>Feature sequence001 2685 1897 gene locus_tag LOCUS_00010 2685 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3646 3098 gene locus_tag LOCUS_00020 3646 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3742 3984 gene locus_tag LOCUS_00030 3742 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4470 4886 gene locus_tag LOCUS_00040 4470 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4930 5889 gene locus_tag LOCUS_00050 4930 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5911 6516 gene locus_tag LOCUS_00060 5911 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6939 9776 gene locus_tag LOCUS_00070 6939 9776 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_00070 9773 10561 gene locus_tag LOCUS_00080 9773 10561 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_00080 10602 11687 gene locus_tag LOCUS_00090 10602 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00090 11904 12485 gene locus_tag LOCUS_00100 11904 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12506 15586 gene locus_tag LOCUS_00110 12506 15586 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_00110 15749 16705 gene locus_tag LOCUS_00120 15749 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17011 16844 gene locus_tag LOCUS_00130 17011 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17169 17002 gene locus_tag LOCUS_00140 17169 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17684 17325 gene locus_tag LOCUS_00150 17684 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18501 17722 gene locus_tag LOCUS_00160 18501 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19884 18919 gene locus_tag LOCUS_00170 19884 18919 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_00170 20209 19874 gene locus_tag LOCUS_00180 20209 19874 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_00180 20436 20206 gene locus_tag LOCUS_00190 20436 20206 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784908.1 protein_id gnl|my_center|LOCUS_00190 21241 20687 gene locus_tag LOCUS_00200 21241 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24555 23788 gene locus_tag LOCUS_00210 24555 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25604 26644 gene locus_tag LOCUS_00220 25604 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26634 27452 gene locus_tag LOCUS_00230 26634 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27799 28095 gene locus_tag LOCUS_00240 27799 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29915 28953 gene locus_tag LOCUS_00250 29915 28953 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 protein_id gnl|my_center|LOCUS_00250 30410 30913 gene locus_tag LOCUS_00260 30410 30913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31759 32958 gene locus_tag LOCUS_00270 gene kbl 31759 32958 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213823.1 protein_id gnl|my_center|LOCUS_00270 >Feature sequence002 167 1732 gene locus_tag LOCUS_00280 167 1732 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107733.1 protein_id gnl|my_center|LOCUS_00280 1729 2589 gene locus_tag LOCUS_00290 1729 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 3779 2586 gene locus_tag LOCUS_00300 3779 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 3978 4940 gene locus_tag LOCUS_00310 3978 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5251 6465 gene locus_tag LOCUS_00320 5251 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 7374 8525 gene locus_tag LOCUS_00330 7374 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 9099 9425 gene locus_tag LOCUS_00340 9099 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 9867 9601 gene locus_tag LOCUS_00350 9867 9601 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_00350 10169 9882 gene locus_tag LOCUS_00360 gene yefM 10169 9882 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_00360 10998 11678 gene locus_tag LOCUS_00370 10998 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 11659 12399 gene locus_tag LOCUS_00380 11659 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 12483 13388 gene locus_tag LOCUS_00390 gene miaA 12483 13388 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265761.1 protein_id gnl|my_center|LOCUS_00390 13699 14739 gene locus_tag LOCUS_00400 gene mnmA 13699 14739 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_00400 14736 16085 gene locus_tag LOCUS_00410 gene mnmE 14736 16085 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_00410 16231 17088 gene locus_tag LOCUS_00420 16231 17088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 17767 17114 gene locus_tag LOCUS_00430 17767 17114 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_00430 18575 17796 gene locus_tag LOCUS_00440 18575 17796 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_00440 18732 19187 gene locus_tag LOCUS_00450 18732 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 19197 20759 gene locus_tag LOCUS_00460 19197 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 20782 21126 gene locus_tag LOCUS_00470 20782 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 21143 23242 gene locus_tag LOCUS_00480 21143 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 23250 24755 gene locus_tag LOCUS_00490 23250 24755 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_00490 24778 26151 gene locus_tag LOCUS_00500 24778 26151 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_00500 26157 27260 gene locus_tag LOCUS_00510 gene mraY 26157 27260 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_00510 27273 28583 gene locus_tag LOCUS_00520 gene murD 27273 28583 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_00520 28607 29407 gene locus_tag LOCUS_00530 28607 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 29432 30574 gene locus_tag LOCUS_00540 gene spoVE 29432 30574 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_00540 30571 31695 gene locus_tag LOCUS_00550 gene murG 30571 31695 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_00550 31676 33985 gene locus_tag LOCUS_00560 31676 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 34008 34943 gene locus_tag LOCUS_00570 34008 34943 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_00570 >Feature sequence003 21 1235 gene locus_tag LOCUS_00580 21 1235 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 protein_id gnl|my_center|LOCUS_00580 1259 2422 gene locus_tag LOCUS_00590 gene bioF 1259 2422 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_00590 2675 3130 gene locus_tag LOCUS_00600 2675 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4036 4599 gene locus_tag LOCUS_00610 4036 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6673 4880 gene locus_tag LOCUS_00620 gene aspS 6673 4880 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_00620 7920 6709 gene locus_tag LOCUS_00630 gene hisS 7920 6709 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222811.1 protein_id gnl|my_center|LOCUS_00630 8530 9213 gene locus_tag LOCUS_00640 gene hypB 8530 9213 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_00640 9194 11521 gene locus_tag LOCUS_00650 gene hypF 9194 11521 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_00650 11525 11767 gene locus_tag LOCUS_00660 11525 11767 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_00660 11801 12868 gene locus_tag LOCUS_00670 gene hypD 11801 12868 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_00670 12873 13907 gene locus_tag LOCUS_00680 gene hypE 12873 13907 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_00680 15187 14066 gene locus_tag LOCUS_00690 15187 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16086 18053 gene locus_tag LOCUS_00700 16086 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 18358 20046 gene locus_tag LOCUS_00710 gene dnaK 18358 20046 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_00710 20383 20673 gene locus_tag LOCUS_00720 gene groES 20383 20673 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_00720 20719 22371 gene locus_tag LOCUS_00730 gene groL 20719 22371 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_00730 22546 22998 gene locus_tag LOCUS_00740 22546 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 23170 25401 gene locus_tag LOCUS_00750 23170 25401 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_00750 25729 25656 gene locus_tag LOCUS_t00010 25729 25656 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25872 25945 gene locus_tag LOCUS_t00020 25872 25945 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25982 26644 gene locus_tag LOCUS_00760 25982 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 26669 27883 gene locus_tag LOCUS_00770 26669 27883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 27976 30183 gene locus_tag LOCUS_00780 27976 30183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 30195 30800 gene locus_tag LOCUS_00790 30195 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence004 1195 977 gene locus_tag LOCUS_00800 1195 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1252 2010 gene locus_tag LOCUS_00810 1252 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3575 2175 gene locus_tag LOCUS_00820 gene asnS 3575 2175 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_00820 4856 3651 gene locus_tag LOCUS_00830 4856 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 5475 5158 gene locus_tag LOCUS_00840 gene trxA 5475 5158 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_00840 6110 5514 gene locus_tag LOCUS_00850 6110 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 6380 7060 gene locus_tag LOCUS_00860 6380 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_00860 7076 8260 gene locus_tag LOCUS_00870 7076 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8280 9506 gene locus_tag LOCUS_00880 8280 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_00880 9510 10763 gene locus_tag LOCUS_00890 9510 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_00890 10760 11872 gene locus_tag LOCUS_00900 10760 11872 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_00900 11862 12365 gene locus_tag LOCUS_00910 11862 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12781 12362 gene locus_tag LOCUS_00920 12781 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 12956 13855 gene locus_tag LOCUS_00930 12956 13855 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_00930 13974 14996 gene locus_tag LOCUS_00940 13974 14996 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_00940 15378 16451 gene locus_tag LOCUS_00950 15378 16451 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_00950 16781 18034 gene locus_tag LOCUS_00960 16781 18034 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_00960 18054 19625 gene locus_tag LOCUS_00970 gene serA 18054 19625 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00970 19770 20819 gene locus_tag LOCUS_00980 19770 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 20926 21609 gene locus_tag LOCUS_00990 20926 21609 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_00990 23680 21701 gene locus_tag LOCUS_01000 23680 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 24487 23732 gene locus_tag LOCUS_01010 24487 23732 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence005 915 205 gene locus_tag LOCUS_01020 915 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 1205 936 gene locus_tag LOCUS_01030 gene rpsS 1205 936 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_01030 2077 1241 gene locus_tag LOCUS_01040 gene rplB 2077 1241 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_01040 2388 2104 gene locus_tag LOCUS_01050 2388 2104 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_01050 3003 2395 gene locus_tag LOCUS_01060 gene rplD 3003 2395 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424397.1 protein_id gnl|my_center|LOCUS_01060 3680 3045 gene locus_tag LOCUS_01070 gene rplC 3680 3045 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_01070 4034 3726 gene locus_tag LOCUS_01080 gene rpsJ 4034 3726 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_01080 6219 4072 gene locus_tag LOCUS_01090 gene fusA 6219 4072 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01090 6756 6283 gene locus_tag LOCUS_01100 gene rpsG 6756 6283 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_01100 7166 6783 gene locus_tag LOCUS_01110 gene rpsL 7166 6783 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_01110 9284 7740 gene locus_tag LOCUS_01120 gene gpmI 9284 7740 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_01120 9721 9290 gene locus_tag LOCUS_01130 9721 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9853 11004 gene locus_tag LOCUS_01140 9853 11004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_01140 11001 12392 gene locus_tag LOCUS_01150 11001 12392 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_01150 12389 14266 gene locus_tag LOCUS_01160 12389 14266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 14275 14535 gene locus_tag LOCUS_01170 14275 14535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 14516 16402 gene locus_tag LOCUS_01180 gene dxs 14516 16402 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_01180 16410 17183 gene locus_tag LOCUS_01190 16410 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17183 17719 gene locus_tag LOCUS_01200 17183 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17871 18962 gene locus_tag LOCUS_01210 17871 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 19029 20432 gene locus_tag LOCUS_01220 gene der 19029 20432 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 protein_id gnl|my_center|LOCUS_01220 20451 21419 gene locus_tag LOCUS_01230 20451 21419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_01230 22104 21469 gene locus_tag LOCUS_01240 22104 21469 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence006 620 3784 gene locus_tag LOCUS_01250 620 3784 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_01250 4401 3997 gene locus_tag LOCUS_01260 4401 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4784 4470 gene locus_tag LOCUS_01270 4784 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6432 5047 gene locus_tag LOCUS_01280 6432 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 7910 6465 gene locus_tag LOCUS_01290 gene rseP 7910 6465 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_01290 8919 8536 gene locus_tag LOCUS_01300 gene rplT 8919 8536 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_01300 9278 9069 gene locus_tag LOCUS_01310 gene rpmI 9278 9069 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_01310 11943 9796 gene locus_tag LOCUS_01320 gene uvrB 11943 9796 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 protein_id gnl|my_center|LOCUS_01320 12030 12410 gene locus_tag LOCUS_01330 12030 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12692 12776 gene locus_tag LOCUS_t00030 12692 12776 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12955 13203 gene locus_tag LOCUS_01340 12955 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 13490 13296 gene locus_tag LOCUS_01350 13490 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 14033 14362 gene locus_tag LOCUS_01360 14033 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14380 16401 gene locus_tag LOCUS_01370 14380 16401 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_01370 16395 17879 gene locus_tag LOCUS_01380 16395 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 18286 18645 gene locus_tag LOCUS_01390 18286 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 18642 20168 gene locus_tag LOCUS_01400 18642 20168 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_01400 21312 20152 gene locus_tag LOCUS_01410 21312 20152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_01410 21892 21533 gene locus_tag LOCUS_01420 gene ndhC 21892 21533 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence007 261 1031 gene locus_tag LOCUS_01430 261 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3709 1166 gene locus_tag LOCUS_01440 gene clpB 3709 1166 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_01440 4249 5205 gene locus_tag LOCUS_01450 4249 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5207 5560 gene locus_tag LOCUS_01460 5207 5560 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_01460 6409 5834 gene locus_tag LOCUS_01470 gene kdpC 6409 5834 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576697.1 protein_id gnl|my_center|LOCUS_01470 8558 6438 gene locus_tag LOCUS_01480 gene kdpB 8558 6438 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529645.1 protein_id gnl|my_center|LOCUS_01480 10188 8581 gene locus_tag LOCUS_01490 gene kdpA 10188 8581 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_01490 11173 10394 gene locus_tag LOCUS_01500 11173 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12024 11326 gene locus_tag LOCUS_01510 12024 11326 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_01510 14716 12038 gene locus_tag LOCUS_01520 14716 12038 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_01520 15208 16167 gene locus_tag LOCUS_01530 15208 16167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 16174 16857 gene locus_tag LOCUS_01540 16174 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 20784 17047 gene locus_tag LOCUS_01550 20784 17047 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence008 1386 280 gene locus_tag LOCUS_01560 1386 280 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_01560 1747 3027 gene locus_tag LOCUS_01570 gene serS 1747 3027 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_01570 3064 3843 gene locus_tag LOCUS_01580 3064 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4293 4138 gene locus_tag LOCUS_01590 4293 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4997 4326 gene locus_tag LOCUS_01600 4997 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5498 5019 gene locus_tag LOCUS_01610 5498 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6357 5740 gene locus_tag LOCUS_01620 6357 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6719 6363 gene locus_tag LOCUS_01630 6719 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7825 6749 gene locus_tag LOCUS_01640 7825 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 10037 8928 gene locus_tag LOCUS_01650 gene hemW 10037 8928 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775763.1 protein_id gnl|my_center|LOCUS_01650 12959 10050 gene locus_tag LOCUS_01660 12959 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 13692 13153 gene locus_tag LOCUS_01670 13692 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 13933 14502 gene locus_tag LOCUS_01680 gene pyrE 13933 14502 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_01680 14516 15583 gene locus_tag LOCUS_01690 14516 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 15628 18858 gene locus_tag LOCUS_01700 15628 18858 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_01700 18872 19525 gene locus_tag LOCUS_01710 18872 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence009 2616 1327 gene locus_tag LOCUS_01720 gene eno 2616 1327 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_01720 3604 2771 gene locus_tag LOCUS_01730 3604 2771 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_01730 4031 5857 gene locus_tag LOCUS_01740 4031 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01740 5926 6990 gene locus_tag LOCUS_01750 5926 6990 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_01750 7180 9114 gene locus_tag LOCUS_01760 7180 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 10453 9077 gene locus_tag LOCUS_01770 gene miaB 10453 9077 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_01770 11685 10462 gene locus_tag LOCUS_01780 gene rlmD 11685 10462 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_01780 12024 11701 gene locus_tag LOCUS_01790 12024 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 12170 12757 gene locus_tag LOCUS_01800 12170 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 12961 14511 gene locus_tag LOCUS_01810 12961 14511 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 protein_id gnl|my_center|LOCUS_01810 14584 15168 gene locus_tag LOCUS_01820 14584 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 15171 16289 gene locus_tag LOCUS_01830 15171 16289 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217540.1 protein_id gnl|my_center|LOCUS_01830 16286 19393 gene locus_tag LOCUS_01840 16286 19393 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141537.1 protein_id gnl|my_center|LOCUS_01840 20928 19459 gene locus_tag LOCUS_01850 20928 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence010 2669 570 gene locus_tag LOCUS_01860 gene recG 2669 570 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_01860 3315 2683 gene locus_tag LOCUS_01870 3315 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3524 5434 gene locus_tag LOCUS_01880 3524 5434 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_01880 5561 6310 gene locus_tag LOCUS_01890 5561 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6752 6366 gene locus_tag LOCUS_01900 gene acpS 6752 6366 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370293.1 protein_id gnl|my_center|LOCUS_01900 7527 6787 gene locus_tag LOCUS_01910 gene pdxJ 7527 6787 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_01910 9114 7567 gene locus_tag LOCUS_01920 gene purH 9114 7567 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_01920 9354 9809 gene locus_tag LOCUS_01930 gene rplI 9354 9809 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_01930 9979 10971 gene locus_tag LOCUS_01940 gene corA 9979 10971 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626268.1 protein_id gnl|my_center|LOCUS_01940 11034 11927 gene locus_tag LOCUS_01950 gene argB 11034 11927 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_01950 11937 12302 gene locus_tag LOCUS_01960 11937 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 12611 12327 gene locus_tag LOCUS_01970 12611 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 12834 13877 gene locus_tag LOCUS_01980 12834 13877 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_01980 13886 14698 gene locus_tag LOCUS_01990 gene cbiQ 13886 14698 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_01990 14695 15465 gene locus_tag LOCUS_02000 14695 15465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_02000 17434 15473 gene locus_tag LOCUS_02010 17434 15473 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_02010 17996 17454 gene locus_tag LOCUS_02020 17996 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 18932 18084 gene locus_tag LOCUS_02030 gene ispE 18932 18084 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence011 <1 3350 gene locus_tag LOCUS_02040 <1 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000139543.1:ATP-dependent RNA helicase HrpA 4150 3443 gene locus_tag LOCUS_02050 4150 3443 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_02050 5906 4158 gene locus_tag LOCUS_02060 5906 4158 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_02060 5909 6076 gene locus_tag LOCUS_02070 5909 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6220 6987 gene locus_tag LOCUS_02080 gene hisF 6220 6987 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_02080 7041 9173 gene locus_tag LOCUS_02090 7041 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 9577 9257 gene locus_tag LOCUS_02100 9577 9257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_02100 13846 10268 gene locus_tag LOCUS_02110 gene nifJ 13846 10268 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_02110 14192 15673 gene locus_tag LOCUS_02120 gene lysS 14192 15673 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369668.1 protein_id gnl|my_center|LOCUS_02120 15691 16476 gene locus_tag LOCUS_02130 15691 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 16729 17373 gene locus_tag LOCUS_02140 gene plsY 16729 17373 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_02140 17375 18385 gene locus_tag LOCUS_02150 17375 18385 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_02150 18443 18877 gene locus_tag LOCUS_02160 18443 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 19019 19837 gene locus_tag LOCUS_02170 19019 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence012 146 619 gene locus_tag LOCUS_02180 146 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 2011 905 gene locus_tag LOCUS_02190 2011 905 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_02190 2907 2128 gene locus_tag LOCUS_02200 2907 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3654 2947 gene locus_tag LOCUS_02210 gene purQ 3654 2947 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_02210 6105 3703 gene locus_tag LOCUS_02220 gene purL 6105 3703 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_02220 6582 6127 gene locus_tag LOCUS_02230 6582 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7360 6650 gene locus_tag LOCUS_02240 7360 6650 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_02240 7592 9451 gene locus_tag LOCUS_02250 7592 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 11976 9943 gene locus_tag LOCUS_02260 gene tkt 11976 9943 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_02260 12384 13142 gene locus_tag LOCUS_02270 12384 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 13147 14436 gene locus_tag LOCUS_02280 13147 14436 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_02280 <20354 14517 gene locus_tag LOCUS_02290 <20354 14517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126622031.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence013 120 1055 gene locus_tag LOCUS_02300 120 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 3227 1140 gene locus_tag LOCUS_02310 gene ppk1 3227 1140 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922240.1 protein_id gnl|my_center|LOCUS_02310 4819 3263 gene locus_tag LOCUS_02320 4819 3263 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_02320 6052 4985 gene locus_tag LOCUS_02330 6052 4985 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_02330 6869 6072 gene locus_tag LOCUS_02340 gene map 6869 6072 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_02340 7534 6884 gene locus_tag LOCUS_02350 7534 6884 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02350 9065 7563 gene locus_tag LOCUS_02360 gene secY 9065 7563 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_02360 9199 9062 gene locus_tag LOCUS_02370 9199 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 9664 9206 gene locus_tag LOCUS_02380 gene rplO 9664 9206 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_02380 10212 9727 gene locus_tag LOCUS_02390 gene rpsE 10212 9727 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_02390 10768 10406 gene locus_tag LOCUS_02400 gene rplR 10768 10406 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_02400 11343 10804 gene locus_tag LOCUS_02410 gene rplF 11343 10804 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_02410 11766 11365 gene locus_tag LOCUS_02420 gene rpsH 11766 11365 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_02420 12360 11779 gene locus_tag LOCUS_02430 gene rplE 12360 11779 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_02430 12654 12427 gene locus_tag LOCUS_02440 12654 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 13762 12878 gene locus_tag LOCUS_02450 13762 12878 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02450 14053 14403 gene locus_tag LOCUS_02460 14053 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14446 15564 gene locus_tag LOCUS_02470 14446 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 15561 15902 gene locus_tag LOCUS_02480 15561 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 15940 18627 gene locus_tag LOCUS_02490 15940 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 19954 18701 gene locus_tag LOCUS_02500 19954 18701 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence014 860 303 gene locus_tag LOCUS_02510 860 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1728 1045 gene locus_tag LOCUS_02520 1728 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2640 1876 gene locus_tag LOCUS_02530 gene tpiA 2640 1876 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_02530 3931 2693 gene locus_tag LOCUS_02540 gene rsmB 3931 2693 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_02540 5523 4018 gene locus_tag LOCUS_02550 5523 4018 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_02550 6971 5679 gene locus_tag LOCUS_02560 6971 5679 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_02560 7941 8252 gene locus_tag LOCUS_02570 gene rpsN 7941 8252 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_02570 8325 8585 gene locus_tag LOCUS_02580 8325 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8642 10054 gene locus_tag LOCUS_02590 8642 10054 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_02590 10059 10703 gene locus_tag LOCUS_02600 10059 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10726 11082 gene locus_tag LOCUS_02610 10726 11082 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_02610 12020 11235 gene locus_tag LOCUS_02620 12020 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12998 12024 gene locus_tag LOCUS_02630 12998 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13898 14569 gene locus_tag LOCUS_02640 13898 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 14657 15295 gene locus_tag LOCUS_02650 gene nth 14657 15295 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_02650 15388 16179 gene locus_tag LOCUS_02660 15388 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 16258 16764 gene locus_tag LOCUS_02670 16258 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16776 17234 gene locus_tag LOCUS_02680 16776 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence015 1792 413 gene locus_tag LOCUS_02690 1792 413 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_02690 2295 1900 gene locus_tag LOCUS_02700 2295 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3586 2660 gene locus_tag LOCUS_02710 3586 2660 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_02710 4707 3613 gene locus_tag LOCUS_02720 4707 3613 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_02720 5595 4720 gene locus_tag LOCUS_02730 5595 4720 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_02730 6423 5704 gene locus_tag LOCUS_02740 6423 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6491 7219 gene locus_tag LOCUS_02750 6491 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7277 8797 gene locus_tag LOCUS_02760 gene proS 7277 8797 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_02760 9089 9163 gene locus_tag LOCUS_t00040 9089 9163 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16145 10290 gene locus_tag LOCUS_02770 16145 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 16645 18129 gene locus_tag LOCUS_02780 16645 18129 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_02780 18122 19063 gene locus_tag LOCUS_02790 gene glsA 18122 19063 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883028.1 protein_id gnl|my_center|LOCUS_02790 19702 19292 gene locus_tag LOCUS_02800 19702 19292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence016 271 1053 gene locus_tag LOCUS_02810 271 1053 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_02810 2399 1095 gene locus_tag LOCUS_02820 2399 1095 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982162.1 protein_id gnl|my_center|LOCUS_02820 2552 3217 gene locus_tag LOCUS_02830 2552 3217 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_02830 3220 4389 gene locus_tag LOCUS_02840 3220 4389 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 protein_id gnl|my_center|LOCUS_02840 4393 5682 gene locus_tag LOCUS_02850 gene lysA 4393 5682 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_02850 6010 7008 gene locus_tag LOCUS_02860 gene fbaA 6010 7008 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_02860 9229 7394 gene locus_tag LOCUS_02870 gene typA 9229 7394 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_02870 9437 10303 gene locus_tag LOCUS_02880 gene ilvE 9437 10303 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_02880 11465 10593 gene locus_tag LOCUS_02890 11465 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 11714 12199 gene locus_tag LOCUS_02900 11714 12199 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_02900 12820 12224 gene locus_tag LOCUS_02910 12820 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13688 14758 gene locus_tag LOCUS_02920 13688 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 14791 15948 gene locus_tag LOCUS_02930 14791 15948 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_02930 16130 17101 gene locus_tag LOCUS_02940 16130 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 18100 17150 gene locus_tag LOCUS_02950 18100 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 19335 18439 gene locus_tag LOCUS_02960 19335 18439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence017 66 2264 gene locus_tag LOCUS_02970 66 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_02970 3589 2318 gene locus_tag LOCUS_02980 3589 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3717 4073 gene locus_tag LOCUS_02990 3717 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5078 4098 gene locus_tag LOCUS_03000 5078 4098 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_03000 6266 5115 gene locus_tag LOCUS_03010 gene tyrS 6266 5115 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_03010 7207 6845 gene locus_tag LOCUS_03020 7207 6845 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_03020 8182 7226 gene locus_tag LOCUS_03030 8182 7226 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_03030 9093 8179 gene locus_tag LOCUS_03040 gene oppB 9093 8179 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_03040 10958 9099 gene locus_tag LOCUS_03050 10958 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 12246 11224 gene locus_tag LOCUS_03060 12246 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 12401 13630 gene locus_tag LOCUS_03070 12401 13630 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_03070 13837 14820 gene locus_tag LOCUS_03080 13837 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15872 14946 gene locus_tag LOCUS_03090 15872 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 16842 15856 gene locus_tag LOCUS_03100 16842 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18308 16920 gene locus_tag LOCUS_03110 18308 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 <19586 18308 gene locus_tag LOCUS_03120 <19586 18308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678695.1:cell division protein FtsZ >Feature sequence018 538 110 gene locus_tag LOCUS_03130 538 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1646 621 gene locus_tag LOCUS_03140 1646 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3140 1659 gene locus_tag LOCUS_03150 3140 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3915 3271 gene locus_tag LOCUS_03160 3915 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3866 4078 gene locus_tag LOCUS_03170 3866 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4245 4829 gene locus_tag LOCUS_03180 4245 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5854 4937 gene locus_tag LOCUS_03190 5854 4937 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_03190 5892 7076 gene locus_tag LOCUS_03200 gene metK 5892 7076 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_03200 7099 8514 gene locus_tag LOCUS_03210 gene ahcY 7099 8514 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_03210 9668 8655 gene locus_tag LOCUS_03220 9668 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10235 11101 gene locus_tag LOCUS_03230 10235 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11129 12394 gene locus_tag LOCUS_03240 11129 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12678 13568 gene locus_tag LOCUS_03250 12678 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15349 13700 gene locus_tag LOCUS_03260 15349 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 15446 17344 gene locus_tag LOCUS_03270 15446 17344 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 protein_id gnl|my_center|LOCUS_03270 17907 17341 gene locus_tag LOCUS_03280 17907 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence019 499 209 gene locus_tag LOCUS_03290 499 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 644 1459 gene locus_tag LOCUS_03300 644 1459 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_03300 1482 1961 gene locus_tag LOCUS_03310 gene dfrA 1482 1961 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_03310 5166 2059 gene locus_tag LOCUS_03320 5166 2059 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_03320 6310 5174 gene locus_tag LOCUS_03330 6310 5174 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_03330 6787 6317 gene locus_tag LOCUS_03340 6787 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7023 7100 gene locus_tag LOCUS_t00050 7023 7100 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7416 8417 gene locus_tag LOCUS_03350 gene pyrC 7416 8417 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258604.1 protein_id gnl|my_center|LOCUS_03350 8509 9138 gene locus_tag LOCUS_03360 8509 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9236 10402 gene locus_tag LOCUS_03370 9236 10402 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_03370 10450 10953 gene locus_tag LOCUS_03380 gene ruvC 10450 10953 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947018.1 protein_id gnl|my_center|LOCUS_03380 11568 11047 gene locus_tag LOCUS_03390 11568 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13280 11805 gene locus_tag LOCUS_03400 13280 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13628 14104 gene locus_tag LOCUS_03410 13628 14104 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_03410 15098 14079 gene locus_tag LOCUS_03420 gene meaB 15098 14079 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_03420 16601 15117 gene locus_tag LOCUS_03430 16601 15117 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_03430 18147 16666 gene locus_tag LOCUS_03440 18147 16666 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_03440 18373 18299 gene locus_tag LOCUS_t00060 18373 18299 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18786 18508 gene locus_tag LOCUS_03450 18786 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence020 3543 2797 gene locus_tag LOCUS_03460 3543 2797 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976137.1 protein_id gnl|my_center|LOCUS_03460 5612 4035 gene locus_tag LOCUS_03470 5612 4035 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_03470 6358 5696 gene locus_tag LOCUS_03480 6358 5696 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 protein_id gnl|my_center|LOCUS_03480 7181 6402 gene locus_tag LOCUS_03490 7181 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8369 7194 gene locus_tag LOCUS_03500 8369 7194 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_03500 8798 8391 gene locus_tag LOCUS_03510 8798 8391 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_03510 9179 12694 gene locus_tag LOCUS_03520 9179 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 14391 13093 gene locus_tag LOCUS_03530 14391 13093 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_03530 16359 14416 gene locus_tag LOCUS_03540 16359 14416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704237.1 protein_id gnl|my_center|LOCUS_03540 16762 16385 gene locus_tag LOCUS_03550 16762 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 17679 16789 gene locus_tag LOCUS_03560 17679 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence021 1916 1383 gene locus_tag LOCUS_03570 1916 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 6473 2043 gene locus_tag LOCUS_03580 6473 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 7317 6778 gene locus_tag LOCUS_03590 7317 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 8616 7411 gene locus_tag LOCUS_03600 gene lpxK 8616 7411 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_03600 9367 8648 gene locus_tag LOCUS_03610 9367 8648 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_03610 10961 9903 gene locus_tag LOCUS_03620 10961 9903 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_03620 11087 11416 gene locus_tag LOCUS_03630 11087 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12238 11429 gene locus_tag LOCUS_03640 gene mazG 12238 11429 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383231.1 protein_id gnl|my_center|LOCUS_03640 12269 12625 gene locus_tag LOCUS_03650 12269 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 12657 13406 gene locus_tag LOCUS_03660 12657 13406 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03660 13446 13877 gene locus_tag LOCUS_03670 13446 13877 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_03670 13963 14038 gene locus_tag LOCUS_t00070 13963 14038 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15169 14279 gene locus_tag LOCUS_03680 15169 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17346 15787 gene locus_tag LOCUS_03690 17346 15787 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050547433.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence022 395 1360 gene locus_tag LOCUS_03700 395 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2813 1494 gene locus_tag LOCUS_03710 2813 1494 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_03710 3770 3081 gene locus_tag LOCUS_03720 3770 3081 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_03720 4871 4050 gene locus_tag LOCUS_03730 4871 4050 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_03730 5049 4804 gene locus_tag LOCUS_03740 5049 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5225 5151 gene locus_tag LOCUS_t00080 5225 5151 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5519 6538 gene locus_tag LOCUS_03750 gene alr 5519 6538 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03750 7664 6657 gene locus_tag LOCUS_03760 7664 6657 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_03760 8660 7683 gene locus_tag LOCUS_03770 8660 7683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_03770 10913 8664 gene locus_tag LOCUS_03780 10913 8664 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_03780 12546 10939 gene locus_tag LOCUS_03790 12546 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 13940 12552 gene locus_tag LOCUS_03800 13940 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14868 14110 gene locus_tag LOCUS_03810 14868 14110 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_03810 15847 14972 gene locus_tag LOCUS_03820 15847 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 16784 15867 gene locus_tag LOCUS_03830 16784 15867 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_03830 <17383 16812 gene locus_tag LOCUS_03840 <17383 16812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966477.1:formate--tetrahydrofolate ligase >Feature sequence023 <1 696 gene locus_tag LOCUS_03850 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599658.1:F0F1 ATP synthase subunit alpha 718 1590 gene locus_tag LOCUS_03860 gene atpG 718 1590 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403678.1 protein_id gnl|my_center|LOCUS_03860 1665 3086 gene locus_tag LOCUS_03870 gene atpD 1665 3086 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190491.1 protein_id gnl|my_center|LOCUS_03870 3110 3532 gene locus_tag LOCUS_03880 3110 3532 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_03880 3529 4092 gene locus_tag LOCUS_03890 3529 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4687 4175 gene locus_tag LOCUS_03900 4687 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4862 5983 gene locus_tag LOCUS_03910 4862 5983 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_03910 6182 5973 gene locus_tag LOCUS_03920 6182 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6105 7244 gene locus_tag LOCUS_03930 gene rffA 6105 7244 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_03930 7241 7738 gene locus_tag LOCUS_03940 7241 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7735 8673 gene locus_tag LOCUS_03950 7735 8673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_03950 8700 9038 gene locus_tag LOCUS_03960 8700 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9031 9375 gene locus_tag LOCUS_03970 9031 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 9504 11300 gene locus_tag LOCUS_03980 9504 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12547 11366 gene locus_tag LOCUS_03990 12547 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 13181 12525 gene locus_tag LOCUS_04000 13181 12525 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 protein_id gnl|my_center|LOCUS_04000 14857 13508 gene locus_tag LOCUS_04010 gene bioA 14857 13508 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_04010 15821 14886 gene locus_tag LOCUS_04020 gene bioB 15821 14886 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_04020 <16598 15936 gene locus_tag LOCUS_04030 <16598 15936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203710.1:arylsulfatase >Feature sequence024 <1 1508 gene locus_tag LOCUS_04040 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922562.1:ATPase, T2SS/T4P/T4SS family 1537 3189 gene locus_tag LOCUS_04050 1537 3189 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_04050 3259 4527 gene locus_tag LOCUS_04060 3259 4527 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04060 4546 5214 gene locus_tag LOCUS_04070 4546 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5349 6293 gene locus_tag LOCUS_04080 5349 6293 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_04080 6302 7123 gene locus_tag LOCUS_04090 6302 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7725 7270 gene locus_tag LOCUS_04100 gene ndk 7725 7270 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_04100 8212 7829 gene locus_tag LOCUS_04110 8212 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8710 9276 gene locus_tag LOCUS_04120 8710 9276 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_04120 9351 9572 gene locus_tag LOCUS_04130 9351 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9687 10145 gene locus_tag LOCUS_04140 gene smpB 9687 10145 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_04140 10256 10038 gene locus_tag LOCUS_04150 10256 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10895 10332 gene locus_tag LOCUS_04160 10895 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10976 11440 gene locus_tag LOCUS_04170 10976 11440 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_04170 13010 11868 gene locus_tag LOCUS_04180 gene citZ 13010 11868 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_04180 13751 13083 gene locus_tag LOCUS_04190 13751 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 13876 14784 gene locus_tag LOCUS_04200 13876 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 14865 15386 gene locus_tag LOCUS_04210 14865 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 15498 15950 gene locus_tag LOCUS_04220 15498 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence025 233 829 gene locus_tag LOCUS_04230 233 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 928 1968 gene locus_tag LOCUS_04240 gene tgt 928 1968 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_04240 1965 2297 gene locus_tag LOCUS_04250 1965 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2422 3273 gene locus_tag LOCUS_04260 2422 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3284 4186 gene locus_tag LOCUS_04270 gene xerC 3284 4186 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 protein_id gnl|my_center|LOCUS_04270 4202 4453 gene locus_tag LOCUS_04280 4202 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4538 4828 gene locus_tag LOCUS_04290 4538 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4994 5236 gene locus_tag LOCUS_04300 gene rpsP 4994 5236 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_04300 5931 5401 gene locus_tag LOCUS_04310 5931 5401 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_04310 6153 7238 gene locus_tag LOCUS_04320 6153 7238 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_04320 7294 7638 gene locus_tag LOCUS_04330 7294 7638 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_04330 7749 8240 gene locus_tag LOCUS_04340 7749 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 8264 8455 gene locus_tag LOCUS_04350 gene rpmF 8264 8455 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_04350 8604 9653 gene locus_tag LOCUS_04360 gene plsX 8604 9653 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_04360 9659 11419 gene locus_tag LOCUS_04370 9659 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11403 11900 gene locus_tag LOCUS_04380 11403 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11968 12044 gene locus_tag LOCUS_t00090 11968 12044 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13109 12483 gene locus_tag LOCUS_04390 13109 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13594 13211 gene locus_tag LOCUS_04400 13594 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13905 16061 gene locus_tag LOCUS_04410 13905 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence026 2389 4395 gene locus_tag LOCUS_04420 gene btuB 2389 4395 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_04420 4542 6659 gene locus_tag LOCUS_04430 4542 6659 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_04430 6758 9100 gene locus_tag LOCUS_04440 6758 9100 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_04440 10022 9354 gene locus_tag LOCUS_04450 10022 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 10104 11426 gene locus_tag LOCUS_04460 10104 11426 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_04460 11573 12967 gene locus_tag LOCUS_04470 gene lpdA 11573 12967 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_04470 14126 13473 gene locus_tag LOCUS_04480 14126 13473 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_04480 15628 14537 gene locus_tag LOCUS_04490 gene odhB 15628 14537 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence027 1219 1046 gene locus_tag LOCUS_04500 1219 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1816 3057 gene locus_tag LOCUS_04510 1816 3057 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_04510 3169 3777 gene locus_tag LOCUS_04520 3169 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4272 5717 gene locus_tag LOCUS_04530 4272 5717 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_04530 6018 7160 gene locus_tag LOCUS_04540 gene eboE 6018 7160 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_04540 7165 8124 gene locus_tag LOCUS_04550 7165 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9294 8143 gene locus_tag LOCUS_04560 9294 8143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171044.1 protein_id gnl|my_center|LOCUS_04560 10814 9444 gene locus_tag LOCUS_04570 gene rpoN 10814 9444 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 protein_id gnl|my_center|LOCUS_04570 10981 11691 gene locus_tag LOCUS_04580 10981 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 12081 12857 gene locus_tag LOCUS_04590 12081 12857 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 protein_id gnl|my_center|LOCUS_04590 12880 13119 gene locus_tag LOCUS_04600 12880 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13352 13951 gene locus_tag LOCUS_04610 13352 13951 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence028 435 510 gene locus_tag LOCUS_t00100 435 510 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 544 771 gene locus_tag LOCUS_04620 544 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 801 1370 gene locus_tag LOCUS_04630 gene nusG 801 1370 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_04630 1438 1866 gene locus_tag LOCUS_04640 gene rplK 1438 1866 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_04640 1918 2619 gene locus_tag LOCUS_04650 gene rplA 1918 2619 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811658.1 protein_id gnl|my_center|LOCUS_04650 2641 3144 gene locus_tag LOCUS_04660 gene rplJ 2641 3144 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_04660 3303 3677 gene locus_tag LOCUS_04670 gene rplL 3303 3677 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_04670 3879 7817 gene locus_tag LOCUS_04680 gene rpoB 3879 7817 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_04680 7891 12087 gene locus_tag LOCUS_04690 gene rpoC 7891 12087 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence029 573 965 gene locus_tag LOCUS_04700 573 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2647 1034 gene locus_tag LOCUS_04710 gene cobA 2647 1034 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_04710 3604 4362 gene locus_tag LOCUS_04720 3604 4362 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_04720 5282 4839 gene locus_tag LOCUS_04730 5282 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7478 5331 gene locus_tag LOCUS_04740 7478 5331 CDS product polymorphic outer membrane protein middle domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883092.1 protein_id gnl|my_center|LOCUS_04740 11490 8353 gene locus_tag LOCUS_04750 gene mexY 11490 8353 CDS product multidrug efflux RND transporter permease subunit MexY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113508.1 protein_id gnl|my_center|LOCUS_04750 12650 11448 gene locus_tag LOCUS_04760 gene mexX 12650 11448 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113509.1 protein_id gnl|my_center|LOCUS_04760 12935 13750 gene locus_tag LOCUS_04770 12935 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 13915 14916 gene locus_tag LOCUS_04780 13915 14916 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence030 1693 56 gene locus_tag LOCUS_04790 1693 56 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_04790 2255 3763 gene locus_tag LOCUS_04800 2255 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4092 6053 gene locus_tag LOCUS_04810 4092 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 7330 6272 gene locus_tag LOCUS_04820 7330 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 8663 7383 gene locus_tag LOCUS_04830 gene hemL 8663 7383 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_04830 8999 8748 gene locus_tag LOCUS_04840 8999 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9228 10718 gene locus_tag LOCUS_04850 gene rfaE1 9228 10718 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_04850 10715 11284 gene locus_tag LOCUS_04860 gene gmhA 10715 11284 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_04860 11274 11780 gene locus_tag LOCUS_04870 gene gmhB 11274 11780 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_04870 11970 14963 gene locus_tag LOCUS_04880 11970 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence031 <1 702 gene locus_tag LOCUS_04890 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880718.1:4-hydroxy-tetrahydrodipicolinate synthase 715 1455 gene locus_tag LOCUS_04900 gene dapB 715 1455 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_04900 1513 2022 gene locus_tag LOCUS_04910 gene folK 1513 2022 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_04910 2035 2832 gene locus_tag LOCUS_04920 gene panB 2035 2832 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_04920 2900 3781 gene locus_tag LOCUS_04930 2900 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3829 4698 gene locus_tag LOCUS_04940 3829 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5559 4714 gene locus_tag LOCUS_04950 5559 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6051 6932 gene locus_tag LOCUS_04960 6051 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7025 7603 gene locus_tag LOCUS_04970 7025 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 8075 7999 gene locus_tag LOCUS_t00110 8075 7999 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8171 8647 gene locus_tag LOCUS_04980 8171 8647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_04980 9192 8725 gene locus_tag LOCUS_04990 9192 8725 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798768.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 9609 11297 gene locus_tag LOCUS_05000 gene rpsA 9609 11297 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_05000 11433 11834 gene locus_tag LOCUS_05010 11433 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 12310 13299 gene locus_tag LOCUS_05020 gene prfB 12310 13299 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_05020 13312 14031 gene locus_tag LOCUS_05030 gene trmD 13312 14031 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_05030 14153 14308 gene locus_tag LOCUS_05040 14153 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14512 14802 gene locus_tag LOCUS_05050 14512 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05050 >Feature sequence032 762 2471 gene locus_tag LOCUS_05060 gene kdpA 762 2471 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_05060 2556 4589 gene locus_tag LOCUS_05070 gene kdpB 2556 4589 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_05070 4609 5193 gene locus_tag LOCUS_05080 4609 5193 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764090.1 protein_id gnl|my_center|LOCUS_05080 5374 6501 gene locus_tag LOCUS_05090 5374 6501 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764092.1 protein_id gnl|my_center|LOCUS_05090 6854 7840 gene locus_tag LOCUS_05100 6854 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8000 8212 gene locus_tag LOCUS_05110 8000 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 8378 9217 gene locus_tag LOCUS_05120 8378 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9243 9839 gene locus_tag LOCUS_05130 9243 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9836 12139 gene locus_tag LOCUS_05140 9836 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12934 12482 gene locus_tag LOCUS_05150 12934 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13170 14207 gene locus_tag LOCUS_05160 13170 14207 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence033 1201 536 gene locus_tag LOCUS_05170 1201 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1603 2979 gene locus_tag LOCUS_05180 1603 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3198 4376 gene locus_tag LOCUS_05190 gene galK 3198 4376 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053399.1 protein_id gnl|my_center|LOCUS_05190 4386 6674 gene locus_tag LOCUS_05200 4386 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8901 6895 gene locus_tag LOCUS_05210 8901 6895 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_05210 9846 8902 gene locus_tag LOCUS_05220 gene fmt 9846 8902 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_05220 10056 11183 gene locus_tag LOCUS_05230 10056 11183 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_05230 11189 11917 gene locus_tag LOCUS_05240 11189 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12049 12291 gene locus_tag LOCUS_05250 gene acpP 12049 12291 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_05250 12360 12929 gene locus_tag LOCUS_05260 12360 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12964 13662 gene locus_tag LOCUS_05270 12964 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 13659 14111 gene locus_tag LOCUS_05280 gene dtd 13659 14111 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence034 <1 610 gene locus_tag LOCUS_05290 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202799.1:alpha-amylase family glycosyl hydrolase 746 3247 gene locus_tag LOCUS_05300 746 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3269 4909 gene locus_tag LOCUS_05310 3269 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4925 5653 gene locus_tag LOCUS_05320 4925 5653 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053541.1 protein_id gnl|my_center|LOCUS_05320 5626 6501 gene locus_tag LOCUS_05330 gene folD 5626 6501 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_05330 6569 7351 gene locus_tag LOCUS_05340 6569 7351 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_05340 8350 7493 gene locus_tag LOCUS_05350 8350 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9486 8347 gene locus_tag LOCUS_05360 9486 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10545 9499 gene locus_tag LOCUS_05370 10545 9499 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 protein_id gnl|my_center|LOCUS_05370 10682 11827 gene locus_tag LOCUS_05380 10682 11827 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_05380 12183 11962 gene locus_tag LOCUS_05390 12183 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12527 12264 gene locus_tag LOCUS_05400 12527 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 12688 13296 gene locus_tag LOCUS_05410 12688 13296 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706953.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence035 880 608 gene locus_tag LOCUS_05420 880 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 960 2999 gene locus_tag LOCUS_05430 960 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3094 5274 gene locus_tag LOCUS_05440 3094 5274 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_05440 5591 5818 gene locus_tag LOCUS_05450 5591 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5842 6810 gene locus_tag LOCUS_05460 5842 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6812 7180 gene locus_tag LOCUS_05470 6812 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7439 7630 gene locus_tag LOCUS_05480 7439 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7620 7925 gene locus_tag LOCUS_05490 7620 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8181 8882 gene locus_tag LOCUS_05500 8181 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9087 9332 gene locus_tag LOCUS_05510 9087 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963633.1 protein_id gnl|my_center|LOCUS_05510 9354 10364 gene locus_tag LOCUS_05520 9354 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 10821 10471 gene locus_tag LOCUS_05530 gene rsfS 10821 10471 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418177.1 protein_id gnl|my_center|LOCUS_05530 13293 10843 gene locus_tag LOCUS_05540 13293 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 14255 13458 gene locus_tag LOCUS_05550 14255 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence036 318 1616 gene locus_tag LOCUS_05560 318 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1674 1973 gene locus_tag LOCUS_05570 gene tatA 1674 1973 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_05570 2478 3884 gene locus_tag LOCUS_05580 2478 3884 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_05580 4052 4411 gene locus_tag LOCUS_05590 4052 4411 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_05590 4420 5190 gene locus_tag LOCUS_05600 4420 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6956 5292 gene locus_tag LOCUS_05610 gene glgP 6956 5292 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_05610 7217 8254 gene locus_tag LOCUS_05620 gene tdh 7217 8254 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 protein_id gnl|my_center|LOCUS_05620 9047 8367 gene locus_tag LOCUS_05630 9047 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 9269 10480 gene locus_tag LOCUS_05640 9269 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 10540 11325 gene locus_tag LOCUS_05650 10540 11325 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_05650 11998 11501 gene locus_tag LOCUS_05660 11998 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12193 12267 gene locus_tag LOCUS_t00120 12193 12267 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12310 12385 gene locus_tag LOCUS_t00130 12310 12385 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12422 12497 gene locus_tag LOCUS_t00140 12422 12497 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence037 <1 1186 gene locus_tag LOCUS_05670 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256378.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 1188 1928 gene locus_tag LOCUS_05680 gene radC 1188 1928 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_05680 2105 2013 gene locus_tag LOCUS_t00150 2105 2013 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3282 2467 gene locus_tag LOCUS_05690 3282 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4106 3330 gene locus_tag LOCUS_05700 4106 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4326 6524 gene locus_tag LOCUS_05710 4326 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6571 6867 gene locus_tag LOCUS_05720 6571 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6880 7920 gene locus_tag LOCUS_05730 6880 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9393 7999 gene locus_tag LOCUS_05740 9393 7999 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_05740 10428 9712 gene locus_tag LOCUS_05750 10428 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 11402 10608 gene locus_tag LOCUS_05760 gene pyrF 11402 10608 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_05760 11559 13382 gene locus_tag LOCUS_05770 11559 13382 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence038 3020 1974 gene locus_tag LOCUS_05780 3020 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05780 3492 3043 gene locus_tag LOCUS_05790 3492 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 5181 3496 gene locus_tag LOCUS_05800 5181 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 5501 6601 gene locus_tag LOCUS_05810 5501 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 8627 6672 gene locus_tag LOCUS_05820 gene speA 8627 6672 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_05820 9835 8633 gene locus_tag LOCUS_05830 gene nspC 9835 8633 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_05830 10013 10804 gene locus_tag LOCUS_05840 10013 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 12784 11120 gene locus_tag LOCUS_05850 12784 11120 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence039 <1 877 gene locus_tag LOCUS_05860 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase 1089 1358 gene locus_tag LOCUS_05870 1089 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1390 1620 gene locus_tag LOCUS_05880 1390 1620 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05880 1697 3958 gene locus_tag LOCUS_05890 gene feoB 1697 3958 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_05890 3993 4178 gene locus_tag LOCUS_05900 3993 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4684 4277 gene locus_tag LOCUS_05910 4684 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6340 5231 gene locus_tag LOCUS_05920 6340 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6983 7252 gene locus_tag LOCUS_05930 6983 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7376 9472 gene locus_tag LOCUS_05940 7376 9472 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_05940 9943 9536 gene locus_tag LOCUS_05950 9943 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11193 10372 gene locus_tag LOCUS_05960 11193 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 11808 11227 gene locus_tag LOCUS_05970 11808 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 11915 13519 gene locus_tag LOCUS_05980 gene nadB 11915 13519 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence040 1894 80 gene locus_tag LOCUS_05990 1894 80 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_05990 2113 2889 gene locus_tag LOCUS_06000 2113 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2900 4438 gene locus_tag LOCUS_06010 2900 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4460 5437 gene locus_tag LOCUS_06020 4460 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5631 6092 gene locus_tag LOCUS_06030 5631 6092 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_06030 6196 7197 gene locus_tag LOCUS_06040 gene purM 6196 7197 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880467.1 protein_id gnl|my_center|LOCUS_06040 7260 9179 gene locus_tag LOCUS_06050 7260 9179 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_06050 9240 9812 gene locus_tag LOCUS_06060 gene rpoE 9240 9812 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_06060 9920 10441 gene locus_tag LOCUS_06070 9920 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10448 11323 gene locus_tag LOCUS_06080 10448 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11435 11803 gene locus_tag LOCUS_06090 11435 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11817 12356 gene locus_tag LOCUS_06100 11817 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12376 13005 gene locus_tag LOCUS_06110 12376 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence041 2899 1379 gene locus_tag LOCUS_06120 2899 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3334 4509 gene locus_tag LOCUS_06130 3334 4509 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_06130 4955 5290 gene locus_tag LOCUS_06140 4955 5290 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_06140 7292 5358 gene locus_tag LOCUS_06150 7292 5358 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_06150 7611 8360 gene locus_tag LOCUS_06160 7611 8360 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_06160 8807 8412 gene locus_tag LOCUS_06170 8807 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9149 9928 gene locus_tag LOCUS_06180 9149 9928 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_06180 13264 10070 gene locus_tag LOCUS_06190 gene carB 13264 10070 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence042 95 994 gene locus_tag LOCUS_06200 95 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1220 2260 gene locus_tag LOCUS_06210 gene recA 1220 2260 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_06210 2453 3439 gene locus_tag LOCUS_06220 2453 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3475 4113 gene locus_tag LOCUS_06230 gene lipB 3475 4113 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_06230 4316 5728 gene locus_tag LOCUS_06240 gene leuC 4316 5728 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_06240 5748 6356 gene locus_tag LOCUS_06250 gene leuD 5748 6356 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_06250 6401 7522 gene locus_tag LOCUS_06260 6401 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7564 9138 gene locus_tag LOCUS_06270 7564 9138 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_06270 9144 10724 gene locus_tag LOCUS_06280 9144 10724 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_06280 10738 11925 gene locus_tag LOCUS_06290 10738 11925 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_06290 13240 12455 gene locus_tag LOCUS_06300 13240 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence043 <1 1424 gene locus_tag LOCUS_06310 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192418.1:ClcB-like voltage-gated chloride channel protein 1925 2935 gene locus_tag LOCUS_06320 1925 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3541 4896 gene locus_tag LOCUS_06330 gene gdhA 3541 4896 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_06330 6394 5264 gene locus_tag LOCUS_06340 gene lpxB 6394 5264 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_06340 6493 7167 gene locus_tag LOCUS_06350 6493 7167 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_06350 7182 7697 gene locus_tag LOCUS_06360 7182 7697 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_06360 8086 7715 gene locus_tag LOCUS_06370 8086 7715 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_06370 8743 8240 gene locus_tag LOCUS_06380 8743 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8917 8991 gene locus_tag LOCUS_t00160 8917 8991 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10293 9412 gene locus_tag LOCUS_06390 10293 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 10567 10286 gene locus_tag LOCUS_06400 10567 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12198 10564 gene locus_tag LOCUS_06410 12198 10564 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939009.1 protein_id gnl|my_center|LOCUS_06410 12422 12207 gene locus_tag LOCUS_06420 12422 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence044 252 1169 gene locus_tag LOCUS_06430 gene pfkA 252 1169 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_06430 1301 2353 gene locus_tag LOCUS_06440 gene rfbB 1301 2353 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870348.1 protein_id gnl|my_center|LOCUS_06440 2363 3226 gene locus_tag LOCUS_06450 gene rfbA 2363 3226 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_06450 4205 3504 gene locus_tag LOCUS_06460 4205 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5820 4324 gene locus_tag LOCUS_06470 5820 4324 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_06470 6661 5882 gene locus_tag LOCUS_06480 6661 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8363 6699 gene locus_tag LOCUS_06490 8363 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 8849 8442 gene locus_tag LOCUS_06500 8849 8442 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 protein_id gnl|my_center|LOCUS_06500 9370 8924 gene locus_tag LOCUS_06510 9370 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10957 9392 gene locus_tag LOCUS_06520 10957 9392 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_06520 11459 10989 gene locus_tag LOCUS_06530 gene mce 11459 10989 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence045 1306 227 gene locus_tag LOCUS_06540 gene dinB 1306 227 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_06540 1474 2811 gene locus_tag LOCUS_06550 1474 2811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_06550 3389 4234 gene locus_tag LOCUS_06560 3389 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4574 4500 gene locus_tag LOCUS_t00170 4574 4500 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5838 4726 gene locus_tag LOCUS_06570 5838 4726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_06570 6949 5843 gene locus_tag LOCUS_06580 6949 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8709 6946 gene locus_tag LOCUS_06590 8709 6946 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_06590 9728 8706 gene locus_tag LOCUS_06600 9728 8706 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_06600 9862 12690 gene locus_tag LOCUS_06610 gene alaS 9862 12690 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence046 81 3626 gene locus_tag LOCUS_06620 81 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3641 5503 gene locus_tag LOCUS_06630 3641 5503 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_06630 5521 6645 gene locus_tag LOCUS_06640 5521 6645 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_06640 6725 7108 gene locus_tag LOCUS_06650 6725 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8898 7258 gene locus_tag LOCUS_06660 gene cysI 8898 7258 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_06660 9426 8914 gene locus_tag LOCUS_06670 9426 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 10475 9678 gene locus_tag LOCUS_06680 10475 9678 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_06680 11493 10468 gene locus_tag LOCUS_06690 11493 10468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223440.1 protein_id gnl|my_center|LOCUS_06690 <12798 11528 gene locus_tag LOCUS_06700 <12798 11528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105005.1:sulfate adenylyltransferase subunit CysN >Feature sequence047 141 881 gene locus_tag LOCUS_06710 141 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2028 979 gene locus_tag LOCUS_06720 2028 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3920 2028 gene locus_tag LOCUS_06730 3920 2028 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_06730 4422 5372 gene locus_tag LOCUS_06740 4422 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5488 7494 gene locus_tag LOCUS_06750 5488 7494 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_06750 8001 7621 gene locus_tag LOCUS_06760 8001 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8234 8016 gene locus_tag LOCUS_06770 8234 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9425 8469 gene locus_tag LOCUS_06780 gene argF 9425 8469 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_06780 11210 9489 gene locus_tag LOCUS_06790 11210 9489 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_06790 <12745 11307 gene locus_tag LOCUS_06800 <12745 11307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942526.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence048 472 666 gene locus_tag LOCUS_06810 472 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 663 1178 gene locus_tag LOCUS_06820 663 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_06820 2057 1308 gene locus_tag LOCUS_06830 2057 1308 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_06830 3435 2050 gene locus_tag LOCUS_06840 3435 2050 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640791.1 protein_id gnl|my_center|LOCUS_06840 4059 3983 gene locus_tag LOCUS_t00180 4059 3983 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4162 5205 gene locus_tag LOCUS_06850 gene argC 4162 5205 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_06850 5215 6492 gene locus_tag LOCUS_06860 gene argJ 5215 6492 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_06860 6543 7004 gene locus_tag LOCUS_06870 6543 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8275 7088 gene locus_tag LOCUS_06880 8275 7088 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_06880 9431 8406 gene locus_tag LOCUS_06890 9431 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12105 9604 gene locus_tag LOCUS_06900 gene uvrA 12105 9604 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence049 7228 5540 gene locus_tag LOCUS_06910 7228 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 8043 7258 gene locus_tag LOCUS_06920 8043 7258 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_06920 9083 8040 gene locus_tag LOCUS_06930 9083 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 9920 9117 gene locus_tag LOCUS_06940 9920 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11886 10981 gene locus_tag LOCUS_06950 11886 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence050 1131 43 gene locus_tag LOCUS_06960 1131 43 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_06960 2200 1133 gene locus_tag LOCUS_06970 gene gmd 2200 1133 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_06970 3475 2357 gene locus_tag LOCUS_06980 gene carA 3475 2357 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_06980 6710 3507 gene locus_tag LOCUS_06990 gene carB 6710 3507 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_06990 9099 6964 gene locus_tag LOCUS_07000 9099 6964 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_07000 9204 9497 gene locus_tag LOCUS_07010 9204 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence051 1412 1816 gene locus_tag LOCUS_07020 1412 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1818 2045 gene locus_tag LOCUS_07030 1818 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2113 2334 gene locus_tag LOCUS_07040 2113 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2535 2723 gene locus_tag LOCUS_07050 2535 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2741 3301 gene locus_tag LOCUS_07060 2741 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3270 4691 gene locus_tag LOCUS_07070 3270 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4784 4984 gene locus_tag LOCUS_07080 4784 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4981 5592 gene locus_tag LOCUS_07090 4981 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5649 6737 gene locus_tag LOCUS_07100 5649 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6741 7772 gene locus_tag LOCUS_07110 6741 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7794 8192 gene locus_tag LOCUS_07120 7794 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 8198 8632 gene locus_tag LOCUS_07130 8198 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8629 9114 gene locus_tag LOCUS_07140 8629 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9104 9310 gene locus_tag LOCUS_07150 9104 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9316 9897 gene locus_tag LOCUS_07160 9316 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9966 10373 gene locus_tag LOCUS_07170 9966 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence052 266 1513 gene locus_tag LOCUS_07180 gene nirJ1 266 1513 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_07180 1771 3063 gene locus_tag LOCUS_07190 1771 3063 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_07190 3522 4103 gene locus_tag LOCUS_07200 3522 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5751 4216 gene locus_tag LOCUS_07210 5751 4216 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404336.1 protein_id gnl|my_center|LOCUS_07210 6739 5825 gene locus_tag LOCUS_07220 6739 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7825 6785 gene locus_tag LOCUS_07230 7825 6785 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_07230 9067 7958 gene locus_tag LOCUS_07240 gene leuB 9067 7958 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_07240 9234 9308 gene locus_tag LOCUS_t00190 9234 9308 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9998 10207 gene locus_tag LOCUS_07250 9998 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 10204 11499 gene locus_tag LOCUS_07260 10204 11499 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723446.1 protein_id gnl|my_center|LOCUS_07260 11496 12011 gene locus_tag LOCUS_07270 11496 12011 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987925.1 protein_id gnl|my_center|LOCUS_07270 12028 12222 gene locus_tag LOCUS_07280 12028 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence053 1126 1809 gene locus_tag LOCUS_07290 1126 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1852 3012 gene locus_tag LOCUS_07300 gene rsgA 1852 3012 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_07300 3066 4034 gene locus_tag LOCUS_07310 3066 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5304 4018 gene locus_tag LOCUS_07320 gene waaA 5304 4018 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_07320 5881 5306 gene locus_tag LOCUS_07330 gene rsmD 5881 5306 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07330 6832 5918 gene locus_tag LOCUS_07340 6832 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6744 7196 gene locus_tag LOCUS_07350 6744 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8224 7301 gene locus_tag LOCUS_07360 8224 7301 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_07360 8841 9062 gene locus_tag LOCUS_07370 8841 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 <12003 9944 gene locus_tag LOCUS_07380 <12003 9944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202199.1:alpha-1,3-galactosidase >Feature sequence054 <1 1904 gene locus_tag LOCUS_07390 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA 1938 2687 gene locus_tag LOCUS_07400 1938 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2724 3659 gene locus_tag LOCUS_07410 gene metF 2724 3659 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_07410 3712 4449 gene locus_tag LOCUS_07420 3712 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5697 5071 gene locus_tag LOCUS_07430 5697 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8988 5830 gene locus_tag LOCUS_07440 8988 5830 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_07440 10503 9079 gene locus_tag LOCUS_07450 10503 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11810 10530 gene locus_tag LOCUS_07460 11810 10530 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence055 1924 887 gene locus_tag LOCUS_07470 gene galE 1924 887 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_07470 2159 3538 gene locus_tag LOCUS_07480 2159 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3525 3986 gene locus_tag LOCUS_07490 3525 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4178 4441 gene locus_tag LOCUS_07500 4178 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4498 5319 gene locus_tag LOCUS_07510 4498 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6882 5545 gene locus_tag LOCUS_07520 6882 5545 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_07520 8774 7020 gene locus_tag LOCUS_07530 8774 7020 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_07530 9020 9106 gene locus_tag LOCUS_t00200 9020 9106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9554 9216 gene locus_tag LOCUS_07540 9554 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 10101 9568 gene locus_tag LOCUS_07550 10101 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10345 10148 gene locus_tag LOCUS_07560 10345 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10698 11879 gene locus_tag LOCUS_07570 10698 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence056 2501 1605 gene locus_tag LOCUS_07580 2501 1605 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_07580 4064 2766 gene locus_tag LOCUS_07590 gene hisD 4064 2766 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_07590 4245 4727 gene locus_tag LOCUS_07600 4245 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07600 4779 5447 gene locus_tag LOCUS_07610 4779 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07610 5469 6356 gene locus_tag LOCUS_07620 gene sucD 5469 6356 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_07620 7286 6552 gene locus_tag LOCUS_07630 7286 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_07630 7926 7834 gene locus_tag LOCUS_t00210 7926 7834 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10436 8286 gene locus_tag LOCUS_07640 10436 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10649 10725 gene locus_tag LOCUS_t00220 10649 10725 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10807 11166 gene locus_tag LOCUS_tm00010 10807 11166 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 1 360 gene locus_tag LOCUS_07650 gene rplM 1 360 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_07650 375 770 gene locus_tag LOCUS_07660 gene rpsI 375 770 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_07660 1438 1001 gene locus_tag LOCUS_07670 1438 1001 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_07670 3013 1445 gene locus_tag LOCUS_07680 3013 1445 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_07680 3125 3916 gene locus_tag LOCUS_07690 3125 3916 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_07690 3956 4402 gene locus_tag LOCUS_07700 3956 4402 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_07700 4444 6831 gene locus_tag LOCUS_07710 4444 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6844 8649 gene locus_tag LOCUS_07720 6844 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8696 9442 gene locus_tag LOCUS_07730 8696 9442 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_07730 9478 9978 gene locus_tag LOCUS_07740 9478 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 10956 10225 gene locus_tag LOCUS_07750 10956 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence058 2137 1175 gene locus_tag LOCUS_07760 gene cdsA 2137 1175 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 protein_id gnl|my_center|LOCUS_07760 2652 4871 gene locus_tag LOCUS_07770 gene prc 2652 4871 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650135.1 protein_id gnl|my_center|LOCUS_07770 5035 6735 gene locus_tag LOCUS_07780 5035 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7318 6935 gene locus_tag LOCUS_07790 7318 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7988 7527 gene locus_tag LOCUS_07800 7988 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8910 8170 gene locus_tag LOCUS_07810 gene vanX 8910 8170 CDS product D-Ala-D-Ala dipeptidase VanX-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029111.1 protein_id gnl|my_center|LOCUS_07810 11015 8949 gene locus_tag LOCUS_07820 11015 8949 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence059 <1 1524 gene locus_tag LOCUS_07830 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064803.1:glutamate synthase-related protein 4205 2319 gene locus_tag LOCUS_07840 4205 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4507 4262 gene locus_tag LOCUS_07850 gene yidD 4507 4262 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_07850 4770 4507 gene locus_tag LOCUS_07860 4770 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5128 4943 gene locus_tag LOCUS_07870 5128 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7450 5339 gene locus_tag LOCUS_07880 7450 5339 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_07880 7859 10051 gene locus_tag LOCUS_07890 7859 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence060 1544 408 gene locus_tag LOCUS_07900 1544 408 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_07900 4845 1669 gene locus_tag LOCUS_07910 4845 1669 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_07910 6189 4849 gene locus_tag LOCUS_07920 6189 4849 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_07920 6663 6268 gene locus_tag LOCUS_07930 6663 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7677 6988 gene locus_tag LOCUS_07940 gene tsaA 7677 6988 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_07940 9008 7734 gene locus_tag LOCUS_07950 9008 7734 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_07950 9944 9015 gene locus_tag LOCUS_07960 9944 9015 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_07960 10506 9973 gene locus_tag LOCUS_07970 gene pyrR 10506 9973 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence061 181 2757 gene locus_tag LOCUS_07980 181 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2811 3290 gene locus_tag LOCUS_07990 2811 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5624 3627 gene locus_tag LOCUS_08000 5624 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5846 6010 gene locus_tag LOCUS_08010 5846 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6020 6640 gene locus_tag LOCUS_08020 6020 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 6809 8596 gene locus_tag LOCUS_08030 6809 8596 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_08030 8827 10320 gene locus_tag LOCUS_08040 8827 10320 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence062 1739 2215 gene locus_tag LOCUS_08050 1739 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2381 2548 gene locus_tag LOCUS_08060 2381 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3715 2588 gene locus_tag LOCUS_08070 gene msrB 3715 2588 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_08070 4371 3856 gene locus_tag LOCUS_08080 4371 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4511 6754 gene locus_tag LOCUS_08090 4511 6754 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_08090 7942 6827 gene locus_tag LOCUS_08100 7942 6827 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930902.1 protein_id gnl|my_center|LOCUS_08100 8073 8990 gene locus_tag LOCUS_08110 8073 8990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109796.1 protein_id gnl|my_center|LOCUS_08110 10234 9002 gene locus_tag LOCUS_08120 10234 9002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence063 1005 2117 gene locus_tag LOCUS_08130 1005 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2619 2053 gene locus_tag LOCUS_08140 gene efp 2619 2053 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 protein_id gnl|my_center|LOCUS_08140 3201 2743 gene locus_tag LOCUS_08150 3201 2743 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_08150 4485 3229 gene locus_tag LOCUS_08160 4485 3229 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_08160 4674 5087 gene locus_tag LOCUS_08170 gene mscL 4674 5087 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948242.1 protein_id gnl|my_center|LOCUS_08170 5177 6322 gene locus_tag LOCUS_08180 5177 6322 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_08180 7521 6331 gene locus_tag LOCUS_08190 7521 6331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_08190 7744 9300 gene locus_tag LOCUS_08200 7744 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 9391 10539 gene locus_tag LOCUS_08210 9391 10539 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence064 1124 1654 gene locus_tag LOCUS_08220 1124 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3957 2026 gene locus_tag LOCUS_08230 3957 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4126 4926 gene locus_tag LOCUS_08240 gene gpmA 4126 4926 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_08240 4944 5966 gene locus_tag LOCUS_08250 4944 5966 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_08250 6098 7246 gene locus_tag LOCUS_08260 6098 7246 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_08260 7309 7812 gene locus_tag LOCUS_08270 7309 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08270 7840 8718 gene locus_tag LOCUS_08280 7840 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08280 9208 8741 gene locus_tag LOCUS_08290 9208 8741 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_08290 9437 9697 gene locus_tag LOCUS_08300 9437 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence065 2642 1644 gene locus_tag LOCUS_08310 2642 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3965 2763 gene locus_tag LOCUS_08320 3965 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5296 4403 gene locus_tag LOCUS_08330 5296 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6478 5324 gene locus_tag LOCUS_08340 6478 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6689 7768 gene locus_tag LOCUS_08350 gene rfaD 6689 7768 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_08350 7790 8764 gene locus_tag LOCUS_08360 7790 8764 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_08360 8761 9786 gene locus_tag LOCUS_08370 8761 9786 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence066 67 759 gene locus_tag LOCUS_08380 67 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 787 1461 gene locus_tag LOCUS_08390 787 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2031 1486 gene locus_tag LOCUS_08400 gene thiE 2031 1486 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_08400 2263 3264 gene locus_tag LOCUS_08410 2263 3264 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_08410 3297 6821 gene locus_tag LOCUS_08420 3297 6821 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_08420 6826 7389 gene locus_tag LOCUS_08430 6826 7389 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_08430 8041 9441 gene locus_tag LOCUS_08440 8041 9441 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358930.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence067 6403 6480 gene locus_tag LOCUS_t00230 6403 6480 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6602 8182 gene locus_tag LOCUS_08450 gene ilvA 6602 8182 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125079.1 protein_id gnl|my_center|LOCUS_08450 8249 8818 gene locus_tag LOCUS_08460 8249 8818 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_08460 10235 8922 gene locus_tag LOCUS_08470 gene hflX 10235 8922 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883116.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence068 <1 834 gene locus_tag LOCUS_08480 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485526.1:formate C-acetyltransferase 851 1630 gene locus_tag LOCUS_08490 gene pflA 851 1630 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_08490 3590 1731 gene locus_tag LOCUS_08500 3590 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3971 4108 gene locus_tag LOCUS_08510 3971 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4195 5358 gene locus_tag LOCUS_08520 4195 5358 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_08520 5557 5967 gene locus_tag LOCUS_08530 5557 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <10106 6089 gene locus_tag LOCUS_08540 <10106 6089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence069 1599 2609 gene locus_tag LOCUS_08550 1599 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4216 3095 gene locus_tag LOCUS_08560 4216 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5876 4281 gene locus_tag LOCUS_08570 gene rng 5876 4281 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_08570 7104 6073 gene locus_tag LOCUS_08580 7104 6073 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence070 1055 1435 gene locus_tag LOCUS_08590 1055 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1601 3694 gene locus_tag LOCUS_08600 1601 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3798 3872 gene locus_tag LOCUS_t00240 3798 3872 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4207 4788 gene locus_tag LOCUS_08610 4207 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5310 4927 gene locus_tag LOCUS_08620 5310 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5755 5429 gene locus_tag LOCUS_08630 5755 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6095 6979 gene locus_tag LOCUS_08640 gene spo0J 6095 6979 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_08640 6998 7942 gene locus_tag LOCUS_08650 6998 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence071 1923 1000 gene locus_tag LOCUS_08660 1923 1000 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_08660 2026 3087 gene locus_tag LOCUS_08670 gene queG 2026 3087 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_08670 3206 3583 gene locus_tag LOCUS_08680 gene rpsM 3206 3583 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_08680 3616 4167 gene locus_tag LOCUS_08690 3616 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4201 4812 gene locus_tag LOCUS_08700 gene rpsD 4201 4812 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_08700 4944 5711 gene locus_tag LOCUS_08710 4944 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5837 6721 gene locus_tag LOCUS_08720 5837 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6864 7790 gene locus_tag LOCUS_08730 6864 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7913 8740 gene locus_tag LOCUS_08740 7913 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9243 8728 gene locus_tag LOCUS_08750 9243 8728 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101942.1 protein_id gnl|my_center|LOCUS_08750 9683 9243 gene locus_tag LOCUS_08760 9683 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence072 <1 544 gene locus_tag LOCUS_08770 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704418.1:2-iminoacetate synthase ThiH 647 2533 gene locus_tag LOCUS_08780 647 2533 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_08780 3753 2596 gene locus_tag LOCUS_08790 3753 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3946 6336 gene locus_tag LOCUS_08800 3946 6336 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_08800 7957 6584 gene locus_tag LOCUS_08810 7957 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8502 7975 gene locus_tag LOCUS_08820 8502 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 <9723 8651 gene locus_tag LOCUS_08830 <9723 8651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615945.1:terpene cyclase/mutase family protein >Feature sequence073 85 474 gene locus_tag LOCUS_08840 85 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 552 1544 gene locus_tag LOCUS_08850 552 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1541 2704 gene locus_tag LOCUS_08860 1541 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2710 3261 gene locus_tag LOCUS_08870 2710 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3271 3696 gene locus_tag LOCUS_08880 3271 3696 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_08880 4291 4710 gene locus_tag LOCUS_08890 4291 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5470 6072 gene locus_tag LOCUS_08900 5470 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976044.1 protein_id gnl|my_center|LOCUS_08900 6104 6874 gene locus_tag LOCUS_08910 6104 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6896 8245 gene locus_tag LOCUS_08920 gene dnaB 6896 8245 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence074 3731 240 gene locus_tag LOCUS_08930 3731 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3944 4093 gene locus_tag LOCUS_08940 3944 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4087 4230 gene locus_tag LOCUS_08950 4087 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5039 4290 gene locus_tag LOCUS_08960 5039 4290 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_08960 6598 5255 gene locus_tag LOCUS_08970 6598 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9277 6617 gene locus_tag LOCUS_08980 9277 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence075 973 2214 gene locus_tag LOCUS_08990 973 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2967 2230 gene locus_tag LOCUS_09000 2967 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3116 4159 gene locus_tag LOCUS_09010 3116 4159 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975735.1 protein_id gnl|my_center|LOCUS_09010 4623 4156 gene locus_tag LOCUS_09020 4623 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4736 5524 gene locus_tag LOCUS_09030 gene thiD 4736 5524 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_09030 5710 5982 gene locus_tag LOCUS_09040 5710 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6268 7650 gene locus_tag LOCUS_09050 6268 7650 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 protein_id gnl|my_center|LOCUS_09050 8893 7697 gene locus_tag LOCUS_09060 8893 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09060 <9531 8924 gene locus_tag LOCUS_09070 <9531 8924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263943.1:efflux RND transporter permease subunit note possible pseudo, internal stop codon >Feature sequence076 127 1299 gene locus_tag LOCUS_09080 127 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1321 1866 gene locus_tag LOCUS_09090 1321 1866 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_09090 1859 2200 gene locus_tag LOCUS_09100 1859 2200 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_09100 2325 3272 gene locus_tag LOCUS_09110 2325 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3770 3369 gene locus_tag LOCUS_09120 3770 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3957 4688 gene locus_tag LOCUS_09130 3957 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7148 4878 gene locus_tag LOCUS_09140 7148 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8167 7520 gene locus_tag LOCUS_09150 8167 7520 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_09150 9291 8200 gene locus_tag LOCUS_09160 gene hisC 9291 8200 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence077 <1 653 gene locus_tag LOCUS_09170 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076054358.1:family 20 glycosylhydrolase 1705 719 gene locus_tag LOCUS_09180 1705 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3462 2218 gene locus_tag LOCUS_09190 3462 2218 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_09190 4039 3635 gene locus_tag LOCUS_09200 4039 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5723 4680 gene locus_tag LOCUS_09210 5723 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6178 6462 gene locus_tag LOCUS_09220 6178 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6804 6722 gene locus_tag LOCUS_t00250 6804 6722 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7796 7248 gene locus_tag LOCUS_09230 gene cobU 7796 7248 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_09230 8628 7813 gene locus_tag LOCUS_09240 8628 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 <9338 8625 gene locus_tag LOCUS_09250 <9338 8625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057177.1:adenosylcobinamide-GDP ribazoletransferase >Feature sequence078 562 1545 gene locus_tag LOCUS_09260 562 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1578 4130 gene locus_tag LOCUS_09270 1578 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4139 5350 gene locus_tag LOCUS_09280 4139 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5478 8654 gene locus_tag LOCUS_09290 5478 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence079 78 341 gene locus_tag LOCUS_09300 78 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1098 658 gene locus_tag LOCUS_09310 1098 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1584 1285 gene locus_tag LOCUS_09320 1584 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1819 1574 gene locus_tag LOCUS_09330 1819 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4076 2394 gene locus_tag LOCUS_09340 gene recJ 4076 2394 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_09340 7155 4324 gene locus_tag LOCUS_09350 7155 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7487 8407 gene locus_tag LOCUS_09360 7487 8407 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064717.1 protein_id gnl|my_center|LOCUS_09360 8404 8838 gene locus_tag LOCUS_09370 8404 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence080 1483 77 gene locus_tag LOCUS_09380 1483 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2145 5687 gene locus_tag LOCUS_09390 2145 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5953 6885 gene locus_tag LOCUS_09400 5953 6885 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_09400 6878 7903 gene locus_tag LOCUS_09410 gene mutY 6878 7903 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_09410 7900 8481 gene locus_tag LOCUS_09420 gene aat 7900 8481 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence081 541 1437 gene locus_tag LOCUS_09430 541 1437 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_09430 1942 5880 gene locus_tag LOCUS_09440 1942 5880 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_09440 6203 7474 gene locus_tag LOCUS_09450 6203 7474 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_09450 7736 8221 gene locus_tag LOCUS_09460 7736 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8381 9220 gene locus_tag LOCUS_09470 8381 9220 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence082 73 534 gene locus_tag LOCUS_09480 73 534 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909619.1 protein_id gnl|my_center|LOCUS_09480 531 1445 gene locus_tag LOCUS_09490 531 1445 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_09490 1442 2392 gene locus_tag LOCUS_09500 1442 2392 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_09500 2780 2379 gene locus_tag LOCUS_09510 2780 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3558 2941 gene locus_tag LOCUS_09520 3558 2941 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_09520 6243 3721 gene locus_tag LOCUS_09530 6243 3721 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_09530 6482 6724 gene locus_tag LOCUS_09540 6482 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 6870 7349 gene locus_tag LOCUS_09550 6870 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021820.1 protein_id gnl|my_center|LOCUS_09550 7385 8344 gene locus_tag LOCUS_09560 7385 8344 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_09560 9077 8430 gene locus_tag LOCUS_09570 gene phoU 9077 8430 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174206.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence083 52 519 gene locus_tag LOCUS_09580 52 519 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_09580 968 531 gene locus_tag LOCUS_09590 968 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1531 1124 gene locus_tag LOCUS_09600 1531 1124 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_09600 1595 3928 gene locus_tag LOCUS_09610 1595 3928 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_09610 4734 4003 gene locus_tag LOCUS_09620 4734 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5379 4786 gene locus_tag LOCUS_09630 5379 4786 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_09630 7849 5381 gene locus_tag LOCUS_09640 gene mutS 7849 5381 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_09640 <9196 8003 gene locus_tag LOCUS_09650 <9196 8003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:sigma-54 dependent transcriptional regulator >Feature sequence084 422 9 gene locus_tag LOCUS_09660 422 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1705 830 gene locus_tag LOCUS_09670 gene hisG 1705 830 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_09670 3054 1771 gene locus_tag LOCUS_09680 3054 1771 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_09680 3426 4085 gene locus_tag LOCUS_09690 3426 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5140 4082 gene locus_tag LOCUS_09700 gene lgt 5140 4082 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_09700 6231 5152 gene locus_tag LOCUS_09710 6231 5152 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_09710 6425 7141 gene locus_tag LOCUS_09720 6425 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7242 9026 gene locus_tag LOCUS_09730 7242 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence085 857 354 gene locus_tag LOCUS_09740 857 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1003 1368 gene locus_tag LOCUS_09750 1003 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3814 1805 gene locus_tag LOCUS_09760 3814 1805 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_09760 5216 3897 gene locus_tag LOCUS_09770 5216 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6623 5241 gene locus_tag LOCUS_09780 gene mpl 6623 5241 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_09780 7533 6649 gene locus_tag LOCUS_09790 7533 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 8276 7554 gene locus_tag LOCUS_09800 gene lptB 8276 7554 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392029.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence086 555 1712 gene locus_tag LOCUS_09810 555 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1751 2383 gene locus_tag LOCUS_09820 1751 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2391 2819 gene locus_tag LOCUS_09830 2391 2819 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_09830 2851 3399 gene locus_tag LOCUS_09840 gene def 2851 3399 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_09840 4747 3560 gene locus_tag LOCUS_09850 4747 3560 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_09850 6096 4798 gene locus_tag LOCUS_09860 6096 4798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_09860 6317 8713 gene locus_tag LOCUS_09870 6317 8713 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence087 878 1687 gene locus_tag LOCUS_09880 878 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2282 1779 gene locus_tag LOCUS_09890 2282 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2957 4057 gene locus_tag LOCUS_09900 gene dnaN 2957 4057 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_09900 4802 4362 gene locus_tag LOCUS_09910 4802 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5957 4905 gene locus_tag LOCUS_09920 5957 4905 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_09920 7537 6158 gene locus_tag LOCUS_09930 7537 6158 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_09930 8558 7827 gene locus_tag LOCUS_09940 8558 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence088 <1 2443 gene locus_tag LOCUS_09950 <1 2443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927193.1:PBP1A family penicillin-binding protein 2461 3714 gene locus_tag LOCUS_09960 2461 3714 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_09960 4573 3872 gene locus_tag LOCUS_09970 4573 3872 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_09970 5330 4578 gene locus_tag LOCUS_09980 gene lpxA 5330 4578 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_09980 6290 5424 gene locus_tag LOCUS_09990 6290 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7928 6303 gene locus_tag LOCUS_10000 7928 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 <8939 8003 gene locus_tag LOCUS_10010 <8939 8003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140598.1:class A beta-lactamase >Feature sequence089 <1 2257 gene locus_tag LOCUS_10020 <1 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109366.1:beta-galactosidase GalB 2412 5084 gene locus_tag LOCUS_10030 2412 5084 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_10030 5103 5945 gene locus_tag LOCUS_10040 5103 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6922 6557 gene locus_tag LOCUS_10050 gene rplN 6922 6557 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_10050 7232 6960 gene locus_tag LOCUS_10060 gene rpsQ 7232 6960 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_10060 7484 7281 gene locus_tag LOCUS_10070 7484 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7912 7499 gene locus_tag LOCUS_10080 gene rplP 7912 7499 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_10080 8663 7974 gene locus_tag LOCUS_10090 gene rpsC 8663 7974 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence090 2645 264 gene locus_tag LOCUS_10100 gene secDF 2645 264 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_10100 3856 2894 gene locus_tag LOCUS_10110 3856 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4734 4003 gene locus_tag LOCUS_10120 4734 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4899 5570 gene locus_tag LOCUS_10130 4899 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5796 6716 gene locus_tag LOCUS_10140 5796 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7716 6922 gene locus_tag LOCUS_10150 7716 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 8077 8784 gene locus_tag LOCUS_10160 8077 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence091 6477 115 gene locus_tag LOCUS_10170 6477 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7805 6618 gene locus_tag LOCUS_10180 7805 6618 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_10180 8298 8372 gene locus_tag LOCUS_t00260 8298 8372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 <1 1184 gene locus_tag LOCUS_10190 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714164.1:heavy metal translocating P-type ATPase 2897 1215 gene locus_tag LOCUS_10200 gene recN 2897 1215 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_10200 2926 3711 gene locus_tag LOCUS_10210 2926 3711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_10210 3737 4531 gene locus_tag LOCUS_10220 3737 4531 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_10220 4635 5384 gene locus_tag LOCUS_10230 4635 5384 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_10230 5432 5815 gene locus_tag LOCUS_10240 5432 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 5894 6223 gene locus_tag LOCUS_10250 5894 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6258 6446 gene locus_tag LOCUS_10260 6258 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7401 6538 gene locus_tag LOCUS_10270 gene lpxI 7401 6538 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_10270 8705 7431 gene locus_tag LOCUS_10280 8705 7431 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089073.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence093 1338 3095 gene locus_tag LOCUS_10290 gene argS 1338 3095 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_10290 3109 4722 gene locus_tag LOCUS_10300 3109 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5028 7130 gene locus_tag LOCUS_10310 5028 7130 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_10310 7162 8484 gene locus_tag LOCUS_10320 7162 8484 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence094 662 396 gene locus_tag LOCUS_10330 662 396 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_10330 1709 747 gene locus_tag LOCUS_10340 gene hprK 1709 747 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_10340 1808 3205 gene locus_tag LOCUS_10350 1808 3205 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_10350 3214 4131 gene locus_tag LOCUS_10360 3214 4131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_10360 4059 4649 gene locus_tag LOCUS_10370 4059 4649 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_10370 6343 4676 gene locus_tag LOCUS_10380 6343 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7125 6430 gene locus_tag LOCUS_10390 7125 6430 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_10390 7699 7136 gene locus_tag LOCUS_10400 7699 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8665 7808 gene locus_tag LOCUS_10410 8665 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence095 1219 1665 gene locus_tag LOCUS_10420 1219 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1807 3954 gene locus_tag LOCUS_10430 1807 3954 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_10430 5171 4221 gene locus_tag LOCUS_10440 5171 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5209 6168 gene locus_tag LOCUS_10450 gene rfbD 5209 6168 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_10450 6165 7466 gene locus_tag LOCUS_10460 6165 7466 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence096 2042 678 gene locus_tag LOCUS_10470 2042 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10470 2743 2039 gene locus_tag LOCUS_10480 2743 2039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_10480 4207 2810 gene locus_tag LOCUS_10490 4207 2810 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_10490 5311 4904 gene locus_tag LOCUS_10500 gene mutT 5311 4904 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_10500 5817 5308 gene locus_tag LOCUS_10510 5817 5308 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_10510 6792 5824 gene locus_tag LOCUS_10520 6792 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7756 6797 gene locus_tag LOCUS_10530 7756 6797 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence097 <1 860 gene locus_tag LOCUS_10540 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000625631.1:phosphodiesterase YaeI 879 2606 gene locus_tag LOCUS_10550 879 2606 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_10550 2613 3284 gene locus_tag LOCUS_10560 2613 3284 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_10560 3466 5151 gene locus_tag LOCUS_10570 3466 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5262 6212 gene locus_tag LOCUS_10580 5262 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6219 7160 gene locus_tag LOCUS_10590 6219 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 7314 8120 gene locus_tag LOCUS_10600 7314 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence098 1302 427 gene locus_tag LOCUS_10610 1302 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1368 2300 gene locus_tag LOCUS_10620 1368 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2403 2897 gene locus_tag LOCUS_10630 2403 2897 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083121.1 protein_id gnl|my_center|LOCUS_10630 2912 3691 gene locus_tag LOCUS_10640 2912 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3728 4699 gene locus_tag LOCUS_10650 3728 4699 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_10650 4814 5599 gene locus_tag LOCUS_10660 4814 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5606 6784 gene locus_tag LOCUS_10670 5606 6784 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_10670 6909 7373 gene locus_tag LOCUS_10680 6909 7373 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615575.1 protein_id gnl|my_center|LOCUS_10680 7446 8312 gene locus_tag LOCUS_10690 gene cysE 7446 8312 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence099 1321 317 gene locus_tag LOCUS_10700 gene dusB 1321 317 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_10700 2092 1583 gene locus_tag LOCUS_10710 2092 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3415 2249 gene locus_tag LOCUS_10720 3415 2249 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_10720 5150 3585 gene locus_tag LOCUS_10730 gene murJ 5150 3585 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_10730 6255 5164 gene locus_tag LOCUS_10740 6255 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7049 6405 gene locus_tag LOCUS_10750 7049 6405 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_10750 8486 7266 gene locus_tag LOCUS_10760 8486 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence100 304 771 gene locus_tag LOCUS_10770 304 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 768 1586 gene locus_tag LOCUS_10780 768 1586 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_10780 2044 1595 gene locus_tag LOCUS_10790 gene tsaE 2044 1595 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_10790 2082 2450 gene locus_tag LOCUS_10800 gene rplU 2082 2450 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 protein_id gnl|my_center|LOCUS_10800 2477 2740 gene locus_tag LOCUS_10810 gene rpmA 2477 2740 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_10810 2896 3336 gene locus_tag LOCUS_10820 2896 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3352 4110 gene locus_tag LOCUS_10830 gene sufC 3352 4110 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_10830 4133 5569 gene locus_tag LOCUS_10840 gene sufB 4133 5569 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_10840 5581 6834 gene locus_tag LOCUS_10850 gene sufD 5581 6834 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_10850 7550 6876 gene locus_tag LOCUS_10860 7550 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence101 381 944 gene locus_tag LOCUS_10870 381 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1020 2132 gene locus_tag LOCUS_10880 gene aroB 1020 2132 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_10880 2765 2349 gene locus_tag LOCUS_10890 2765 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3096 4340 gene locus_tag LOCUS_10900 3096 4340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_10900 4372 5076 gene locus_tag LOCUS_10910 4372 5076 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228901.1 protein_id gnl|my_center|LOCUS_10910 5460 8345 gene locus_tag LOCUS_10920 5460 8345 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228900.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence102 321 875 gene locus_tag LOCUS_10930 321 875 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_10930 907 1839 gene locus_tag LOCUS_10940 907 1839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052232.1 protein_id gnl|my_center|LOCUS_10940 2699 1836 gene locus_tag LOCUS_10950 gene metF 2699 1836 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_10950 4822 2696 gene locus_tag LOCUS_10960 gene metE 4822 2696 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864555.1 protein_id gnl|my_center|LOCUS_10960 5148 5294 gene locus_tag LOCUS_10970 5148 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5707 5564 gene locus_tag LOCUS_10980 5707 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5909 6790 gene locus_tag LOCUS_10990 5909 6790 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_10990 7619 6885 gene locus_tag LOCUS_11000 7619 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 8163 8300 gene locus_tag LOCUS_11010 8163 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence103 2319 16 gene locus_tag LOCUS_11020 2319 16 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_11020 3715 2390 gene locus_tag LOCUS_11030 3715 2390 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_11030 5046 3712 gene locus_tag LOCUS_11040 5046 3712 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_11040 7474 5330 gene locus_tag LOCUS_11050 gene pnp 7474 5330 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence104 1719 217 gene locus_tag LOCUS_11060 1719 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1935 1777 gene locus_tag LOCUS_11070 1935 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1934 2233 gene locus_tag LOCUS_11080 1934 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11080 2703 3194 gene locus_tag LOCUS_11090 2703 3194 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_11090 3194 3898 gene locus_tag LOCUS_11100 3194 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5094 3958 gene locus_tag LOCUS_11110 5094 3958 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_11110 5827 5210 gene locus_tag LOCUS_11120 5827 5210 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_11120 5858 6874 gene locus_tag LOCUS_11130 5858 6874 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_11130 6855 7469 gene locus_tag LOCUS_11140 6855 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 <8263 7536 gene locus_tag LOCUS_11150 <8263 7536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119310.1:AGE family epimerase/isomerase >Feature sequence105 1462 2769 gene locus_tag LOCUS_11160 gene aroA 1462 2769 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_11160 3181 2855 gene locus_tag LOCUS_11170 3181 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4032 3199 gene locus_tag LOCUS_11180 4032 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5995 5159 gene locus_tag LOCUS_11190 5995 5159 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_11190 7168 6020 gene locus_tag LOCUS_11200 7168 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence106 253 92 gene locus_tag LOCUS_11210 253 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 540 2021 gene locus_tag LOCUS_11220 540 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2301 2792 gene locus_tag LOCUS_11230 gene nrdR 2301 2792 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_11230 2805 3332 gene locus_tag LOCUS_11240 2805 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5407 3728 gene locus_tag LOCUS_11250 gene sulP 5407 3728 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_11250 6920 5544 gene locus_tag LOCUS_11260 gene argH 6920 5544 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_11260 7103 7792 gene locus_tag LOCUS_11270 7103 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence107 <1 1445 gene locus_tag LOCUS_11280 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275159.1:ATP-dependent helicase HrpB 1560 3800 gene locus_tag LOCUS_11290 1560 3800 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_11290 4304 5602 gene locus_tag LOCUS_11300 4304 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5599 6993 gene locus_tag LOCUS_11310 5599 6993 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence108 2150 282 gene locus_tag LOCUS_11320 2150 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2563 2186 gene locus_tag LOCUS_11330 2563 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4443 2671 gene locus_tag LOCUS_11340 4443 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6507 4750 gene locus_tag LOCUS_11350 6507 4750 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_11350 7433 6585 gene locus_tag LOCUS_11360 7433 6585 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence109 2452 68 gene locus_tag LOCUS_11370 2452 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2742 4796 gene locus_tag LOCUS_11380 2742 4796 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_11380 4820 6964 gene locus_tag LOCUS_11390 gene scpA 4820 6964 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_11390 7784 8026 gene locus_tag LOCUS_11400 7784 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence110 1930 812 gene locus_tag LOCUS_11410 1930 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2108 2833 gene locus_tag LOCUS_11420 2108 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2889 3539 gene locus_tag LOCUS_11430 2889 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3564 3995 gene locus_tag LOCUS_11440 3564 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4015 4779 gene locus_tag LOCUS_11450 4015 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5486 5043 gene locus_tag LOCUS_11460 5486 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5763 5500 gene locus_tag LOCUS_11470 5763 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6346 5843 gene locus_tag LOCUS_11480 6346 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6887 6582 gene locus_tag LOCUS_11490 6887 6582 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_11490 7082 7987 gene locus_tag LOCUS_11500 gene rnhC 7082 7987 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872309.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence111 3 620 gene locus_tag LOCUS_11510 3 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 617 949 gene locus_tag LOCUS_11520 617 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 990 1283 gene locus_tag LOCUS_11530 gene gatC 990 1283 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 protein_id gnl|my_center|LOCUS_11530 1338 2750 gene locus_tag LOCUS_11540 gene gatA 1338 2750 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_11540 2805 3788 gene locus_tag LOCUS_11550 2805 3788 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_11550 3887 4777 gene locus_tag LOCUS_11560 3887 4777 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_11560 4934 5410 gene locus_tag LOCUS_11570 4934 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5417 6403 gene locus_tag LOCUS_11580 5417 6403 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence112 2002 3858 gene locus_tag LOCUS_11590 2002 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4059 5243 gene locus_tag LOCUS_11600 4059 5243 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_11600 5484 6437 gene locus_tag LOCUS_11610 gene pheS 5484 6437 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018581.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence113 347 1765 gene locus_tag LOCUS_11620 347 1765 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_11620 1781 2869 gene locus_tag LOCUS_11630 1781 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2874 3839 gene locus_tag LOCUS_11640 gene yclN 2874 3839 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_11640 3832 4842 gene locus_tag LOCUS_11650 gene yclO 3832 4842 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_11650 4839 5597 gene locus_tag LOCUS_11660 4839 5597 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 protein_id gnl|my_center|LOCUS_11660 5640 6563 gene locus_tag LOCUS_11670 gene yclQ 5640 6563 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_11670 6606 7403 gene locus_tag LOCUS_11680 6606 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence114 <1 2107 gene locus_tag LOCUS_11690 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869951.1:penicillin-binding protein 2 2358 4559 gene locus_tag LOCUS_11700 2358 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4875 5771 gene locus_tag LOCUS_11710 gene atpB 4875 5771 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_11710 5854 6075 gene locus_tag LOCUS_11720 5854 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6177 6704 gene locus_tag LOCUS_11730 6177 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6712 7119 gene locus_tag LOCUS_11740 6712 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence115 <1 1045 gene locus_tag LOCUS_11750 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329329.1:threonine--tRNA ligase 1178 1723 gene locus_tag LOCUS_11760 gene infC 1178 1723 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_11760 2000 2236 gene locus_tag LOCUS_11770 2000 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3473 2241 gene locus_tag LOCUS_11780 3473 2241 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_11780 4653 3478 gene locus_tag LOCUS_11790 4653 3478 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_11790 4941 5450 gene locus_tag LOCUS_11800 gene coaD 4941 5450 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_11800 5837 5475 gene locus_tag LOCUS_11810 5837 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6378 5824 gene locus_tag LOCUS_11820 6378 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 7750 6365 gene locus_tag LOCUS_11830 7750 6365 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence116 2 2305 gene locus_tag LOCUS_11840 2 2305 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_11840 2418 3590 gene locus_tag LOCUS_11850 2418 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4243 3812 gene locus_tag LOCUS_11860 4243 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4671 4267 gene locus_tag LOCUS_11870 4671 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6290 5625 gene locus_tag LOCUS_11880 6290 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 <7831 6481 gene locus_tag LOCUS_11890 <7831 6481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888355.1:aconitate hydratase AcnA >Feature sequence117 182 1015 gene locus_tag LOCUS_11900 182 1015 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_11900 1348 3405 gene locus_tag LOCUS_11910 1348 3405 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_11910 3635 4549 gene locus_tag LOCUS_11920 3635 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4629 5777 gene locus_tag LOCUS_11930 4629 5777 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11930 5848 6267 gene locus_tag LOCUS_11940 gene fucU 5848 6267 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_11940 6293 7291 gene locus_tag LOCUS_11950 6293 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 7225 7494 gene locus_tag LOCUS_11960 7225 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 >Feature sequence118 1115 267 gene locus_tag LOCUS_11970 1115 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1642 1154 gene locus_tag LOCUS_11980 1642 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 1825 1664 gene locus_tag LOCUS_11990 1825 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4228 1892 gene locus_tag LOCUS_12000 4228 1892 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_12000 5201 4419 gene locus_tag LOCUS_12010 5201 4419 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_12010 6095 5946 gene locus_tag LOCUS_12020 6095 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6326 6102 gene locus_tag LOCUS_12030 6326 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6993 6553 gene locus_tag LOCUS_12040 6993 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6992 7270 gene locus_tag LOCUS_12050 6992 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence119 123 893 gene locus_tag LOCUS_12060 123 893 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257306.1 protein_id gnl|my_center|LOCUS_12060 1134 3881 gene locus_tag LOCUS_12070 1134 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3967 4545 gene locus_tag LOCUS_12080 3967 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5553 4861 gene locus_tag LOCUS_12090 5553 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6112 5573 gene locus_tag LOCUS_12100 6112 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7056 6109 gene locus_tag LOCUS_12110 7056 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence120 303 2462 gene locus_tag LOCUS_12120 303 2462 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_12120 2471 3103 gene locus_tag LOCUS_12130 2471 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4100 3135 gene locus_tag LOCUS_12140 4100 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7302 4456 gene locus_tag LOCUS_12150 gene gcvP 7302 4456 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence121 2 340 gene locus_tag LOCUS_12160 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 347 1042 gene locus_tag LOCUS_12170 347 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1147 1905 gene locus_tag LOCUS_12180 1147 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2170 3567 gene locus_tag LOCUS_12190 2170 3567 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_12190 4051 3683 gene locus_tag LOCUS_12200 4051 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5375 4080 gene locus_tag LOCUS_12210 gene eno 5375 4080 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_12210 5543 7033 gene locus_tag LOCUS_12220 5543 7033 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125805.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence122 2174 741 gene locus_tag LOCUS_12230 2174 741 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_12230 5427 2212 gene locus_tag LOCUS_12240 5427 2212 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_12240 6748 5489 gene locus_tag LOCUS_12250 6748 5489 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence123 2653 1424 gene locus_tag LOCUS_12260 gene vmeY 2653 1424 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_12260 5437 2681 gene locus_tag LOCUS_12270 5437 2681 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_12270 5604 6257 gene locus_tag LOCUS_12280 5604 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <7388 6367 gene locus_tag LOCUS_12290 <7388 6367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703586.1:enterotoxin >Feature sequence124 3 3821 gene locus_tag LOCUS_12300 3 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3808 5439 gene locus_tag LOCUS_12310 3808 5439 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705882.1 protein_id gnl|my_center|LOCUS_12310 5679 6419 gene locus_tag LOCUS_12320 5679 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6397 7038 gene locus_tag LOCUS_12330 6397 7038 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence125 581 363 gene locus_tag LOCUS_12340 581 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3453 907 gene locus_tag LOCUS_12350 3453 907 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_12350 6166 3584 gene locus_tag LOCUS_12360 6166 3584 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892034.1 protein_id gnl|my_center|LOCUS_12360 7250 6195 gene locus_tag LOCUS_12370 7250 6195 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence126 3071 2325 gene locus_tag LOCUS_12380 3071 2325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123055.1 protein_id gnl|my_center|LOCUS_12380 5345 3087 gene locus_tag LOCUS_12390 5345 3087 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765172.1 protein_id gnl|my_center|LOCUS_12390 6316 5429 gene locus_tag LOCUS_12400 6316 5429 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_12400 6993 6397 gene locus_tag LOCUS_12410 6993 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence127 313 630 gene locus_tag LOCUS_12420 313 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 788 2950 gene locus_tag LOCUS_12430 788 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2954 4318 gene locus_tag LOCUS_12440 gene xseA 2954 4318 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_12440 6748 5156 gene locus_tag LOCUS_12450 6748 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence128 6367 5534 gene locus_tag LOCUS_12460 6367 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 7093 6506 gene locus_tag LOCUS_12470 gene purN 7093 6506 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence129 1889 1395 gene locus_tag LOCUS_12480 1889 1395 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_12480 2078 3529 gene locus_tag LOCUS_12490 gene guaB 2078 3529 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_12490 3542 4606 gene locus_tag LOCUS_12500 3542 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12500 4637 5065 gene locus_tag LOCUS_12510 4637 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12510 5149 5751 gene locus_tag LOCUS_12520 5149 5751 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_12520 5748 6386 gene locus_tag LOCUS_12530 5748 6386 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_12530 6421 7131 gene locus_tag LOCUS_12540 6421 7131 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence130 817 1413 gene locus_tag LOCUS_12550 817 1413 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788696.1 protein_id gnl|my_center|LOCUS_12550 1428 1658 gene locus_tag LOCUS_12560 1428 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1655 2008 gene locus_tag LOCUS_12570 1655 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2346 2026 gene locus_tag LOCUS_12580 2346 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3047 2343 gene locus_tag LOCUS_12590 gene menH 3047 2343 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704503.1 protein_id gnl|my_center|LOCUS_12590 3669 3064 gene locus_tag LOCUS_12600 3669 3064 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_12600 4439 3864 gene locus_tag LOCUS_12610 4439 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6115 4436 gene locus_tag LOCUS_12620 6115 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6898 6491 gene locus_tag LOCUS_12630 6898 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7097 6966 gene locus_tag LOCUS_12640 7097 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence131 1673 3307 gene locus_tag LOCUS_12650 gene cimA 1673 3307 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_12650 3733 3945 gene locus_tag LOCUS_12660 3733 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4199 5275 gene locus_tag LOCUS_12670 gene apbC 4199 5275 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_12670 5418 6194 gene locus_tag LOCUS_12680 5418 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12680 6207 6803 gene locus_tag LOCUS_12690 6207 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12690 >Feature sequence132 879 2753 gene locus_tag LOCUS_12700 879 2753 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_12700 3882 3280 gene locus_tag LOCUS_12710 gene gmk 3882 3280 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_12710 4754 3879 gene locus_tag LOCUS_12720 4754 3879 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_12720 6049 4775 gene locus_tag LOCUS_12730 6049 4775 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_12730 6158 6619 gene locus_tag LOCUS_12740 6158 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence133 923 702 gene locus_tag LOCUS_12750 923 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2316 859 gene locus_tag LOCUS_12760 2316 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3519 2362 gene locus_tag LOCUS_12770 gene pheA 3519 2362 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_12770 4863 3892 gene locus_tag LOCUS_12780 4863 3892 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_12780 5659 4880 gene locus_tag LOCUS_12790 5659 4880 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence134 2965 2390 gene locus_tag LOCUS_12800 2965 2390 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_12800 3269 3865 gene locus_tag LOCUS_12810 3269 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4584 3940 gene locus_tag LOCUS_12820 4584 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <6938 4589 gene locus_tag LOCUS_12830 <6938 4589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence135 1353 2552 gene locus_tag LOCUS_12840 1353 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029539.1 protein_id gnl|my_center|LOCUS_12840 2549 3604 gene locus_tag LOCUS_12850 2549 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3648 4520 gene locus_tag LOCUS_12860 3648 4520 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_12860 4505 5668 gene locus_tag LOCUS_12870 4505 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5683 6099 gene locus_tag LOCUS_12880 5683 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence136 <1 1674 gene locus_tag LOCUS_12890 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114377.1:phosphate ABC transporter permease PstA 1697 2476 gene locus_tag LOCUS_12900 gene pstB 1697 2476 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_12900 2502 3176 gene locus_tag LOCUS_12910 gene phoU 2502 3176 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_12910 3786 4715 gene locus_tag LOCUS_12920 gene cysK 3786 4715 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_12920 4771 5454 gene locus_tag LOCUS_12930 4771 5454 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_12930 5478 6389 gene locus_tag LOCUS_12940 gene cysD 5478 6389 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389944.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence137 <1 506 gene locus_tag LOCUS_12950 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200204420.1:M6 family metalloprotease domain-containing protein 1854 1096 gene locus_tag LOCUS_12960 1854 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2844 2047 gene locus_tag LOCUS_12970 2844 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2877 4292 gene locus_tag LOCUS_12980 2877 4292 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_12980 6245 4305 gene locus_tag LOCUS_12990 6245 4305 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence138 2606 1335 gene locus_tag LOCUS_13000 2606 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2748 3545 gene locus_tag LOCUS_13010 gene truA 2748 3545 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_13010 4141 3560 gene locus_tag LOCUS_13020 4141 3560 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162767.1 protein_id gnl|my_center|LOCUS_13020 4829 4152 gene locus_tag LOCUS_13030 4829 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence139 1222 1461 gene locus_tag LOCUS_13040 1222 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1522 3408 gene locus_tag LOCUS_13050 1522 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13050 5178 3460 gene locus_tag LOCUS_13060 5178 3460 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940631.1 protein_id gnl|my_center|LOCUS_13060 5955 5407 gene locus_tag LOCUS_13070 5955 5407 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence140 984 910 gene locus_tag LOCUS_t00270 984 910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2273 1191 gene locus_tag LOCUS_13080 gene tsaD 2273 1191 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_13080 3667 2297 gene locus_tag LOCUS_13090 gene clpX 3667 2297 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_13090 4365 3709 gene locus_tag LOCUS_13100 gene clpP 4365 3709 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_13100 5864 4488 gene locus_tag LOCUS_13110 gene tig 5864 4488 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence141 944 516 gene locus_tag LOCUS_13120 944 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4809 1273 gene locus_tag LOCUS_13130 4809 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5002 5424 gene locus_tag LOCUS_13140 5002 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence142 <1 863 gene locus_tag LOCUS_13150 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit 1358 1583 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcacccacacgggtgcgtgaattgaaac 1823 2611 gene locus_tag LOCUS_13160 1823 2611 CDS product basic secretory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764203.1 protein_id gnl|my_center|LOCUS_13160 2932 3828 gene locus_tag LOCUS_13170 2932 3828 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_13170 4619 3966 gene locus_tag LOCUS_13180 gene rpe 4619 3966 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_13180 <6349 4644 gene locus_tag LOCUS_13190 <6349 4644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase >Feature sequence143 506 1051 gene locus_tag LOCUS_13200 gene sufT 506 1051 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_13200 1058 1531 gene locus_tag LOCUS_13210 1058 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1916 1764 gene locus_tag LOCUS_13220 1916 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2803 1919 gene locus_tag LOCUS_13230 2803 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4543 3161 gene locus_tag LOCUS_13240 gene nuoN 4543 3161 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186264.1 protein_id gnl|my_center|LOCUS_13240 6018 4594 gene locus_tag LOCUS_13250 6018 4594 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence144 3619 2873 gene locus_tag LOCUS_13260 3619 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence145 1047 214 gene locus_tag LOCUS_13270 1047 214 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_13270 1168 2259 gene locus_tag LOCUS_13280 gene pta 1168 2259 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_13280 3124 2246 gene locus_tag LOCUS_13290 3124 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3123 3314 gene locus_tag LOCUS_13300 3123 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3653 3324 gene locus_tag LOCUS_13310 3653 3324 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882762.1 protein_id gnl|my_center|LOCUS_13310 3751 4626 gene locus_tag LOCUS_13320 3751 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4759 4834 gene locus_tag LOCUS_t00280 4759 4834 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4870 4946 gene locus_tag LOCUS_t00290 4870 4946 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5766 5335 gene locus_tag LOCUS_13330 5766 5335 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925739.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence146 1453 2157 gene locus_tag LOCUS_13340 1453 2157 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_13340 2170 3447 gene locus_tag LOCUS_13350 2170 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5191 3590 gene locus_tag LOCUS_13360 5191 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence147 <1 1270 gene locus_tag LOCUS_13370 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943920.1:adenylosuccinate synthase 2413 1688 gene locus_tag LOCUS_13380 2413 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2980 4464 gene locus_tag LOCUS_13390 2980 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4550 5770 gene locus_tag LOCUS_13400 4550 5770 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence148 2350 1601 gene locus_tag LOCUS_13410 gene kdsB 2350 1601 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_13410 3991 2444 gene locus_tag LOCUS_13420 3991 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4119 4044 gene locus_tag LOCUS_t00300 4119 4044 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5487 4414 gene locus_tag LOCUS_13430 5487 4414 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_13430 <6221 5512 gene locus_tag LOCUS_13440 <6221 5512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546105.1:type IV pilus twitching motility protein PilT >Feature sequence149 786 313 gene locus_tag LOCUS_13450 786 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 977 1516 gene locus_tag LOCUS_13460 977 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1616 2236 gene locus_tag LOCUS_13470 1616 2236 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_13470 5440 2384 gene locus_tag LOCUS_13480 5440 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence150 <1 848 gene locus_tag LOCUS_13490 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108747.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1002 3578 gene locus_tag LOCUS_13500 1002 3578 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_13500 4964 3573 gene locus_tag LOCUS_13510 4964 3573 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence151 113 304 gene locus_tag LOCUS_13520 113 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 338 511 gene locus_tag LOCUS_13530 gene rpmG 338 511 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_13530 543 788 gene locus_tag LOCUS_13540 543 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 896 1690 gene locus_tag LOCUS_13550 gene folE2 896 1690 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_13550 1711 2469 gene locus_tag LOCUS_13560 1711 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2475 3491 gene locus_tag LOCUS_13570 2475 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3481 4458 gene locus_tag LOCUS_13580 gene hemC 3481 4458 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_13580 5151 4795 gene locus_tag LOCUS_13590 5151 4795 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence152 961 1143 gene locus_tag LOCUS_13600 961 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2270 1140 gene locus_tag LOCUS_13610 2270 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2594 2283 gene locus_tag LOCUS_13620 2594 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3391 2591 gene locus_tag LOCUS_13630 3391 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4011 3427 gene locus_tag LOCUS_13640 4011 3427 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403173.1 protein_id gnl|my_center|LOCUS_13640 4638 4057 gene locus_tag LOCUS_13650 gene nuoB 4638 4057 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403172.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence153 382 831 gene locus_tag LOCUS_13660 382 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 831 1826 gene locus_tag LOCUS_13670 831 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1985 5566 gene locus_tag LOCUS_13680 1985 5566 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence154 881 561 gene locus_tag LOCUS_13690 881 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1473 907 gene locus_tag LOCUS_13700 gene frr 1473 907 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_13700 2250 1525 gene locus_tag LOCUS_13710 gene pyrH 2250 1525 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_13710 3219 2317 gene locus_tag LOCUS_13720 3219 2317 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_13720 4094 3471 gene locus_tag LOCUS_13730 4094 3471 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence155 1577 309 gene locus_tag LOCUS_13740 gene nuoH 1577 309 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_13740 3349 1613 gene locus_tag LOCUS_13750 3349 1613 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_13750 4802 3402 gene locus_tag LOCUS_13760 gene nuoF 4802 3402 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_13760 5417 4836 gene locus_tag LOCUS_13770 5417 4836 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence156 173 1192 gene locus_tag LOCUS_13780 173 1192 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017578.1 protein_id gnl|my_center|LOCUS_13780 2137 1295 gene locus_tag LOCUS_13790 2137 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3695 2172 gene locus_tag LOCUS_13800 3695 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4922 3711 gene locus_tag LOCUS_13810 4922 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5755 4919 gene locus_tag LOCUS_13820 5755 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence157 1127 2371 gene locus_tag LOCUS_13830 1127 2371 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_13830 2981 2361 gene locus_tag LOCUS_13840 2981 2361 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425720.1 protein_id gnl|my_center|LOCUS_13840 3962 3135 gene locus_tag LOCUS_13850 3962 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 <5800 4351 gene locus_tag LOCUS_13860 <5800 4351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048440.1:replicative DNA helicase >Feature sequence158 1152 289 gene locus_tag LOCUS_13870 1152 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1353 2735 gene locus_tag LOCUS_13880 1353 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2867 5449 gene locus_tag LOCUS_13890 2867 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence159 749 453 gene locus_tag LOCUS_13900 749 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1078 776 gene locus_tag LOCUS_13910 1078 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1732 1139 gene locus_tag LOCUS_13920 1732 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2128 1766 gene locus_tag LOCUS_13930 2128 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2522 2160 gene locus_tag LOCUS_13940 2522 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2896 3963 gene locus_tag LOCUS_13950 2896 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5337 4006 gene locus_tag LOCUS_13960 5337 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence160 738 19 gene locus_tag LOCUS_13970 738 19 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_13970 842 1351 gene locus_tag LOCUS_13980 842 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2979 1762 gene locus_tag LOCUS_13990 2979 1762 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_13990 4328 3000 gene locus_tag LOCUS_14000 4328 3000 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_14000 4661 4587 gene locus_tag LOCUS_t00310 4661 4587 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5259 4756 gene locus_tag LOCUS_14010 5259 4756 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence161 1254 784 gene locus_tag LOCUS_14020 1254 784 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_14020 2308 1343 gene locus_tag LOCUS_14030 gene trpS 2308 1343 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_14030 3353 2499 gene locus_tag LOCUS_14040 3353 2499 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211898.1 protein_id gnl|my_center|LOCUS_14040 4045 3350 gene locus_tag LOCUS_14050 gene ispD 4045 3350 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_14050 4497 4042 gene locus_tag LOCUS_14060 4497 4042 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_14060 5530 4616 gene locus_tag LOCUS_14070 5530 4616 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963694.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence162 1173 223 gene locus_tag LOCUS_14080 1173 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1358 3679 gene locus_tag LOCUS_14090 gene rnr 1358 3679 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_14090 3984 4322 gene locus_tag LOCUS_14100 3984 4322 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_14100 5039 4482 gene locus_tag LOCUS_14110 5039 4482 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_14110 5186 5602 gene locus_tag LOCUS_14120 5186 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence163 380 1804 gene locus_tag LOCUS_14130 gene purB 380 1804 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230775.1 protein_id gnl|my_center|LOCUS_14130 2034 2489 gene locus_tag LOCUS_14140 2034 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2517 3629 gene locus_tag LOCUS_14150 2517 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 <5668 3827 gene locus_tag LOCUS_14160 <5668 3827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence164 1905 1090 gene locus_tag LOCUS_14170 1905 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2109 1912 gene locus_tag LOCUS_14180 2109 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14180 3336 2158 gene locus_tag LOCUS_14190 gene fucK 3336 2158 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 3657 3361 gene locus_tag LOCUS_14200 3657 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5555 3777 gene locus_tag LOCUS_14210 gene fucI 5555 3777 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence165 <1 3116 gene locus_tag LOCUS_14220 <1 3116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119288.1:arylsulfatase 3792 3310 gene locus_tag LOCUS_14230 3792 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 <5640 3829 gene locus_tag LOCUS_14240 <5640 3829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 >Feature sequence166 >Feature sequence167 <1 512 gene locus_tag LOCUS_14250 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122095.1:MoxR family ATPase 551 1453 gene locus_tag LOCUS_14260 551 1453 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_14260 1505 2143 gene locus_tag LOCUS_14270 gene pth 1505 2143 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_14270 2443 4932 gene locus_tag LOCUS_14280 2443 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence168 3496 776 gene locus_tag LOCUS_14290 3496 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3870 3568 gene locus_tag LOCUS_14300 3870 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4581 3916 gene locus_tag LOCUS_14310 4581 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence169 <1 698 gene locus_tag LOCUS_14320 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770492.1:CDP-diacylglycerol--serine O-phosphatidyltransferase 1484 969 gene locus_tag LOCUS_14330 1484 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1549 2388 gene locus_tag LOCUS_14340 gene folP 1549 2388 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707079.1 protein_id gnl|my_center|LOCUS_14340 2396 4987 gene locus_tag LOCUS_14350 2396 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence170 404 1318 gene locus_tag LOCUS_14360 404 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2038 1337 gene locus_tag LOCUS_14370 gene rsmI 2038 1337 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_14370 2583 2068 gene locus_tag LOCUS_14380 2583 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3552 2602 gene locus_tag LOCUS_14390 3552 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4107 3616 gene locus_tag LOCUS_14400 gene hisI 4107 3616 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_14400 4194 5162 gene locus_tag LOCUS_14410 4194 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence171 2773 1160 gene locus_tag LOCUS_14420 2773 1160 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327627.1 protein_id gnl|my_center|LOCUS_14420 3367 2888 gene locus_tag LOCUS_14430 3367 2888 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_14430 4796 3354 gene locus_tag LOCUS_14440 4796 3354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261686.1 protein_id gnl|my_center|LOCUS_14440 <5492 4864 gene locus_tag LOCUS_14450 <5492 4864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005418795.1:SLC13 family permease >Feature sequence172 980 213 gene locus_tag LOCUS_14460 980 213 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_14460 2979 1021 gene locus_tag LOCUS_14470 2979 1021 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_14470 3702 3001 gene locus_tag LOCUS_14480 3702 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_14480 3924 4175 gene locus_tag LOCUS_14490 3924 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4208 4993 gene locus_tag LOCUS_14500 4208 4993 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_14500 5260 5027 gene locus_tag LOCUS_14510 5260 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence173 1623 769 gene locus_tag LOCUS_14520 1623 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2258 1620 gene locus_tag LOCUS_14530 gene pdxH 2258 1620 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 protein_id gnl|my_center|LOCUS_14530 3143 2280 gene locus_tag LOCUS_14540 gene nadC 3143 2280 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_14540 4051 3158 gene locus_tag LOCUS_14550 4051 3158 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_14550 5100 4090 gene locus_tag LOCUS_14560 5100 4090 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence174 1621 485 gene locus_tag LOCUS_14570 1621 485 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_14570 3028 1748 gene locus_tag LOCUS_14580 3028 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4063 3140 gene locus_tag LOCUS_14590 4063 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5185 4220 gene locus_tag LOCUS_14600 5185 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence175 2256 523 gene locus_tag LOCUS_14610 2256 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3520 2294 gene locus_tag LOCUS_14620 3520 2294 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_14620 4005 3523 gene locus_tag LOCUS_14630 4005 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4685 4023 gene locus_tag LOCUS_14640 4685 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <5434 4693 gene locus_tag LOCUS_14650 <5434 4693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003014705.1:signal peptidase II >Feature sequence176 321 1373 gene locus_tag LOCUS_14660 321 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2094 1411 gene locus_tag LOCUS_14670 2094 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3171 2173 gene locus_tag LOCUS_14680 3171 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3370 3173 gene locus_tag LOCUS_14690 3370 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4777 3545 gene locus_tag LOCUS_14700 4777 3545 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence177 2 478 gene locus_tag LOCUS_14710 2 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1632 553 gene locus_tag LOCUS_14720 1632 553 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_14720 2624 1677 gene locus_tag LOCUS_14730 2624 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2822 3232 gene locus_tag LOCUS_14740 2822 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3393 3653 gene locus_tag LOCUS_14750 3393 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3673 4542 gene locus_tag LOCUS_14760 gene pdxA 3673 4542 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_14760 4978 5262 gene locus_tag LOCUS_14770 4978 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence178 3 758 gene locus_tag LOCUS_14780 3 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 755 1927 gene locus_tag LOCUS_14790 755 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3006 2194 gene locus_tag LOCUS_14800 3006 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3478 3272 gene locus_tag LOCUS_14810 3478 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence179 1445 750 gene locus_tag LOCUS_14820 1445 750 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_14820 2769 1432 gene locus_tag LOCUS_14830 2769 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3078 4190 gene locus_tag LOCUS_14840 3078 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence180 1862 690 gene locus_tag LOCUS_14850 gene trpB 1862 690 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_14850 2506 1859 gene locus_tag LOCUS_14860 2506 1859 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404413.1 protein_id gnl|my_center|LOCUS_14860 3288 2503 gene locus_tag LOCUS_14870 3288 2503 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_14870 4870 3278 gene locus_tag LOCUS_14880 4870 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence181 1495 284 gene locus_tag LOCUS_14890 gene ftsA 1495 284 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 protein_id gnl|my_center|LOCUS_14890 2216 1611 gene locus_tag LOCUS_14900 2216 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4062 2251 gene locus_tag LOCUS_14910 4062 2251 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_14910 4212 4063 gene locus_tag LOCUS_14920 4212 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 <5323 4317 gene locus_tag LOCUS_14930 <5323 4317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942900.1:lipid A export permease/ATP-binding protein MsbA >Feature sequence182 1247 309 gene locus_tag LOCUS_14940 1247 309 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929187.1 protein_id gnl|my_center|LOCUS_14940 2569 1346 gene locus_tag LOCUS_14950 gene trpB 2569 1346 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_14950 3164 2730 gene locus_tag LOCUS_14960 3164 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5035 4541 gene locus_tag LOCUS_14970 5035 4541 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence183 1276 236 gene locus_tag LOCUS_14980 1276 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2343 1273 gene locus_tag LOCUS_14990 2343 1273 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_14990 4662 2380 gene locus_tag LOCUS_15000 4662 2380 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence184 <1 609 gene locus_tag LOCUS_15010 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922324.1:single-stranded DNA-binding protein 866 708 gene locus_tag LOCUS_15020 866 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 975 2441 gene locus_tag LOCUS_15030 gene gatB 975 2441 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_15030 4262 2496 gene locus_tag LOCUS_15040 gene poxB 4262 2496 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090021.1 protein_id gnl|my_center|LOCUS_15040 4991 4389 gene locus_tag LOCUS_15050 4991 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence185 <1 743 gene locus_tag LOCUS_15060 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459799.1:DMT family transporter 2930 954 gene locus_tag LOCUS_15070 2930 954 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_15070 3514 3011 gene locus_tag LOCUS_15080 3514 3011 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_15080 3708 4490 gene locus_tag LOCUS_15090 3708 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4608 5177 gene locus_tag LOCUS_15100 4608 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence186 90 1835 gene locus_tag LOCUS_15110 90 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1959 3503 gene locus_tag LOCUS_15120 1959 3503 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_15120 3625 5040 gene locus_tag LOCUS_15130 gene cysS 3625 5040 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence187 <1 697 gene locus_tag LOCUS_15140 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000526694.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase 1148 1972 gene locus_tag LOCUS_15150 1148 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2276 2566 gene locus_tag LOCUS_15160 2276 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4101 2791 gene locus_tag LOCUS_15170 4101 2791 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence188 4098 337 gene locus_tag LOCUS_15180 gene metH 4098 337 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_15180 4564 5025 gene locus_tag LOCUS_15190 4564 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence189 476 1198 gene locus_tag LOCUS_15200 476 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1879 1214 gene locus_tag LOCUS_15210 1879 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1960 2544 gene locus_tag LOCUS_15220 1960 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2548 3924 gene locus_tag LOCUS_15230 2548 3924 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence190 56 2575 gene locus_tag LOCUS_15240 56 2575 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_15240 4370 2601 gene locus_tag LOCUS_15250 4370 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence191 908 1351 gene locus_tag LOCUS_15260 908 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1407 1796 gene locus_tag LOCUS_15270 1407 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1856 2287 gene locus_tag LOCUS_15280 1856 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4596 2443 gene locus_tag LOCUS_15290 4596 2443 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_15290 4998 4726 gene locus_tag LOCUS_15300 4998 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence192 <1 769 gene locus_tag LOCUS_15310 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase 1155 2783 gene locus_tag LOCUS_15320 1155 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3260 3075 gene locus_tag LOCUS_15330 3260 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3573 3214 gene locus_tag LOCUS_15340 3573 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4374 3646 gene locus_tag LOCUS_15350 4374 3646 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence193 1595 906 gene locus_tag LOCUS_15360 1595 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3076 1697 gene locus_tag LOCUS_15370 3076 1697 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_15370 4076 3147 gene locus_tag LOCUS_15380 gene trxB 4076 3147 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence194 841 751 gene locus_tag LOCUS_t00320 841 751 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1514 2548 gene locus_tag LOCUS_15390 gene ruvB 1514 2548 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_15390 2670 3689 gene locus_tag LOCUS_15400 2670 3689 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_15400 3717 4847 gene locus_tag LOCUS_15410 3717 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence195 467 552 gene locus_tag LOCUS_t00330 467 552 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 792 2657 gene locus_tag LOCUS_15420 792 2657 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_15420 2781 3014 gene locus_tag LOCUS_15430 2781 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4212 3181 gene locus_tag LOCUS_15440 4212 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4908 4372 gene locus_tag LOCUS_15450 4908 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence196 <1 763 gene locus_tag LOCUS_15460 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003692438.1:16S rRNA (uracil(1498)-N(3))-methyltransferase 784 1776 gene locus_tag LOCUS_15470 784 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3579 1789 gene locus_tag LOCUS_15480 3579 1789 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767406.1 protein_id gnl|my_center|LOCUS_15480 4599 3664 gene locus_tag LOCUS_15490 4599 3664 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258542.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence197 197 658 gene locus_tag LOCUS_15500 197 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 717 1484 gene locus_tag LOCUS_15510 717 1484 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_15510 1681 2238 gene locus_tag LOCUS_15520 1681 2238 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 protein_id gnl|my_center|LOCUS_15520 2886 2401 gene locus_tag LOCUS_15530 2886 2401 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183068.1 protein_id gnl|my_center|LOCUS_15530 3120 3572 gene locus_tag LOCUS_15540 3120 3572 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_15540 <4853 3642 gene locus_tag LOCUS_15550 <4853 3642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109383.1:alpha-amylase >Feature sequence198 537 1361 gene locus_tag LOCUS_15560 gene menB 537 1361 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_15560 1381 2211 gene locus_tag LOCUS_15570 1381 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2986 2282 gene locus_tag LOCUS_15580 2986 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3310 3014 gene locus_tag LOCUS_15590 3310 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4611 3322 gene locus_tag LOCUS_15600 4611 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence199 572 93 gene locus_tag LOCUS_15610 572 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1384 569 gene locus_tag LOCUS_15620 gene kdsA 1384 569 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_15620 1708 2427 gene locus_tag LOCUS_15630 1708 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2666 3361 gene locus_tag LOCUS_15640 gene rpsB 2666 3361 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 protein_id gnl|my_center|LOCUS_15640 3391 4269 gene locus_tag LOCUS_15650 gene tsf 3391 4269 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence200 3563 804 gene locus_tag LOCUS_15660 3563 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence201 2694 679 gene locus_tag LOCUS_15670 2694 679 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_15670 4069 2951 gene locus_tag LOCUS_15680 4069 2951 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence202 <1 823 gene locus_tag LOCUS_15690 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922162.1:cytochrome c biogenesis protein CcsA 1226 2140 gene locus_tag LOCUS_15700 1226 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4186 2192 gene locus_tag LOCUS_15710 4186 2192 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107274.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence203 250 2637 gene locus_tag LOCUS_15720 250 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2982 3629 gene locus_tag LOCUS_15730 2982 3629 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_15730 4419 3643 gene locus_tag LOCUS_15740 4419 3643 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence204 1953 790 gene locus_tag LOCUS_15750 gene holA 1953 790 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_15750 2159 3610 gene locus_tag LOCUS_15760 2159 3610 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_15760 3732 4214 gene locus_tag LOCUS_15770 gene ilvN 3732 4214 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence205 <1 2407 gene locus_tag LOCUS_15780 <1 2407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963336.1:DNA gyrase subunit A 2434 3099 gene locus_tag LOCUS_15790 2434 3099 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_15790 3130 4374 gene locus_tag LOCUS_15800 3130 4374 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence206 <1 605 gene locus_tag LOCUS_15810 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039005.1:dTMP kinase 1340 669 gene locus_tag LOCUS_15820 gene queC 1340 669 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_15820 1759 1349 gene locus_tag LOCUS_15830 gene queF 1759 1349 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_15830 4220 1785 gene locus_tag LOCUS_15840 4220 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence207 <1 598 gene locus_tag LOCUS_15850 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766031.1:exo-alpha-sialidase 1399 806 gene locus_tag LOCUS_15860 1399 806 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_15860 2241 2516 gene locus_tag LOCUS_15870 2241 2516 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_15870 2652 4529 gene locus_tag LOCUS_15880 2652 4529 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence208 205 945 gene locus_tag LOCUS_15890 205 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 961 1950 gene locus_tag LOCUS_15900 gene mgrA 961 1950 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_15900 2081 4309 gene locus_tag LOCUS_15910 2081 4309 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence209 924 217 gene locus_tag LOCUS_15920 924 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1029 1367 gene locus_tag LOCUS_15930 1029 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1418 1768 gene locus_tag LOCUS_15940 1418 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2559 1903 gene locus_tag LOCUS_15950 2559 1903 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_15950 3778 2573 gene locus_tag LOCUS_15960 3778 2573 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_15960 <4454 3802 gene locus_tag LOCUS_15970 <4454 3802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428442.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence210 2369 1119 gene locus_tag LOCUS_15980 2369 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2998 2510 gene locus_tag LOCUS_15990 2998 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 <4444 3018 gene locus_tag LOCUS_16000 <4444 3018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107897.1:sulfatase-like hydrolase/transferase >Feature sequence211 1214 1756 gene locus_tag LOCUS_16010 gene hpt 1214 1756 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_16010 1851 2282 gene locus_tag LOCUS_16020 1851 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2612 3211 gene locus_tag LOCUS_16030 2612 3211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence212 2178 706 gene locus_tag LOCUS_16040 2178 706 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_16040 2509 3267 gene locus_tag LOCUS_16050 2509 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence213 1028 201 gene locus_tag LOCUS_16060 1028 201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_16060 2497 1211 gene locus_tag LOCUS_16070 2497 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3649 2516 gene locus_tag LOCUS_16080 3649 2516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_16080 <4370 3788 gene locus_tag LOCUS_16090 <4370 3788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000859695.1:alpha/beta fold hydrolase >Feature sequence214 213 1058 gene locus_tag LOCUS_16100 gene panC 213 1058 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_16100 1088 1741 gene locus_tag LOCUS_16110 gene lolD 1088 1741 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_16110 2759 2160 gene locus_tag LOCUS_16120 2759 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2967 3758 gene locus_tag LOCUS_16130 gene cdaA 2967 3758 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_16130 3736 3888 gene locus_tag LOCUS_16140 3736 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence215 1163 156 gene locus_tag LOCUS_16150 1163 156 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_16150 1901 1209 gene locus_tag LOCUS_16160 1901 1209 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_16160 2139 2912 gene locus_tag LOCUS_16170 2139 2912 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970168.1 protein_id gnl|my_center|LOCUS_16170 3006 3485 gene locus_tag LOCUS_16180 3006 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3629 4063 gene locus_tag LOCUS_16190 3629 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence216 >Feature sequence217 1394 399 gene locus_tag LOCUS_16200 gene hemB 1394 399 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_16200 2969 1449 gene locus_tag LOCUS_16210 2969 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence218 >Feature sequence219 978 2723 gene locus_tag LOCUS_16220 978 2723 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_16220 <4093 2830 gene locus_tag LOCUS_16230 <4093 2830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939066.1:cation-efflux pump >Feature sequence220 1390 308 gene locus_tag LOCUS_16240 1390 308 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_16240 2117 1773 gene locus_tag LOCUS_16250 2117 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2563 2117 gene locus_tag LOCUS_16260 2563 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2960 2634 gene locus_tag LOCUS_16270 2960 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 <4080 3104 gene locus_tag LOCUS_16280 <4080 3104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545262.1:MlaD family protein >Feature sequence221 989 663 gene locus_tag LOCUS_16290 989 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1091 1897 gene locus_tag LOCUS_16300 1091 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2177 3358 gene locus_tag LOCUS_16310 2177 3358 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_16310 3641 3567 gene locus_tag LOCUS_t00340 3641 3567 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3781 3960 gene locus_tag LOCUS_16320 3781 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence222 150 2300 gene locus_tag LOCUS_16330 150 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence223 1182 250 gene locus_tag LOCUS_16340 1182 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2072 1476 gene locus_tag LOCUS_16350 2072 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 3020 2172 gene locus_tag LOCUS_16360 3020 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3175 3918 gene locus_tag LOCUS_16370 3175 3918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence224 1313 609 gene locus_tag LOCUS_16380 gene ubiE 1313 609 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_16380 1419 1345 gene locus_tag LOCUS_t00350 1419 1345 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1839 1591 gene locus_tag LOCUS_16390 1839 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2117 2815 gene locus_tag LOCUS_16400 2117 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3683 2859 gene locus_tag LOCUS_16410 gene dapF 3683 2859 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence225 3457 2420 gene locus_tag LOCUS_16420 gene cydB 3457 2420 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence226 1 795 gene locus_tag LOCUS_16430 1 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1646 855 gene locus_tag LOCUS_16440 1646 855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_16440 2431 1643 gene locus_tag LOCUS_16450 2431 1643 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_16450 3474 2428 gene locus_tag LOCUS_16460 3474 2428 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence227 <1 2789 gene locus_tag LOCUS_16470 <1 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932908.1:preprotein translocase subunit SecA >Feature sequence228 2056 1304 gene locus_tag LOCUS_16480 2056 1304 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_16480 2277 2083 gene locus_tag LOCUS_16490 2277 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3799 2330 gene locus_tag LOCUS_16500 3799 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence229 439 206 gene locus_tag LOCUS_16510 439 206 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_16510 616 2466 gene locus_tag LOCUS_16520 gene lnt 616 2466 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 protein_id gnl|my_center|LOCUS_16520 3182 2433 gene locus_tag LOCUS_16530 3182 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 <3746 3185 gene locus_tag LOCUS_16540 <3746 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417097.1:NDP-sugar synthase >Feature sequence230 >Feature sequence231 1521 19 gene locus_tag LOCUS_16550 gene ffh 1521 19 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_16550 1570 2505 gene locus_tag LOCUS_16560 gene nadA 1570 2505 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_16560 2522 3544 gene locus_tag LOCUS_16570 2522 3544 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence232 1994 639 gene locus_tag LOCUS_16580 1994 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence233 1027 92 gene locus_tag LOCUS_16590 1027 92 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918589.1 protein_id gnl|my_center|LOCUS_16590 1765 1031 gene locus_tag LOCUS_16600 1765 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2775 1762 gene locus_tag LOCUS_16610 2775 1762 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_16610 3081 2863 gene locus_tag LOCUS_16620 3081 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence234 1499 729 gene locus_tag LOCUS_16630 1499 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence235 2534 1650 gene locus_tag LOCUS_16640 2534 1650 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence236 480 1916 gene locus_tag LOCUS_16650 480 1916 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_16650 1943 3301 gene locus_tag LOCUS_16660 gene rimO 1943 3301 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence237 2064 2999 gene locus_tag LOCUS_16670 gene cas1 2064 2999 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_16670 2966 3298 gene locus_tag LOCUS_16680 gene cas2 2966 3298 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence238 1032 1949 gene locus_tag LOCUS_16690 1032 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2482 3465 gene locus_tag LOCUS_16700 2482 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence239 1422 505 gene locus_tag LOCUS_16710 1422 505 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_16710 3064 1826 gene locus_tag LOCUS_16720 3064 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence240 1978 2484 gene locus_tag LOCUS_16730 1978 2484 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_16730 <3452 2539 gene locus_tag LOCUS_16740 <3452 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906242.1:DNA replication/repair protein RecF >Feature sequence241 549 1292 gene locus_tag LOCUS_16750 549 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1289 1579 gene locus_tag LOCUS_16760 1289 1579 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921449.1 protein_id gnl|my_center|LOCUS_16760 1714 2268 gene locus_tag LOCUS_16770 gene grpE 1714 2268 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence242 305 1651 gene locus_tag LOCUS_16780 305 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 2214 1990 gene locus_tag LOCUS_16790 2214 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2677 2414 gene locus_tag LOCUS_16800 gene rpmB 2677 2414 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence243 2581 1493 gene locus_tag LOCUS_16810 2581 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <3432 2684 gene locus_tag LOCUS_16820 <3432 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905243.1:class I SAM-dependent rRNA methyltransferase >Feature sequence244 1803 1204 gene locus_tag LOCUS_16830 1803 1204 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_16830 2211 1834 gene locus_tag LOCUS_16840 2211 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16840 3090 2251 gene locus_tag LOCUS_16850 3090 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16850 >Feature sequence245 1361 276 gene locus_tag LOCUS_16860 gene gcvT 1361 276 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_16860 2558 1437 gene locus_tag LOCUS_16870 gene ychF 2558 1437 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_16870 <3382 2617 gene locus_tag LOCUS_16880 <3382 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965357.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence246 1177 428 gene locus_tag LOCUS_16890 1177 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16890 1894 1499 gene locus_tag LOCUS_16900 1894 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence247 1136 393 gene locus_tag LOCUS_16910 1136 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1395 1108 gene locus_tag LOCUS_16920 1395 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1935 3305 gene locus_tag LOCUS_16930 1935 3305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence248 >Feature sequence249 384 884 gene locus_tag LOCUS_16940 384 884 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_16940 1011 2045 gene locus_tag LOCUS_16950 1011 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2484 2083 gene locus_tag LOCUS_16960 2484 2083 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948666.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence250 53 1597 gene locus_tag LOCUS_16970 53 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2493 1744 gene locus_tag LOCUS_16980 2493 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence251 3005 591 gene locus_tag LOCUS_16990 3005 591 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence252 1197 787 gene locus_tag LOCUS_17000 gene rplQ 1197 787 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_17000 2358 1234 gene locus_tag LOCUS_17010 2358 1234 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence253 21 728 gene locus_tag LOCUS_17020 21 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2358 838 gene locus_tag LOCUS_17030 gene oadA 2358 838 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_17030 <3187 2465 gene locus_tag LOCUS_17040 <3187 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144064.1:cardiolipin synthase >Feature sequence254 84 9 gene locus_tag LOCUS_t00360 84 9 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1270 617 gene locus_tag LOCUS_17050 1270 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2684 2496 gene locus_tag LOCUS_17060 2684 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence255 <1 1649 gene locus_tag LOCUS_17070 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase <3159 1815 gene locus_tag LOCUS_17080 <3159 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179608.1:transcription termination factor Rho >Feature sequence256 1737 490 gene locus_tag LOCUS_17090 1737 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 <3123 1848 gene locus_tag LOCUS_17100 <3123 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764994.1:Na+/H+ antiporter NhaC family protein >Feature sequence257 1547 567 gene locus_tag LOCUS_17110 gene ilvC 1547 567 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_17110 2424 1915 gene locus_tag LOCUS_17120 2424 1915 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_17120 <3115 2421 gene locus_tag LOCUS_17130 <3115 2421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203144.1:TIGR01777 family oxidoreductase note possible pseudo, internal stop codon, frameshifted >Feature sequence258 88 2322 gene locus_tag LOCUS_17140 gene katE 88 2322 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077853.1 protein_id gnl|my_center|LOCUS_17140 2622 2548 gene locus_tag LOCUS_t00370 2622 2548 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence259 641 21 gene locus_tag LOCUS_17150 641 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1441 680 gene locus_tag LOCUS_17160 1441 680 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_17160 1696 2991 gene locus_tag LOCUS_17170 gene nusA 1696 2991 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311294.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence260 299 111 gene locus_tag LOCUS_17180 299 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 307 2130 gene locus_tag LOCUS_17190 gene thiC 307 2130 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence261 413 45 gene locus_tag LOCUS_17200 413 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1412 633 gene locus_tag LOCUS_17210 1412 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 >Feature sequence262 147 956 gene locus_tag LOCUS_17220 147 956 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964627.1 protein_id gnl|my_center|LOCUS_17220 1833 2903 gene locus_tag LOCUS_17230 1833 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence263 >Feature sequence264 559 1572 gene locus_tag LOCUS_17240 559 1572 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_17240 1706 2311 gene locus_tag LOCUS_17250 1706 2311 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311165.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence265 >Feature sequence266 746 2323 gene locus_tag LOCUS_17260 746 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence267 1665 622 gene locus_tag LOCUS_17270 1665 622 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_17270 1769 2626 gene locus_tag LOCUS_17280 1769 2626 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence268 1438 155 gene locus_tag LOCUS_17290 1438 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 <2949 1808 gene locus_tag LOCUS_17300 <2949 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_078755645.1:translation elongation factor 4 >Feature sequence269 3 1616 gene locus_tag LOCUS_17310 3 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1838 1686 gene locus_tag LOCUS_17320 1838 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1828 2124 gene locus_tag LOCUS_17330 1828 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2471 2079 gene locus_tag LOCUS_17340 2471 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence270 788 39 gene locus_tag LOCUS_17350 788 39 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_17350 1901 969 gene locus_tag LOCUS_17360 1901 969 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_17360 <2939 2142 gene locus_tag LOCUS_17370 <2939 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439079.1:DUF4118 domain-containing protein >Feature sequence271 1149 1949 gene locus_tag LOCUS_17380 1149 1949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_17380 1965 2783 gene locus_tag LOCUS_17390 1965 2783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence272 1605 544 gene locus_tag LOCUS_17400 gene floA 1605 544 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_17400 1688 2677 gene locus_tag LOCUS_17410 gene queA 1688 2677 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence273 339 1691 gene locus_tag LOCUS_17420 339 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2841 1702 gene locus_tag LOCUS_17430 2841 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 >Feature sequence274 1106 291 gene locus_tag LOCUS_17440 gene larE 1106 291 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17440 2298 1078 gene locus_tag LOCUS_17450 gene larC 2298 1078 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence275 354 58 gene locus_tag LOCUS_17460 354 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 455 880 gene locus_tag LOCUS_17470 455 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2694 1087 gene locus_tag LOCUS_17480 gene fumA 2694 1087 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence276 2357 942 gene locus_tag LOCUS_17490 2357 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2832 2341 gene locus_tag LOCUS_17500 2832 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence277 489 413 gene locus_tag LOCUS_t00380 489 413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 838 1431 gene locus_tag LOCUS_17510 gene raiA 838 1431 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903257.1 protein_id gnl|my_center|LOCUS_17510 1645 1773 gene locus_tag LOCUS_17520 1645 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2636 1983 gene locus_tag LOCUS_17530 2636 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence278 >Feature sequence279 410 2023 gene locus_tag LOCUS_17540 410 2023 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_17540 2048 2653 gene locus_tag LOCUS_17550 2048 2653 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence280 1480 575 gene locus_tag LOCUS_17560 gene prmC 1480 575 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_17560 2573 1497 gene locus_tag LOCUS_17570 gene prfA 2573 1497 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence281 450 983 gene locus_tag LOCUS_17580 450 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1049 1642 gene locus_tag LOCUS_17590 gene ruvA 1049 1642 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence282 251 859 gene locus_tag LOCUS_17600 gene recR 251 859 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_17600 1269 1024 gene locus_tag LOCUS_17610 1269 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence283 1083 43 gene locus_tag LOCUS_17620 gene cobT 1083 43 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_17620 1913 1089 gene locus_tag LOCUS_17630 1913 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 <2770 2076 gene locus_tag LOCUS_17640 <2770 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001052877.1:cobyric acid synthase >Feature sequence284 907 296 gene locus_tag LOCUS_17650 907 296 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_17650 1545 904 gene locus_tag LOCUS_17660 gene cmk 1545 904 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence285 2593 35 gene locus_tag LOCUS_17670 gene gyrB 2593 35 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence286 <1 889 gene locus_tag LOCUS_17680 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 979 1422 gene locus_tag LOCUS_17690 979 1422 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence287 831 49 gene locus_tag LOCUS_17700 gene pstB 831 49 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_17700 980 1996 gene locus_tag LOCUS_17710 980 1996 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence288 590 1537 gene locus_tag LOCUS_17720 590 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence289 951 676 gene locus_tag LOCUS_17730 951 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2469 1285 gene locus_tag LOCUS_17740 2469 1285 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence290 <1 1782 gene locus_tag LOCUS_17750 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942900.1:lipid A export permease/ATP-binding protein MsbA >Feature sequence291 305 802 gene locus_tag LOCUS_17760 305 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 <2606 1259 gene locus_tag LOCUS_17770 <2606 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946906.1:Dot/Icm type IV secretion system effector LidL >Feature sequence292 855 247 gene locus_tag LOCUS_17780 855 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 <2604 1033 gene locus_tag LOCUS_17790 <2604 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114675.1:NAD-dependent DNA ligase LigA >Feature sequence293 >Feature sequence294 <2601 52 gene locus_tag LOCUS_17800 <2601 52 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081557.1:isoleucine--tRNA ligase >Feature sequence295 1857 625 gene locus_tag LOCUS_17810 1857 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_17810 2516 1854 gene locus_tag LOCUS_17820 2516 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence296 <1 950 gene locus_tag LOCUS_17830 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964424.1:thioredoxin family protein 1001 1813 gene locus_tag LOCUS_17840 gene zupT 1001 1813 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence297 <2552 853 gene locus_tag LOCUS_17850 <2552 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106496.1:SslE/AcfD family lipoprotein zinc metalloprotease >Feature sequence298 1671 100 gene locus_tag LOCUS_17860 1671 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <2519 1706 gene locus_tag LOCUS_17870 <2519 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102804.1:ABC transporter permease >Feature sequence299 1517 69 gene locus_tag LOCUS_17880 1517 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 <2512 1514 gene locus_tag LOCUS_17890 <2512 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331193.1:ABC transporter ATP-binding protein >Feature sequence300 912 2300 gene locus_tag LOCUS_17900 912 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence301 136 1347 gene locus_tag LOCUS_17910 136 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1806 1399 gene locus_tag LOCUS_17920 1806 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1777 2442 gene locus_tag LOCUS_17930 1777 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence302 >Feature sequence303 1769 483 gene locus_tag LOCUS_17940 gene nrfD 1769 483 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence304 <1 628 gene locus_tag LOCUS_17950 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202725.1:aldo/keto reductase 719 1855 gene locus_tag LOCUS_17960 719 1855 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence305 1823 1335 gene locus_tag LOCUS_17970 1823 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1979 2191 gene locus_tag LOCUS_17980 1979 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2188 2325 gene locus_tag LOCUS_17990 2188 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence306 <1 1041 gene locus_tag LOCUS_18000 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403343.1:mannose-1-phosphate guanylyltransferase 1038 1463 gene locus_tag LOCUS_18010 1038 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 <2360 1658 gene locus_tag LOCUS_18020 <2360 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275492.1:zinc-binding dehydrogenase >Feature sequence307 1687 593 gene locus_tag LOCUS_18030 1687 593 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence308 62 1672 gene locus_tag LOCUS_18040 62 1672 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973389.1 protein_id gnl|my_center|LOCUS_18040 1915 2202 gene locus_tag LOCUS_18050 1915 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence309 243 722 gene locus_tag LOCUS_18060 243 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1911 844 gene locus_tag LOCUS_18070 gene aroG 1911 844 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704774.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence310 499 1854 gene locus_tag LOCUS_18080 499 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence311 578 1060 gene locus_tag LOCUS_18090 578 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence312 <2264 1134 gene locus_tag LOCUS_18100 <2264 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546828.1:A24 family peptidase >Feature sequence313 606 70 gene locus_tag LOCUS_18110 606 70 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence314 <1 1317 gene locus_tag LOCUS_18120 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107278.1:family 20 glycosylhydrolase 1438 2211 gene locus_tag LOCUS_18130 1438 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence315 163 1011 gene locus_tag LOCUS_18140 gene ftsY 163 1011 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_18140 1030 2109 gene locus_tag LOCUS_18150 gene rlmN 1030 2109 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940164.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence316 526 452 gene locus_tag LOCUS_t00390 526 452 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1310 741 gene locus_tag LOCUS_18160 1310 741 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence317 1848 964 gene locus_tag LOCUS_18170 1848 964 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence318 2065 1049 gene locus_tag LOCUS_18180 2065 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence319 >Feature sequence320 708 136 gene locus_tag LOCUS_18190 708 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 <2154 991 gene locus_tag LOCUS_18200 <2154 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000613941.1:FAD-dependent oxidoreductase >Feature sequence321 1577 114 gene locus_tag LOCUS_18210 1577 114 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence322 3 797 gene locus_tag LOCUS_18220 3 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 858 1880 gene locus_tag LOCUS_18230 858 1880 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence323 >Feature sequence324 <1 784 gene locus_tag LOCUS_18240 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993669.1:acyltransferase 1607 1350 gene locus_tag LOCUS_18250 1607 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1903 1604 gene locus_tag LOCUS_18260 1903 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence325 651 172 gene locus_tag LOCUS_18270 651 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1090 659 gene locus_tag LOCUS_18280 1090 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 <2053 1131 gene locus_tag LOCUS_18290 <2053 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933177.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase >Feature sequence326 261 1268 gene locus_tag LOCUS_18300 261 1268 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence327 346 990 gene locus_tag LOCUS_18310 346 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1306 2016 gene locus_tag LOCUS_18320 1306 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence328 >Feature sequence329 1200 1949 gene locus_tag LOCUS_18330 1200 1949 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence330 996 313 gene locus_tag LOCUS_18340 996 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence331 >Feature sequence332 721 134 gene locus_tag LOCUS_18350 721 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence333 1528 1040 gene locus_tag LOCUS_18360 gene elsL 1528 1040 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence334 >Feature sequence335 <1 777 gene locus_tag LOCUS_18370 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947895.1:chromosomal replication initiator protein DnaA >Feature sequence336 <1 777 gene locus_tag LOCUS_18380 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764020.1:acyltransferase 1846 860 gene locus_tag LOCUS_18390 gene icd 1846 860 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence337 696 181 gene locus_tag LOCUS_18400 696 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1487 693 gene locus_tag LOCUS_18410 gene tcdA 1487 693 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence338 1776 649 gene locus_tag LOCUS_18420 gene dprA 1776 649 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence339 1767 205 gene locus_tag LOCUS_18430 1767 205 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence340 >Feature sequence341 1327 329 gene locus_tag LOCUS_18440 1327 329 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence342 226 1635 gene locus_tag LOCUS_18450 226 1635 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_18450 1723 1798 gene locus_tag LOCUS_t00400 1723 1798 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence343 1430 615 gene locus_tag LOCUS_18460 gene thiM 1430 615 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047875.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence344 222 309 gene locus_tag LOCUS_t00410 222 309 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <1792 434 gene locus_tag LOCUS_18470 <1792 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228683.1:excinuclease ABC subunit UvrA >Feature sequence345 944 1534 gene locus_tag LOCUS_18480 gene hisB 944 1534 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence346 <1768 669 gene locus_tag LOCUS_18490 <1768 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000541039.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence347 1353 415 gene locus_tag LOCUS_18500 gene lipA 1353 415 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence348 543 1601 gene locus_tag LOCUS_18510 543 1601 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence349 >Feature sequence350 454 942 gene locus_tag LOCUS_18520 gene ribH 454 942 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence351 >Feature sequence352 <1 1630 gene locus_tag LOCUS_18530 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939333.1:methionine--tRNA ligase >Feature sequence353 <1 962 gene locus_tag LOCUS_18540 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943751.1:MATE family efflux transporter 1083 1158 gene locus_tag LOCUS_t00420 1083 1158 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence354 <1 920 gene locus_tag LOCUS_18550 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403526.1:PfkB family carbohydrate kinase <1670 1103 gene locus_tag LOCUS_18560 <1670 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933326.1:bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase >Feature sequence355 <1 959 gene locus_tag LOCUS_18570 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001011576.1:(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 996 1637 gene locus_tag LOCUS_18580 gene fabG 996 1637 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence356 >Feature sequence357 1022 1360 gene locus_tag LOCUS_18590 1022 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence358 341 1270 gene locus_tag LOCUS_18600 gene cysK 341 1270 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence359 1223 249 gene locus_tag LOCUS_18610 1223 249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence360 600 397 gene locus_tag LOCUS_18620 600 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence361 >Feature sequence362 1340 474 gene locus_tag LOCUS_18630 1340 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence363 33 1283 gene locus_tag LOCUS_18640 33 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence364 865 164 gene locus_tag LOCUS_18650 865 164 CDS product prokaryotic E2 ligase family D protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108425.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence365 <1 905 gene locus_tag LOCUS_18660 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453777.1:GNAT family N-acetyltransferase <1552 950 gene locus_tag LOCUS_18670 <1552 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943812.1:thiamine-phosphate kinase >Feature sequence366 >Feature sequence367 715 446 gene locus_tag LOCUS_18680 715 446 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_18680 <1530 797 gene locus_tag LOCUS_18690 <1530 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037922.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence368 107 811 gene locus_tag LOCUS_18700 107 811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence369 258 1190 gene locus_tag LOCUS_18710 258 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence370 <1 604 gene locus_tag LOCUS_18720 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000018758.1:NADP(+)-dependent aldehyde reductase