3738 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4060 4623 gene locus_tag LOCUS_07930 4060 4623 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_07930 4930 6426 gene locus_tag LOCUS_07940 4930 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7275 6535 gene locus_tag LOCUS_07950 7275 6535 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_07950 9845 7281 gene locus_tag LOCUS_07960 9845 7281 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_07960 10868 9963 gene locus_tag LOCUS_07970 10868 9963 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_07970 11018 12109 gene locus_tag LOCUS_07980 11018 12109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 protein_id gnl|my_center|LOCUS_07980 12168 14315 gene locus_tag LOCUS_07990 12168 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14353 14595 gene locus_tag LOCUS_08000 14353 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence035 324 1148 gene locus_tag LOCUS_08010 324 1148 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766404.1 protein_id gnl|my_center|LOCUS_08010 1220 1933 gene locus_tag LOCUS_08020 1220 1933 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_08020 1952 2692 gene locus_tag LOCUS_08030 1952 2692 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 protein_id gnl|my_center|LOCUS_08030 2679 3347 gene locus_tag LOCUS_08040 2679 3347 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_08040 3344 3952 gene locus_tag LOCUS_08050 3344 3952 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_08050 4083 3949 gene locus_tag LOCUS_08060 4083 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4577 4197 gene locus_tag LOCUS_08070 4577 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4713 5879 gene locus_tag LOCUS_08080 gene mltG 4713 5879 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_08080 5943 7136 gene locus_tag LOCUS_08090 5943 7136 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_08090 7392 7598 gene locus_tag LOCUS_08100 7392 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7632 10271 gene locus_tag LOCUS_08110 gene alaS 7632 10271 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_08110 10284 10625 gene locus_tag LOCUS_08120 10284 10625 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_08120 10708 12987 gene locus_tag LOCUS_08130 10708 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 12997 14052 gene locus_tag LOCUS_08140 12997 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence036 1018 263 gene locus_tag LOCUS_08150 1018 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1822 1058 gene locus_tag LOCUS_08160 gene rlmB 1822 1058 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_08160 1991 2827 gene locus_tag LOCUS_08170 1991 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2833 3648 gene locus_tag LOCUS_08180 2833 3648 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_08180 3764 4003 gene locus_tag LOCUS_08190 3764 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4250 7303 gene locus_tag LOCUS_08200 4250 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence037 2 2443 gene locus_tag LOCUS_08210 2 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2556 2756 gene locus_tag LOCUS_08220 gene rpmE 2556 2756 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_08220 3284 3105 gene locus_tag LOCUS_08230 3284 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4907 3303 gene locus_tag LOCUS_08240 4907 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6110 4929 gene locus_tag LOCUS_08250 6110 4929 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454390.1 protein_id gnl|my_center|LOCUS_08250 6947 6372 gene locus_tag LOCUS_08260 6947 6372 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_08260 7145 8869 gene locus_tag LOCUS_08270 7145 8869 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_08270 8866 10119 gene locus_tag LOCUS_08280 8866 10119 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_08280 10116 10481 gene locus_tag LOCUS_08290 10116 10481 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_08290 10527 12083 gene locus_tag LOCUS_08300 10527 12083 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_08300 12080 13849 gene locus_tag LOCUS_08310 12080 13849 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence038 151 531 gene locus_tag LOCUS_08320 151 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3112 590 gene locus_tag LOCUS_08330 3112 590 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_08330 3455 3138 gene locus_tag LOCUS_08340 3455 3138 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_08340 3544 3762 gene locus_tag LOCUS_08350 3544 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4747 3821 gene locus_tag LOCUS_08360 4747 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5838 5077 gene locus_tag LOCUS_08370 5838 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 6084 6917 gene locus_tag LOCUS_08380 6084 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6939 8123 gene locus_tag LOCUS_08390 6939 8123 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_08390 8260 9693 gene locus_tag LOCUS_08400 8260 9693 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_08400 9697 10491 gene locus_tag LOCUS_08410 9697 10491 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_08410 10505 11500 gene locus_tag LOCUS_08420 10505 11500 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_08420 11660 12184 gene locus_tag LOCUS_08430 11660 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 12414 12338 gene locus_tag LOCUS_t00150 12414 12338 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12559 13950 gene locus_tag LOCUS_08440 12559 13950 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence039 560 243 gene locus_tag LOCUS_08450 560 243 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_08450 1335 766 gene locus_tag LOCUS_08460 1335 766 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_08460 1792 1379 gene locus_tag LOCUS_08470 1792 1379 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_08470 2659 2231 gene locus_tag LOCUS_08480 2659 2231 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_08480 3809 2760 gene locus_tag LOCUS_08490 3809 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3920 4162 gene locus_tag LOCUS_08500 3920 4162 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_08500 4512 5561 gene locus_tag LOCUS_08510 4512 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6058 6756 gene locus_tag LOCUS_08520 gene rsmG 6058 6756 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_08520 7915 6869 gene locus_tag LOCUS_08530 7915 6869 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_08530 8646 8344 gene locus_tag LOCUS_08540 8646 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9041 8718 gene locus_tag LOCUS_08550 9041 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9233 11287 gene locus_tag LOCUS_08560 9233 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 11412 11702 gene locus_tag LOCUS_08570 11412 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11718 13217 gene locus_tag LOCUS_08580 11718 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence040 3 983 gene locus_tag LOCUS_08590 3 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 983 1147 gene locus_tag LOCUS_08600 983 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1405 1208 gene locus_tag LOCUS_08610 1405 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2612 1644 gene locus_tag LOCUS_08620 2612 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 4256 2622 gene locus_tag LOCUS_08630 4256 2622 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_08630 5777 5256 gene locus_tag LOCUS_08640 5777 5256 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_08640 6244 5777 gene locus_tag LOCUS_08650 gene smpB 6244 5777 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_08650 6783 6316 gene locus_tag LOCUS_08660 6783 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6931 7497 gene locus_tag LOCUS_08670 6931 7497 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_08670 7636 8931 gene locus_tag LOCUS_08680 7636 8931 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_08680 8928 9731 gene locus_tag LOCUS_08690 8928 9731 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_08690 9713 10201 gene locus_tag LOCUS_08700 gene rlmH 9713 10201 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_08700 10224 10559 gene locus_tag LOCUS_08710 10224 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10552 12282 gene locus_tag LOCUS_08720 10552 12282 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_08720 12349 12903 gene locus_tag LOCUS_08730 12349 12903 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_08730 12900 13484 gene locus_tag LOCUS_08740 12900 13484 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence041 1788 1309 gene locus_tag LOCUS_08750 1788 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2047 1817 gene locus_tag LOCUS_08760 gene atpE 2047 1817 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142903.1 protein_id gnl|my_center|LOCUS_08760 2780 2118 gene locus_tag LOCUS_08770 gene atpB 2780 2118 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582552.1 protein_id gnl|my_center|LOCUS_08770 3195 2773 gene locus_tag LOCUS_08780 3195 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3497 4735 gene locus_tag LOCUS_08790 3497 4735 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_08790 4732 5604 gene locus_tag LOCUS_08800 gene ispE 4732 5604 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_08800 5697 6326 gene locus_tag LOCUS_08810 gene spoIIR 5697 6326 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_08810 7340 6402 gene locus_tag LOCUS_08820 7340 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 8800 7337 gene locus_tag LOCUS_08830 8800 7337 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 protein_id gnl|my_center|LOCUS_08830 9789 8833 gene locus_tag LOCUS_08840 9789 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <13420 10061 gene locus_tag LOCUS_08850 <13420 10061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965948.1:pyruvate carboxylase >Feature sequence042 1396 710 gene locus_tag LOCUS_08860 1396 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2037 1468 gene locus_tag LOCUS_08870 2037 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2816 2112 gene locus_tag LOCUS_08880 2816 2112 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_08880 4032 2833 gene locus_tag LOCUS_08890 4032 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4296 4069 gene locus_tag LOCUS_08900 gene hfq 4296 4069 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392630.1 protein_id gnl|my_center|LOCUS_08900 5368 4424 gene locus_tag LOCUS_08910 gene miaA 5368 4424 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_08910 5477 6319 gene locus_tag LOCUS_08920 5477 6319 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_08920 8295 6373 gene locus_tag LOCUS_08930 8295 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8448 9860 gene locus_tag LOCUS_08940 gene miaB 8448 9860 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_08940 9864 12470 gene locus_tag LOCUS_08950 gene mutS 9864 12470 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_08950 12472 13176 gene locus_tag LOCUS_08960 12472 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence043 <1 1072 gene locus_tag LOCUS_08970 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903799.1:acyl-CoA dehydrogenase family protein 1085 1897 gene locus_tag LOCUS_08980 1085 1897 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_08980 1890 2900 gene locus_tag LOCUS_08990 1890 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2925 3716 gene locus_tag LOCUS_09000 2925 3716 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183923.1 protein_id gnl|my_center|LOCUS_09000 3734 4492 gene locus_tag LOCUS_09010 3734 4492 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065257.1 protein_id gnl|my_center|LOCUS_09010 6190 4565 gene locus_tag LOCUS_09020 6190 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6669 8210 gene locus_tag LOCUS_09030 6669 8210 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_09030 9532 8345 gene locus_tag LOCUS_09040 9532 8345 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_09040 10257 9796 gene locus_tag LOCUS_09050 10257 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 11400 10285 gene locus_tag LOCUS_09060 11400 10285 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_09060 13032 11635 gene locus_tag LOCUS_09070 13032 11635 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876425.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence044 3 380 gene locus_tag LOCUS_09080 3 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 737 504 gene locus_tag LOCUS_09090 737 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1000 2145 gene locus_tag LOCUS_09100 1000 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3552 2224 gene locus_tag LOCUS_09110 gene brnQ 3552 2224 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 protein_id gnl|my_center|LOCUS_09110 3755 4615 gene locus_tag LOCUS_09120 3755 4615 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088772.1 protein_id gnl|my_center|LOCUS_09120 6669 4729 gene locus_tag LOCUS_09130 6669 4729 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_09130 7452 6691 gene locus_tag LOCUS_09140 7452 6691 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_09140 7955 7452 gene locus_tag LOCUS_09150 7955 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 8309 9724 gene locus_tag LOCUS_09160 8309 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9759 10229 gene locus_tag LOCUS_09170 9759 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10260 10652 gene locus_tag LOCUS_09180 10260 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12514 10799 gene locus_tag LOCUS_09190 12514 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence045 587 1717 gene locus_tag LOCUS_09200 gene dacF 587 1717 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_09200 1792 3072 gene locus_tag LOCUS_09210 1792 3072 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_09210 3160 3579 gene locus_tag LOCUS_09220 3160 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_09220 3878 3633 gene locus_tag LOCUS_09230 3878 3633 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234988.1 protein_id gnl|my_center|LOCUS_09230 4207 3932 gene locus_tag LOCUS_09240 4207 3932 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_09240 5093 4275 gene locus_tag LOCUS_09250 5093 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6768 5161 gene locus_tag LOCUS_09260 6768 5161 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_09260 7900 6881 gene locus_tag LOCUS_09270 gene gap 7900 6881 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_09270 8123 9190 gene locus_tag LOCUS_09280 8123 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 10064 9246 gene locus_tag LOCUS_09290 gene lipA 10064 9246 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_09290 10803 10039 gene locus_tag LOCUS_09300 10803 10039 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_09300 11531 10800 gene locus_tag LOCUS_09310 gene nadE 11531 10800 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_09310 <13333 11554 gene locus_tag LOCUS_09320 <13333 11554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393509.1:NAD-dependent DNA ligase LigA >Feature sequence046 59 352 gene locus_tag LOCUS_09330 59 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 642 295 gene locus_tag LOCUS_09340 642 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 812 1090 gene locus_tag LOCUS_09350 812 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1110 1607 gene locus_tag LOCUS_09360 1110 1607 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_09360 1675 2601 gene locus_tag LOCUS_09370 1675 2601 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_09370 3402 3280 gene locus_tag LOCUS_09380 3402 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6467 3933 gene locus_tag LOCUS_09390 6467 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6727 10059 gene locus_tag LOCUS_09400 6727 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11268 10375 gene locus_tag LOCUS_09410 11268 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 12851 11283 gene locus_tag LOCUS_09420 12851 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 13075 12863 gene locus_tag LOCUS_09430 13075 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence047 240 965 gene locus_tag LOCUS_09440 240 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1378 1022 gene locus_tag LOCUS_09450 gene rplT 1378 1022 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_09450 1606 1409 gene locus_tag LOCUS_09460 gene rpmI 1606 1409 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_09460 2078 1632 gene locus_tag LOCUS_09470 gene infC 2078 1632 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830789.1 protein_id gnl|my_center|LOCUS_09470 2465 2857 gene locus_tag LOCUS_09480 2465 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3609 2851 gene locus_tag LOCUS_09490 gene deoC 3609 2851 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_09490 3743 4366 gene locus_tag LOCUS_09500 3743 4366 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_09500 5295 4441 gene locus_tag LOCUS_09510 5295 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5798 5433 gene locus_tag LOCUS_09520 5798 5433 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_09520 5943 7838 gene locus_tag LOCUS_09530 gene glgB 5943 7838 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_09530 7852 11343 gene locus_tag LOCUS_09540 7852 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence048 163 1581 gene locus_tag LOCUS_09550 163 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1581 2141 gene locus_tag LOCUS_09560 1581 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2278 3069 gene locus_tag LOCUS_09570 2278 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3389 4774 gene locus_tag LOCUS_09580 gene fumC 3389 4774 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_09580 4777 5952 gene locus_tag LOCUS_09590 4777 5952 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_09590 5986 8364 gene locus_tag LOCUS_09600 5986 8364 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_09600 8486 8749 gene locus_tag LOCUS_09610 8486 8749 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_09610 8842 10674 gene locus_tag LOCUS_09620 gene uvrC 8842 10674 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_09620 10665 11207 gene locus_tag LOCUS_09630 gene rsmD 10665 11207 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_09630 11204 11695 gene locus_tag LOCUS_09640 gene coaD 11204 11695 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_09640 11756 12319 gene locus_tag LOCUS_09650 11756 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence049 522 139 gene locus_tag LOCUS_09660 522 139 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941063.1 protein_id gnl|my_center|LOCUS_09660 2219 519 gene locus_tag LOCUS_09670 gene recN 2219 519 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_09670 2693 2244 gene locus_tag LOCUS_09680 2693 2244 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_09680 3562 2705 gene locus_tag LOCUS_09690 3562 2705 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_09690 4377 3559 gene locus_tag LOCUS_09700 4377 3559 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_09700 6233 4374 gene locus_tag LOCUS_09710 gene dxs 6233 4374 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_09710 7228 6350 gene locus_tag LOCUS_09720 7228 6350 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09720 7465 7232 gene locus_tag LOCUS_09730 7465 7232 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 protein_id gnl|my_center|LOCUS_09730 8669 7440 gene locus_tag LOCUS_09740 gene xseA 8669 7440 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_09740 9198 8671 gene locus_tag LOCUS_09750 gene nusB 9198 8671 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_09750 9582 9220 gene locus_tag LOCUS_09760 9582 9220 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_09760 10851 9715 gene locus_tag LOCUS_09770 10851 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11417 11238 gene locus_tag LOCUS_09780 11417 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence050 468 49 gene locus_tag LOCUS_09790 468 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1212 535 gene locus_tag LOCUS_09800 1212 535 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_09800 1432 1953 gene locus_tag LOCUS_09810 1432 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1972 2475 gene locus_tag LOCUS_09820 gene greA 1972 2475 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_09820 2687 2535 gene locus_tag LOCUS_09830 2687 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3883 2897 gene locus_tag LOCUS_09840 3883 2897 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_09840 4042 4575 gene locus_tag LOCUS_09850 4042 4575 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_09850 6063 4651 gene locus_tag LOCUS_09860 6063 4651 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903277.1 protein_id gnl|my_center|LOCUS_09860 6282 6950 gene locus_tag LOCUS_09870 6282 6950 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_09870 6950 7867 gene locus_tag LOCUS_09880 6950 7867 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_09880 9911 7932 gene locus_tag LOCUS_09890 9911 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10251 9949 gene locus_tag LOCUS_09900 10251 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11032 10334 gene locus_tag LOCUS_09910 11032 10334 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence051 1647 106 gene locus_tag LOCUS_09920 gene guaA 1647 106 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_09920 3494 1662 gene locus_tag LOCUS_09930 gene glmS 3494 1662 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_09930 3874 4074 gene locus_tag LOCUS_09940 3874 4074 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_09940 5300 4140 gene locus_tag LOCUS_09950 5300 4140 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_09950 5416 5949 gene locus_tag LOCUS_09960 5416 5949 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_09960 7173 6010 gene locus_tag LOCUS_09970 7173 6010 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_09970 8257 7166 gene locus_tag LOCUS_09980 gene serC 8257 7166 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_09980 9630 8344 gene locus_tag LOCUS_09990 gene mtaB 9630 8344 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_09990 9661 10794 gene locus_tag LOCUS_10000 9661 10794 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_10000 <11767 10783 gene locus_tag LOCUS_10010 <11767 10783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_132377852.1:AI-2E family transporter >Feature sequence052 3222 457 gene locus_tag LOCUS_10020 3222 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3925 4755 gene locus_tag LOCUS_10030 gene thiM 3925 4755 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_10030 4742 5383 gene locus_tag LOCUS_10040 gene thiE 4742 5383 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_10040 5483 6286 gene locus_tag LOCUS_10050 gene thiD 5483 6286 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_10050 6289 7461 gene locus_tag LOCUS_10060 gene cytX 6289 7461 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705129.1 protein_id gnl|my_center|LOCUS_10060 7832 8755 gene locus_tag LOCUS_10070 7832 8755 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_10070 8769 8984 gene locus_tag LOCUS_10080 8769 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 9781 9029 gene locus_tag LOCUS_10090 9781 9029 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_10090 9912 10829 gene locus_tag LOCUS_10100 9912 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11272 10868 gene locus_tag LOCUS_10110 11272 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 11323 11541 gene locus_tag LOCUS_10120 11323 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence053 734 78 gene locus_tag LOCUS_10130 734 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1480 731 gene locus_tag LOCUS_10140 1480 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2181 1495 gene locus_tag LOCUS_10150 2181 1495 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986593.1 protein_id gnl|my_center|LOCUS_10150 2768 2181 gene locus_tag LOCUS_10160 2768 2181 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666370.1 protein_id gnl|my_center|LOCUS_10160 3702 2914 gene locus_tag LOCUS_10170 3702 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4291 4989 gene locus_tag LOCUS_10180 gene dapD 4291 4989 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_10180 5037 6134 gene locus_tag LOCUS_10190 5037 6134 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_10190 6128 7279 gene locus_tag LOCUS_10200 6128 7279 CDS product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 protein_id gnl|my_center|LOCUS_10200 7308 8195 gene locus_tag LOCUS_10210 gene dapA 7308 8195 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_10210 8233 8904 gene locus_tag LOCUS_10220 8233 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 8901 10217 gene locus_tag LOCUS_10230 8901 10217 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_10230 11103 10423 gene locus_tag LOCUS_10240 11103 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 11615 11184 gene locus_tag LOCUS_10250 11615 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence054 146 928 gene locus_tag LOCUS_10260 gene tpiA 146 928 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564269.1 protein_id gnl|my_center|LOCUS_10260 925 2448 gene locus_tag LOCUS_10270 gene gpmI 925 2448 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_10270 2461 3753 gene locus_tag LOCUS_10280 gene eno 2461 3753 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_10280 3833 4528 gene locus_tag LOCUS_10290 3833 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4616 4692 gene locus_tag LOCUS_t00160 4616 4692 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4725 4799 gene locus_tag LOCUS_t00170 4725 4799 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4803 4879 gene locus_tag LOCUS_t00180 4803 4879 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4932 5759 gene locus_tag LOCUS_10300 4932 5759 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766372.1 protein_id gnl|my_center|LOCUS_10300 6997 5810 gene locus_tag LOCUS_10310 6997 5810 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_10310 7192 7935 gene locus_tag LOCUS_10320 7192 7935 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090697.1 protein_id gnl|my_center|LOCUS_10320 9097 7991 gene locus_tag LOCUS_10330 9097 7991 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_10330 9233 10456 gene locus_tag LOCUS_10340 9233 10456 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_10340 <11535 10510 gene locus_tag LOCUS_10350 <11535 10510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767612.1:sodium-translocating pyrophosphatase >Feature sequence055 3100 653 gene locus_tag LOCUS_10360 3100 653 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476221.1 protein_id gnl|my_center|LOCUS_10360 4017 3181 gene locus_tag LOCUS_10370 4017 3181 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_10370 4644 4021 gene locus_tag LOCUS_10380 4644 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4995 6737 gene locus_tag LOCUS_10390 4995 6737 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10390 6956 8176 gene locus_tag LOCUS_10400 6956 8176 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_10400 8446 9822 gene locus_tag LOCUS_10410 gene argH 8446 9822 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence056 85 1221 gene locus_tag LOCUS_10420 gene murG 85 1221 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_10420 1278 2537 gene locus_tag LOCUS_10430 gene murA 1278 2537 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_10430 2554 3333 gene locus_tag LOCUS_10440 2554 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3378 4661 gene locus_tag LOCUS_10450 3378 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4737 5561 gene locus_tag LOCUS_10460 4737 5561 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_10460 5745 6326 gene locus_tag LOCUS_10470 5745 6326 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532679.1 protein_id gnl|my_center|LOCUS_10470 6316 7665 gene locus_tag LOCUS_10480 6316 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 8130 7762 gene locus_tag LOCUS_10490 8130 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8888 8196 gene locus_tag LOCUS_10500 gene sigK 8888 8196 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_10500 9141 9350 gene locus_tag LOCUS_10510 9141 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9522 9815 gene locus_tag LOCUS_10520 9522 9815 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986587.1 protein_id gnl|my_center|LOCUS_10520 9812 10561 gene locus_tag LOCUS_10530 9812 10561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263300.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence057 1280 399 gene locus_tag LOCUS_10540 1280 399 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_10540 1429 2001 gene locus_tag LOCUS_10550 1429 2001 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_10550 2615 2061 gene locus_tag LOCUS_10560 2615 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3090 2650 gene locus_tag LOCUS_10570 3090 2650 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_10570 3210 3752 gene locus_tag LOCUS_10580 3210 3752 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020496.1 protein_id gnl|my_center|LOCUS_10580 3777 4751 gene locus_tag LOCUS_10590 3777 4751 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_10590 4764 5519 gene locus_tag LOCUS_10600 4764 5519 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_10600 5602 6765 gene locus_tag LOCUS_10610 5602 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7016 8929 gene locus_tag LOCUS_10620 7016 8929 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10620 9075 9551 gene locus_tag LOCUS_10630 9075 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9564 10157 gene locus_tag LOCUS_10640 9564 10157 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_10640 10391 10564 gene locus_tag LOCUS_10650 10391 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence058 991 1482 gene locus_tag LOCUS_10660 gene ybaK 991 1482 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_10660 1501 4329 gene locus_tag LOCUS_10670 gene uvrA 1501 4329 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_10670 4372 4719 gene locus_tag LOCUS_10680 4372 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4695 6917 gene locus_tag LOCUS_10690 4695 6917 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_10690 6914 7567 gene locus_tag LOCUS_10700 6914 7567 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_10700 7635 8666 gene locus_tag LOCUS_10710 7635 8666 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_10710 8702 9604 gene locus_tag LOCUS_10720 8702 9604 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence059 323 1459 gene locus_tag LOCUS_10730 gene hrcA 323 1459 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_10730 1401 2027 gene locus_tag LOCUS_10740 1401 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2080 3945 gene locus_tag LOCUS_10750 gene dnaK 2080 3945 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_10750 4062 4478 gene locus_tag LOCUS_10760 4062 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10760 4605 5216 gene locus_tag LOCUS_10770 4605 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10770 5362 6399 gene locus_tag LOCUS_10780 gene mutY 5362 6399 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486227.1 protein_id gnl|my_center|LOCUS_10780 7236 6454 gene locus_tag LOCUS_10790 7236 6454 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_10790 8386 7475 gene locus_tag LOCUS_10800 8386 7475 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_10800 8558 8869 gene locus_tag LOCUS_10810 8558 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence060 2508 739 gene locus_tag LOCUS_10820 2508 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3558 2551 gene locus_tag LOCUS_10830 3558 2551 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_10830 4933 4295 gene locus_tag LOCUS_10840 4933 4295 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_10840 6215 4935 gene locus_tag LOCUS_10850 gene hflX 6215 4935 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_10850 7510 6566 gene locus_tag LOCUS_10860 7510 6566 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964846.1 protein_id gnl|my_center|LOCUS_10860 8448 7516 gene locus_tag LOCUS_10870 8448 7516 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_10870 9195 8779 gene locus_tag LOCUS_10880 9195 8779 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_10880 <10172 9204 gene locus_tag LOCUS_10890 <10172 9204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta >Feature sequence061 3906 2314 gene locus_tag LOCUS_10900 3906 2314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_10900 5111 3903 gene locus_tag LOCUS_10910 5111 3903 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_10910 5823 5377 gene locus_tag LOCUS_10920 5823 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6604 5951 gene locus_tag LOCUS_10930 6604 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 7212 6616 gene locus_tag LOCUS_10940 7212 6616 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814942.1 protein_id gnl|my_center|LOCUS_10940 7351 8292 gene locus_tag LOCUS_10950 7351 8292 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence062 1339 650 gene locus_tag LOCUS_10960 1339 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1604 1401 gene locus_tag LOCUS_10970 1604 1401 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_10970 1970 1692 gene locus_tag LOCUS_10980 1970 1692 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_10980 2637 2017 gene locus_tag LOCUS_10990 2637 2017 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_10990 3785 2745 gene locus_tag LOCUS_11000 gene ruvB 3785 2745 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_11000 4415 3804 gene locus_tag LOCUS_11010 gene ruvA 4415 3804 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 protein_id gnl|my_center|LOCUS_11010 4915 4400 gene locus_tag LOCUS_11020 gene ruvC 4915 4400 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11020 5913 5023 gene locus_tag LOCUS_11030 gene xerD 5913 5023 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_11030 6539 5961 gene locus_tag LOCUS_11040 6539 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7282 6854 gene locus_tag LOCUS_11050 7282 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7734 7354 gene locus_tag LOCUS_11060 7734 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8925 7795 gene locus_tag LOCUS_11070 gene tgt 8925 7795 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_11070 9515 9063 gene locus_tag LOCUS_11080 9515 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence063 242 1723 gene locus_tag LOCUS_11090 gene thrC 242 1723 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_11090 1944 1756 gene locus_tag LOCUS_11100 1944 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2030 2719 gene locus_tag LOCUS_11110 2030 2719 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_11110 2834 4162 gene locus_tag LOCUS_11120 gene tig 2834 4162 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11120 4240 4821 gene locus_tag LOCUS_11130 gene clpP 4240 4821 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_11130 4884 6134 gene locus_tag LOCUS_11140 gene clpX 4884 6134 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_11140 6182 6877 gene locus_tag LOCUS_11150 6182 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 6908 8602 gene locus_tag LOCUS_11160 6908 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11160 8613 9206 gene locus_tag LOCUS_11170 gene yihA 8613 9206 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816879.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence064 845 411 gene locus_tag LOCUS_11180 gene rnhA 845 411 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_11180 3346 842 gene locus_tag LOCUS_11190 gene gyrA 3346 842 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_11190 5292 3361 gene locus_tag LOCUS_11200 gene gyrB 5292 3361 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_11200 5591 5322 gene locus_tag LOCUS_11210 5591 5322 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_11210 6691 5591 gene locus_tag LOCUS_11220 gene recF 6691 5591 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_11220 6903 6688 gene locus_tag LOCUS_11230 6903 6688 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_11230 8033 6927 gene locus_tag LOCUS_11240 gene dnaN 8033 6927 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_11240 9597 8275 gene locus_tag LOCUS_11250 gene dnaA 9597 8275 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence065 807 34 gene locus_tag LOCUS_11260 807 34 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_11260 983 1435 gene locus_tag LOCUS_11270 983 1435 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 protein_id gnl|my_center|LOCUS_11270 2690 1497 gene locus_tag LOCUS_11280 2690 1497 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_11280 3130 2687 gene locus_tag LOCUS_11290 gene aroQ 3130 2687 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_11290 4347 3127 gene locus_tag LOCUS_11300 4347 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5489 4347 gene locus_tag LOCUS_11310 gene pheA 5489 4347 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130282.1 protein_id gnl|my_center|LOCUS_11310 6781 5501 gene locus_tag LOCUS_11320 gene aroA 6781 5501 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11320 7839 6778 gene locus_tag LOCUS_11330 gene aroB 7839 6778 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_11330 8669 7836 gene locus_tag LOCUS_11340 8669 7836 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_11340 <9660 8666 gene locus_tag LOCUS_11350 <9660 8666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439427.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence066 363 58 gene locus_tag LOCUS_11360 363 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1299 469 gene locus_tag LOCUS_11370 1299 469 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_11370 1425 1781 gene locus_tag LOCUS_11380 1425 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1817 2329 gene locus_tag LOCUS_11390 1817 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2436 3668 gene locus_tag LOCUS_11400 2436 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3753 5357 gene locus_tag LOCUS_11410 3753 5357 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_11410 6593 5718 gene locus_tag LOCUS_11420 6593 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6995 7309 gene locus_tag LOCUS_11430 6995 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7309 9291 gene locus_tag LOCUS_11440 7309 9291 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence067 47 277 gene locus_tag LOCUS_11450 47 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 413 871 gene locus_tag LOCUS_11460 gene nrdR 413 871 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_11460 1245 868 gene locus_tag LOCUS_11470 1245 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1919 1242 gene locus_tag LOCUS_11480 1919 1242 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_11480 1995 2828 gene locus_tag LOCUS_11490 gene dapF 1995 2828 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_11490 2865 3560 gene locus_tag LOCUS_11500 gene nagB 2865 3560 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 protein_id gnl|my_center|LOCUS_11500 3613 4962 gene locus_tag LOCUS_11510 gene glmM 3613 4962 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_11510 4967 5623 gene locus_tag LOCUS_11520 4967 5623 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11520 6468 5677 gene locus_tag LOCUS_11530 6468 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6613 7149 gene locus_tag LOCUS_11540 6613 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7146 8159 gene locus_tag LOCUS_11550 gene asnA 7146 8159 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_11550 8313 8957 gene locus_tag LOCUS_11560 8313 8957 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713769.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence068 1392 3437 gene locus_tag LOCUS_11570 gene fusA 1392 3437 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_11570 3501 4319 gene locus_tag LOCUS_11580 3501 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5674 4370 gene locus_tag LOCUS_11590 5674 4370 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 protein_id gnl|my_center|LOCUS_11590 6233 5739 gene locus_tag LOCUS_11600 6233 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6771 6289 gene locus_tag LOCUS_11610 6771 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7152 6802 gene locus_tag LOCUS_11620 7152 6802 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_11620 8350 7235 gene locus_tag LOCUS_11630 gene alr 8350 7235 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_11630 8909 8307 gene locus_tag LOCUS_11640 8909 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9397 8918 gene locus_tag LOCUS_11650 9397 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence069 2535 472 gene locus_tag LOCUS_11660 2535 472 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_11660 2968 3558 gene locus_tag LOCUS_11670 2968 3558 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_11670 3686 4096 gene locus_tag LOCUS_11680 gene iscR 3686 4096 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_11680 4228 5418 gene locus_tag LOCUS_11690 gene nifS 4228 5418 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_11690 5448 5879 gene locus_tag LOCUS_11700 gene nifU 5448 5879 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_11700 7154 6012 gene locus_tag LOCUS_11710 gene rodA 7154 6012 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_11710 7274 7705 gene locus_tag LOCUS_11720 7274 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 7699 8409 gene locus_tag LOCUS_11730 gene tsaB 7699 8409 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_11730 8439 9068 gene locus_tag LOCUS_11740 gene upp 8439 9068 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence070 <1 910 gene locus_tag LOCUS_11750 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813284.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO 907 1932 gene locus_tag LOCUS_11760 gene plsX 907 1932 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_11760 1932 2609 gene locus_tag LOCUS_11770 gene rnc 1932 2609 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_11770 2784 6344 gene locus_tag LOCUS_11780 gene smc 2784 6344 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_11780 6361 7269 gene locus_tag LOCUS_11790 gene ftsY 6361 7269 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_11790 7266 7856 gene locus_tag LOCUS_11800 7266 7856 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 protein_id gnl|my_center|LOCUS_11800 7843 8148 gene locus_tag LOCUS_11810 gene yhbY 7843 8148 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_11810 8145 9332 gene locus_tag LOCUS_11820 8145 9332 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence071 609 190 gene locus_tag LOCUS_11830 609 190 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_11830 1540 626 gene locus_tag LOCUS_11840 gene pyrB 1540 626 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_11840 2192 1542 gene locus_tag LOCUS_11850 gene pyrE 2192 1542 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_11850 2929 2231 gene locus_tag LOCUS_11860 gene pyrF 2929 2231 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_11860 3839 2922 gene locus_tag LOCUS_11870 3839 2922 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_11870 4561 3821 gene locus_tag LOCUS_11880 4561 3821 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_11880 7747 4565 gene locus_tag LOCUS_11890 gene carB 7747 4565 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_11890 8808 7813 gene locus_tag LOCUS_11900 gene pyrC 8808 7813 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_11900 7874 7969 gene locus_tag LOCUS_t00190 7874 7969 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 1283 414 gene locus_tag LOCUS_11910 1283 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2083 1322 gene locus_tag LOCUS_11920 2083 1322 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_11920 2878 2234 gene locus_tag LOCUS_11930 2878 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3228 3153 gene locus_tag LOCUS_t00200 3228 3153 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3603 3527 gene locus_tag LOCUS_t00210 3603 3527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4336 3701 gene locus_tag LOCUS_11940 4336 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5809 4451 gene locus_tag LOCUS_11950 5809 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6545 5871 gene locus_tag LOCUS_11960 6545 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8041 6551 gene locus_tag LOCUS_11970 gene gltX 8041 6551 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence073 409 858 gene locus_tag LOCUS_11980 gene mscL 409 858 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_11980 924 1000 gene locus_tag LOCUS_t00220 924 1000 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1247 1498 gene locus_tag LOCUS_11990 1247 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1495 1872 gene locus_tag LOCUS_12000 1495 1872 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_12000 2756 2364 gene locus_tag LOCUS_12010 2756 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2968 3600 gene locus_tag LOCUS_12020 2968 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3712 4917 gene locus_tag LOCUS_12030 3712 4917 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_12030 4919 6487 gene locus_tag LOCUS_12040 4919 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6500 6655 gene locus_tag LOCUS_12050 6500 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6864 8093 gene locus_tag LOCUS_12060 gene sstT 6864 8093 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence074 813 172 gene locus_tag LOCUS_12070 gene plsY 813 172 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_12070 2135 810 gene locus_tag LOCUS_12080 gene der 2135 810 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_12080 3523 2138 gene locus_tag LOCUS_12090 3523 2138 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_12090 3805 3623 gene locus_tag LOCUS_12100 gene rpmF 3805 3623 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_12100 4351 3821 gene locus_tag LOCUS_12110 4351 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4473 5444 gene locus_tag LOCUS_12120 4473 5444 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_12120 7021 5732 gene locus_tag LOCUS_12130 7021 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7745 7005 gene locus_tag LOCUS_12140 7745 7005 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_12140 8885 7773 gene locus_tag LOCUS_12150 8885 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence075 1571 531 gene locus_tag LOCUS_12160 1571 531 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_12160 1738 2730 gene locus_tag LOCUS_12170 1738 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3702 2791 gene locus_tag LOCUS_12180 gene ribF 3702 2791 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_12180 4575 3706 gene locus_tag LOCUS_12190 gene truB 4575 3706 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905772.1 protein_id gnl|my_center|LOCUS_12190 5510 4572 gene locus_tag LOCUS_12200 5510 4572 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_12200 5876 5514 gene locus_tag LOCUS_12210 gene rbfA 5876 5514 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965109.1 protein_id gnl|my_center|LOCUS_12210 8228 5889 gene locus_tag LOCUS_12220 8228 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8677 8225 gene locus_tag LOCUS_12230 8677 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 8906 8634 gene locus_tag LOCUS_12240 8906 8634 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence076 2 571 gene locus_tag LOCUS_12250 2 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 764 2266 gene locus_tag LOCUS_12260 764 2266 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_12260 2418 2960 gene locus_tag LOCUS_12270 2418 2960 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384382.1 protein_id gnl|my_center|LOCUS_12270 2953 4488 gene locus_tag LOCUS_12280 2953 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5163 4543 gene locus_tag LOCUS_12290 5163 4543 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_12290 6395 5064 gene locus_tag LOCUS_12300 6395 5064 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_12300 6614 7423 gene locus_tag LOCUS_12310 6614 7423 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_12310 8287 7781 gene locus_tag LOCUS_12320 8287 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence077 820 2391 gene locus_tag LOCUS_12330 820 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2495 2656 gene locus_tag LOCUS_12340 2495 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2653 3378 gene locus_tag LOCUS_12350 2653 3378 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_12350 3375 4418 gene locus_tag LOCUS_12360 3375 4418 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_12360 4596 5129 gene locus_tag LOCUS_12370 4596 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5126 5329 gene locus_tag LOCUS_12380 5126 5329 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_12380 6849 5434 gene locus_tag LOCUS_12390 6849 5434 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_12390 7823 6924 gene locus_tag LOCUS_12400 7823 6924 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_12400 8309 7836 gene locus_tag LOCUS_12410 8309 7836 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence078 90 2033 gene locus_tag LOCUS_12420 gene metG 90 2033 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_12420 2170 3762 gene locus_tag LOCUS_12430 2170 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4351 5394 gene locus_tag LOCUS_12440 4351 5394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_12440 5423 6355 gene locus_tag LOCUS_12450 5423 6355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_12450 6348 7166 gene locus_tag LOCUS_12460 6348 7166 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_12460 7758 8048 gene locus_tag LOCUS_12470 7758 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence079 247 3969 gene locus_tag LOCUS_12480 gene rpoC 247 3969 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788197.1 protein_id gnl|my_center|LOCUS_12480 4241 4663 gene locus_tag LOCUS_12490 gene rpsL 4241 4663 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_12490 4793 5263 gene locus_tag LOCUS_12500 gene rpsG 4793 5263 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_12500 5288 7360 gene locus_tag LOCUS_12510 gene fusA 5288 7360 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence080 107 1234 gene locus_tag LOCUS_12520 gene mnmA 107 1234 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_12520 1225 2187 gene locus_tag LOCUS_12530 1225 2187 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_12530 2184 2612 gene locus_tag LOCUS_12540 2184 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2751 3122 gene locus_tag LOCUS_12550 2751 3122 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_12550 3180 3398 gene locus_tag LOCUS_12560 3180 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3452 3757 gene locus_tag LOCUS_12570 3452 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12570 3791 5272 gene locus_tag LOCUS_12580 3791 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12580 6890 5562 gene locus_tag LOCUS_12590 6890 5562 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_12590 7601 7038 gene locus_tag LOCUS_12600 7601 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence081 1741 2 gene locus_tag LOCUS_12610 1741 2 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_12610 3219 2188 gene locus_tag LOCUS_12620 3219 2188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_12620 4520 3216 gene locus_tag LOCUS_12630 4520 3216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_12630 6064 4517 gene locus_tag LOCUS_12640 6064 4517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_12640 7610 6468 gene locus_tag LOCUS_12650 7610 6468 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence082 89 244 gene locus_tag LOCUS_12660 89 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 506 339 gene locus_tag LOCUS_12670 506 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 963 520 gene locus_tag LOCUS_12680 gene spoVAC 963 520 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_12680 1691 1236 gene locus_tag LOCUS_12690 1691 1236 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_12690 2095 1688 gene locus_tag LOCUS_12700 2095 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2287 2709 gene locus_tag LOCUS_12710 2287 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2736 4433 gene locus_tag LOCUS_12720 gene argS 2736 4433 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_12720 5257 4742 gene locus_tag LOCUS_12730 5257 4742 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_12730 5841 5263 gene locus_tag LOCUS_12740 5841 5263 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_12740 6187 6432 gene locus_tag LOCUS_12750 6187 6432 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966909.1 protein_id gnl|my_center|LOCUS_12750 7325 6495 gene locus_tag LOCUS_12760 gene rsmI 7325 6495 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence083 <1 2095 gene locus_tag LOCUS_12770 <1 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit 2126 2578 gene locus_tag LOCUS_12780 2126 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3621 2632 gene locus_tag LOCUS_12790 gene spoIID 3621 2632 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_12790 3768 4535 gene locus_tag LOCUS_12800 3768 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4615 5367 gene locus_tag LOCUS_12810 4615 5367 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_12810 5380 6075 gene locus_tag LOCUS_12820 5380 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_12820 6072 7505 gene locus_tag LOCUS_12830 6072 7505 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence084 92 508 gene locus_tag LOCUS_12840 gene mraZ 92 508 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_12840 508 1440 gene locus_tag LOCUS_12850 gene rsmH 508 1440 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_12850 1455 1997 gene locus_tag LOCUS_12860 1455 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2045 4399 gene locus_tag LOCUS_12870 2045 4399 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_12870 4420 5877 gene locus_tag LOCUS_12880 4420 5877 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_12880 5874 6890 gene locus_tag LOCUS_12890 gene mraY 5874 6890 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence085 1587 2114 gene locus_tag LOCUS_12900 1587 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2885 2361 gene locus_tag LOCUS_12910 gene pgsA 2885 2361 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_12910 4217 2895 gene locus_tag LOCUS_12920 gene rimO 4217 2895 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_12920 4838 4221 gene locus_tag LOCUS_12930 4838 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5944 4838 gene locus_tag LOCUS_12940 gene recA 5944 4838 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_12940 6818 5964 gene locus_tag LOCUS_12950 gene prmC 6818 5964 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_12950 <7546 6849 gene locus_tag LOCUS_12960 <7546 6849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966170.1:DUF1385 domain-containing protein >Feature sequence086 <1 2188 gene locus_tag LOCUS_12970 <1 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966481.1:stage II sporulation protein E 2188 2544 gene locus_tag LOCUS_12980 2188 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2680 3915 gene locus_tag LOCUS_12990 2680 3915 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_12990 3951 5354 gene locus_tag LOCUS_13000 gene mgtE 3951 5354 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_13000 5492 7075 gene locus_tag LOCUS_13010 5492 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence087 <1 517 gene locus_tag LOCUS_13020 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392918.1:nucleoside recognition domain-containing protein 579 770 gene locus_tag LOCUS_13030 579 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1114 2253 gene locus_tag LOCUS_13040 1114 2253 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_13040 2250 4991 gene locus_tag LOCUS_13050 2250 4991 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_13050 6050 5040 gene locus_tag LOCUS_13060 6050 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6179 6898 gene locus_tag LOCUS_13070 6179 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6980 7168 gene locus_tag LOCUS_13080 6980 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence088 305 1504 gene locus_tag LOCUS_13090 305 1504 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_13090 1803 1537 gene locus_tag LOCUS_13100 1803 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2232 2546 gene locus_tag LOCUS_13110 gene rplU 2232 2546 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_13110 2587 2850 gene locus_tag LOCUS_13120 gene rpmA 2587 2850 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_13120 2932 4215 gene locus_tag LOCUS_13130 gene obgE 2932 4215 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_13130 5109 4267 gene locus_tag LOCUS_13140 5109 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_13140 5810 5157 gene locus_tag LOCUS_13150 5810 5157 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_13150 6281 5859 gene locus_tag LOCUS_13160 6281 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence089 61 1221 gene locus_tag LOCUS_13170 61 1221 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_13170 1205 2353 gene locus_tag LOCUS_13180 gene wecB 1205 2353 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_13180 2625 2350 gene locus_tag LOCUS_13190 2625 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2962 2618 gene locus_tag LOCUS_13200 2962 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3197 2955 gene locus_tag LOCUS_13210 3197 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3368 3799 gene locus_tag LOCUS_13220 3368 3799 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_13220 4664 3852 gene locus_tag LOCUS_13230 4664 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4773 5480 gene locus_tag LOCUS_13240 4773 5480 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_13240 6844 5537 gene locus_tag LOCUS_13250 6844 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence090 <1 1186 gene locus_tag LOCUS_13260 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965048.1:nucleotidyltransferase 1351 2532 gene locus_tag LOCUS_13270 1351 2532 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_13270 2680 3555 gene locus_tag LOCUS_13280 2680 3555 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_13280 3570 4772 gene locus_tag LOCUS_13290 3570 4772 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_13290 4765 5676 gene locus_tag LOCUS_13300 4765 5676 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096031.1 protein_id gnl|my_center|LOCUS_13300 5669 6379 gene locus_tag LOCUS_13310 5669 6379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence091 74 343 gene locus_tag LOCUS_13320 74 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 713 333 gene locus_tag LOCUS_13330 713 333 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_13330 1131 691 gene locus_tag LOCUS_13340 1131 691 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_13340 2702 1128 gene locus_tag LOCUS_13350 2702 1128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020360.1 protein_id gnl|my_center|LOCUS_13350 3522 2719 gene locus_tag LOCUS_13360 gene pgeF 3522 2719 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_13360 6283 3515 gene locus_tag LOCUS_13370 gene secA 6283 3515 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence092 1243 134 gene locus_tag LOCUS_13380 1243 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2119 1256 gene locus_tag LOCUS_13390 2119 1256 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_13390 4366 2132 gene locus_tag LOCUS_13400 gene gyrA 4366 2132 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_13400 6382 4397 gene locus_tag LOCUS_13410 gene gyrB 6382 4397 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence093 343 2826 gene locus_tag LOCUS_13420 343 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2813 6484 gene locus_tag LOCUS_13430 2813 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence094 1786 401 gene locus_tag LOCUS_13440 gene murC 1786 401 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_13440 1990 2568 gene locus_tag LOCUS_13450 1990 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2561 3379 gene locus_tag LOCUS_13460 2561 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3857 5044 gene locus_tag LOCUS_13470 3857 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5044 6645 gene locus_tag LOCUS_13480 5044 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence095 81 953 gene locus_tag LOCUS_13490 81 953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_13490 1102 1824 gene locus_tag LOCUS_13500 1102 1824 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_13500 2558 1884 gene locus_tag LOCUS_13510 2558 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2730 3245 gene locus_tag LOCUS_13520 2730 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4890 3316 gene locus_tag LOCUS_13530 4890 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6089 4893 gene locus_tag LOCUS_13540 6089 4893 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_13540 6266 6505 gene locus_tag LOCUS_13550 6266 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6502 6726 gene locus_tag LOCUS_13560 6502 6726 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence096 285 34 gene locus_tag LOCUS_13570 285 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2087 432 gene locus_tag LOCUS_13580 2087 432 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_13580 2758 2084 gene locus_tag LOCUS_13590 2758 2084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_13590 3406 2762 gene locus_tag LOCUS_13600 gene phoU 3406 2762 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_13600 4161 3406 gene locus_tag LOCUS_13610 gene pstB 4161 3406 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_13610 5021 4158 gene locus_tag LOCUS_13620 gene pstA 5021 4158 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_13620 5893 5018 gene locus_tag LOCUS_13630 gene pstC 5893 5018 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_13630 6656 5958 gene locus_tag LOCUS_13640 6656 5958 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence097 1206 619 gene locus_tag LOCUS_13650 1206 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1822 1271 gene locus_tag LOCUS_13660 1822 1271 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_13660 3446 1854 gene locus_tag LOCUS_13670 gene cls 3446 1854 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_13670 4380 3607 gene locus_tag LOCUS_13680 4380 3607 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_13680 4978 4382 gene locus_tag LOCUS_13690 4978 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 <6610 5116 gene locus_tag LOCUS_13700 <6610 5116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107164.1:NAD(+) synthase >Feature sequence098 1037 1705 gene locus_tag LOCUS_13710 gene hypB 1037 1705 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_13710 2654 1779 gene locus_tag LOCUS_13720 2654 1779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_13720 2890 4377 gene locus_tag LOCUS_13730 gene putP 2890 4377 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_13730 4565 5023 gene locus_tag LOCUS_13740 4565 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence099 <1 687 gene locus_tag LOCUS_13750 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119597939.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1192 2433 gene locus_tag LOCUS_13760 1192 2433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_13760 3005 2496 gene locus_tag LOCUS_13770 3005 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3043 3687 gene locus_tag LOCUS_13780 3043 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3786 3703 gene locus_tag LOCUS_t00230 3786 3703 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4036 4917 gene locus_tag LOCUS_13790 4036 4917 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_13790 6165 4975 gene locus_tag LOCUS_13800 6165 4975 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence100 1 225 gene locus_tag LOCUS_13810 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 291 1712 gene locus_tag LOCUS_13820 291 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1778 3136 gene locus_tag LOCUS_13830 gene caiB 1778 3136 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_13830 3252 4619 gene locus_tag LOCUS_13840 3252 4619 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813458.1 protein_id gnl|my_center|LOCUS_13840 4692 5477 gene locus_tag LOCUS_13850 4692 5477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084940.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence101 1749 1075 gene locus_tag LOCUS_13860 1749 1075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_13860 1902 2048 gene locus_tag LOCUS_13870 1902 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2041 2964 gene locus_tag LOCUS_13880 2041 2964 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_13880 2964 3926 gene locus_tag LOCUS_13890 2964 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4958 3999 gene locus_tag LOCUS_13900 4958 3999 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803849.1 protein_id gnl|my_center|LOCUS_13900 5113 5529 gene locus_tag LOCUS_13910 5113 5529 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968595.1 protein_id gnl|my_center|LOCUS_13910 5541 6095 gene locus_tag LOCUS_13920 5541 6095 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence102 <1 817 gene locus_tag LOCUS_13930 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966231.1:ATP-binding cassette domain-containing protein 821 2185 gene locus_tag LOCUS_13940 gene rlmD 821 2185 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_13940 2197 3099 gene locus_tag LOCUS_13950 2197 3099 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_13950 3225 3476 gene locus_tag LOCUS_13960 3225 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4101 3559 gene locus_tag LOCUS_13970 4101 3559 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 protein_id gnl|my_center|LOCUS_13970 4234 5280 gene locus_tag LOCUS_13980 4234 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence103 1520 246 gene locus_tag LOCUS_13990 1520 246 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_13990 1653 2507 gene locus_tag LOCUS_14000 1653 2507 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_14000 2511 3521 gene locus_tag LOCUS_14010 2511 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3672 4934 gene locus_tag LOCUS_14020 3672 4934 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837362.1 protein_id gnl|my_center|LOCUS_14020 <5863 4993 gene locus_tag LOCUS_14030 <5863 4993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048128.1:alpha-hydroxy-acid oxidizing protein >Feature sequence104 1322 255 gene locus_tag LOCUS_14040 1322 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2010 1327 gene locus_tag LOCUS_14050 2010 1327 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_14050 2192 2746 gene locus_tag LOCUS_14060 2192 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2976 3063 gene locus_tag LOCUS_t00240 2976 3063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4403 3210 gene locus_tag LOCUS_14070 4403 3210 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_14070 4721 4503 gene locus_tag LOCUS_14080 4721 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5257 4733 gene locus_tag LOCUS_14090 5257 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence105 1 1197 gene locus_tag LOCUS_14100 1 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1314 2381 gene locus_tag LOCUS_14110 gene prfA 1314 2381 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_14110 2378 3580 gene locus_tag LOCUS_14120 2378 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3577 4986 gene locus_tag LOCUS_14130 3577 4986 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence106 <1 578 gene locus_tag LOCUS_14140 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389803.1:xanthine phosphoribosyltransferase 935 2146 gene locus_tag LOCUS_14150 935 2146 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_14150 2260 3792 gene locus_tag LOCUS_14160 2260 3792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_14160 3785 4897 gene locus_tag LOCUS_14170 3785 4897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence107 1180 464 gene locus_tag LOCUS_14180 1180 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1790 1215 gene locus_tag LOCUS_14190 1790 1215 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_14190 3198 1981 gene locus_tag LOCUS_14200 3198 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3339 4466 gene locus_tag LOCUS_14210 3339 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4459 5424 gene locus_tag LOCUS_14220 4459 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence108 1034 249 gene locus_tag LOCUS_14230 gene spo0A 1034 249 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_14230 4097 1599 gene locus_tag LOCUS_14240 4097 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5414 4131 gene locus_tag LOCUS_14250 5414 4131 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence109 968 84 gene locus_tag LOCUS_14260 968 84 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808876.1 protein_id gnl|my_center|LOCUS_14260 1176 1991 gene locus_tag LOCUS_14270 1176 1991 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_14270 2025 3377 gene locus_tag LOCUS_14280 gene caiB 2025 3377 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_14280 3426 5240 gene locus_tag LOCUS_14290 3426 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence110 2512 1271 gene locus_tag LOCUS_14300 2512 1271 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14300 2673 3608 gene locus_tag LOCUS_14310 gene fba 2673 3608 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_14310 3652 5322 gene locus_tag LOCUS_14320 3652 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence111 537 1238 gene locus_tag LOCUS_14330 537 1238 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815058.1 protein_id gnl|my_center|LOCUS_14330 1231 2559 gene locus_tag LOCUS_14340 1231 2559 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_14340 4680 2929 gene locus_tag LOCUS_14350 4680 2929 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_14350 5047 4718 gene locus_tag LOCUS_14360 5047 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence112 848 204 gene locus_tag LOCUS_14370 848 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2279 897 gene locus_tag LOCUS_14380 gene murD 2279 897 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_14380 3014 3271 gene locus_tag LOCUS_14390 3014 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3460 3385 gene locus_tag LOCUS_t00250 3460 3385 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3569 3493 gene locus_tag LOCUS_t00260 3569 3493 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5298 3730 gene locus_tag LOCUS_14400 5298 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence113 222 1139 gene locus_tag LOCUS_14410 222 1139 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_14410 1158 1634 gene locus_tag LOCUS_14420 1158 1634 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_14420 2328 1711 gene locus_tag LOCUS_14430 2328 1711 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_14430 3753 2428 gene locus_tag LOCUS_14440 3753 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4189 4080 gene locus_tag LOCUS_r00010 4189 4080 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4296 4221 gene locus_tag LOCUS_t00270 4296 4221 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 358 3855 gene locus_tag LOCUS_14450 358 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4034 4264 gene locus_tag LOCUS_14460 4034 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence115 418 1173 gene locus_tag LOCUS_14470 418 1173 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_14470 1167 2141 gene locus_tag LOCUS_14480 gene dusB 1167 2141 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_14480 2163 2786 gene locus_tag LOCUS_14490 2163 2786 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_14490 2783 3658 gene locus_tag LOCUS_14500 2783 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3935 4606 gene locus_tag LOCUS_14510 3935 4606 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence116 1265 375 gene locus_tag LOCUS_14520 1265 375 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_14520 2058 1432 gene locus_tag LOCUS_14530 2058 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2279 4972 gene locus_tag LOCUS_14540 2279 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence117 1635 2408 gene locus_tag LOCUS_14550 1635 2408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_14550 2421 3164 gene locus_tag LOCUS_14560 2421 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3245 4021 gene locus_tag LOCUS_14570 gene truA 3245 4021 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_14570 4018 4719 gene locus_tag LOCUS_14580 4018 4719 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence118 <1 784 gene locus_tag LOCUS_14590 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048087.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 1437 853 gene locus_tag LOCUS_14600 1437 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2082 2867 gene locus_tag LOCUS_14610 2082 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14610 3097 3546 gene locus_tag LOCUS_14620 3097 3546 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_14620 4391 4026 gene locus_tag LOCUS_14630 4391 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14630 >Feature sequence119 <1 1903 gene locus_tag LOCUS_14640 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243561.1:molecular chaperone HtpG 1967 3253 gene locus_tag LOCUS_14650 gene hemW 1967 3253 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence120 1348 515 gene locus_tag LOCUS_14660 1348 515 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_14660 1498 3051 gene locus_tag LOCUS_14670 1498 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3083 3604 gene locus_tag LOCUS_14680 3083 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3648 4160 gene locus_tag LOCUS_14690 3648 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4255 4566 gene locus_tag LOCUS_14700 4255 4566 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence121 651 2165 gene locus_tag LOCUS_14710 gene glpK 651 2165 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_14710 2162 3391 gene locus_tag LOCUS_14720 2162 3391 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_14720 3499 4380 gene locus_tag LOCUS_14730 gene spoIIIAA 3499 4380 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence122 959 1891 gene locus_tag LOCUS_14740 gene cysK 959 1891 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_14740 2189 2025 gene locus_tag LOCUS_14750 2189 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2476 3258 gene locus_tag LOCUS_14760 gene proB 2476 3258 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence123 >Feature sequence124 919 1650 gene locus_tag LOCUS_14770 919 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2482 2045 gene locus_tag LOCUS_14780 2482 2045 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_14780 2700 4010 gene locus_tag LOCUS_14790 2700 4010 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766587.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence125 335 988 gene locus_tag LOCUS_14800 gene rpe 335 988 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_14800 1006 1605 gene locus_tag LOCUS_14810 gene recR 1006 1605 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_14810 1744 3402 gene locus_tag LOCUS_14820 1744 3402 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_14820 3418 3750 gene locus_tag LOCUS_14830 3418 3750 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_14830 4395 3805 gene locus_tag LOCUS_14840 4395 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence126 809 1873 gene locus_tag LOCUS_14850 809 1873 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810346.1 protein_id gnl|my_center|LOCUS_14850 1842 2897 gene locus_tag LOCUS_14860 1842 2897 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459052.1 protein_id gnl|my_center|LOCUS_14860 2894 3670 gene locus_tag LOCUS_14870 2894 3670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810342.1 protein_id gnl|my_center|LOCUS_14870 3667 4188 gene locus_tag LOCUS_14880 3667 4188 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860658.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence127 296 1105 gene locus_tag LOCUS_14890 296 1105 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_14890 1115 1732 gene locus_tag LOCUS_14900 gene scpB 1115 1732 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460224.1 protein_id gnl|my_center|LOCUS_14900 1739 2377 gene locus_tag LOCUS_14910 1739 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2370 2750 gene locus_tag LOCUS_14920 gene ytfJ 2370 2750 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_14920 2811 3950 gene locus_tag LOCUS_14930 2811 3950 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence128 399 1301 gene locus_tag LOCUS_14940 399 1301 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_14940 2531 1377 gene locus_tag LOCUS_14950 gene rlmD 2531 1377 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_14950 3225 2578 gene locus_tag LOCUS_14960 3225 2578 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_14960 3519 4097 gene locus_tag LOCUS_14970 3519 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence129 724 263 gene locus_tag LOCUS_14980 724 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 920 2689 gene locus_tag LOCUS_14990 920 2689 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_14990 3261 2785 gene locus_tag LOCUS_15000 3261 2785 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_15000 <4072 3287 gene locus_tag LOCUS_15010 <4072 3287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024339.1:flippase >Feature sequence130 <1 518 gene locus_tag LOCUS_15020 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962872.1:type I restriction endonuclease 633 1406 gene locus_tag LOCUS_15030 gene yfaU 633 1406 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992954.1 protein_id gnl|my_center|LOCUS_15030 1807 1466 gene locus_tag LOCUS_15040 1807 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2055 1876 gene locus_tag LOCUS_15050 2055 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2111 2320 gene locus_tag LOCUS_15060 2111 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2398 2634 gene locus_tag LOCUS_15070 2398 2634 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence131 618 73 gene locus_tag LOCUS_15080 618 73 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_15080 1308 967 gene locus_tag LOCUS_15090 1308 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2089 1403 gene locus_tag LOCUS_15100 gene rplA 2089 1403 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_15100 2588 2163 gene locus_tag LOCUS_15110 gene rplK 2588 2163 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_15110 3140 2616 gene locus_tag LOCUS_15120 gene nusG 3140 2616 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_15120 3599 3435 gene locus_tag LOCUS_15130 gene rpmG 3599 3435 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence132 1139 27 gene locus_tag LOCUS_15140 1139 27 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_15140 3067 1136 gene locus_tag LOCUS_15150 3067 1136 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_15150 3713 3060 gene locus_tag LOCUS_15160 3713 3060 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence133 <1 1626 gene locus_tag LOCUS_15170 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001287115.1:glutamine--tRNA ligase 1874 2419 gene locus_tag LOCUS_15180 gene pyrR 1874 2419 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_15180 2455 3816 gene locus_tag LOCUS_15190 2455 3816 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence134 1678 14 gene locus_tag LOCUS_15200 1678 14 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262763.1 protein_id gnl|my_center|LOCUS_15200 2113 1760 gene locus_tag LOCUS_15210 2113 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence135 711 19 gene locus_tag LOCUS_15220 711 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1637 813 gene locus_tag LOCUS_15230 1637 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3016 1634 gene locus_tag LOCUS_15240 3016 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3674 3021 gene locus_tag LOCUS_15250 3674 3021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence136 900 520 gene locus_tag LOCUS_15260 900 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2304 904 gene locus_tag LOCUS_15270 2304 904 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_15270 2581 2970 gene locus_tag LOCUS_15280 2581 2970 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence137 1629 217 gene locus_tag LOCUS_15290 gene pyk 1629 217 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680502.1 protein_id gnl|my_center|LOCUS_15290 2716 1658 gene locus_tag LOCUS_15300 2716 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence138 1349 1795 gene locus_tag LOCUS_15310 1349 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1796 3163 gene locus_tag LOCUS_15320 1796 3163 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_15320 3424 3248 gene locus_tag LOCUS_15330 3424 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence139 <1 703 gene locus_tag LOCUS_15340 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188032.1:site-specific DNA-methyltransferase 845 1825 gene locus_tag LOCUS_15350 845 1825 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964363.1 protein_id gnl|my_center|LOCUS_15350 1967 2344 gene locus_tag LOCUS_15360 1967 2344 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_15360 2346 3041 gene locus_tag LOCUS_15370 2346 3041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence140 3 707 gene locus_tag LOCUS_15380 3 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 920 1183 gene locus_tag LOCUS_15390 920 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1186 3255 gene locus_tag LOCUS_15400 1186 3255 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence141 1579 938 gene locus_tag LOCUS_15410 1579 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3040 1739 gene locus_tag LOCUS_15420 3040 1739 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_15420 3335 3422 gene locus_tag LOCUS_t00280 3335 3422 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence142 1020 421 gene locus_tag LOCUS_15430 1020 421 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_15430 1455 1024 gene locus_tag LOCUS_15440 1455 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2950 1580 gene locus_tag LOCUS_15450 2950 1580 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_15450 3088 3161 gene locus_tag LOCUS_t00290 3088 3161 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 235 897 gene locus_tag LOCUS_15460 235 897 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_15460 884 1741 gene locus_tag LOCUS_15470 884 1741 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_15470 1792 2940 gene locus_tag LOCUS_15480 1792 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence144 2426 1128 gene locus_tag LOCUS_15490 gene radA 2426 1128 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_15490 3061 2492 gene locus_tag LOCUS_15500 gene cwlD 3061 2492 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence145 462 656 gene locus_tag LOCUS_15510 462 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 653 1042 gene locus_tag LOCUS_15520 653 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1039 2148 gene locus_tag LOCUS_15530 1039 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2145 2633 gene locus_tag LOCUS_15540 2145 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2630 3124 gene locus_tag LOCUS_15550 2630 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence146 1 1335 gene locus_tag LOCUS_15560 1 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1582 2775 gene locus_tag LOCUS_15570 gene metK 1582 2775 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence147 845 621 gene locus_tag LOCUS_15580 gene acpP 845 621 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_15580 1648 872 gene locus_tag LOCUS_15590 1648 872 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_15590 2904 1645 gene locus_tag LOCUS_15600 2904 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence148 <1 566 gene locus_tag LOCUS_15610 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365401.1:ATP-dependent chaperone ClpB 1050 628 gene locus_tag LOCUS_15620 1050 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1637 1047 gene locus_tag LOCUS_15630 1637 1047 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880948.1 protein_id gnl|my_center|LOCUS_15630 2261 1638 gene locus_tag LOCUS_15640 gene udk 2261 1638 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575382.1 protein_id gnl|my_center|LOCUS_15640 2413 3138 gene locus_tag LOCUS_15650 gene deoD 2413 3138 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence149 403 182 gene locus_tag LOCUS_15660 403 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 571 407 gene locus_tag LOCUS_15670 571 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 850 775 gene locus_tag LOCUS_t00300 850 775 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1606 983 gene locus_tag LOCUS_15680 1606 983 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 protein_id gnl|my_center|LOCUS_15680 2534 1617 gene locus_tag LOCUS_15690 2534 1617 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_15690 <3127 2549 gene locus_tag LOCUS_15700 <3127 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429190.1:ATP-binding cassette domain-containing protein >Feature sequence150 1465 788 gene locus_tag LOCUS_15710 1465 788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_15710 2247 1858 gene locus_tag LOCUS_15720 2247 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2991 2425 gene locus_tag LOCUS_15730 2991 2425 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence151 <3103 742 gene locus_tag LOCUS_15740 <3103 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393945.1:DNA-directed RNA polymerase subunit beta >Feature sequence152 1332 256 gene locus_tag LOCUS_15750 1332 256 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393267.1 protein_id gnl|my_center|LOCUS_15750 1443 2099 gene locus_tag LOCUS_15760 1443 2099 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_15760 2848 2153 gene locus_tag LOCUS_15770 2848 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence153 1 2250 gene locus_tag LOCUS_15780 gene ileS 1 2250 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence154 1450 266 gene locus_tag LOCUS_15790 1450 266 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_15790 2324 1485 gene locus_tag LOCUS_15800 2324 1485 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence155 1184 132 gene locus_tag LOCUS_15810 gene nusA 1184 132 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_15810 1657 1202 gene locus_tag LOCUS_15820 gene rimP 1657 1202 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_15820 2568 1807 gene locus_tag LOCUS_15830 2568 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence156 2371 1763 gene locus_tag LOCUS_15840 2371 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence157 284 1177 gene locus_tag LOCUS_15850 284 1177 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_15850 1180 2592 gene locus_tag LOCUS_15860 gene gltA 1180 2592 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence158 <1 1470 gene locus_tag LOCUS_15870 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392832.1:stage IV sporulation protein A >Feature sequence159 <1 918 gene locus_tag LOCUS_15880 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272578.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1356 1553 gene locus_tag LOCUS_15890 1356 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1745 2263 gene locus_tag LOCUS_15900 1745 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2574 2308 gene locus_tag LOCUS_15910 2574 2308 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391580.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence160 <1 683 gene locus_tag LOCUS_15920 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433859.1:ABC transporter ATP-binding protein 686 2500 gene locus_tag LOCUS_15930 686 2500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence161 947 24 gene locus_tag LOCUS_15940 947 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2249 951 gene locus_tag LOCUS_15950 2249 951 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_15950 2499 2266 gene locus_tag LOCUS_15960 2499 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence162 1543 311 gene locus_tag LOCUS_15970 1543 311 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178657.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence163 454 1002 gene locus_tag LOCUS_15980 gene lepB 454 1002 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_15980 1004 1882 gene locus_tag LOCUS_15990 gene ylqF 1004 1882 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_15990 1879 2484 gene locus_tag LOCUS_16000 gene rnhB 1879 2484 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence164 367 552 gene locus_tag LOCUS_16010 367 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 756 681 gene locus_tag LOCUS_t00310 756 681 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 1388 516 gene locus_tag LOCUS_16020 gene atpG 1388 516 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_16020 <2460 1429 gene locus_tag LOCUS_16030 <2460 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393857.1:F0F1 ATP synthase subunit alpha >Feature sequence166 >Feature sequence167 609 424 gene locus_tag LOCUS_16040 gene rpsU 609 424 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_16040 <2277 714 gene locus_tag LOCUS_16050 <2277 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830785.1:leucine--tRNA ligase >Feature sequence168 218 535 gene locus_tag LOCUS_16060 218 535 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_16060 532 1281 gene locus_tag LOCUS_16070 532 1281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259482.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence169 983 111 gene locus_tag LOCUS_16080 983 111 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_16080 1286 1062 gene locus_tag LOCUS_16090 1286 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1740 1366 gene locus_tag LOCUS_16100 1740 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2130 2057 gene locus_tag LOCUS_t00320 2130 2057 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2213 2138 gene locus_tag LOCUS_t00330 2213 2138 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 408 746 gene locus_tag LOCUS_16110 408 746 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_16110 2017 791 gene locus_tag LOCUS_16120 gene dinB 2017 791 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence171 451 813 gene locus_tag LOCUS_16130 451 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 825 1649 gene locus_tag LOCUS_16140 825 1649 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence172 263 958 gene locus_tag LOCUS_16150 263 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 955 1638 gene locus_tag LOCUS_16160 gene tenA 955 1638 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198338.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence173 76 762 gene locus_tag LOCUS_16170 gene plsY 76 762 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence174 216 767 gene locus_tag LOCUS_16180 gene rfbC 216 767 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence175 1129 251 gene locus_tag LOCUS_16190 1129 251 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674381.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence176 1110 226 gene locus_tag LOCUS_16200 1110 226 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence177 1444 1007 gene locus_tag LOCUS_16210 gene rpiB 1444 1007 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_16210