>Feature sequence01 <1 1939 gene locus_tag LOCUS_00010 <1 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263335.1:GBS Bsp-like repeat-containing protein 1955 2542 gene locus_tag LOCUS_00020 1955 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2643 3860 gene locus_tag LOCUS_00030 gene pepT 2643 3860 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837055.1 protein_id gnl|my_center|LOCUS_00030 3911 4402 gene locus_tag LOCUS_00040 3911 4402 CDS product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593178.1 protein_id gnl|my_center|LOCUS_00040 4586 4392 gene locus_tag LOCUS_00050 4586 4392 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861358.1 protein_id gnl|my_center|LOCUS_00050 4631 5119 gene locus_tag LOCUS_00060 4631 5119 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990270.1 protein_id gnl|my_center|LOCUS_00060 5136 5816 gene locus_tag LOCUS_00070 gene cmk 5136 5816 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084720.1 protein_id gnl|my_center|LOCUS_00070 5982 6512 gene locus_tag LOCUS_00080 gene infC 5982 6512 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691023.1 protein_id gnl|my_center|LOCUS_00080 6551 6751 gene locus_tag LOCUS_00090 gene rpmI 6551 6751 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895038.1 protein_id gnl|my_center|LOCUS_00090 6804 7163 gene locus_tag LOCUS_00100 6804 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9501 7357 gene locus_tag LOCUS_00110 9501 7357 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721255.1 protein_id gnl|my_center|LOCUS_00110 9853 11016 gene locus_tag LOCUS_00120 9853 11016 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037599.1 protein_id gnl|my_center|LOCUS_00120 11034 11690 gene locus_tag LOCUS_00130 gene aroD 11034 11690 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985140.1 protein_id gnl|my_center|LOCUS_00130 11680 12549 gene locus_tag LOCUS_00140 11680 12549 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261932.1 protein_id gnl|my_center|LOCUS_00140 12571 13638 gene locus_tag LOCUS_00150 gene aroB 12571 13638 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261933.1 protein_id gnl|my_center|LOCUS_00150 13640 14806 gene locus_tag LOCUS_00160 gene aroC 13640 14806 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269854.1 protein_id gnl|my_center|LOCUS_00160 14885 15991 gene locus_tag LOCUS_00170 14885 15991 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261935.1 protein_id gnl|my_center|LOCUS_00170 16003 16341 gene locus_tag LOCUS_00180 16003 16341 CDS product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261936.1 protein_id gnl|my_center|LOCUS_00180 16435 17352 gene locus_tag LOCUS_00190 16435 17352 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197060.1 protein_id gnl|my_center|LOCUS_00190 18629 17385 gene locus_tag LOCUS_00200 18629 17385 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261989.1 protein_id gnl|my_center|LOCUS_00200 19144 18689 gene locus_tag LOCUS_00210 19144 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19340 20485 gene locus_tag LOCUS_00220 19340 20485 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638895.1 protein_id gnl|my_center|LOCUS_00220 20526 21740 gene locus_tag LOCUS_00230 gene thiI 20526 21740 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200105.1 protein_id gnl|my_center|LOCUS_00230 21835 23037 gene locus_tag LOCUS_00240 21835 23037 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017643.1 protein_id gnl|my_center|LOCUS_00240 23028 23567 gene locus_tag LOCUS_00250 23028 23567 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261994.1 protein_id gnl|my_center|LOCUS_00250 23770 24084 gene locus_tag LOCUS_00260 gene rplU 23770 24084 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985116.1 protein_id gnl|my_center|LOCUS_00260 24097 24432 gene locus_tag LOCUS_00270 24097 24432 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261997.1 protein_id gnl|my_center|LOCUS_00270 24454 24747 gene locus_tag LOCUS_00280 gene rpmA 24454 24747 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916503.1 protein_id gnl|my_center|LOCUS_00280 24849 25802 gene locus_tag LOCUS_00290 24849 25802 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262001.1 protein_id gnl|my_center|LOCUS_00290 25799 26272 gene locus_tag LOCUS_00300 gene lspA 25799 26272 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226253.1 protein_id gnl|my_center|LOCUS_00300 26256 27152 gene locus_tag LOCUS_00310 26256 27152 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403233.1 protein_id gnl|my_center|LOCUS_00310 27436 27957 gene locus_tag LOCUS_00320 gene pyrR 27436 27957 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922146.1 protein_id gnl|my_center|LOCUS_00320 27989 29251 gene locus_tag LOCUS_00330 27989 29251 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_00330 29255 30181 gene locus_tag LOCUS_00340 29255 30181 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262007.1 protein_id gnl|my_center|LOCUS_00340 30253 31341 gene locus_tag LOCUS_00350 30253 31341 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262008.1 protein_id gnl|my_center|LOCUS_00350 31575 34754 gene locus_tag LOCUS_00360 gene carB 31575 34754 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262009.1 protein_id gnl|my_center|LOCUS_00360 34974 36161 gene locus_tag LOCUS_00370 34974 36161 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922148.1 protein_id gnl|my_center|LOCUS_00370 36165 36884 gene locus_tag LOCUS_00380 36165 36884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210674.1 protein_id gnl|my_center|LOCUS_00380 36897 38126 gene locus_tag LOCUS_00390 36897 38126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432854.1 protein_id gnl|my_center|LOCUS_00390 38245 38802 gene locus_tag LOCUS_00400 38245 38802 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056394.1 protein_id gnl|my_center|LOCUS_00400 38821 39570 gene locus_tag LOCUS_00410 38821 39570 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775077.1 protein_id gnl|my_center|LOCUS_00410 39713 39874 gene locus_tag LOCUS_00420 39713 39874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40031 40192 gene locus_tag LOCUS_00430 40031 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40189 41109 gene locus_tag LOCUS_00440 40189 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41102 41266 gene locus_tag LOCUS_00450 41102 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41501 41827 gene locus_tag LOCUS_00460 41501 41827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 41838 42623 gene locus_tag LOCUS_00470 gene prgC 41838 42623 CDS product pheromone response LPXTG-anchored adhesin PrgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367673.1 protein_id gnl|my_center|LOCUS_00470 42681 45899 gene locus_tag LOCUS_00480 42681 45899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46102 50646 gene locus_tag LOCUS_00490 46102 50646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50853 51080 gene locus_tag LOCUS_00500 50853 51080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51161 51733 gene locus_tag LOCUS_00510 51161 51733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51786 52538 gene locus_tag LOCUS_00520 51786 52538 CDS product PrgH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774271.1 protein_id gnl|my_center|LOCUS_00520 52595 52960 gene locus_tag LOCUS_00530 52595 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52926 55292 gene locus_tag LOCUS_00540 52926 55292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 protein_id gnl|my_center|LOCUS_00540 55350 58010 gene locus_tag LOCUS_00550 55350 58010 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775521.1 protein_id gnl|my_center|LOCUS_00550 58027 58632 gene locus_tag LOCUS_00560 58027 58632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395055.1 protein_id gnl|my_center|LOCUS_00560 58644 59036 gene locus_tag LOCUS_00570 58644 59036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59055 59330 gene locus_tag LOCUS_00580 59055 59330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59330 60133 gene locus_tag LOCUS_00590 59330 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60147 60638 gene locus_tag LOCUS_00600 60147 60638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 60638 62704 gene locus_tag LOCUS_00610 60638 62704 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069653754.1 protein_id gnl|my_center|LOCUS_00610 62740 62883 gene locus_tag LOCUS_00620 62740 62883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62938 64674 gene locus_tag LOCUS_00630 62938 64674 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484399.1 protein_id gnl|my_center|LOCUS_00630 64728 69368 gene locus_tag LOCUS_00640 64728 69368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69426 69719 gene locus_tag LOCUS_00650 69426 69719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70030 70404 gene locus_tag LOCUS_00660 70030 70404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70376 72004 gene locus_tag LOCUS_00670 70376 72004 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774278.1 protein_id gnl|my_center|LOCUS_00670 72194 72856 gene locus_tag LOCUS_00680 72194 72856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72866 73252 gene locus_tag LOCUS_00690 72866 73252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 73475 74137 gene locus_tag LOCUS_00700 73475 74137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74131 74319 gene locus_tag LOCUS_00710 74131 74319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74519 75103 gene locus_tag LOCUS_00720 74519 75103 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241777.1 protein_id gnl|my_center|LOCUS_00720 75223 75588 gene locus_tag LOCUS_00730 75223 75588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75825 76622 gene locus_tag LOCUS_00740 75825 76622 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 protein_id gnl|my_center|LOCUS_00740 76697 76921 gene locus_tag LOCUS_00750 76697 76921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 77040 78374 gene locus_tag LOCUS_00760 77040 78374 CDS product ISLre2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453221.1 protein_id gnl|my_center|LOCUS_00760 78869 79141 gene locus_tag LOCUS_00770 gene rpsP 78869 79141 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268757.1 protein_id gnl|my_center|LOCUS_00770 79159 79407 gene locus_tag LOCUS_00780 79159 79407 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985072.1 protein_id gnl|my_center|LOCUS_00780 79650 79721 gene locus_tag LOCUS_t00010 79650 79721 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 79746 79820 gene locus_tag LOCUS_t00020 79746 79820 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 79904 80422 gene locus_tag LOCUS_00790 gene rimM 79904 80422 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922346.1 protein_id gnl|my_center|LOCUS_00790 80412 81140 gene locus_tag LOCUS_00800 gene trmD 80412 81140 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262016.1 protein_id gnl|my_center|LOCUS_00800 81200 81712 gene locus_tag LOCUS_00810 81200 81712 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_00810 81713 82714 gene locus_tag LOCUS_00820 81713 82714 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262017.1 protein_id gnl|my_center|LOCUS_00820 82892 83641 gene locus_tag LOCUS_00830 82892 83641 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266239.1 protein_id gnl|my_center|LOCUS_00830 83638 84549 gene locus_tag LOCUS_00840 gene pfkB 83638 84549 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640752.1 protein_id gnl|my_center|LOCUS_00840 84546 86474 gene locus_tag LOCUS_00850 84546 86474 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701402.1 protein_id gnl|my_center|LOCUS_00850 86732 88966 gene locus_tag LOCUS_00860 gene metE 86732 88966 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262021.1 protein_id gnl|my_center|LOCUS_00860 88980 90836 gene locus_tag LOCUS_00870 88980 90836 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262022.1 protein_id gnl|my_center|LOCUS_00870 90927 91913 gene locus_tag LOCUS_00880 90927 91913 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_00880 92043 92660 gene locus_tag LOCUS_00890 92043 92660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 92668 92967 gene locus_tag LOCUS_00900 92668 92967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 92971 93933 gene locus_tag LOCUS_00910 92971 93933 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_00910 93954 94475 gene locus_tag LOCUS_00920 93954 94475 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068818.1 protein_id gnl|my_center|LOCUS_00920 94508 95305 gene locus_tag LOCUS_00930 94508 95305 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_00930 95326 95943 gene locus_tag LOCUS_00940 95326 95943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_00940 96033 96503 gene locus_tag LOCUS_00950 96033 96503 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702501.1 protein_id gnl|my_center|LOCUS_00950 96602 98362 gene locus_tag LOCUS_00960 96602 98362 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_00960 98607 99137 gene locus_tag LOCUS_00970 98607 99137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99253 99633 gene locus_tag LOCUS_00980 99253 99633 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985011.1 protein_id gnl|my_center|LOCUS_00980 99633 100481 gene locus_tag LOCUS_00990 99633 100481 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922161.1 protein_id gnl|my_center|LOCUS_00990 100502 101269 gene locus_tag LOCUS_01000 gene dapB 100502 101269 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262893.1 protein_id gnl|my_center|LOCUS_01000 101266 102471 gene locus_tag LOCUS_01010 101266 102471 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262894.1 protein_id gnl|my_center|LOCUS_01010 102468 104336 gene locus_tag LOCUS_01020 102468 104336 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262895.1 protein_id gnl|my_center|LOCUS_01020 104381 106120 gene locus_tag LOCUS_01030 104381 106120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262897.1 protein_id gnl|my_center|LOCUS_01030 106123 107892 gene locus_tag LOCUS_01040 106123 107892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262898.1 protein_id gnl|my_center|LOCUS_01040 108058 108711 gene locus_tag LOCUS_01050 gene queC 108058 108711 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263291.1 protein_id gnl|my_center|LOCUS_01050 108711 109157 gene locus_tag LOCUS_01060 gene queD 108711 109157 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464576.1 protein_id gnl|my_center|LOCUS_01060 109150 109863 gene locus_tag LOCUS_01070 gene queE 109150 109863 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196451.1 protein_id gnl|my_center|LOCUS_01070 109878 110369 gene locus_tag LOCUS_01080 gene queF 109878 110369 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082587.1 protein_id gnl|my_center|LOCUS_01080 110905 110408 gene locus_tag LOCUS_01090 110905 110408 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870956.1 protein_id gnl|my_center|LOCUS_01090 111137 112486 gene locus_tag LOCUS_01100 gene gdhA 111137 112486 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 protein_id gnl|my_center|LOCUS_01100 112639 113142 gene locus_tag LOCUS_01110 112639 113142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_01110 113145 113555 gene locus_tag LOCUS_01120 113145 113555 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836525.1 protein_id gnl|my_center|LOCUS_01120 113703 114143 gene locus_tag LOCUS_01130 113703 114143 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263292.1 protein_id gnl|my_center|LOCUS_01130 114147 115961 gene locus_tag LOCUS_01140 114147 115961 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263293.1 protein_id gnl|my_center|LOCUS_01140 115951 117723 gene locus_tag LOCUS_01150 115951 117723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 protein_id gnl|my_center|LOCUS_01150 117831 118982 gene locus_tag LOCUS_01160 117831 118982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118987 119724 gene locus_tag LOCUS_01170 118987 119724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 119727 120167 gene locus_tag LOCUS_01180 119727 120167 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262243.1 protein_id gnl|my_center|LOCUS_01180 120169 120363 gene locus_tag LOCUS_01190 120169 120363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 120453 121070 gene locus_tag LOCUS_01200 120453 121070 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449640.1 protein_id gnl|my_center|LOCUS_01200 121086 121766 gene locus_tag LOCUS_01210 121086 121766 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264416.1 protein_id gnl|my_center|LOCUS_01210 121774 122997 gene locus_tag LOCUS_01220 121774 122997 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489528.1 protein_id gnl|my_center|LOCUS_01220 123878 123033 gene locus_tag LOCUS_01230 123878 123033 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_01230 124854 123940 gene locus_tag LOCUS_01240 124854 123940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263650.1 protein_id gnl|my_center|LOCUS_01240 125087 125281 gene locus_tag LOCUS_01250 125087 125281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 125440 126471 gene locus_tag LOCUS_01260 125440 126471 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_01260 126523 127401 gene locus_tag LOCUS_01270 126523 127401 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837552.1 protein_id gnl|my_center|LOCUS_01270 127411 128103 gene locus_tag LOCUS_01280 127411 128103 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263653.1 protein_id gnl|my_center|LOCUS_01280 128114 128794 gene locus_tag LOCUS_01290 128114 128794 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263654.1 protein_id gnl|my_center|LOCUS_01290 128815 129573 gene locus_tag LOCUS_01300 128815 129573 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263655.1 protein_id gnl|my_center|LOCUS_01300 129794 130477 gene locus_tag LOCUS_01310 129794 130477 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_01310 130437 131114 gene locus_tag LOCUS_01320 130437 131114 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_01320 131120 131866 gene locus_tag LOCUS_01330 131120 131866 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_01330 131896 132768 gene locus_tag LOCUS_01340 131896 132768 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_01340 132923 133801 gene locus_tag LOCUS_01350 gene mvk 132923 133801 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984974.1 protein_id gnl|my_center|LOCUS_01350 133783 134733 gene locus_tag LOCUS_01360 gene mvaD 133783 134733 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922167.1 protein_id gnl|my_center|LOCUS_01360 134720 135718 gene locus_tag LOCUS_01370 134720 135718 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263657.1 protein_id gnl|my_center|LOCUS_01370 135715 136713 gene locus_tag LOCUS_01380 gene fni 135715 136713 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922169.1 protein_id gnl|my_center|LOCUS_01380 137392 136736 gene locus_tag LOCUS_01390 137392 136736 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263659.1 protein_id gnl|my_center|LOCUS_01390 137825 137382 gene locus_tag LOCUS_01400 137825 137382 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264322.1 protein_id gnl|my_center|LOCUS_01400 139334 138060 gene locus_tag LOCUS_01410 139334 138060 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 protein_id gnl|my_center|LOCUS_01410 140499 139321 gene locus_tag LOCUS_01420 140499 139321 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266471.1 protein_id gnl|my_center|LOCUS_01420 140831 141670 gene locus_tag LOCUS_01430 140831 141670 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 protein_id gnl|my_center|LOCUS_01430 141754 142248 gene locus_tag LOCUS_01440 141754 142248 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166043.1 protein_id gnl|my_center|LOCUS_01440 142264 142434 gene locus_tag LOCUS_01450 142264 142434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189822.1 protein_id gnl|my_center|LOCUS_01450 142471 143700 gene locus_tag LOCUS_01460 gene clpX 142471 143700 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262816.1 protein_id gnl|my_center|LOCUS_01460 143710 144303 gene locus_tag LOCUS_01470 gene yihA 143710 144303 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 protein_id gnl|my_center|LOCUS_01470 144506 145816 gene locus_tag LOCUS_01480 144506 145816 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427485.1 protein_id gnl|my_center|LOCUS_01480 145829 146773 gene locus_tag LOCUS_01490 gene mmuM 145829 146773 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262819.1 protein_id gnl|my_center|LOCUS_01490 147494 146808 gene locus_tag LOCUS_01500 147494 146808 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250491.1 protein_id gnl|my_center|LOCUS_01500 149859 147751 gene locus_tag LOCUS_01510 149859 147751 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002813.1 protein_id gnl|my_center|LOCUS_01510 150419 150922 gene locus_tag LOCUS_01520 gene rplJ 150419 150922 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262824.1 protein_id gnl|my_center|LOCUS_01520 150991 151359 gene locus_tag LOCUS_01530 gene rplL 150991 151359 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196965.1 protein_id gnl|my_center|LOCUS_01530 152498 151872 gene locus_tag LOCUS_01540 152498 151872 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592593.1 protein_id gnl|my_center|LOCUS_01540 153647 152709 gene locus_tag LOCUS_01550 153647 152709 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262828.1 protein_id gnl|my_center|LOCUS_01550 153868 155154 gene locus_tag LOCUS_01560 153868 155154 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262829.1 protein_id gnl|my_center|LOCUS_01560 155191 156069 gene locus_tag LOCUS_01570 gene thrB 155191 156069 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262830.1 protein_id gnl|my_center|LOCUS_01570 156268 157521 gene locus_tag LOCUS_01580 156268 157521 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222112.1 protein_id gnl|my_center|LOCUS_01580 157560 158123 gene locus_tag LOCUS_01590 gene folE 157560 158123 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133588.1 protein_id gnl|my_center|LOCUS_01590 158157 158957 gene locus_tag LOCUS_01600 gene folP 158157 158957 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690157.1 protein_id gnl|my_center|LOCUS_01600 159017 159379 gene locus_tag LOCUS_01610 gene folB 159017 159379 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989868.1 protein_id gnl|my_center|LOCUS_01610 159376 159855 gene locus_tag LOCUS_01620 gene folK 159376 159855 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214497.1 protein_id gnl|my_center|LOCUS_01620 160031 160933 gene locus_tag LOCUS_01630 gene murB 160031 160933 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598027.1 protein_id gnl|my_center|LOCUS_01630 160961 162112 gene locus_tag LOCUS_01640 160961 162112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184098.1 protein_id gnl|my_center|LOCUS_01640 162099 162890 gene locus_tag LOCUS_01650 162099 162890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262838.1 protein_id gnl|my_center|LOCUS_01650 162887 163678 gene locus_tag LOCUS_01660 162887 163678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712712.1 protein_id gnl|my_center|LOCUS_01660 163671 164744 gene locus_tag LOCUS_01670 163671 164744 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984738.1 protein_id gnl|my_center|LOCUS_01670 164885 166417 gene locus_tag LOCUS_01680 164885 166417 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427427.1 protein_id gnl|my_center|LOCUS_01680 166613 167452 gene locus_tag LOCUS_01690 166613 167452 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264303.1 protein_id gnl|my_center|LOCUS_01690 167790 169703 gene locus_tag LOCUS_01700 167790 169703 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262843.1 protein_id gnl|my_center|LOCUS_01700 170714 169788 gene locus_tag LOCUS_01710 170714 169788 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_01710 170972 171259 gene locus_tag LOCUS_01720 170972 171259 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963363.1 protein_id gnl|my_center|LOCUS_01720 171272 172840 gene locus_tag LOCUS_01730 171272 172840 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963362.1 protein_id gnl|my_center|LOCUS_01730 172950 174383 gene locus_tag LOCUS_01740 172950 174383 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 protein_id gnl|my_center|LOCUS_01740 174473 174712 gene locus_tag LOCUS_01750 174473 174712 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_01750 174906 175211 gene locus_tag LOCUS_01760 174906 175211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 175340 175666 gene locus_tag LOCUS_01770 175340 175666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 175678 176016 gene locus_tag LOCUS_01780 175678 176016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 176238 176555 gene locus_tag LOCUS_01790 176238 176555 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262789.1 protein_id gnl|my_center|LOCUS_01790 176606 178579 gene locus_tag LOCUS_01800 176606 178579 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352342.1 protein_id gnl|my_center|LOCUS_01800 178598 178912 gene locus_tag LOCUS_01810 178598 178912 CDS product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262791.1 protein_id gnl|my_center|LOCUS_01810 178935 179447 gene locus_tag LOCUS_01820 178935 179447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285960.1 protein_id gnl|my_center|LOCUS_01820 179486 180811 gene locus_tag LOCUS_01830 gene celB 179486 180811 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 protein_id gnl|my_center|LOCUS_01830 180960 181781 gene locus_tag LOCUS_01840 180960 181781 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593347.1 protein_id gnl|my_center|LOCUS_01840 181774 182598 gene locus_tag LOCUS_01850 181774 182598 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774938.1 protein_id gnl|my_center|LOCUS_01850 182599 183252 gene locus_tag LOCUS_01860 182599 183252 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836482.1 protein_id gnl|my_center|LOCUS_01860 183348 184850 gene locus_tag LOCUS_01870 183348 184850 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546652.1 protein_id gnl|my_center|LOCUS_01870 184993 188355 gene locus_tag LOCUS_01880 184993 188355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 188455 189276 gene locus_tag LOCUS_01890 188455 189276 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774938.1 protein_id gnl|my_center|LOCUS_01890 190643 189312 gene locus_tag LOCUS_01900 190643 189312 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_01900 191005 190766 gene locus_tag LOCUS_01910 191005 190766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 192531 191131 gene locus_tag LOCUS_01920 192531 191131 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_01920 192637 193512 gene locus_tag LOCUS_01930 gene pdxS 192637 193512 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_01930 193521 194096 gene locus_tag LOCUS_01940 gene pdxT 193521 194096 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_01940 194221 196533 gene locus_tag LOCUS_01950 gene pcrA 194221 196533 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068642.1 protein_id gnl|my_center|LOCUS_01950 196881 197456 gene locus_tag LOCUS_01960 gene thiW 196881 197456 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181409.1 protein_id gnl|my_center|LOCUS_01960 197460 198173 gene locus_tag LOCUS_01970 197460 198173 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_01970 198157 198807 gene locus_tag LOCUS_01980 198157 198807 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922263.1 protein_id gnl|my_center|LOCUS_01980 198808 199488 gene locus_tag LOCUS_01990 gene tenA 198808 199488 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910184.1 protein_id gnl|my_center|LOCUS_01990 199481 200278 gene locus_tag LOCUS_02000 gene thiD 199481 200278 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922264.1 protein_id gnl|my_center|LOCUS_02000 200279 201073 gene locus_tag LOCUS_02010 gene thiM 200279 201073 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922265.1 protein_id gnl|my_center|LOCUS_02010 201066 201698 gene locus_tag LOCUS_02020 gene thiE 201066 201698 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922792.1 protein_id gnl|my_center|LOCUS_02020 201811 203091 gene locus_tag LOCUS_02030 201811 203091 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 protein_id gnl|my_center|LOCUS_02030 203322 204023 gene locus_tag LOCUS_02040 203322 204023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262181.1 protein_id gnl|my_center|LOCUS_02040 204034 206670 gene locus_tag LOCUS_02050 204034 206670 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262182.1 protein_id gnl|my_center|LOCUS_02050 206774 207370 gene locus_tag LOCUS_02060 206774 207370 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135934.1 protein_id gnl|my_center|LOCUS_02060 207490 208842 gene locus_tag LOCUS_02070 207490 208842 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922363.1 protein_id gnl|my_center|LOCUS_02070 208931 209170 gene locus_tag LOCUS_02080 208931 209170 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262193.1 protein_id gnl|my_center|LOCUS_02080 209163 210524 gene locus_tag LOCUS_02090 209163 210524 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289298.1 protein_id gnl|my_center|LOCUS_02090 210600 211478 gene locus_tag LOCUS_02100 gene truB 210600 211478 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262200.1 protein_id gnl|my_center|LOCUS_02100 211492 212424 gene locus_tag LOCUS_02110 211492 212424 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262201.1 protein_id gnl|my_center|LOCUS_02110 212467 212871 gene locus_tag LOCUS_02120 gene spx 212467 212871 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263835.1 protein_id gnl|my_center|LOCUS_02120 212941 213216 gene locus_tag LOCUS_02130 212941 213216 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625903.1 protein_id gnl|my_center|LOCUS_02130 213206 213970 gene locus_tag LOCUS_02140 213206 213970 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338948.1 protein_id gnl|my_center|LOCUS_02140 214072 214896 gene locus_tag LOCUS_02150 gene tmpA 214072 214896 CDS product ZIP family manganese transporter TmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904720.1 protein_id gnl|my_center|LOCUS_02150 215005 215319 gene locus_tag LOCUS_02160 215005 215319 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_02160 215333 215665 gene locus_tag LOCUS_02170 215333 215665 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027860.1 protein_id gnl|my_center|LOCUS_02170 215679 217034 gene locus_tag LOCUS_02180 gene gorA 215679 217034 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261988.1 protein_id gnl|my_center|LOCUS_02180 217176 218486 gene locus_tag LOCUS_02190 217176 218486 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775401.1 protein_id gnl|my_center|LOCUS_02190 218619 219485 gene locus_tag LOCUS_02200 218619 219485 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265494.1 protein_id gnl|my_center|LOCUS_02200 219496 220413 gene locus_tag LOCUS_02210 gene pstC 219496 220413 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795716.1 protein_id gnl|my_center|LOCUS_02210 220403 221290 gene locus_tag LOCUS_02220 gene pstA 220403 221290 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262208.1 protein_id gnl|my_center|LOCUS_02220 221301 222104 gene locus_tag LOCUS_02230 gene pstB 221301 222104 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262209.1 protein_id gnl|my_center|LOCUS_02230 222116 222874 gene locus_tag LOCUS_02240 gene pstB 222116 222874 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775587.1 protein_id gnl|my_center|LOCUS_02240 222906 223559 gene locus_tag LOCUS_02250 gene phoU 222906 223559 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922357.1 protein_id gnl|my_center|LOCUS_02250 223768 226311 gene locus_tag LOCUS_02260 223768 226311 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262212.1 protein_id gnl|my_center|LOCUS_02260 226465 227139 gene locus_tag LOCUS_02270 gene ciaR 226465 227139 CDS product three-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262214.1 protein_id gnl|my_center|LOCUS_02270 227324 228454 gene locus_tag LOCUS_02280 gene ciaH 227324 228454 CDS product three-component system sensor histidine kinase CiaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262215.1 protein_id gnl|my_center|LOCUS_02280 228774 228538 gene locus_tag LOCUS_02290 gene rpsT 228774 228538 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935285.1 protein_id gnl|my_center|LOCUS_02290 229785 228865 gene locus_tag LOCUS_02300 gene coaA 229785 228865 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058331.1 protein_id gnl|my_center|LOCUS_02300 229908 230489 gene locus_tag LOCUS_02310 229908 230489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 protein_id gnl|my_center|LOCUS_02310 230992 231657 gene locus_tag LOCUS_02320 gene deoC 230992 231657 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_02320 231846 232901 gene locus_tag LOCUS_02330 231846 232901 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034779.1 protein_id gnl|my_center|LOCUS_02330 233047 234591 gene locus_tag LOCUS_02340 233047 234591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897687.1 protein_id gnl|my_center|LOCUS_02340 234578 235636 gene locus_tag LOCUS_02350 234578 235636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036988.1 protein_id gnl|my_center|LOCUS_02350 235638 236594 gene locus_tag LOCUS_02360 235638 236594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029122.1 protein_id gnl|my_center|LOCUS_02360 236697 238064 gene locus_tag LOCUS_02370 236697 238064 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989788.1 protein_id gnl|my_center|LOCUS_02370 239118 238129 gene locus_tag LOCUS_02380 239118 238129 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262228.1 protein_id gnl|my_center|LOCUS_02380 239392 241845 gene locus_tag LOCUS_02390 gene gyrA 239392 241845 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152975.1 protein_id gnl|my_center|LOCUS_02390 241853 242599 gene locus_tag LOCUS_02400 241853 242599 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244681.1 protein_id gnl|my_center|LOCUS_02400 242676 243089 gene locus_tag LOCUS_02410 242676 243089 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767937.1 protein_id gnl|my_center|LOCUS_02410 243169 244137 gene locus_tag LOCUS_02420 243169 244137 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289313.1 protein_id gnl|my_center|LOCUS_02420 244326 245585 gene locus_tag LOCUS_02430 244326 245585 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_02430 247468 245753 gene locus_tag LOCUS_02440 247468 245753 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262263.1 protein_id gnl|my_center|LOCUS_02440 248258 247686 gene locus_tag LOCUS_02450 248258 247686 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935390.1 protein_id gnl|my_center|LOCUS_02450 248902 248363 gene locus_tag LOCUS_02460 gene coaC 248902 248363 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595814.1 protein_id gnl|my_center|LOCUS_02460 249581 248895 gene locus_tag LOCUS_02470 249581 248895 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262266.1 protein_id gnl|my_center|LOCUS_02470 249927 251597 gene locus_tag LOCUS_02480 249927 251597 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775633.1 protein_id gnl|my_center|LOCUS_02480 251685 253301 gene locus_tag LOCUS_02490 gene cls 251685 253301 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638280.1 protein_id gnl|my_center|LOCUS_02490 253667 254743 gene locus_tag LOCUS_02500 253667 254743 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263802.1 protein_id gnl|my_center|LOCUS_02500 254830 255765 gene locus_tag LOCUS_02510 gene dapA 254830 255765 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935444.1 protein_id gnl|my_center|LOCUS_02510 257073 255808 gene locus_tag LOCUS_02520 257073 255808 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263804.1 protein_id gnl|my_center|LOCUS_02520 257211 258071 gene locus_tag LOCUS_02530 257211 258071 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028411.1 protein_id gnl|my_center|LOCUS_02530 258068 258625 gene locus_tag LOCUS_02540 258068 258625 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262822.1 protein_id gnl|my_center|LOCUS_02540 258785 260323 gene locus_tag LOCUS_02550 258785 260323 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025410.1 protein_id gnl|my_center|LOCUS_02550 260653 260976 gene locus_tag LOCUS_02560 260653 260976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568093.1 protein_id gnl|my_center|LOCUS_02560 260966 261154 gene locus_tag LOCUS_02570 260966 261154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 261592 261185 gene locus_tag LOCUS_02580 261592 261185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 261807 262661 gene locus_tag LOCUS_02590 gene ylqF 261807 262661 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201282.1 protein_id gnl|my_center|LOCUS_02590 262648 263427 gene locus_tag LOCUS_02600 262648 263427 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262858.1 protein_id gnl|my_center|LOCUS_02600 263427 263978 gene locus_tag LOCUS_02610 263427 263978 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136509.1 protein_id gnl|my_center|LOCUS_02610 264048 264890 gene locus_tag LOCUS_02620 gene dprA 264048 264890 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262865.1 protein_id gnl|my_center|LOCUS_02620 265109 267247 gene locus_tag LOCUS_02630 gene topA 265109 267247 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246611.1 protein_id gnl|my_center|LOCUS_02630 267388 268053 gene locus_tag LOCUS_02640 267388 268053 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989760.1 protein_id gnl|my_center|LOCUS_02640 268053 268775 gene locus_tag LOCUS_02650 268053 268775 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922318.1 protein_id gnl|my_center|LOCUS_02650 268961 270298 gene locus_tag LOCUS_02660 gene trmFO 268961 270298 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083750.1 protein_id gnl|my_center|LOCUS_02660 270326 271147 gene locus_tag LOCUS_02670 270326 271147 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641543.1 protein_id gnl|my_center|LOCUS_02670 271278 271397 gene locus_tag LOCUS_02680 271278 271397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 271583 272335 gene locus_tag LOCUS_02690 271583 272335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263239.1 protein_id gnl|my_center|LOCUS_02690 272337 274322 gene locus_tag LOCUS_02700 272337 274322 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499553.1 protein_id gnl|my_center|LOCUS_02700 274423 275085 gene locus_tag LOCUS_02710 274423 275085 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775103.1 protein_id gnl|my_center|LOCUS_02710 275082 276026 gene locus_tag LOCUS_02720 275082 276026 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263236.1 protein_id gnl|my_center|LOCUS_02720 277265 276195 gene locus_tag LOCUS_02730 gene xerS 277265 276195 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262304.1 protein_id gnl|my_center|LOCUS_02730 279198 277816 gene locus_tag LOCUS_02740 279198 277816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680630.1 protein_id gnl|my_center|LOCUS_02740 279718 279203 gene locus_tag LOCUS_02750 279718 279203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 280546 279959 gene locus_tag LOCUS_02760 280546 279959 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_02760 282289 280556 gene locus_tag LOCUS_02770 282289 280556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682080.1 protein_id gnl|my_center|LOCUS_02770 284025 282286 gene locus_tag LOCUS_02780 284025 282286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682081.1 protein_id gnl|my_center|LOCUS_02780 284196 285221 gene locus_tag LOCUS_02790 284196 285221 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943652.1 protein_id gnl|my_center|LOCUS_02790 285571 285260 gene locus_tag LOCUS_02800 285571 285260 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899314.1 protein_id gnl|my_center|LOCUS_02800 286337 285564 gene locus_tag LOCUS_02810 286337 285564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 287877 286327 gene locus_tag LOCUS_02820 287877 286327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 289555 287990 gene locus_tag LOCUS_02830 gene ffh 289555 287990 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863589.1 protein_id gnl|my_center|LOCUS_02830 289943 289602 gene locus_tag LOCUS_02840 289943 289602 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402066.1 protein_id gnl|my_center|LOCUS_02840 290768 290070 gene locus_tag LOCUS_02850 290768 290070 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936162.1 protein_id gnl|my_center|LOCUS_02850 292823 290877 gene locus_tag LOCUS_02860 292823 290877 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476430.1 protein_id gnl|my_center|LOCUS_02860 294949 292808 gene locus_tag LOCUS_02870 294949 292808 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963675.1 protein_id gnl|my_center|LOCUS_02870 299459 295071 gene locus_tag LOCUS_02880 299459 295071 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079793.1 protein_id gnl|my_center|LOCUS_02880 300141 299464 gene locus_tag LOCUS_02890 300141 299464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 300825 300466 gene locus_tag LOCUS_02900 300825 300466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567215.1 protein_id gnl|my_center|LOCUS_02900 302242 300827 gene locus_tag LOCUS_02910 302242 300827 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540278.1 protein_id gnl|my_center|LOCUS_02910 302446 302243 gene locus_tag LOCUS_02920 302446 302243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 303134 302448 gene locus_tag LOCUS_02930 303134 302448 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284674.1 protein_id gnl|my_center|LOCUS_02930 303856 303239 gene locus_tag LOCUS_02940 303856 303239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 304477 303863 gene locus_tag LOCUS_02950 304477 303863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 306146 304488 gene locus_tag LOCUS_02960 306146 304488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837107.1 protein_id gnl|my_center|LOCUS_02960 306501 306169 gene locus_tag LOCUS_02970 306501 306169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 306775 306503 gene locus_tag LOCUS_02980 306775 306503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 307252 306875 gene locus_tag LOCUS_02990 gene dhaM 307252 306875 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279899.1 protein_id gnl|my_center|LOCUS_02990 307835 307245 gene locus_tag LOCUS_03000 gene dhaL 307835 307245 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453282.1 protein_id gnl|my_center|LOCUS_03000 309303 307978 gene locus_tag LOCUS_03010 309303 307978 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_03010 310077 309442 gene locus_tag LOCUS_03020 310077 309442 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393633.1 protein_id gnl|my_center|LOCUS_03020 314614 310277 gene locus_tag LOCUS_03030 314614 310277 CDS product glycoside hydrolase family 70 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352262.1 protein_id gnl|my_center|LOCUS_03030 315565 314669 gene locus_tag LOCUS_03040 315565 314669 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911924.1 protein_id gnl|my_center|LOCUS_03040 316437 315766 gene locus_tag LOCUS_03050 316437 315766 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896485.1 protein_id gnl|my_center|LOCUS_03050 317278 316457 gene locus_tag LOCUS_03060 317278 316457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 318087 317347 gene locus_tag LOCUS_03070 318087 317347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 318882 318115 gene locus_tag LOCUS_03080 318882 318115 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890740.1 protein_id gnl|my_center|LOCUS_03080 319764 319027 gene locus_tag LOCUS_03090 319764 319027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_03090 320222 319761 gene locus_tag LOCUS_03100 320222 319761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 322204 320642 gene locus_tag LOCUS_03110 gene guaA 322204 320642 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129872.1 protein_id gnl|my_center|LOCUS_03110 322636 323106 gene locus_tag LOCUS_03120 322636 323106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 323218 324675 gene locus_tag LOCUS_03130 323218 324675 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836876.1 protein_id gnl|my_center|LOCUS_03130 326482 324746 gene locus_tag LOCUS_03140 326482 324746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647640.1 protein_id gnl|my_center|LOCUS_03140 328207 326486 gene locus_tag LOCUS_03150 328207 326486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826931.1 protein_id gnl|my_center|LOCUS_03150 328832 328230 gene locus_tag LOCUS_03160 328832 328230 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994981.1 protein_id gnl|my_center|LOCUS_03160 329809 328832 gene locus_tag LOCUS_03170 329809 328832 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 protein_id gnl|my_center|LOCUS_03170 331102 329852 gene locus_tag LOCUS_03180 331102 329852 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575546.1 protein_id gnl|my_center|LOCUS_03180 331805 331209 gene locus_tag LOCUS_03190 331805 331209 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998734.1 protein_id gnl|my_center|LOCUS_03190 332628 331798 gene locus_tag LOCUS_03200 gene prmC 332628 331798 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104948.1 protein_id gnl|my_center|LOCUS_03200 333707 332628 gene locus_tag LOCUS_03210 gene prfA 333707 332628 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262255.1 protein_id gnl|my_center|LOCUS_03210 334337 333747 gene locus_tag LOCUS_03220 334337 333747 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068109.1 protein_id gnl|my_center|LOCUS_03220 334879 335088 gene locus_tag LOCUS_03230 334879 335088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965216.1 protein_id gnl|my_center|LOCUS_03230 335185 335370 gene locus_tag LOCUS_03240 335185 335370 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262253.1 protein_id gnl|my_center|LOCUS_03240 335490 336425 gene locus_tag LOCUS_03250 335490 336425 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177182.1 protein_id gnl|my_center|LOCUS_03250 337754 336477 gene locus_tag LOCUS_03260 337754 336477 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671521.1 protein_id gnl|my_center|LOCUS_03260 338328 337747 gene locus_tag LOCUS_03270 338328 337747 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770389.1 protein_id gnl|my_center|LOCUS_03270 339694 338711 gene locus_tag LOCUS_03280 gene guaC 339694 338711 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775084.1 protein_id gnl|my_center|LOCUS_03280 340060 341610 gene locus_tag LOCUS_03290 340060 341610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262247.1 protein_id gnl|my_center|LOCUS_03290 341624 342280 gene locus_tag LOCUS_03300 341624 342280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262246.1 protein_id gnl|my_center|LOCUS_03300 343738 342320 gene locus_tag LOCUS_03310 343738 342320 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_03310 344740 343901 gene locus_tag LOCUS_03320 344740 343901 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_03320 345673 344918 gene locus_tag LOCUS_03330 345673 344918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009854121.1 protein_id gnl|my_center|LOCUS_03330 346732 345737 gene locus_tag LOCUS_03340 gene pta 346732 345737 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922296.1 protein_id gnl|my_center|LOCUS_03340 347640 346750 gene locus_tag LOCUS_03350 347640 346750 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262294.1 protein_id gnl|my_center|LOCUS_03350 348473 347637 gene locus_tag LOCUS_03360 348473 347637 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192910.1 protein_id gnl|my_center|LOCUS_03360 349113 348448 gene locus_tag LOCUS_03370 349113 348448 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061344.1 protein_id gnl|my_center|LOCUS_03370 349251 349820 gene locus_tag LOCUS_03380 349251 349820 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149079.1 protein_id gnl|my_center|LOCUS_03380 349906 350877 gene locus_tag LOCUS_03390 349906 350877 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840698.1 protein_id gnl|my_center|LOCUS_03390 350883 351998 gene locus_tag LOCUS_03400 350883 351998 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639605.1 protein_id gnl|my_center|LOCUS_03400 352000 352347 gene locus_tag LOCUS_03410 352000 352347 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863500.1 protein_id gnl|my_center|LOCUS_03410 352477 353118 gene locus_tag LOCUS_03420 352477 353118 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361440.1 protein_id gnl|my_center|LOCUS_03420 353873 353193 gene locus_tag LOCUS_03430 gene radC 353873 353193 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274751.1 protein_id gnl|my_center|LOCUS_03430 355044 353929 gene locus_tag LOCUS_03440 355044 353929 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_03440 355721 355119 gene locus_tag LOCUS_03450 355721 355119 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262237.1 protein_id gnl|my_center|LOCUS_03450 356356 355736 gene locus_tag LOCUS_03460 356356 355736 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262236.1 protein_id gnl|my_center|LOCUS_03460 357874 356411 gene locus_tag LOCUS_03470 357874 356411 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_03470 358252 359580 gene locus_tag LOCUS_03480 358252 359580 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_03480 359756 360952 gene locus_tag LOCUS_03490 359756 360952 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235899.1 protein_id gnl|my_center|LOCUS_03490 361869 361027 gene locus_tag LOCUS_03500 361869 361027 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262172.1 protein_id gnl|my_center|LOCUS_03500 362522 361893 gene locus_tag LOCUS_03510 362522 361893 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891276.1 protein_id gnl|my_center|LOCUS_03510 363175 362534 gene locus_tag LOCUS_03520 363175 362534 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992417.1 protein_id gnl|my_center|LOCUS_03520 363690 363355 gene locus_tag LOCUS_03530 363690 363355 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056777.1 protein_id gnl|my_center|LOCUS_03530 365605 363791 gene locus_tag LOCUS_03540 gene glmS 365605 363791 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775016.1 protein_id gnl|my_center|LOCUS_03540 366360 365803 gene locus_tag LOCUS_03550 gene lepB 366360 365803 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240773.1 protein_id gnl|my_center|LOCUS_03550 368061 366559 gene locus_tag LOCUS_03560 gene pyk 368061 366559 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042781.1 protein_id gnl|my_center|LOCUS_03560 369157 368141 gene locus_tag LOCUS_03570 gene pfkA 369157 368141 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262160.1 protein_id gnl|my_center|LOCUS_03570 372355 369248 gene locus_tag LOCUS_03580 372355 369248 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262159.1 protein_id gnl|my_center|LOCUS_03580 372538 372906 gene locus_tag LOCUS_03590 372538 372906 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922377.1 protein_id gnl|my_center|LOCUS_03590 372908 373606 gene locus_tag LOCUS_03600 372908 373606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_03600 373615 374382 gene locus_tag LOCUS_03610 373615 374382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922378.1 protein_id gnl|my_center|LOCUS_03610 374999 374652 gene locus_tag LOCUS_tm00010 374999 374652 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 375456 375277 gene locus_tag LOCUS_03620 375456 375277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 375925 376305 gene locus_tag LOCUS_03630 375925 376305 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_03630 376298 376993 gene locus_tag LOCUS_03640 376298 376993 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636215.1 protein_id gnl|my_center|LOCUS_03640 377254 377183 gene locus_tag LOCUS_t00030 377254 377183 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 378522 377326 gene locus_tag LOCUS_03650 gene rpsA 378522 377326 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001614.1 protein_id gnl|my_center|LOCUS_03650 378722 378648 gene locus_tag LOCUS_t00040 378722 378648 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 378842 378762 gene locus_tag LOCUS_t00050 378842 378762 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 379134 378904 gene locus_tag LOCUS_03660 379134 378904 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984906.1 protein_id gnl|my_center|LOCUS_03660 380221 379199 gene locus_tag LOCUS_03670 380221 379199 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263260.1 protein_id gnl|my_center|LOCUS_03670 382983 380524 gene locus_tag LOCUS_03680 gene parC 382983 380524 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352284.1 protein_id gnl|my_center|LOCUS_03680 385072 383123 gene locus_tag LOCUS_03690 gene parE 385072 383123 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263267.1 protein_id gnl|my_center|LOCUS_03690 385295 385942 gene locus_tag LOCUS_03700 gene plsY 385295 385942 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984911.1 protein_id gnl|my_center|LOCUS_03700 387241 385973 gene locus_tag LOCUS_03710 387241 385973 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922183.1 protein_id gnl|my_center|LOCUS_03710 387907 387254 gene locus_tag LOCUS_03720 387907 387254 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682955.1 protein_id gnl|my_center|LOCUS_03720 388426 387926 gene locus_tag LOCUS_03730 388426 387926 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_03730 389128 388499 gene locus_tag LOCUS_03740 gene pyrE 389128 388499 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263221.1 protein_id gnl|my_center|LOCUS_03740 389875 389183 gene locus_tag LOCUS_03750 gene pyrF 389875 389183 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263220.1 protein_id gnl|my_center|LOCUS_03750 391042 390095 gene locus_tag LOCUS_03760 391042 390095 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263219.1 protein_id gnl|my_center|LOCUS_03760 391852 391052 gene locus_tag LOCUS_03770 391852 391052 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_03770 393606 392083 gene locus_tag LOCUS_03780 393606 392083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 394676 393822 gene locus_tag LOCUS_03790 gene rfbD 394676 393822 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261974.1 protein_id gnl|my_center|LOCUS_03790 396499 395108 gene locus_tag LOCUS_03800 396499 395108 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_03800 397352 396510 gene locus_tag LOCUS_03810 397352 396510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838868.1 protein_id gnl|my_center|LOCUS_03810 399071 397356 gene locus_tag LOCUS_03820 399071 397356 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068374.1 protein_id gnl|my_center|LOCUS_03820 400213 399068 gene locus_tag LOCUS_03830 400213 399068 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068376.1 protein_id gnl|my_center|LOCUS_03830 401252 400188 gene locus_tag LOCUS_03840 401252 400188 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476092.1 protein_id gnl|my_center|LOCUS_03840 402273 401266 gene locus_tag LOCUS_03850 402273 401266 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 protein_id gnl|my_center|LOCUS_03850 403343 402294 gene locus_tag LOCUS_03860 403343 402294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 404514 403387 gene locus_tag LOCUS_03870 404514 403387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 405406 404525 gene locus_tag LOCUS_03880 405406 404525 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_03880 405983 405414 gene locus_tag LOCUS_03890 405983 405414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 407073 405970 gene locus_tag LOCUS_03900 407073 405970 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_03900 408208 407075 gene locus_tag LOCUS_03910 408208 407075 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261146.1 protein_id gnl|my_center|LOCUS_03910 409630 408257 gene locus_tag LOCUS_03920 409630 408257 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_03920 410448 409696 gene locus_tag LOCUS_03930 410448 409696 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197405.1 protein_id gnl|my_center|LOCUS_03930 411152 410463 gene locus_tag LOCUS_03940 411152 410463 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894051.1 protein_id gnl|my_center|LOCUS_03940 411892 411161 gene locus_tag LOCUS_03950 411892 411161 CDS product tyrosine-protein phosphatase CpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565383.1 protein_id gnl|my_center|LOCUS_03950 413043 411898 gene locus_tag LOCUS_03960 413043 411898 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_03960 413042 413233 gene locus_tag LOCUS_03970 413042 413233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 413921 414775 gene locus_tag LOCUS_03980 413921 414775 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_03980 415528 414821 gene locus_tag LOCUS_03990 gene deoD 415528 414821 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352302.1 protein_id gnl|my_center|LOCUS_03990 416711 415485 gene locus_tag LOCUS_04000 416711 415485 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254652.1 protein_id gnl|my_center|LOCUS_04000 417626 416814 gene locus_tag LOCUS_04010 417626 416814 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263213.1 protein_id gnl|my_center|LOCUS_04010 418847 417636 gene locus_tag LOCUS_04020 418847 417636 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263210.1 protein_id gnl|my_center|LOCUS_04020 419656 418982 gene locus_tag LOCUS_04030 gene rpiA 419656 418982 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 protein_id gnl|my_center|LOCUS_04030 419847 420746 gene locus_tag LOCUS_04040 419847 420746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 420957 422330 gene locus_tag LOCUS_04050 gene mnmE 420957 422330 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028893.1 protein_id gnl|my_center|LOCUS_04050 422948 422364 gene locus_tag LOCUS_04060 422948 422364 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263204.1 protein_id gnl|my_center|LOCUS_04060 424423 423017 gene locus_tag LOCUS_04070 gene pepV 424423 423017 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922267.1 protein_id gnl|my_center|LOCUS_04070 425189 424587 gene locus_tag LOCUS_04080 425189 424587 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989923.1 protein_id gnl|my_center|LOCUS_04080 427041 425311 gene locus_tag LOCUS_04090 427041 425311 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775361.1 protein_id gnl|my_center|LOCUS_04090 428112 427156 gene locus_tag LOCUS_04100 428112 427156 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263532.1 protein_id gnl|my_center|LOCUS_04100 428511 428137 gene locus_tag LOCUS_04110 428511 428137 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 protein_id gnl|my_center|LOCUS_04110 430294 428498 gene locus_tag LOCUS_04120 gene uvrC 430294 428498 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263201.1 protein_id gnl|my_center|LOCUS_04120 431557 430532 gene locus_tag LOCUS_04130 431557 430532 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_04130 431664 432530 gene locus_tag LOCUS_04140 431664 432530 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_04140 432611 433282 gene locus_tag LOCUS_04150 432611 433282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 433661 433332 gene locus_tag LOCUS_04160 433661 433332 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367385.1 protein_id gnl|my_center|LOCUS_04160 434418 433732 gene locus_tag LOCUS_04170 434418 433732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906419.1 protein_id gnl|my_center|LOCUS_04170 435479 434427 gene locus_tag LOCUS_04180 435479 434427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379839.1 protein_id gnl|my_center|LOCUS_04180 436131 435631 gene locus_tag LOCUS_04190 436131 435631 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263336.1 protein_id gnl|my_center|LOCUS_04190 437108 436212 gene locus_tag LOCUS_04200 437108 436212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775092.1 protein_id gnl|my_center|LOCUS_04200 437616 437191 gene locus_tag LOCUS_04210 437616 437191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04210 437963 437640 gene locus_tag LOCUS_04220 437963 437640 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263342.1 protein_id gnl|my_center|LOCUS_04220 438917 438072 gene locus_tag LOCUS_04230 438917 438072 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_04230 439321 438929 gene locus_tag LOCUS_04240 439321 438929 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263345.1 protein_id gnl|my_center|LOCUS_04240 440595 439408 gene locus_tag LOCUS_04250 440595 439408 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065321.1 protein_id gnl|my_center|LOCUS_04250 443462 440673 gene locus_tag LOCUS_04260 443462 440673 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168898.1 protein_id gnl|my_center|LOCUS_04260 444112 443624 gene locus_tag LOCUS_04270 444112 443624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386980.1 protein_id gnl|my_center|LOCUS_04270 444807 444340 gene locus_tag LOCUS_04280 444807 444340 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_04280 445518 444868 gene locus_tag LOCUS_04290 445518 444868 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180008.1 protein_id gnl|my_center|LOCUS_04290 445880 445581 gene locus_tag LOCUS_04300 445880 445581 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 protein_id gnl|my_center|LOCUS_04300 447528 445873 gene locus_tag LOCUS_04310 447528 445873 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 protein_id gnl|my_center|LOCUS_04310 447824 447525 gene locus_tag LOCUS_04320 447824 447525 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775130.1 protein_id gnl|my_center|LOCUS_04320 447992 448252 gene locus_tag LOCUS_04330 447992 448252 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909865.1 protein_id gnl|my_center|LOCUS_04330 448349 449131 gene locus_tag LOCUS_04340 448349 449131 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_04340 450180 449209 gene locus_tag LOCUS_04350 450180 449209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_04350 451508 450348 gene locus_tag LOCUS_04360 451508 450348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_04360 453017 451653 gene locus_tag LOCUS_04370 453017 451653 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_04370 453663 453148 gene locus_tag LOCUS_04380 453663 453148 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_04380 454075 453728 gene locus_tag LOCUS_04390 454075 453728 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307336.1 protein_id gnl|my_center|LOCUS_04390 454529 454077 gene locus_tag LOCUS_04400 454529 454077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 455699 454533 gene locus_tag LOCUS_04410 455699 454533 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_04410 456551 455703 gene locus_tag LOCUS_04420 456551 455703 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_04420 456736 457605 gene locus_tag LOCUS_04430 456736 457605 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287470.1 protein_id gnl|my_center|LOCUS_04430 458105 458683 gene locus_tag LOCUS_04440 458105 458683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 459718 458729 gene locus_tag LOCUS_04450 459718 458729 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992006.1 protein_id gnl|my_center|LOCUS_04450 461195 459789 gene locus_tag LOCUS_04460 461195 459789 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459583.1 protein_id gnl|my_center|LOCUS_04460 461290 462183 gene locus_tag LOCUS_04470 461290 462183 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_04470 463998 462268 gene locus_tag LOCUS_04480 gene lpdA 463998 462268 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922240.1 protein_id gnl|my_center|LOCUS_04480 465096 464026 gene locus_tag LOCUS_04490 465096 464026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 466112 465108 gene locus_tag LOCUS_04500 466112 465108 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989981.1 protein_id gnl|my_center|LOCUS_04500 467109 466144 gene locus_tag LOCUS_04510 467109 466144 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922238.1 protein_id gnl|my_center|LOCUS_04510 467663 467247 gene locus_tag LOCUS_04520 467663 467247 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379393.1 protein_id gnl|my_center|LOCUS_04520 469670 467793 gene locus_tag LOCUS_04530 469670 467793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_04530 471421 469670 gene locus_tag LOCUS_04540 471421 469670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_04540 471860 471414 gene locus_tag LOCUS_04550 471860 471414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 473379 472087 gene locus_tag LOCUS_04560 473379 472087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024508.1 protein_id gnl|my_center|LOCUS_04560 474233 473376 gene locus_tag LOCUS_04570 474233 473376 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477654.1 protein_id gnl|my_center|LOCUS_04570 476198 474279 gene locus_tag LOCUS_04580 476198 474279 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263109.1 protein_id gnl|my_center|LOCUS_04580 477000 476287 gene locus_tag LOCUS_04590 477000 476287 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263103.1 protein_id gnl|my_center|LOCUS_04590 478784 477123 gene locus_tag LOCUS_04600 478784 477123 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280077.1 protein_id gnl|my_center|LOCUS_04600 479745 478987 gene locus_tag LOCUS_04610 479745 478987 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245086.1 protein_id gnl|my_center|LOCUS_04610 480611 479742 gene locus_tag LOCUS_04620 480611 479742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587303.1 protein_id gnl|my_center|LOCUS_04620 481631 480630 gene locus_tag LOCUS_04630 gene trpX 481631 480630 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790865.1 protein_id gnl|my_center|LOCUS_04630 483602 481980 gene locus_tag LOCUS_04640 483602 481980 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227487.1 protein_id gnl|my_center|LOCUS_04640 484557 483592 gene locus_tag LOCUS_04650 484557 483592 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_04650 485620 484535 gene locus_tag LOCUS_04660 gene hisC 485620 484535 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837142.1 protein_id gnl|my_center|LOCUS_04660 486520 485684 gene locus_tag LOCUS_04670 486520 485684 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_04670 488086 486533 gene locus_tag LOCUS_04680 488086 486533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 488880 488107 gene locus_tag LOCUS_04690 488880 488107 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 protein_id gnl|my_center|LOCUS_04690 489063 489923 gene locus_tag LOCUS_04700 489063 489923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 490065 491732 gene locus_tag LOCUS_04710 490065 491732 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006730.1 protein_id gnl|my_center|LOCUS_04710 493167 491758 gene locus_tag LOCUS_04720 493167 491758 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775636.1 protein_id gnl|my_center|LOCUS_04720 494102 493383 gene locus_tag LOCUS_04730 gene budA 494102 493383 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360301.1 protein_id gnl|my_center|LOCUS_04730 495852 494179 gene locus_tag LOCUS_04740 gene alsS 495852 494179 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140344.1 protein_id gnl|my_center|LOCUS_04740 496289 496107 gene locus_tag LOCUS_04750 496289 496107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 497508 496273 gene locus_tag LOCUS_04760 497508 496273 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922231.1 protein_id gnl|my_center|LOCUS_04760 498685 497498 gene locus_tag LOCUS_04770 498685 497498 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990002.1 protein_id gnl|my_center|LOCUS_04770 499207 498722 gene locus_tag LOCUS_04780 499207 498722 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163512.1 protein_id gnl|my_center|LOCUS_04780 499781 499527 gene locus_tag LOCUS_04790 499781 499527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04790 >Feature sequence02 870 1505 gene locus_tag LOCUS_04800 870 1505 CDS product DUF443 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006145684.1 protein_id gnl|my_center|LOCUS_04800 1522 1818 gene locus_tag LOCUS_04810 1522 1818 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899314.1 protein_id gnl|my_center|LOCUS_04810 1934 2176 gene locus_tag LOCUS_04820 1934 2176 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028863.1 protein_id gnl|my_center|LOCUS_04820 2366 3175 gene locus_tag LOCUS_04830 gene racE 2366 3175 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262556.1 protein_id gnl|my_center|LOCUS_04830 3193 4209 gene locus_tag LOCUS_04840 3193 4209 CDS product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921915.1 protein_id gnl|my_center|LOCUS_04840 4215 4712 gene locus_tag LOCUS_04850 4215 4712 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007722.1 protein_id gnl|my_center|LOCUS_04850 4709 5176 gene locus_tag LOCUS_04860 4709 5176 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985900.1 protein_id gnl|my_center|LOCUS_04860 5169 5909 gene locus_tag LOCUS_04870 gene xerD 5169 5909 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262560.1 protein_id gnl|my_center|LOCUS_04870 5909 6613 gene locus_tag LOCUS_04880 5909 6613 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351869.1 protein_id gnl|my_center|LOCUS_04880 6662 7258 gene locus_tag LOCUS_04890 gene scpB 6662 7258 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985894.1 protein_id gnl|my_center|LOCUS_04890 7289 8014 gene locus_tag LOCUS_04900 7289 8014 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222207.1 protein_id gnl|my_center|LOCUS_04900 8113 8274 gene locus_tag LOCUS_04910 8113 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9734 8295 gene locus_tag LOCUS_04920 9734 8295 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262565.1 protein_id gnl|my_center|LOCUS_04920 11087 9738 gene locus_tag LOCUS_04930 gene trkA 11087 9738 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262566.1 protein_id gnl|my_center|LOCUS_04930 11291 13138 gene locus_tag LOCUS_04940 11291 13138 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045634338.1 protein_id gnl|my_center|LOCUS_04940 13431 13976 gene locus_tag LOCUS_04950 13431 13976 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019793.1 protein_id gnl|my_center|LOCUS_04950 14344 14910 gene locus_tag LOCUS_04960 14344 14910 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185820.1 protein_id gnl|my_center|LOCUS_04960 15028 15699 gene locus_tag LOCUS_04970 15028 15699 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263906.1 protein_id gnl|my_center|LOCUS_04970 15782 16717 gene locus_tag LOCUS_04980 15782 16717 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262575.1 protein_id gnl|my_center|LOCUS_04980 16714 17262 gene locus_tag LOCUS_04990 16714 17262 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262576.1 protein_id gnl|my_center|LOCUS_04990 18087 17305 gene locus_tag LOCUS_05000 18087 17305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262577.1 protein_id gnl|my_center|LOCUS_05000 18278 20194 gene locus_tag LOCUS_05010 18278 20194 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_05010 20367 21698 gene locus_tag LOCUS_05020 20367 21698 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153940.1 protein_id gnl|my_center|LOCUS_05020 21773 22561 gene locus_tag LOCUS_05030 gene pflA 21773 22561 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 protein_id gnl|my_center|LOCUS_05030 22622 23239 gene locus_tag LOCUS_05040 22622 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 23392 24324 gene locus_tag LOCUS_05050 23392 24324 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036041.1 protein_id gnl|my_center|LOCUS_05050 24403 24543 gene locus_tag LOCUS_05060 24403 24543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 25314 24583 gene locus_tag LOCUS_05070 gene yaaA 25314 24583 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775019.1 protein_id gnl|my_center|LOCUS_05070 25415 25930 gene locus_tag LOCUS_05080 25415 25930 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837328.1 protein_id gnl|my_center|LOCUS_05080 25923 26579 gene locus_tag LOCUS_05090 25923 26579 CDS product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262587.1 protein_id gnl|my_center|LOCUS_05090 27563 26757 gene locus_tag LOCUS_05100 27563 26757 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615138.1 protein_id gnl|my_center|LOCUS_05100 27445 27744 gene locus_tag LOCUS_05110 27445 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 28774 27755 gene locus_tag LOCUS_05120 28774 27755 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775037.1 protein_id gnl|my_center|LOCUS_05120 29736 28804 gene locus_tag LOCUS_05130 29736 28804 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775038.1 protein_id gnl|my_center|LOCUS_05130 30543 29761 gene locus_tag LOCUS_05140 30543 29761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018231.1 protein_id gnl|my_center|LOCUS_05140 32169 30718 gene locus_tag LOCUS_05150 32169 30718 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921928.1 protein_id gnl|my_center|LOCUS_05150 32266 33900 gene locus_tag LOCUS_05160 32266 33900 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264036.1 protein_id gnl|my_center|LOCUS_05160 34114 35208 gene locus_tag LOCUS_05170 34114 35208 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262596.1 protein_id gnl|my_center|LOCUS_05170 35192 36376 gene locus_tag LOCUS_05180 35192 36376 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352351.1 protein_id gnl|my_center|LOCUS_05180 36536 37165 gene locus_tag LOCUS_05190 gene upp 36536 37165 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514490.1 protein_id gnl|my_center|LOCUS_05190 38098 37229 gene locus_tag LOCUS_05200 38098 37229 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156743.1 protein_id gnl|my_center|LOCUS_05200 38212 39105 gene locus_tag LOCUS_05210 38212 39105 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_05210 39182 39772 gene locus_tag LOCUS_05220 gene clpP 39182 39772 CDS product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613465.1 protein_id gnl|my_center|LOCUS_05220 39878 40315 gene locus_tag LOCUS_05230 39878 40315 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262673.1 protein_id gnl|my_center|LOCUS_05230 40308 40559 gene locus_tag LOCUS_05240 40308 40559 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262674.1 protein_id gnl|my_center|LOCUS_05240 40656 41834 gene locus_tag LOCUS_05250 40656 41834 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 protein_id gnl|my_center|LOCUS_05250 41892 42776 gene locus_tag LOCUS_05260 41892 42776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941427.1 protein_id gnl|my_center|LOCUS_05260 42780 43733 gene locus_tag LOCUS_05270 42780 43733 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262677.1 protein_id gnl|my_center|LOCUS_05270 43733 44497 gene locus_tag LOCUS_05280 43733 44497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_05280 44497 45207 gene locus_tag LOCUS_05290 44497 45207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 protein_id gnl|my_center|LOCUS_05290 45315 45974 gene locus_tag LOCUS_05300 45315 45974 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268654.1 protein_id gnl|my_center|LOCUS_05300 46064 46696 gene locus_tag LOCUS_05310 gene tmk 46064 46696 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715592.1 protein_id gnl|my_center|LOCUS_05310 46710 47585 gene locus_tag LOCUS_05320 46710 47585 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262682.1 protein_id gnl|my_center|LOCUS_05320 47582 48382 gene locus_tag LOCUS_05330 gene ricT 47582 48382 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262683.1 protein_id gnl|my_center|LOCUS_05330 48375 48695 gene locus_tag LOCUS_05340 gene yabA 48375 48695 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985838.1 protein_id gnl|my_center|LOCUS_05340 48705 49571 gene locus_tag LOCUS_05350 gene rsmI 48705 49571 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935362.1 protein_id gnl|my_center|LOCUS_05350 49893 51128 gene locus_tag LOCUS_05360 49893 51128 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_05360 51160 51501 gene locus_tag LOCUS_05370 51160 51501 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262687.1 protein_id gnl|my_center|LOCUS_05370 52245 51616 gene locus_tag LOCUS_05380 52245 51616 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603277.1 protein_id gnl|my_center|LOCUS_05380 52381 53472 gene locus_tag LOCUS_05390 gene serC 52381 53472 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262688.1 protein_id gnl|my_center|LOCUS_05390 53568 54746 gene locus_tag LOCUS_05400 53568 54746 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262691.1 protein_id gnl|my_center|LOCUS_05400 54834 55190 gene locus_tag LOCUS_05410 54834 55190 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014407341.1 protein_id gnl|my_center|LOCUS_05410 56058 55231 gene locus_tag LOCUS_05420 56058 55231 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767464.1 protein_id gnl|my_center|LOCUS_05420 56239 56520 gene locus_tag LOCUS_05430 56239 56520 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_05430 56507 57145 gene locus_tag LOCUS_05440 56507 57145 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_05440 57225 58886 gene locus_tag LOCUS_05450 57225 58886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922207.1 protein_id gnl|my_center|LOCUS_05450 59037 61037 gene locus_tag LOCUS_05460 gene metG 59037 61037 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263617.1 protein_id gnl|my_center|LOCUS_05460 61240 62472 gene locus_tag LOCUS_05470 61240 62472 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185391.1 protein_id gnl|my_center|LOCUS_05470 62616 62945 gene locus_tag LOCUS_05480 62616 62945 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027520.1 protein_id gnl|my_center|LOCUS_05480 62938 63765 gene locus_tag LOCUS_05490 62938 63765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 63837 64073 gene locus_tag LOCUS_05500 63837 64073 CDS product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874474.1 protein_id gnl|my_center|LOCUS_05500 64066 64764 gene locus_tag LOCUS_05510 64066 64764 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921951.1 protein_id gnl|my_center|LOCUS_05510 64866 65309 gene locus_tag LOCUS_05520 64866 65309 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611364.1 protein_id gnl|my_center|LOCUS_05520 65392 66354 gene locus_tag LOCUS_05530 65392 66354 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_05530 66483 67868 gene locus_tag LOCUS_05540 gene glmU 66483 67868 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263614.1 protein_id gnl|my_center|LOCUS_05540 68019 68567 gene locus_tag LOCUS_05550 68019 68567 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921955.1 protein_id gnl|my_center|LOCUS_05550 68569 68895 gene locus_tag LOCUS_05560 gene macP 68569 68895 CDS product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517852.1 protein_id gnl|my_center|LOCUS_05560 68957 69649 gene locus_tag LOCUS_05570 68957 69649 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689757.1 protein_id gnl|my_center|LOCUS_05570 70340 69687 gene locus_tag LOCUS_05580 70340 69687 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188485.1 protein_id gnl|my_center|LOCUS_05580 71267 70464 gene locus_tag LOCUS_05590 71267 70464 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921960.1 protein_id gnl|my_center|LOCUS_05590 71370 73772 gene locus_tag LOCUS_05600 71370 73772 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231579.1 protein_id gnl|my_center|LOCUS_05600 74437 74862 gene locus_tag LOCUS_05610 gene rplK 74437 74862 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990800.1 protein_id gnl|my_center|LOCUS_05610 75018 75707 gene locus_tag LOCUS_05620 gene rplA 75018 75707 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985768.1 protein_id gnl|my_center|LOCUS_05620 75912 76649 gene locus_tag LOCUS_05630 gene pyrH 75912 76649 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985765.1 protein_id gnl|my_center|LOCUS_05630 76702 77259 gene locus_tag LOCUS_05640 gene frr 76702 77259 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262766.1 protein_id gnl|my_center|LOCUS_05640 77313 78179 gene locus_tag LOCUS_05650 77313 78179 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262767.1 protein_id gnl|my_center|LOCUS_05650 78340 78849 gene locus_tag LOCUS_05660 gene msrA 78340 78849 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921964.1 protein_id gnl|my_center|LOCUS_05660 78846 79061 gene locus_tag LOCUS_05670 78846 79061 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262769.1 protein_id gnl|my_center|LOCUS_05670 79167 80231 gene locus_tag LOCUS_05680 79167 80231 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262770.1 protein_id gnl|my_center|LOCUS_05680 80423 80653 gene locus_tag LOCUS_05690 80423 80653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 80723 81253 gene locus_tag LOCUS_05700 80723 81253 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443760.1 protein_id gnl|my_center|LOCUS_05700 81545 83773 gene locus_tag LOCUS_05710 gene amyE 81545 83773 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234692.1 protein_id gnl|my_center|LOCUS_05710 83933 84430 gene locus_tag LOCUS_05720 gene ybeY 83933 84430 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001867191.1 protein_id gnl|my_center|LOCUS_05720 84471 84821 gene locus_tag LOCUS_05730 gene dagK 84471 84821 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365219.1 protein_id gnl|my_center|LOCUS_05730 84878 85774 gene locus_tag LOCUS_05740 gene era 84878 85774 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143288.1 protein_id gnl|my_center|LOCUS_05740 86148 86969 gene locus_tag LOCUS_05750 gene mutM 86148 86969 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262776.1 protein_id gnl|my_center|LOCUS_05750 86966 87553 gene locus_tag LOCUS_05760 gene coaE 86966 87553 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930246.1 protein_id gnl|my_center|LOCUS_05760 87713 88888 gene locus_tag LOCUS_05770 87713 88888 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312381.1 protein_id gnl|my_center|LOCUS_05770 89149 89385 gene locus_tag LOCUS_05780 89149 89385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 89621 91966 gene locus_tag LOCUS_05790 gene rnr 89621 91966 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659926.1 protein_id gnl|my_center|LOCUS_05790 92010 92477 gene locus_tag LOCUS_05800 gene smpB 92010 92477 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238456.1 protein_id gnl|my_center|LOCUS_05800 92956 92516 gene locus_tag LOCUS_05810 92956 92516 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645037.1 protein_id gnl|my_center|LOCUS_05810 93089 93535 gene locus_tag LOCUS_05820 93089 93535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 93653 94891 gene locus_tag LOCUS_05830 93653 94891 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456709.1 protein_id gnl|my_center|LOCUS_05830 95619 94942 gene locus_tag LOCUS_05840 95619 94942 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159251.1 protein_id gnl|my_center|LOCUS_05840 96201 95710 gene locus_tag LOCUS_05850 96201 95710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 96657 96229 gene locus_tag LOCUS_05860 96657 96229 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315975.1 protein_id gnl|my_center|LOCUS_05860 97189 96755 gene locus_tag LOCUS_05870 97189 96755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 98099 97371 gene locus_tag LOCUS_05880 98099 97371 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 protein_id gnl|my_center|LOCUS_05880 98276 99166 gene locus_tag LOCUS_05890 98276 99166 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 protein_id gnl|my_center|LOCUS_05890 99677 99183 gene locus_tag LOCUS_05900 99677 99183 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963471.1 protein_id gnl|my_center|LOCUS_05900 99805 100131 gene locus_tag LOCUS_05910 gene qacH 99805 100131 CDS product quaternary ammonium compound efflux SMR transporter QacH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010730188.1 protein_id gnl|my_center|LOCUS_05910 101251 100166 gene locus_tag LOCUS_05920 101251 100166 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040811.1 protein_id gnl|my_center|LOCUS_05920 101592 102596 gene locus_tag LOCUS_05930 gene ccpA 101592 102596 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985680.1 protein_id gnl|my_center|LOCUS_05930 102679 103677 gene locus_tag LOCUS_05940 102679 103677 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262799.1 protein_id gnl|my_center|LOCUS_05940 103679 105013 gene locus_tag LOCUS_05950 103679 105013 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262800.1 protein_id gnl|my_center|LOCUS_05950 105364 107310 gene locus_tag LOCUS_05960 gene thrS 105364 107310 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837214.1 protein_id gnl|my_center|LOCUS_05960 107451 109349 gene locus_tag LOCUS_05970 107451 109349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 111183 109414 gene locus_tag LOCUS_05980 111183 109414 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262804.1 protein_id gnl|my_center|LOCUS_05980 111816 111298 gene locus_tag LOCUS_05990 111816 111298 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_05990 111898 112779 gene locus_tag LOCUS_06000 111898 112779 CDS product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352238.1 protein_id gnl|my_center|LOCUS_06000 112868 113563 gene locus_tag LOCUS_06010 112868 113563 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_06010 113667 115025 gene locus_tag LOCUS_06020 113667 115025 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730417.1 protein_id gnl|my_center|LOCUS_06020 115207 115503 gene locus_tag LOCUS_06030 115207 115503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 115721 116329 gene locus_tag LOCUS_06040 115721 116329 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383106.1 protein_id gnl|my_center|LOCUS_06040 117009 116362 gene locus_tag LOCUS_06050 117009 116362 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262934.1 protein_id gnl|my_center|LOCUS_06050 117723 117019 gene locus_tag LOCUS_06060 117723 117019 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262933.1 protein_id gnl|my_center|LOCUS_06060 118542 117739 gene locus_tag LOCUS_06070 118542 117739 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262932.1 protein_id gnl|my_center|LOCUS_06070 119317 118553 gene locus_tag LOCUS_06080 119317 118553 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262931.1 protein_id gnl|my_center|LOCUS_06080 119625 120335 gene locus_tag LOCUS_06090 gene yycF 119625 120335 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985645.1 protein_id gnl|my_center|LOCUS_06090 120328 121680 gene locus_tag LOCUS_06100 gene vicK 120328 121680 CDS product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065468.1 protein_id gnl|my_center|LOCUS_06100 121681 122490 gene locus_tag LOCUS_06110 121681 122490 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289497.1 protein_id gnl|my_center|LOCUS_06110 122699 123385 gene locus_tag LOCUS_06120 gene rnc 122699 123385 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661526.1 protein_id gnl|my_center|LOCUS_06120 123532 127071 gene locus_tag LOCUS_06130 gene smc 123532 127071 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478794.1 protein_id gnl|my_center|LOCUS_06130 127921 127112 gene locus_tag LOCUS_06140 127921 127112 CDS product DUF6287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263334.1 protein_id gnl|my_center|LOCUS_06140 128096 128893 gene locus_tag LOCUS_06150 128096 128893 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594101.1 protein_id gnl|my_center|LOCUS_06150 128893 129714 gene locus_tag LOCUS_06160 128893 129714 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263635.1 protein_id gnl|my_center|LOCUS_06160 129755 131077 gene locus_tag LOCUS_06170 gene ftsY 129755 131077 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775180.1 protein_id gnl|my_center|LOCUS_06170 131082 131249 gene locus_tag LOCUS_06180 131082 131249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 132094 131282 gene locus_tag LOCUS_06190 132094 131282 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617813.1 protein_id gnl|my_center|LOCUS_06190 132996 132091 gene locus_tag LOCUS_06200 132996 132091 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350891.1 protein_id gnl|my_center|LOCUS_06200 133136 133002 gene locus_tag LOCUS_06210 133136 133002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 133322 135454 gene locus_tag LOCUS_06220 133322 135454 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263864.1 protein_id gnl|my_center|LOCUS_06220 135441 135878 gene locus_tag LOCUS_06230 135441 135878 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778583.1 protein_id gnl|my_center|LOCUS_06230 135969 136256 gene locus_tag LOCUS_06240 135969 136256 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985568.1 protein_id gnl|my_center|LOCUS_06240 136556 137503 gene locus_tag LOCUS_06250 gene hprK 136556 137503 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263627.1 protein_id gnl|my_center|LOCUS_06250 137496 138278 gene locus_tag LOCUS_06260 gene lgt 137496 138278 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609732.1 protein_id gnl|my_center|LOCUS_06260 138299 138718 gene locus_tag LOCUS_06270 138299 138718 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569599.1 protein_id gnl|my_center|LOCUS_06270 138711 139181 gene locus_tag LOCUS_06280 138711 139181 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039971.1 protein_id gnl|my_center|LOCUS_06280 139529 139245 gene locus_tag LOCUS_06290 139529 139245 CDS product DUF3270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097985.1 protein_id gnl|my_center|LOCUS_06290 139803 140729 gene locus_tag LOCUS_06300 139803 140729 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411251.1 protein_id gnl|my_center|LOCUS_06300 140860 142149 gene locus_tag LOCUS_06310 140860 142149 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922022.1 protein_id gnl|my_center|LOCUS_06310 142535 142206 gene locus_tag LOCUS_06320 142535 142206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261922.1 protein_id gnl|my_center|LOCUS_06320 142647 142859 gene locus_tag LOCUS_06330 142647 142859 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985548.1 protein_id gnl|my_center|LOCUS_06330 142978 143730 gene locus_tag LOCUS_06340 142978 143730 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_06340 144988 143795 gene locus_tag LOCUS_06350 144988 143795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_06350 145693 145133 gene locus_tag LOCUS_06360 145693 145133 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262123.1 protein_id gnl|my_center|LOCUS_06360 145812 147581 gene locus_tag LOCUS_06370 145812 147581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673967.1 protein_id gnl|my_center|LOCUS_06370 149156 147666 gene locus_tag LOCUS_06380 gene lysS 149156 147666 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261927.1 protein_id gnl|my_center|LOCUS_06380 149347 150249 gene locus_tag LOCUS_06390 149347 150249 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 protein_id gnl|my_center|LOCUS_06390 150917 150294 gene locus_tag LOCUS_06400 150917 150294 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263325.1 protein_id gnl|my_center|LOCUS_06400 151423 150938 gene locus_tag LOCUS_06410 151423 150938 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922070.1 protein_id gnl|my_center|LOCUS_06410 152395 151502 gene locus_tag LOCUS_06420 152395 151502 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074540.1 protein_id gnl|my_center|LOCUS_06420 153361 152567 gene locus_tag LOCUS_06430 153361 152567 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254339.1 protein_id gnl|my_center|LOCUS_06430 154042 153557 gene locus_tag LOCUS_06440 154042 153557 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922028.1 protein_id gnl|my_center|LOCUS_06440 155834 154035 gene locus_tag LOCUS_06450 gene pepF 155834 154035 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922029.1 protein_id gnl|my_center|LOCUS_06450 156132 158954 gene locus_tag LOCUS_06460 gene ppc 156132 158954 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019267.1 protein_id gnl|my_center|LOCUS_06460 159105 160427 gene locus_tag LOCUS_06470 159105 160427 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985525.1 protein_id gnl|my_center|LOCUS_06470 160657 161853 gene locus_tag LOCUS_06480 gene tuf 160657 161853 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263314.1 protein_id gnl|my_center|LOCUS_06480 162045 162803 gene locus_tag LOCUS_06490 gene tpiA 162045 162803 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087897.1 protein_id gnl|my_center|LOCUS_06490 164132 162897 gene locus_tag LOCUS_06500 164132 162897 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263312.1 protein_id gnl|my_center|LOCUS_06500 165346 164132 gene locus_tag LOCUS_06510 165346 164132 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527081.1 protein_id gnl|my_center|LOCUS_06510 166164 165346 gene locus_tag LOCUS_06520 gene yidA 166164 165346 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985513.1 protein_id gnl|my_center|LOCUS_06520 167623 166322 gene locus_tag LOCUS_06530 167623 166322 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985509.1 protein_id gnl|my_center|LOCUS_06530 167720 168598 gene locus_tag LOCUS_06540 167720 168598 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263308.1 protein_id gnl|my_center|LOCUS_06540 168670 169056 gene locus_tag LOCUS_06550 168670 169056 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263307.1 protein_id gnl|my_center|LOCUS_06550 169283 171964 gene locus_tag LOCUS_06560 169283 171964 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910746.1 protein_id gnl|my_center|LOCUS_06560 172060 172707 gene locus_tag LOCUS_06570 172060 172707 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_06570 173139 174149 gene locus_tag LOCUS_06580 gene prfB 173139 174149 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100198625.1 protein_id gnl|my_center|LOCUS_06580 174197 174889 gene locus_tag LOCUS_06590 gene ftsE 174197 174889 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_06590 174882 175811 gene locus_tag LOCUS_06600 gene ftsX 174882 175811 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990498.1 protein_id gnl|my_center|LOCUS_06600 176563 175847 gene locus_tag LOCUS_06610 176563 175847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022571.1 protein_id gnl|my_center|LOCUS_06610 177201 176560 gene locus_tag LOCUS_06620 177201 176560 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263539.1 protein_id gnl|my_center|LOCUS_06620 177327 179810 gene locus_tag LOCUS_06630 177327 179810 CDS product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458614.1 protein_id gnl|my_center|LOCUS_06630 179841 180311 gene locus_tag LOCUS_06640 179841 180311 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837100.1 protein_id gnl|my_center|LOCUS_06640 180308 181489 gene locus_tag LOCUS_06650 180308 181489 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922154.1 protein_id gnl|my_center|LOCUS_06650 181491 181934 gene locus_tag LOCUS_06660 181491 181934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 181953 183299 gene locus_tag LOCUS_06670 gene asnS 181953 183299 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038470.1 protein_id gnl|my_center|LOCUS_06670 183443 183727 gene locus_tag LOCUS_06680 183443 183727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 184328 183765 gene locus_tag LOCUS_06690 184328 183765 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167491.1 protein_id gnl|my_center|LOCUS_06690 185315 184332 gene locus_tag LOCUS_06700 185315 184332 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031097.1 protein_id gnl|my_center|LOCUS_06700 185620 186000 gene locus_tag LOCUS_06710 185620 186000 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263719.1 protein_id gnl|my_center|LOCUS_06710 188652 186076 gene locus_tag LOCUS_06720 188652 186076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 190444 188645 gene locus_tag LOCUS_06730 190444 188645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 190736 191347 gene locus_tag LOCUS_06740 190736 191347 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262077.1 protein_id gnl|my_center|LOCUS_06740 191421 192191 gene locus_tag LOCUS_06750 191421 192191 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227144.1 protein_id gnl|my_center|LOCUS_06750 192184 193074 gene locus_tag LOCUS_06760 gene rapZ 192184 193074 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836729.1 protein_id gnl|my_center|LOCUS_06760 193071 194048 gene locus_tag LOCUS_06770 193071 194048 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231102.1 protein_id gnl|my_center|LOCUS_06770 194045 194956 gene locus_tag LOCUS_06780 gene whiA 194045 194956 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011316.1 protein_id gnl|my_center|LOCUS_06780 196439 195021 gene locus_tag LOCUS_06790 196439 195021 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922052.1 protein_id gnl|my_center|LOCUS_06790 196980 196573 gene locus_tag LOCUS_06800 196980 196573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 197776 197036 gene locus_tag LOCUS_06810 197776 197036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 198526 197780 gene locus_tag LOCUS_06820 198526 197780 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580488.1 protein_id gnl|my_center|LOCUS_06820 198688 198909 gene locus_tag LOCUS_06830 198688 198909 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388578.1 protein_id gnl|my_center|LOCUS_06830 199029 199199 gene locus_tag LOCUS_06840 199029 199199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 199299 199553 gene locus_tag LOCUS_06850 199299 199553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 199692 200072 gene locus_tag LOCUS_06860 199692 200072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 200082 200354 gene locus_tag LOCUS_06870 200082 200354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 200354 200584 gene locus_tag LOCUS_06880 200354 200584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 200581 200700 gene locus_tag LOCUS_06890 200581 200700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 200715 201389 gene locus_tag LOCUS_06900 200715 201389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 201402 202415 gene locus_tag LOCUS_06910 201402 202415 CDS product DUF1351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121835672.1 protein_id gnl|my_center|LOCUS_06910 202412 202579 gene locus_tag LOCUS_06920 202412 202579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 202576 202734 gene locus_tag LOCUS_06930 202576 202734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 202718 203272 gene locus_tag LOCUS_06940 202718 203272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 203282 203509 gene locus_tag LOCUS_06950 203282 203509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 203506 203721 gene locus_tag LOCUS_06960 203506 203721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 203718 204452 gene locus_tag LOCUS_06970 203718 204452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 204464 204805 gene locus_tag LOCUS_06980 204464 204805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 204807 204932 gene locus_tag LOCUS_06990 204807 204932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 204913 205164 gene locus_tag LOCUS_07000 204913 205164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 205161 205595 gene locus_tag LOCUS_07010 205161 205595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 205595 205771 gene locus_tag LOCUS_07020 205595 205771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 205761 206009 gene locus_tag LOCUS_07030 205761 206009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 206013 206396 gene locus_tag LOCUS_07040 206013 206396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 206383 206619 gene locus_tag LOCUS_07050 206383 206619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 206609 206755 gene locus_tag LOCUS_07060 206609 206755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 206752 206958 gene locus_tag LOCUS_07070 206752 206958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 206948 207502 gene locus_tag LOCUS_07080 206948 207502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 207495 207710 gene locus_tag LOCUS_07090 207495 207710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 207730 208110 gene locus_tag LOCUS_07100 207730 208110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 208192 208674 gene locus_tag LOCUS_07110 208192 208674 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083312988.1 protein_id gnl|my_center|LOCUS_07110 208664 209974 gene locus_tag LOCUS_07120 208664 209974 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989956.1 protein_id gnl|my_center|LOCUS_07120 209984 211534 gene locus_tag LOCUS_07130 209984 211534 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922075.1 protein_id gnl|my_center|LOCUS_07130 211527 213170 gene locus_tag LOCUS_07140 211527 213170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 213174 213377 gene locus_tag LOCUS_07150 213174 213377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 213541 214107 gene locus_tag LOCUS_07160 213541 214107 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_07160 214122 215009 gene locus_tag LOCUS_07170 214122 215009 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714191.1 protein_id gnl|my_center|LOCUS_07170 215011 215235 gene locus_tag LOCUS_07180 215011 215235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 215264 215656 gene locus_tag LOCUS_07190 215264 215656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922081.1 protein_id gnl|my_center|LOCUS_07190 215646 215972 gene locus_tag LOCUS_07200 215646 215972 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922082.1 protein_id gnl|my_center|LOCUS_07200 215972 216319 gene locus_tag LOCUS_07210 215972 216319 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922083.1 protein_id gnl|my_center|LOCUS_07210 216319 216717 gene locus_tag LOCUS_07220 216319 216717 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922084.1 protein_id gnl|my_center|LOCUS_07220 216728 217186 gene locus_tag LOCUS_07230 216728 217186 CDS product major tail shaft protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011527917.1 protein_id gnl|my_center|LOCUS_07230 217200 217577 gene locus_tag LOCUS_07240 217200 217577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 217676 218158 gene locus_tag LOCUS_07250 217676 218158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 218173 222045 gene locus_tag LOCUS_07260 218173 222045 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922222.1 protein_id gnl|my_center|LOCUS_07260 222042 223529 gene locus_tag LOCUS_07270 222042 223529 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228810.1 protein_id gnl|my_center|LOCUS_07270 223529 225280 gene locus_tag LOCUS_07280 223529 225280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 225298 226422 gene locus_tag LOCUS_07290 225298 226422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905923.1 protein_id gnl|my_center|LOCUS_07290 226436 226669 gene locus_tag LOCUS_07300 226436 226669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 226578 228623 gene locus_tag LOCUS_07310 226578 228623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 228640 230721 gene locus_tag LOCUS_07320 228640 230721 CDS product DUF859 family phage minor structural protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536253.1 protein_id gnl|my_center|LOCUS_07320 230734 231117 gene locus_tag LOCUS_07330 230734 231117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 231143 231286 gene locus_tag LOCUS_07340 231143 231286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 231309 231641 gene locus_tag LOCUS_07350 231309 231641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 231686 232012 gene locus_tag LOCUS_07360 231686 232012 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191484.1 protein_id gnl|my_center|LOCUS_07360 232009 232854 gene locus_tag LOCUS_07370 232009 232854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 233376 233762 gene locus_tag LOCUS_07380 233376 233762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 233893 235305 gene locus_tag LOCUS_07390 233893 235305 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351154.1 protein_id gnl|my_center|LOCUS_07390 235435 236946 gene locus_tag LOCUS_07400 235435 236946 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227406.1 protein_id gnl|my_center|LOCUS_07400 237076 237801 gene locus_tag LOCUS_07410 237076 237801 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990206.1 protein_id gnl|my_center|LOCUS_07410 238137 237892 gene locus_tag LOCUS_07420 238137 237892 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710764.1 protein_id gnl|my_center|LOCUS_07420 239236 238301 gene locus_tag LOCUS_07430 239236 238301 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583238.1 protein_id gnl|my_center|LOCUS_07430 239401 240552 gene locus_tag LOCUS_07440 239401 240552 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190397.1 protein_id gnl|my_center|LOCUS_07440 240679 241698 gene locus_tag LOCUS_07450 gene add 240679 241698 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074606.1 protein_id gnl|my_center|LOCUS_07450 241740 242183 gene locus_tag LOCUS_07460 241740 242183 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162136.1 protein_id gnl|my_center|LOCUS_07460 242266 243651 gene locus_tag LOCUS_07470 gene sufB 242266 243651 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263153.1 protein_id gnl|my_center|LOCUS_07470 243735 244016 gene locus_tag LOCUS_07480 243735 244016 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362440.1 protein_id gnl|my_center|LOCUS_07480 244035 245255 gene locus_tag LOCUS_07490 244035 245255 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263157.1 protein_id gnl|my_center|LOCUS_07490 245387 245734 gene locus_tag LOCUS_07500 gene rplS 245387 245734 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921928.1 protein_id gnl|my_center|LOCUS_07500 245791 245862 gene locus_tag LOCUS_t00060 245791 245862 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 246086 247297 gene locus_tag LOCUS_07510 246086 247297 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263164.1 protein_id gnl|my_center|LOCUS_07510 247408 247974 gene locus_tag LOCUS_07520 247408 247974 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106189.1 protein_id gnl|my_center|LOCUS_07520 247975 249927 gene locus_tag LOCUS_07530 gene gyrB 247975 249927 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134196.1 protein_id gnl|my_center|LOCUS_07530 250032 251756 gene locus_tag LOCUS_07540 gene ezrA 250032 251756 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922105.1 protein_id gnl|my_center|LOCUS_07540 252224 253282 gene locus_tag LOCUS_07550 gene hisC 252224 253282 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837142.1 protein_id gnl|my_center|LOCUS_07550 253295 254263 gene locus_tag LOCUS_07560 253295 254263 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263172.1 protein_id gnl|my_center|LOCUS_07560 254263 254910 gene locus_tag LOCUS_07570 gene hisG 254263 254910 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263173.1 protein_id gnl|my_center|LOCUS_07570 254907 256184 gene locus_tag LOCUS_07580 gene hisD 254907 256184 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909411.1 protein_id gnl|my_center|LOCUS_07580 256177 256833 gene locus_tag LOCUS_07590 gene serB 256177 256833 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263175.1 protein_id gnl|my_center|LOCUS_07590 256834 257418 gene locus_tag LOCUS_07600 gene hisB 256834 257418 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263176.1 protein_id gnl|my_center|LOCUS_07600 257488 258102 gene locus_tag LOCUS_07610 gene hisH 257488 258102 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263178.1 protein_id gnl|my_center|LOCUS_07610 258120 258839 gene locus_tag LOCUS_07620 gene hisA 258120 258839 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603770.1 protein_id gnl|my_center|LOCUS_07620 258843 259601 gene locus_tag LOCUS_07630 gene hisF 258843 259601 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263180.1 protein_id gnl|my_center|LOCUS_07630 259598 259918 gene locus_tag LOCUS_07640 gene hisI 259598 259918 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_07640 259931 260245 gene locus_tag LOCUS_07650 gene hisE 259931 260245 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265591.1 protein_id gnl|my_center|LOCUS_07650 260452 267108 gene locus_tag LOCUS_07660 260452 267108 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925492.1 protein_id gnl|my_center|LOCUS_07660 267239 268354 gene locus_tag LOCUS_07670 267239 268354 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263192.1 protein_id gnl|my_center|LOCUS_07670 268803 268351 gene locus_tag LOCUS_07680 268803 268351 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263193.1 protein_id gnl|my_center|LOCUS_07680 269010 270308 gene locus_tag LOCUS_07690 gene eno 269010 270308 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263196.1 protein_id gnl|my_center|LOCUS_07690 270383 270544 gene locus_tag LOCUS_07700 270383 270544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 270867 270598 gene locus_tag LOCUS_07710 270867 270598 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525227.1 protein_id gnl|my_center|LOCUS_07710 271793 271005 gene locus_tag LOCUS_07720 271793 271005 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263110.1 protein_id gnl|my_center|LOCUS_07720 273120 271795 gene locus_tag LOCUS_07730 273120 271795 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263111.1 protein_id gnl|my_center|LOCUS_07730 273244 274092 gene locus_tag LOCUS_07740 gene cdaA 273244 274092 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350949.1 protein_id gnl|my_center|LOCUS_07740 274089 275045 gene locus_tag LOCUS_07750 274089 275045 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984857.1 protein_id gnl|my_center|LOCUS_07750 275157 276509 gene locus_tag LOCUS_07760 gene glmM 275157 276509 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 protein_id gnl|my_center|LOCUS_07760 276603 277733 gene locus_tag LOCUS_07770 gene hemW 276603 277733 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914664.1 protein_id gnl|my_center|LOCUS_07770 277738 278466 gene locus_tag LOCUS_07780 277738 278466 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_07780 278539 279312 gene locus_tag LOCUS_07790 278539 279312 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922249.1 protein_id gnl|my_center|LOCUS_07790 279344 279961 gene locus_tag LOCUS_07800 279344 279961 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653357.1 protein_id gnl|my_center|LOCUS_07800 280246 280389 gene locus_tag LOCUS_07810 280246 280389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 280507 280923 gene locus_tag LOCUS_07820 gene ndk 280507 280923 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438314.1 protein_id gnl|my_center|LOCUS_07820 281029 284421 gene locus_tag LOCUS_07830 gene cas9 281029 284421 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_07830 284593 285504 gene locus_tag LOCUS_07840 gene cas1 284593 285504 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 protein_id gnl|my_center|LOCUS_07840 285506 285829 gene locus_tag LOCUS_07850 gene cas2 285506 285829 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 protein_id gnl|my_center|LOCUS_07850 285826 286875 gene locus_tag LOCUS_07860 285826 286875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 286938 288159 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttgtactctcaagatttaagtaaccgtaaaac 288388 290223 gene locus_tag LOCUS_07870 gene lepA 288388 290223 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019133.1 protein_id gnl|my_center|LOCUS_07870 290357 291640 gene locus_tag LOCUS_07880 gene aroA 290357 291640 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837158.1 protein_id gnl|my_center|LOCUS_07880 291633 292109 gene locus_tag LOCUS_07890 291633 292109 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261939.1 protein_id gnl|my_center|LOCUS_07890 292106 292930 gene locus_tag LOCUS_07900 gene pheA 292106 292930 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261940.1 protein_id gnl|my_center|LOCUS_07900 293082 294560 gene locus_tag LOCUS_07910 293082 294560 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261941.1 protein_id gnl|my_center|LOCUS_07910 294673 296037 gene locus_tag LOCUS_07920 gene rlmD 294673 296037 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261942.1 protein_id gnl|my_center|LOCUS_07920 296233 297126 gene locus_tag LOCUS_07930 296233 297126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 297236 297673 gene locus_tag LOCUS_07940 297236 297673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 297670 298020 gene locus_tag LOCUS_07950 297670 298020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 298021 298212 gene locus_tag LOCUS_07960 298021 298212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 298228 298410 gene locus_tag LOCUS_07970 298228 298410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 298423 298629 gene locus_tag LOCUS_07980 298423 298629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 298872 298708 gene locus_tag LOCUS_07990 298872 298708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 299176 298967 gene locus_tag LOCUS_08000 299176 298967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 299564 300322 gene locus_tag LOCUS_08010 299564 300322 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_08010 300379 300555 gene locus_tag LOCUS_08020 300379 300555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 300674 301594 gene locus_tag LOCUS_08030 300674 301594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 301633 302043 gene locus_tag LOCUS_08040 301633 302043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_08040 302301 302885 gene locus_tag LOCUS_08050 302301 302885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08050 302915 303316 gene locus_tag LOCUS_08060 302915 303316 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 protein_id gnl|my_center|LOCUS_08060 303629 305284 gene locus_tag LOCUS_08070 303629 305284 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_08070 305453 307102 gene locus_tag LOCUS_08080 305453 307102 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093960.1 protein_id gnl|my_center|LOCUS_08080 307505 309151 gene locus_tag LOCUS_08090 307505 309151 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118749.1 protein_id gnl|my_center|LOCUS_08090 309257 309985 gene locus_tag LOCUS_08100 309257 309985 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028519.1 protein_id gnl|my_center|LOCUS_08100 310069 310197 gene locus_tag LOCUS_08110 310069 310197 CDS product DUF4044 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261953.1 protein_id gnl|my_center|LOCUS_08110 310270 311583 gene locus_tag LOCUS_08120 gene obgE 310270 311583 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020750251.1 protein_id gnl|my_center|LOCUS_08120 311716 311898 gene locus_tag LOCUS_08130 311716 311898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502594.1 protein_id gnl|my_center|LOCUS_08130 312616 311939 gene locus_tag LOCUS_08140 312616 311939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08140 313438 312689 gene locus_tag LOCUS_08150 313438 312689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08150 314264 313728 gene locus_tag LOCUS_08160 314264 313728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 315288 314548 gene locus_tag LOCUS_08170 315288 314548 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818887.1 protein_id gnl|my_center|LOCUS_08170 317489 315288 gene locus_tag LOCUS_08180 317489 315288 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681005.1 protein_id gnl|my_center|LOCUS_08180 317680 319671 gene locus_tag LOCUS_08190 gene uvrB 317680 319671 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261961.1 protein_id gnl|my_center|LOCUS_08190 319690 320154 gene locus_tag LOCUS_08200 319690 320154 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261965.1 protein_id gnl|my_center|LOCUS_08200 321113 320277 gene locus_tag LOCUS_08210 321113 320277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035401.1 protein_id gnl|my_center|LOCUS_08210 322480 321113 gene locus_tag LOCUS_08220 322480 321113 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035541.1 protein_id gnl|my_center|LOCUS_08220 323867 322608 gene locus_tag LOCUS_08230 323867 322608 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262976.1 protein_id gnl|my_center|LOCUS_08230 324199 325224 gene locus_tag LOCUS_08240 324199 325224 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256302.1 protein_id gnl|my_center|LOCUS_08240 325390 326892 gene locus_tag LOCUS_08250 gene malQ 325390 326892 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745458.1 protein_id gnl|my_center|LOCUS_08250 326915 329179 gene locus_tag LOCUS_08260 gene glgP 326915 329179 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922381.1 protein_id gnl|my_center|LOCUS_08260 329331 330149 gene locus_tag LOCUS_08270 329331 330149 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_08270 330159 330968 gene locus_tag LOCUS_08280 330159 330968 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_08280 331049 332167 gene locus_tag LOCUS_08290 331049 332167 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_08290 332263 333078 gene locus_tag LOCUS_08300 332263 333078 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261968.1 protein_id gnl|my_center|LOCUS_08300 333241 333417 gene locus_tag LOCUS_08310 333241 333417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 333862 333479 gene locus_tag LOCUS_08320 gene mscL 333862 333479 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588846.1 protein_id gnl|my_center|LOCUS_08320 333962 335788 gene locus_tag LOCUS_08330 gene dnaG 333962 335788 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734875.1 protein_id gnl|my_center|LOCUS_08330 335797 336906 gene locus_tag LOCUS_08340 gene rpoD 335797 336906 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985187.1 protein_id gnl|my_center|LOCUS_08340 336928 337263 gene locus_tag LOCUS_08350 336928 337263 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261973.1 protein_id gnl|my_center|LOCUS_08350 337625 339592 gene locus_tag LOCUS_08360 337625 339592 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910555.1 protein_id gnl|my_center|LOCUS_08360 339660 341162 gene locus_tag LOCUS_08370 339660 341162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902452.1 protein_id gnl|my_center|LOCUS_08370 341162 342088 gene locus_tag LOCUS_08380 341162 342088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921892.1 protein_id gnl|my_center|LOCUS_08380 342097 343167 gene locus_tag LOCUS_08390 342097 343167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921893.1 protein_id gnl|my_center|LOCUS_08390 343160 344086 gene locus_tag LOCUS_08400 343160 344086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986000.1 protein_id gnl|my_center|LOCUS_08400 344254 345408 gene locus_tag LOCUS_08410 344254 345408 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154382.1 protein_id gnl|my_center|LOCUS_08410 345416 346333 gene locus_tag LOCUS_08420 345416 346333 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922131.1 protein_id gnl|my_center|LOCUS_08420 346330 347136 gene locus_tag LOCUS_08430 346330 347136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027237.1 protein_id gnl|my_center|LOCUS_08430 347136 348344 gene locus_tag LOCUS_08440 347136 348344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 protein_id gnl|my_center|LOCUS_08440 348373 349389 gene locus_tag LOCUS_08450 348373 349389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 349386 351086 gene locus_tag LOCUS_08460 349386 351086 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018364630.1 protein_id gnl|my_center|LOCUS_08460 351083 351877 gene locus_tag LOCUS_08470 351083 351877 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_08470 351889 352584 gene locus_tag LOCUS_08480 351889 352584 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_08480 352586 352921 gene locus_tag LOCUS_08490 352586 352921 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985167.1 protein_id gnl|my_center|LOCUS_08490 352914 354182 gene locus_tag LOCUS_08500 352914 354182 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_08500 354179 355477 gene locus_tag LOCUS_08510 354179 355477 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775199.1 protein_id gnl|my_center|LOCUS_08510 355584 358043 gene locus_tag LOCUS_08520 355584 358043 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261981.1 protein_id gnl|my_center|LOCUS_08520 358106 359605 gene locus_tag LOCUS_08530 358106 359605 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002405598.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence03 842 450 gene locus_tag LOCUS_08540 gene rpsI 842 450 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982716.1 protein_id gnl|my_center|LOCUS_08540 1311 865 gene locus_tag LOCUS_08550 gene rplM 1311 865 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893769.1 protein_id gnl|my_center|LOCUS_08550 2185 1532 gene locus_tag LOCUS_08560 2185 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3140 2280 gene locus_tag LOCUS_08570 3140 2280 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262997.1 protein_id gnl|my_center|LOCUS_08570 3812 3300 gene locus_tag LOCUS_08580 3812 3300 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982682.1 protein_id gnl|my_center|LOCUS_08580 4608 3859 gene locus_tag LOCUS_08590 gene rlmB 4608 3859 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027787.1 protein_id gnl|my_center|LOCUS_08590 5070 4669 gene locus_tag LOCUS_08600 5070 4669 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263003.1 protein_id gnl|my_center|LOCUS_08600 6409 5063 gene locus_tag LOCUS_08610 gene cysS 6409 5063 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591131.1 protein_id gnl|my_center|LOCUS_08610 7056 6439 gene locus_tag LOCUS_08620 gene cysE 7056 6439 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899011.1 protein_id gnl|my_center|LOCUS_08620 7819 7070 gene locus_tag LOCUS_08630 7819 7070 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922672.1 protein_id gnl|my_center|LOCUS_08630 10027 7856 gene locus_tag LOCUS_08640 gene pnp 10027 7856 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922673.1 protein_id gnl|my_center|LOCUS_08640 10474 10244 gene locus_tag LOCUS_08650 10474 10244 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310292.1 protein_id gnl|my_center|LOCUS_08650 13402 10721 gene locus_tag LOCUS_08660 gene adhE 13402 10721 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263602.1 protein_id gnl|my_center|LOCUS_08660 14121 13852 gene locus_tag LOCUS_08670 gene rpsO 14121 13852 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018249.1 protein_id gnl|my_center|LOCUS_08670 15442 14279 gene locus_tag LOCUS_08680 15442 14279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689136.1 protein_id gnl|my_center|LOCUS_08680 15534 16178 gene locus_tag LOCUS_08690 15534 16178 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263600.1 protein_id gnl|my_center|LOCUS_08690 16245 16859 gene locus_tag LOCUS_08700 gene def 16245 16859 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902258.1 protein_id gnl|my_center|LOCUS_08700 17509 16964 gene locus_tag LOCUS_08710 17509 16964 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039607.1 protein_id gnl|my_center|LOCUS_08710 18062 17610 gene locus_tag LOCUS_08720 18062 17610 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526288.1 protein_id gnl|my_center|LOCUS_08720 22523 18168 gene locus_tag LOCUS_08730 22523 18168 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922680.1 protein_id gnl|my_center|LOCUS_08730 24572 22716 gene locus_tag LOCUS_08740 24572 22716 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814045.1 protein_id gnl|my_center|LOCUS_08740 25987 24725 gene locus_tag LOCUS_08750 gene rseP 25987 24725 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900647.1 protein_id gnl|my_center|LOCUS_08750 26866 26072 gene locus_tag LOCUS_08760 26866 26072 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664686.1 protein_id gnl|my_center|LOCUS_08760 27634 26879 gene locus_tag LOCUS_08770 27634 26879 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469563.1 protein_id gnl|my_center|LOCUS_08770 28113 27769 gene locus_tag LOCUS_08780 gene yajC 28113 27769 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285724.1 protein_id gnl|my_center|LOCUS_08780 29066 28185 gene locus_tag LOCUS_08790 29066 28185 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613646.1 protein_id gnl|my_center|LOCUS_08790 30142 29144 gene locus_tag LOCUS_08800 gene galE 30142 29144 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262881.1 protein_id gnl|my_center|LOCUS_08800 31621 30152 gene locus_tag LOCUS_08810 gene galT 31621 30152 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352255.1 protein_id gnl|my_center|LOCUS_08810 32813 31641 gene locus_tag LOCUS_08820 32813 31641 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262879.1 protein_id gnl|my_center|LOCUS_08820 32963 33961 gene locus_tag LOCUS_08830 32963 33961 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289652.1 protein_id gnl|my_center|LOCUS_08830 35608 33998 gene locus_tag LOCUS_08840 gene dexB 35608 33998 CDS product glucan 1,6-alpha-glucosidase DexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262877.1 protein_id gnl|my_center|LOCUS_08840 37174 35729 gene locus_tag LOCUS_08850 gene gtfA 37174 35729 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262875.1 protein_id gnl|my_center|LOCUS_08850 38294 37461 gene locus_tag LOCUS_08860 38294 37461 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262874.1 protein_id gnl|my_center|LOCUS_08860 39170 38304 gene locus_tag LOCUS_08870 39170 38304 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262873.1 protein_id gnl|my_center|LOCUS_08870 40454 39183 gene locus_tag LOCUS_08880 gene msmE 40454 39183 CDS product sugar-binding protein MsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262872.1 protein_id gnl|my_center|LOCUS_08880 42628 40466 gene locus_tag LOCUS_08890 42628 40466 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262871.1 protein_id gnl|my_center|LOCUS_08890 42738 43571 gene locus_tag LOCUS_08900 42738 43571 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_08900 45202 43616 gene locus_tag LOCUS_08910 45202 43616 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288633.1 protein_id gnl|my_center|LOCUS_08910 46928 45255 gene locus_tag LOCUS_08920 46928 45255 CDS product PTS lactose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288634.1 protein_id gnl|my_center|LOCUS_08920 47329 47018 gene locus_tag LOCUS_08930 47329 47018 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288635.1 protein_id gnl|my_center|LOCUS_08930 48742 47342 gene locus_tag LOCUS_08940 gene lacG 48742 47342 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288636.1 protein_id gnl|my_center|LOCUS_08940 49589 48753 gene locus_tag LOCUS_08950 49589 48753 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027022.1 protein_id gnl|my_center|LOCUS_08950 50691 49795 gene locus_tag LOCUS_08960 50691 49795 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 protein_id gnl|my_center|LOCUS_08960 51783 50788 gene locus_tag LOCUS_08970 gene lacD 51783 50788 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084249.1 protein_id gnl|my_center|LOCUS_08970 52718 51786 gene locus_tag LOCUS_08980 gene lacC 52718 51786 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_08980 53245 52730 gene locus_tag LOCUS_08990 gene lacB 53245 52730 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922572.1 protein_id gnl|my_center|LOCUS_08990 53687 53262 gene locus_tag LOCUS_09000 gene lacA 53687 53262 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829760.1 protein_id gnl|my_center|LOCUS_09000 53987 54757 gene locus_tag LOCUS_09010 53987 54757 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919197.1 protein_id gnl|my_center|LOCUS_09010 56007 54874 gene locus_tag LOCUS_09020 gene ugpC 56007 54874 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922688.1 protein_id gnl|my_center|LOCUS_09020 56954 56106 gene locus_tag LOCUS_09030 56954 56106 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345946.1 protein_id gnl|my_center|LOCUS_09030 57427 56984 gene locus_tag LOCUS_09040 gene dtd 57427 56984 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922691.1 protein_id gnl|my_center|LOCUS_09040 59779 57557 gene locus_tag LOCUS_09050 59779 57557 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993702.1 protein_id gnl|my_center|LOCUS_09050 60857 59901 gene locus_tag LOCUS_09060 60857 59901 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_09060 61512 60871 gene locus_tag LOCUS_09070 61512 60871 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_09070 62385 61522 gene locus_tag LOCUS_09080 62385 61522 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302918.1 protein_id gnl|my_center|LOCUS_09080 63132 62419 gene locus_tag LOCUS_09090 63132 62419 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105270.1 protein_id gnl|my_center|LOCUS_09090 65438 63207 gene locus_tag LOCUS_09100 65438 63207 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_09100 66019 65435 gene locus_tag LOCUS_09110 66019 65435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 66871 66041 gene locus_tag LOCUS_09120 66871 66041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_09120 67752 66868 gene locus_tag LOCUS_09130 67752 66868 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_09130 69159 67864 gene locus_tag LOCUS_09140 69159 67864 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_09140 69601 71052 gene locus_tag LOCUS_09150 69601 71052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 71212 72039 gene locus_tag LOCUS_09160 gene panB 71212 72039 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_09160 72060 72902 gene locus_tag LOCUS_09170 gene panC 72060 72902 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_09170 72914 73315 gene locus_tag LOCUS_09180 72914 73315 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_09180 74319 73369 gene locus_tag LOCUS_09190 gene manA 74319 73369 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294263.1 protein_id gnl|my_center|LOCUS_09190 75118 74393 gene locus_tag LOCUS_09200 75118 74393 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 protein_id gnl|my_center|LOCUS_09200 76439 75171 gene locus_tag LOCUS_09210 gene celB 76439 75171 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 protein_id gnl|my_center|LOCUS_09210 76598 77998 gene locus_tag LOCUS_09220 76598 77998 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922527.1 protein_id gnl|my_center|LOCUS_09220 78488 78171 gene locus_tag LOCUS_09230 78488 78171 CDS product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262791.1 protein_id gnl|my_center|LOCUS_09230 78819 78505 gene locus_tag LOCUS_09240 78819 78505 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029637.1 protein_id gnl|my_center|LOCUS_09240 79054 79518 gene locus_tag LOCUS_09250 gene nrdI 79054 79518 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125401.1 protein_id gnl|my_center|LOCUS_09250 79623 80660 gene locus_tag LOCUS_09260 79623 80660 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450417.1 protein_id gnl|my_center|LOCUS_09260 81746 80931 gene locus_tag LOCUS_09270 81746 80931 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679582.1 protein_id gnl|my_center|LOCUS_09270 84025 81845 gene locus_tag LOCUS_09280 84025 81845 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262358.1 protein_id gnl|my_center|LOCUS_09280 84281 84009 gene locus_tag LOCUS_09290 84281 84009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 85287 84274 gene locus_tag LOCUS_09300 85287 84274 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703033.1 protein_id gnl|my_center|LOCUS_09300 86134 85394 gene locus_tag LOCUS_09310 86134 85394 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188235.1 protein_id gnl|my_center|LOCUS_09310 87115 86135 gene locus_tag LOCUS_09320 gene prmA 87115 86135 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903455.1 protein_id gnl|my_center|LOCUS_09320 87721 87251 gene locus_tag LOCUS_09330 87721 87251 CDS product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262363.1 protein_id gnl|my_center|LOCUS_09330 87786 88280 gene locus_tag LOCUS_09340 87786 88280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262364.1 protein_id gnl|my_center|LOCUS_09340 88270 89538 gene locus_tag LOCUS_09350 88270 89538 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262365.1 protein_id gnl|my_center|LOCUS_09350 89833 89907 gene locus_tag LOCUS_t00070 89833 89907 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 91857 90430 gene locus_tag LOCUS_09360 91857 90430 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837259.1 protein_id gnl|my_center|LOCUS_09360 93109 92150 gene locus_tag LOCUS_09370 93109 92150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 94168 93137 gene locus_tag LOCUS_09380 94168 93137 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476378.1 protein_id gnl|my_center|LOCUS_09380 96044 94704 gene locus_tag LOCUS_09390 96044 94704 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775674.1 protein_id gnl|my_center|LOCUS_09390 97547 96108 gene locus_tag LOCUS_09400 gene abfB 97547 96108 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_09400 98218 97571 gene locus_tag LOCUS_09410 gene fsa 98218 97571 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983569.1 protein_id gnl|my_center|LOCUS_09410 99747 98239 gene locus_tag LOCUS_09420 99747 98239 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287297.1 protein_id gnl|my_center|LOCUS_09420 100986 99793 gene locus_tag LOCUS_09430 100986 99793 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584076.1 protein_id gnl|my_center|LOCUS_09430 103401 100999 gene locus_tag LOCUS_09440 103401 100999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 104420 103458 gene locus_tag LOCUS_09450 104420 103458 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287289.1 protein_id gnl|my_center|LOCUS_09450 105147 104542 gene locus_tag LOCUS_09460 105147 104542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 105986 105153 gene locus_tag LOCUS_09470 105986 105153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_09470 106901 105996 gene locus_tag LOCUS_09480 106901 105996 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_09480 108281 107004 gene locus_tag LOCUS_09490 108281 107004 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776896.1 protein_id gnl|my_center|LOCUS_09490 108697 109587 gene locus_tag LOCUS_09500 108697 109587 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_09500 109869 109627 gene locus_tag LOCUS_09510 109869 109627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 111818 109866 gene locus_tag LOCUS_09520 111818 109866 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101526.1 protein_id gnl|my_center|LOCUS_09520 114340 111971 gene locus_tag LOCUS_09530 114340 111971 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288399.1 protein_id gnl|my_center|LOCUS_09530 115893 114469 gene locus_tag LOCUS_09540 gene araA 115893 114469 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 protein_id gnl|my_center|LOCUS_09540 116635 115934 gene locus_tag LOCUS_09550 116635 115934 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_09550 118231 116645 gene locus_tag LOCUS_09560 118231 116645 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_09560 119486 118413 gene locus_tag LOCUS_09570 119486 118413 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_09570 122131 119630 gene locus_tag LOCUS_09580 gene leuS 122131 119630 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145178.1 protein_id gnl|my_center|LOCUS_09580 123109 122267 gene locus_tag LOCUS_09590 123109 122267 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_09590 123215 123931 gene locus_tag LOCUS_09600 123215 123931 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_09600 124819 124280 gene locus_tag LOCUS_09610 gene nusG 124819 124280 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887149.1 protein_id gnl|my_center|LOCUS_09610 125137 124961 gene locus_tag LOCUS_09620 gene secE 125137 124961 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497678.1 protein_id gnl|my_center|LOCUS_09620 125354 125202 gene locus_tag LOCUS_09630 gene rpmG 125354 125202 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057521.1 protein_id gnl|my_center|LOCUS_09630 127718 125406 gene locus_tag LOCUS_09640 gene pbp2a 127718 125406 CDS product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764803.1 protein_id gnl|my_center|LOCUS_09640 127874 128077 gene locus_tag LOCUS_09650 127874 128077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 128128 128988 gene locus_tag LOCUS_09660 128128 128988 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010476.1 protein_id gnl|my_center|LOCUS_09660 130712 129108 gene locus_tag LOCUS_09670 130712 129108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459236.1 protein_id gnl|my_center|LOCUS_09670 131064 131252 gene locus_tag LOCUS_09680 131064 131252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 131609 131325 gene locus_tag LOCUS_09690 131609 131325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 133389 132514 gene locus_tag LOCUS_09700 133389 132514 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 protein_id gnl|my_center|LOCUS_09700 135140 133512 gene locus_tag LOCUS_09710 gene groL 135140 133512 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029978.1 protein_id gnl|my_center|LOCUS_09710 135475 135191 gene locus_tag LOCUS_09720 gene groES 135475 135191 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917302.1 protein_id gnl|my_center|LOCUS_09720 136456 135653 gene locus_tag LOCUS_09730 136456 135653 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 protein_id gnl|my_center|LOCUS_09730 138402 136456 gene locus_tag LOCUS_09740 138402 136456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 139305 139021 gene locus_tag LOCUS_09750 139305 139021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002928974.1 protein_id gnl|my_center|LOCUS_09750 140166 139333 gene locus_tag LOCUS_09760 140166 139333 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262151.1 protein_id gnl|my_center|LOCUS_09760 141010 140168 gene locus_tag LOCUS_09770 141010 140168 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 protein_id gnl|my_center|LOCUS_09770 141583 141089 gene locus_tag LOCUS_09780 141583 141089 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263460.1 protein_id gnl|my_center|LOCUS_09780 142033 141605 gene locus_tag LOCUS_09790 142033 141605 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263459.1 protein_id gnl|my_center|LOCUS_09790 143500 142199 gene locus_tag LOCUS_09800 143500 142199 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263458.1 protein_id gnl|my_center|LOCUS_09800 144176 143493 gene locus_tag LOCUS_09810 144176 143493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263457.1 protein_id gnl|my_center|LOCUS_09810 145489 144173 gene locus_tag LOCUS_09820 145489 144173 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263456.1 protein_id gnl|my_center|LOCUS_09820 146454 145489 gene locus_tag LOCUS_09830 146454 145489 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263455.1 protein_id gnl|my_center|LOCUS_09830 150542 146622 gene locus_tag LOCUS_09840 150542 146622 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837502.1 protein_id gnl|my_center|LOCUS_09840 151543 150743 gene locus_tag LOCUS_09850 151543 150743 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_09850 152119 151724 gene locus_tag LOCUS_09860 152119 151724 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282447.1 protein_id gnl|my_center|LOCUS_09860 152231 152947 gene locus_tag LOCUS_09870 152231 152947 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186185.1 protein_id gnl|my_center|LOCUS_09870 153659 153033 gene locus_tag LOCUS_09880 153659 153033 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263451.1 protein_id gnl|my_center|LOCUS_09880 153985 153668 gene locus_tag LOCUS_09890 153985 153668 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263450.1 protein_id gnl|my_center|LOCUS_09890 154319 153978 gene locus_tag LOCUS_09900 154319 153978 CDS product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263449.1 protein_id gnl|my_center|LOCUS_09900 154388 155455 gene locus_tag LOCUS_09910 gene pepA 154388 155455 CDS product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921806.1 protein_id gnl|my_center|LOCUS_09910 155547 156287 gene locus_tag LOCUS_09920 gene proC 155547 156287 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921805.1 protein_id gnl|my_center|LOCUS_09920 156973 156338 gene locus_tag LOCUS_09930 156973 156338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 157437 156985 gene locus_tag LOCUS_09940 157437 156985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905673.1 protein_id gnl|my_center|LOCUS_09940 157690 157493 gene locus_tag LOCUS_09950 157690 157493 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_09950 159047 157848 gene locus_tag LOCUS_09960 159047 157848 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911070.1 protein_id gnl|my_center|LOCUS_09960 160057 159101 gene locus_tag LOCUS_09970 160057 159101 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008574.1 protein_id gnl|my_center|LOCUS_09970 160461 160111 gene locus_tag LOCUS_09980 gene comGG 160461 160111 CDS product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601104.1 protein_id gnl|my_center|LOCUS_09980 160870 160433 gene locus_tag LOCUS_09990 gene comGF 160870 160433 CDS product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263440.1 protein_id gnl|my_center|LOCUS_09990 161045 160854 gene locus_tag LOCUS_10000 161045 160854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 161448 161101 gene locus_tag LOCUS_10010 gene comGD 161448 161101 CDS product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074677.1 protein_id gnl|my_center|LOCUS_10010 161818 161516 gene locus_tag LOCUS_10020 gene comGC 161818 161516 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921720.1 protein_id gnl|my_center|LOCUS_10020 162624 161818 gene locus_tag LOCUS_10030 gene comGB 162624 161818 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914479.1 protein_id gnl|my_center|LOCUS_10030 163726 162785 gene locus_tag LOCUS_10040 gene comGA 163726 162785 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250805.1 protein_id gnl|my_center|LOCUS_10040 164163 163795 gene locus_tag LOCUS_10050 164163 163795 CDS product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986560.1 protein_id gnl|my_center|LOCUS_10050 167968 164330 gene locus_tag LOCUS_10060 gene rpoC 167968 164330 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921797.1 protein_id gnl|my_center|LOCUS_10060 171712 168140 gene locus_tag LOCUS_10070 gene rpoB 171712 168140 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907191.1 protein_id gnl|my_center|LOCUS_10070 174379 172058 gene locus_tag LOCUS_10080 gene pbp1b 174379 172058 CDS product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472388.1 protein_id gnl|my_center|LOCUS_10080 174540 175796 gene locus_tag LOCUS_10090 gene tyrS 174540 175796 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922558.1 protein_id gnl|my_center|LOCUS_10090 176685 175867 gene locus_tag LOCUS_10100 176685 175867 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923270.1 protein_id gnl|my_center|LOCUS_10100 177385 176675 gene locus_tag LOCUS_10110 177385 176675 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269501.1 protein_id gnl|my_center|LOCUS_10110 177828 177382 gene locus_tag LOCUS_10120 177828 177382 CDS product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921790.1 protein_id gnl|my_center|LOCUS_10120 178756 177908 gene locus_tag LOCUS_10130 gene ispE 178756 177908 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352368.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence04 947 1681 gene locus_tag LOCUS_10140 947 1681 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814338.1 protein_id gnl|my_center|LOCUS_10140 1692 2150 gene locus_tag LOCUS_10150 1692 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2150 2605 gene locus_tag LOCUS_10160 2150 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2715 3569 gene locus_tag LOCUS_10170 2715 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3576 4457 gene locus_tag LOCUS_10180 3576 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4450 4758 gene locus_tag LOCUS_10190 4450 4758 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926393.1 protein_id gnl|my_center|LOCUS_10190 4925 5185 gene locus_tag LOCUS_10200 4925 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5187 6674 gene locus_tag LOCUS_10210 5187 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 6682 7425 gene locus_tag LOCUS_10220 6682 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7438 7587 gene locus_tag LOCUS_10230 7438 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7659 8093 gene locus_tag LOCUS_10240 7659 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8564 8415 gene locus_tag LOCUS_10250 gene rpmG 8564 8415 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262412.1 protein_id gnl|my_center|LOCUS_10250 8757 8581 gene locus_tag LOCUS_10260 gene rpmF 8757 8581 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290414.1 protein_id gnl|my_center|LOCUS_10260 9035 10312 gene locus_tag LOCUS_10270 gene hisS 9035 10312 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922777.1 protein_id gnl|my_center|LOCUS_10270 10468 12210 gene locus_tag LOCUS_10280 gene aspS 10468 12210 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922776.1 protein_id gnl|my_center|LOCUS_10280 12210 13148 gene locus_tag LOCUS_10290 12210 13148 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857771.1 protein_id gnl|my_center|LOCUS_10290 13192 14058 gene locus_tag LOCUS_10300 13192 14058 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982164.1 protein_id gnl|my_center|LOCUS_10300 14329 15762 gene locus_tag LOCUS_10310 14329 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 17588 15897 gene locus_tag LOCUS_10320 gene argS 17588 15897 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991367.1 protein_id gnl|my_center|LOCUS_10320 17778 18215 gene locus_tag LOCUS_10330 gene argR 17778 18215 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982171.1 protein_id gnl|my_center|LOCUS_10330 18212 18565 gene locus_tag LOCUS_10340 18212 18565 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264540.1 protein_id gnl|my_center|LOCUS_10340 18552 21122 gene locus_tag LOCUS_10350 gene mutS 18552 21122 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118377.1 protein_id gnl|my_center|LOCUS_10350 21236 23179 gene locus_tag LOCUS_10360 gene mutL 21236 23179 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262396.1 protein_id gnl|my_center|LOCUS_10360 23180 23773 gene locus_tag LOCUS_10370 gene ruvA 23180 23773 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992186.1 protein_id gnl|my_center|LOCUS_10370 23803 24360 gene locus_tag LOCUS_10380 23803 24360 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262394.1 protein_id gnl|my_center|LOCUS_10380 24483 25685 gene locus_tag LOCUS_10390 24483 25685 CDS product HP1165 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944753.1 protein_id gnl|my_center|LOCUS_10390 25799 27058 gene locus_tag LOCUS_10400 25799 27058 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922754.1 protein_id gnl|my_center|LOCUS_10400 27108 28262 gene locus_tag LOCUS_10410 gene recA 27108 28262 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085741.1 protein_id gnl|my_center|LOCUS_10410 28460 28858 gene locus_tag LOCUS_10420 gene spx 28460 28858 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982188.1 protein_id gnl|my_center|LOCUS_10420 29088 29357 gene locus_tag LOCUS_10430 29088 29357 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262386.1 protein_id gnl|my_center|LOCUS_10430 29363 29773 gene locus_tag LOCUS_10440 gene ruvX 29363 29773 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222109.1 protein_id gnl|my_center|LOCUS_10440 29806 30123 gene locus_tag LOCUS_10450 29806 30123 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940932.1 protein_id gnl|my_center|LOCUS_10450 30223 30351 gene locus_tag LOCUS_10460 30223 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 30394 31968 gene locus_tag LOCUS_10470 30394 31968 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922751.1 protein_id gnl|my_center|LOCUS_10470 32069 34285 gene locus_tag LOCUS_10480 gene nrdD 32069 34285 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989504.1 protein_id gnl|my_center|LOCUS_10480 34385 34531 gene locus_tag LOCUS_10490 34385 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262380.1 protein_id gnl|my_center|LOCUS_10490 34543 35046 gene locus_tag LOCUS_10500 34543 35046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262379.1 protein_id gnl|my_center|LOCUS_10500 35063 35677 gene locus_tag LOCUS_10510 gene nrdG 35063 35677 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982219.1 protein_id gnl|my_center|LOCUS_10510 36166 35996 gene locus_tag LOCUS_10520 36166 35996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 36913 36302 gene locus_tag LOCUS_10530 36913 36302 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592593.1 protein_id gnl|my_center|LOCUS_10530 37312 37590 gene locus_tag LOCUS_10540 37312 37590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938694.1 protein_id gnl|my_center|LOCUS_10540 37609 38223 gene locus_tag LOCUS_10550 gene lepB 37609 38223 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_10550 38426 42802 gene locus_tag LOCUS_10560 38426 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 42944 44437 gene locus_tag LOCUS_10570 42944 44437 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_10570 44557 45384 gene locus_tag LOCUS_10580 44557 45384 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 protein_id gnl|my_center|LOCUS_10580 45491 47386 gene locus_tag LOCUS_10590 45491 47386 CDS product endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599038.1 protein_id gnl|my_center|LOCUS_10590 47647 48513 gene locus_tag LOCUS_10600 47647 48513 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 protein_id gnl|my_center|LOCUS_10600 49951 50021 gene locus_tag LOCUS_t00080 49951 50021 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 50287 51054 gene locus_tag LOCUS_10610 gene rpsB 50287 51054 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268454.1 protein_id gnl|my_center|LOCUS_10610 51161 52198 gene locus_tag LOCUS_10620 gene tsf 51161 52198 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 protein_id gnl|my_center|LOCUS_10620 53003 52539 gene locus_tag LOCUS_10630 53003 52539 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_10630 53263 53724 gene locus_tag LOCUS_10640 53263 53724 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985641.1 protein_id gnl|my_center|LOCUS_10640 53721 56162 gene locus_tag LOCUS_10650 53721 56162 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020289.1 protein_id gnl|my_center|LOCUS_10650 57212 56235 gene locus_tag LOCUS_10660 gene dusB 57212 56235 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987812.1 protein_id gnl|my_center|LOCUS_10660 58071 57205 gene locus_tag LOCUS_10670 gene hslO 58071 57205 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262034.1 protein_id gnl|my_center|LOCUS_10670 59459 58185 gene locus_tag LOCUS_10680 59459 58185 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285393.1 protein_id gnl|my_center|LOCUS_10680 60296 59478 gene locus_tag LOCUS_10690 60296 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921826.1 protein_id gnl|my_center|LOCUS_10690 62643 60394 gene locus_tag LOCUS_10700 gene gshAB 62643 60394 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582678.1 protein_id gnl|my_center|LOCUS_10700 63048 64340 gene locus_tag LOCUS_10710 63048 64340 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205037.1 protein_id gnl|my_center|LOCUS_10710 65323 64409 gene locus_tag LOCUS_10720 65323 64409 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_10720 65395 67587 gene locus_tag LOCUS_10730 65395 67587 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 protein_id gnl|my_center|LOCUS_10730 67589 69004 gene locus_tag LOCUS_10740 67589 69004 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 protein_id gnl|my_center|LOCUS_10740 69172 70419 gene locus_tag LOCUS_10750 69172 70419 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037328452.1 protein_id gnl|my_center|LOCUS_10750 70553 71497 gene locus_tag LOCUS_10760 70553 71497 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_10760 72187 71540 gene locus_tag LOCUS_10770 72187 71540 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_10770 72897 72199 gene locus_tag LOCUS_10780 72897 72199 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966717.1 protein_id gnl|my_center|LOCUS_10780 73010 73609 gene locus_tag LOCUS_10790 73010 73609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 73890 76526 gene locus_tag LOCUS_10800 gene polA 73890 76526 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263533.1 protein_id gnl|my_center|LOCUS_10800 76615 77037 gene locus_tag LOCUS_10810 76615 77037 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263534.1 protein_id gnl|my_center|LOCUS_10810 77255 77752 gene locus_tag LOCUS_10820 gene perR 77255 77752 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986328.1 protein_id gnl|my_center|LOCUS_10820 78573 77821 gene locus_tag LOCUS_10830 78573 77821 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185054.1 protein_id gnl|my_center|LOCUS_10830 78838 79980 gene locus_tag LOCUS_10840 gene tgt 78838 79980 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921852.1 protein_id gnl|my_center|LOCUS_10840 80429 80971 gene locus_tag LOCUS_10850 80429 80971 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469149.1 protein_id gnl|my_center|LOCUS_10850 81047 81823 gene locus_tag LOCUS_10860 81047 81823 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262914.1 protein_id gnl|my_center|LOCUS_10860 81823 82329 gene locus_tag LOCUS_10870 gene tadA 81823 82329 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027934.1 protein_id gnl|my_center|LOCUS_10870 82644 83993 gene locus_tag LOCUS_10880 82644 83993 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148892.1 protein_id gnl|my_center|LOCUS_10880 84131 84781 gene locus_tag LOCUS_10890 84131 84781 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903682.1 protein_id gnl|my_center|LOCUS_10890 84981 85679 gene locus_tag LOCUS_10900 gene dapD 84981 85679 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262903.1 protein_id gnl|my_center|LOCUS_10900 85737 86873 gene locus_tag LOCUS_10910 85737 86873 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262527.1 protein_id gnl|my_center|LOCUS_10910 87153 87680 gene locus_tag LOCUS_10920 87153 87680 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412414.1 protein_id gnl|my_center|LOCUS_10920 87677 88348 gene locus_tag LOCUS_10930 87677 88348 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262525.1 protein_id gnl|my_center|LOCUS_10930 89317 88397 gene locus_tag LOCUS_10940 gene galU 89317 88397 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262524.1 protein_id gnl|my_center|LOCUS_10940 90405 89389 gene locus_tag LOCUS_10950 90405 89389 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986123.1 protein_id gnl|my_center|LOCUS_10950 90611 91378 gene locus_tag LOCUS_10960 90611 91378 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986113.1 protein_id gnl|my_center|LOCUS_10960 91405 91851 gene locus_tag LOCUS_10970 91405 91851 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_10970 92061 93248 gene locus_tag LOCUS_10980 gene radA 92061 93248 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085195.1 protein_id gnl|my_center|LOCUS_10980 93365 93862 gene locus_tag LOCUS_10990 93365 93862 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_10990 93891 94817 gene locus_tag LOCUS_11000 93891 94817 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269460.1 protein_id gnl|my_center|LOCUS_11000 94996 96453 gene locus_tag LOCUS_11010 gene gltX 94996 96453 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031057.1 protein_id gnl|my_center|LOCUS_11010 96650 97816 gene locus_tag LOCUS_11020 96650 97816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837692.1 protein_id gnl|my_center|LOCUS_11020 98033 99223 gene locus_tag LOCUS_11030 98033 99223 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262513.1 protein_id gnl|my_center|LOCUS_11030 99659 101041 gene locus_tag LOCUS_11040 gene argH 99659 101041 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262512.1 protein_id gnl|my_center|LOCUS_11040 101193 101552 gene locus_tag LOCUS_11050 gene rnpA 101193 101552 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262511.1 protein_id gnl|my_center|LOCUS_11050 101536 102351 gene locus_tag LOCUS_11060 101536 102351 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921871.1 protein_id gnl|my_center|LOCUS_11060 102364 103374 gene locus_tag LOCUS_11070 102364 103374 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310832.1 protein_id gnl|my_center|LOCUS_11070 103493 104344 gene locus_tag LOCUS_11080 103493 104344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 protein_id gnl|my_center|LOCUS_11080 104346 104696 gene locus_tag LOCUS_11090 104346 104696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11090 104703 105185 gene locus_tag LOCUS_11100 104703 105185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 105199 105654 gene locus_tag LOCUS_11110 105199 105654 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_11110 105665 106063 gene locus_tag LOCUS_11120 105665 106063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 106170 106304 gene locus_tag LOCUS_11130 gene rpmH 106170 106304 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885866.1 protein_id gnl|my_center|LOCUS_11130 106430 106639 gene locus_tag LOCUS_11140 106430 106639 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982507.1 protein_id gnl|my_center|LOCUS_11140 106799 106972 gene locus_tag LOCUS_11150 106799 106972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 107345 108058 gene locus_tag LOCUS_11160 gene bglS 107345 108058 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 protein_id gnl|my_center|LOCUS_11160 110668 108257 gene locus_tag LOCUS_11170 110668 108257 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_11170 113388 110689 gene locus_tag LOCUS_11180 113388 110689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 113767 115134 gene locus_tag LOCUS_11190 113767 115134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 115291 116235 gene locus_tag LOCUS_11200 115291 116235 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_11200 116235 117080 gene locus_tag LOCUS_11210 116235 117080 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_11210 117104 118402 gene locus_tag LOCUS_11220 117104 118402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 118421 119062 gene locus_tag LOCUS_11230 gene bglS 118421 119062 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244531.1 protein_id gnl|my_center|LOCUS_11230 119168 119962 gene locus_tag LOCUS_11240 119168 119962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 120262 120951 gene locus_tag LOCUS_11250 120262 120951 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_11250 120948 122129 gene locus_tag LOCUS_11260 120948 122129 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490535.1 protein_id gnl|my_center|LOCUS_11260 122130 122252 gene locus_tag LOCUS_11270 122130 122252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 122268 123803 gene locus_tag LOCUS_11280 gene dltA 122268 123803 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581010.1 protein_id gnl|my_center|LOCUS_11280 123800 125062 gene locus_tag LOCUS_11290 gene dltB 123800 125062 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262583.1 protein_id gnl|my_center|LOCUS_11290 125092 125331 gene locus_tag LOCUS_11300 gene dltC 125092 125331 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262584.1 protein_id gnl|my_center|LOCUS_11300 125324 126589 gene locus_tag LOCUS_11310 gene dltD 125324 126589 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919740.1 protein_id gnl|my_center|LOCUS_11310 127514 126633 gene locus_tag LOCUS_11320 gene mleR 127514 126633 CDS product LysR family transcriptional regulator MleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263592.1 protein_id gnl|my_center|LOCUS_11320 127673 129295 gene locus_tag LOCUS_11330 127673 129295 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905616.1 protein_id gnl|my_center|LOCUS_11330 129317 130588 gene locus_tag LOCUS_11340 129317 130588 CDS product citrate:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905617.1 protein_id gnl|my_center|LOCUS_11340 132381 130816 gene locus_tag LOCUS_11350 132381 130816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906017.1 protein_id gnl|my_center|LOCUS_11350 132529 133299 gene locus_tag LOCUS_11360 132529 133299 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267315.1 protein_id gnl|my_center|LOCUS_11360 133292 133861 gene locus_tag LOCUS_11370 gene rnmV 133292 133861 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267314.1 protein_id gnl|my_center|LOCUS_11370 133858 134382 gene locus_tag LOCUS_11380 133858 134382 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910909.1 protein_id gnl|my_center|LOCUS_11380 134464 135336 gene locus_tag LOCUS_11390 gene rsmA 134464 135336 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991156.1 protein_id gnl|my_center|LOCUS_11390 135903 136082 gene locus_tag LOCUS_11400 135903 136082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 137487 136108 gene locus_tag LOCUS_11410 137487 136108 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905095.1 protein_id gnl|my_center|LOCUS_11410 139644 137497 gene locus_tag LOCUS_11420 139644 137497 CDS product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082313.1 protein_id gnl|my_center|LOCUS_11420 139879 140118 gene locus_tag LOCUS_11430 139879 140118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 140130 140432 gene locus_tag LOCUS_11440 140130 140432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 140593 141591 gene locus_tag LOCUS_11450 140593 141591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 141830 142147 gene locus_tag LOCUS_11460 141830 142147 CDS product DUF3884 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471579.1 protein_id gnl|my_center|LOCUS_11460 142452 143183 gene locus_tag LOCUS_11470 142452 143183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 protein_id gnl|my_center|LOCUS_11470 143188 144513 gene locus_tag LOCUS_11480 143188 144513 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_11480 144689 144537 gene locus_tag LOCUS_11490 144689 144537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 144889 145173 gene locus_tag LOCUS_11500 144889 145173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 145193 145498 gene locus_tag LOCUS_11510 145193 145498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 145529 145822 gene locus_tag LOCUS_11520 145529 145822 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence05 1230 184 gene locus_tag LOCUS_11530 gene rfbB 1230 184 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263087.1 protein_id gnl|my_center|LOCUS_11530 2003 1407 gene locus_tag LOCUS_11540 2003 1407 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264623.1 protein_id gnl|my_center|LOCUS_11540 2872 2003 gene locus_tag LOCUS_11550 gene rfbA 2872 2003 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_11550 3794 3006 gene locus_tag LOCUS_11560 3794 3006 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263082.1 protein_id gnl|my_center|LOCUS_11560 4467 3784 gene locus_tag LOCUS_11570 4467 3784 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990104.1 protein_id gnl|my_center|LOCUS_11570 5208 4558 gene locus_tag LOCUS_11580 gene nth 5208 4558 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922193.1 protein_id gnl|my_center|LOCUS_11580 5882 5208 gene locus_tag LOCUS_11590 5882 5208 CDS product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263080.1 protein_id gnl|my_center|LOCUS_11590 6905 5961 gene locus_tag LOCUS_11600 gene metA 6905 5961 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263079.1 protein_id gnl|my_center|LOCUS_11600 7531 7013 gene locus_tag LOCUS_11610 7531 7013 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263078.1 protein_id gnl|my_center|LOCUS_11610 8611 7634 gene locus_tag LOCUS_11620 gene bsh 8611 7634 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355428.1 protein_id gnl|my_center|LOCUS_11620 10963 8765 gene locus_tag LOCUS_11630 gene recJ 10963 8765 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622237.1 protein_id gnl|my_center|LOCUS_11630 11757 10999 gene locus_tag LOCUS_11640 11757 10999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263858.1 protein_id gnl|my_center|LOCUS_11640 12683 11754 gene locus_tag LOCUS_11650 gene rnz 12683 11754 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405386.1 protein_id gnl|my_center|LOCUS_11650 13362 12721 gene locus_tag LOCUS_11660 13362 12721 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263071.1 protein_id gnl|my_center|LOCUS_11660 14593 13355 gene locus_tag LOCUS_11670 gene hflX 14593 13355 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573348.1 protein_id gnl|my_center|LOCUS_11670 15581 14682 gene locus_tag LOCUS_11680 gene miaA 15581 14682 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226482.1 protein_id gnl|my_center|LOCUS_11680 15768 15944 gene locus_tag LOCUS_11690 15768 15944 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239229.1 protein_id gnl|my_center|LOCUS_11690 16736 16002 gene locus_tag LOCUS_11700 16736 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263062.1 protein_id gnl|my_center|LOCUS_11700 17205 16765 gene locus_tag LOCUS_11710 17205 16765 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_11710 17393 18538 gene locus_tag LOCUS_11720 17393 18538 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 protein_id gnl|my_center|LOCUS_11720 22243 18617 gene locus_tag LOCUS_11730 gene addA 22243 18617 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262919.1 protein_id gnl|my_center|LOCUS_11730 25478 22233 gene locus_tag LOCUS_11740 gene rexB 25478 22233 CDS product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262920.1 protein_id gnl|my_center|LOCUS_11740 28021 25616 gene locus_tag LOCUS_11750 gene pheT 28021 25616 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352339.1 protein_id gnl|my_center|LOCUS_11750 28615 28091 gene locus_tag LOCUS_11760 28615 28091 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078400.1 protein_id gnl|my_center|LOCUS_11760 29690 28647 gene locus_tag LOCUS_11770 gene pheS 29690 28647 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262925.1 protein_id gnl|my_center|LOCUS_11770 30845 29979 gene locus_tag LOCUS_11780 30845 29979 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262935.1 protein_id gnl|my_center|LOCUS_11780 31132 30944 gene locus_tag LOCUS_11790 31132 30944 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168511.1 protein_id gnl|my_center|LOCUS_11790 32409 31135 gene locus_tag LOCUS_11800 gene murA 32409 31135 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357877.1 protein_id gnl|my_center|LOCUS_11800 32708 32472 gene locus_tag LOCUS_11810 32708 32472 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602601.1 protein_id gnl|my_center|LOCUS_11810 33266 32850 gene locus_tag LOCUS_11820 33266 32850 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003050138.1 protein_id gnl|my_center|LOCUS_11820 34685 33279 gene locus_tag LOCUS_11830 gene atpD 34685 33279 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262940.1 protein_id gnl|my_center|LOCUS_11830 35626 34751 gene locus_tag LOCUS_11840 35626 34751 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919085.1 protein_id gnl|my_center|LOCUS_11840 37146 35641 gene locus_tag LOCUS_11850 gene atpA 37146 35641 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996613.1 protein_id gnl|my_center|LOCUS_11850 37698 37162 gene locus_tag LOCUS_11860 37698 37162 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922118.1 protein_id gnl|my_center|LOCUS_11860 38195 37698 gene locus_tag LOCUS_11870 gene atpF 38195 37698 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025478.1 protein_id gnl|my_center|LOCUS_11870 38929 38210 gene locus_tag LOCUS_11880 gene atpB 38929 38210 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446421.1 protein_id gnl|my_center|LOCUS_11880 39170 38967 gene locus_tag LOCUS_11890 39170 38967 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262946.1 protein_id gnl|my_center|LOCUS_11890 40532 39507 gene locus_tag LOCUS_11900 40532 39507 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744293.1 protein_id gnl|my_center|LOCUS_11900 42507 40549 gene locus_tag LOCUS_11910 gene ligA 42507 40549 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880222.1 protein_id gnl|my_center|LOCUS_11910 43120 42611 gene locus_tag LOCUS_11920 43120 42611 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737071.1 protein_id gnl|my_center|LOCUS_11920 43264 43689 gene locus_tag LOCUS_11930 43264 43689 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262957.1 protein_id gnl|my_center|LOCUS_11930 44619 43702 gene locus_tag LOCUS_11940 44619 43702 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768440.1 protein_id gnl|my_center|LOCUS_11940 45483 44623 gene locus_tag LOCUS_11950 45483 44623 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631567.1 protein_id gnl|my_center|LOCUS_11950 46895 45609 gene locus_tag LOCUS_11960 gene spxR 46895 45609 CDS product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033788.1 protein_id gnl|my_center|LOCUS_11960 47442 46888 gene locus_tag LOCUS_11970 47442 46888 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355953.1 protein_id gnl|my_center|LOCUS_11970 48790 47531 gene locus_tag LOCUS_11980 48790 47531 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226242.1 protein_id gnl|my_center|LOCUS_11980 49912 49073 gene locus_tag LOCUS_11990 49912 49073 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837044.1 protein_id gnl|my_center|LOCUS_11990 51225 50035 gene locus_tag LOCUS_12000 gene metK 51225 50035 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837180.1 protein_id gnl|my_center|LOCUS_12000 51672 52607 gene locus_tag LOCUS_12010 gene birA 51672 52607 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262808.1 protein_id gnl|my_center|LOCUS_12010 54544 52865 gene locus_tag LOCUS_12020 gene dnaX 54544 52865 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283819.1 protein_id gnl|my_center|LOCUS_12020 55041 54544 gene locus_tag LOCUS_12030 55041 54544 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043210.1 protein_id gnl|my_center|LOCUS_12030 55751 55161 gene locus_tag LOCUS_12040 gene leuD 55751 55161 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909937.1 protein_id gnl|my_center|LOCUS_12040 57152 55764 gene locus_tag LOCUS_12050 gene leuC 57152 55764 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836839.1 protein_id gnl|my_center|LOCUS_12050 58488 57451 gene locus_tag LOCUS_12060 gene leuB 58488 57451 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262707.1 protein_id gnl|my_center|LOCUS_12060 60101 58536 gene locus_tag LOCUS_12070 60101 58536 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262708.1 protein_id gnl|my_center|LOCUS_12070 61038 60406 gene locus_tag LOCUS_12080 gene udk 61038 60406 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227823.1 protein_id gnl|my_center|LOCUS_12080 61193 62278 gene locus_tag LOCUS_12090 61193 62278 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628861.1 protein_id gnl|my_center|LOCUS_12090 66893 62319 gene locus_tag LOCUS_12100 66893 62319 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093389.1 protein_id gnl|my_center|LOCUS_12100 68741 67098 gene locus_tag LOCUS_12110 68741 67098 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_12110 70345 68915 gene locus_tag LOCUS_12120 gene gapN 70345 68915 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262986.1 protein_id gnl|my_center|LOCUS_12120 72352 70619 gene locus_tag LOCUS_12130 gene ptsP 72352 70619 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138135.1 protein_id gnl|my_center|LOCUS_12130 72620 72357 gene locus_tag LOCUS_12140 72620 72357 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146945.1 protein_id gnl|my_center|LOCUS_12140 73695 72892 gene locus_tag LOCUS_12150 73695 72892 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352228.1 protein_id gnl|my_center|LOCUS_12150 74949 73774 gene locus_tag LOCUS_12160 gene icd 74949 73774 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603126.1 protein_id gnl|my_center|LOCUS_12160 76092 74974 gene locus_tag LOCUS_12170 76092 74974 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261870.1 protein_id gnl|my_center|LOCUS_12170 78759 76096 gene locus_tag LOCUS_12180 gene acnA 78759 76096 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836671.1 protein_id gnl|my_center|LOCUS_12180 79043 79270 gene locus_tag LOCUS_12190 79043 79270 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719060.1 protein_id gnl|my_center|LOCUS_12190 79331 81490 gene locus_tag LOCUS_12200 gene nrdE 79331 81490 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261873.1 protein_id gnl|my_center|LOCUS_12200 81717 82679 gene locus_tag LOCUS_12210 gene nrdF 81717 82679 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987365.1 protein_id gnl|my_center|LOCUS_12210 82924 83490 gene locus_tag LOCUS_12220 gene thiT 82924 83490 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042137.1 protein_id gnl|my_center|LOCUS_12220 84015 83548 gene locus_tag LOCUS_12230 gene ribE 84015 83548 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_12230 85206 84028 gene locus_tag LOCUS_12240 85206 84028 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 protein_id gnl|my_center|LOCUS_12240 85809 85207 gene locus_tag LOCUS_12250 gene ribE 85809 85207 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_12250 86864 85809 gene locus_tag LOCUS_12260 gene ribD 86864 85809 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131960.1 protein_id gnl|my_center|LOCUS_12260 88118 87348 gene locus_tag LOCUS_12270 88118 87348 CDS product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904127.1 protein_id gnl|my_center|LOCUS_12270 88483 88115 gene locus_tag LOCUS_12280 88483 88115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 89196 88630 gene locus_tag LOCUS_12290 89196 88630 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 protein_id gnl|my_center|LOCUS_12290 90412 89282 gene locus_tag LOCUS_12300 90412 89282 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 protein_id gnl|my_center|LOCUS_12300 91163 90429 gene locus_tag LOCUS_12310 gene argB 91163 90429 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261876.1 protein_id gnl|my_center|LOCUS_12310 92369 91176 gene locus_tag LOCUS_12320 gene argJ 92369 91176 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261877.1 protein_id gnl|my_center|LOCUS_12320 93442 92420 gene locus_tag LOCUS_12330 gene argC 93442 92420 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261878.1 protein_id gnl|my_center|LOCUS_12330 94265 93570 gene locus_tag LOCUS_12340 94265 93570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488859.1 protein_id gnl|my_center|LOCUS_12340 95088 94255 gene locus_tag LOCUS_12350 95088 94255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837496.1 protein_id gnl|my_center|LOCUS_12350 96434 95262 gene locus_tag LOCUS_12360 96434 95262 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 protein_id gnl|my_center|LOCUS_12360 97229 96447 gene locus_tag LOCUS_12370 97229 96447 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_12370 98366 97386 gene locus_tag LOCUS_12380 98366 97386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 98652 98467 gene locus_tag LOCUS_12390 98652 98467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 101272 98654 gene locus_tag LOCUS_12400 gene alaS 101272 98654 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261891.1 protein_id gnl|my_center|LOCUS_12400 102682 101621 gene locus_tag LOCUS_12410 gene prsA 102682 101621 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857822.1 protein_id gnl|my_center|LOCUS_12410 103452 102751 gene locus_tag LOCUS_12420 103452 102751 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250853.1 protein_id gnl|my_center|LOCUS_12420 104115 103504 gene locus_tag LOCUS_12430 104115 103504 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261895.1 protein_id gnl|my_center|LOCUS_12430 104632 104117 gene locus_tag LOCUS_12440 104632 104117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130700.1 protein_id gnl|my_center|LOCUS_12440 106504 104702 gene locus_tag LOCUS_12450 gene pepF 106504 104702 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282902.1 protein_id gnl|my_center|LOCUS_12450 107466 106504 gene locus_tag LOCUS_12460 107466 106504 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261897.1 protein_id gnl|my_center|LOCUS_12460 108232 107516 gene locus_tag LOCUS_12470 108232 107516 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261903.1 protein_id gnl|my_center|LOCUS_12470 108969 108265 gene locus_tag LOCUS_12480 gene nagB 108969 108265 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922428.1 protein_id gnl|my_center|LOCUS_12480 109609 109103 gene locus_tag LOCUS_12490 109609 109103 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_12490 109769 110797 gene locus_tag LOCUS_12500 gene queA 109769 110797 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095273.1 protein_id gnl|my_center|LOCUS_12500 111568 110843 gene locus_tag LOCUS_12510 111568 110843 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287391.1 protein_id gnl|my_center|LOCUS_12510 112285 111674 gene locus_tag LOCUS_12520 gene sodA 112285 111674 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261912.1 protein_id gnl|my_center|LOCUS_12520 113419 112382 gene locus_tag LOCUS_12530 gene holA 113419 112382 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261913.1 protein_id gnl|my_center|LOCUS_12530 115547 113487 gene locus_tag LOCUS_12540 115547 113487 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261915.1 protein_id gnl|my_center|LOCUS_12540 116391 115711 gene locus_tag LOCUS_12550 116391 115711 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261916.1 protein_id gnl|my_center|LOCUS_12550 117233 116487 gene locus_tag LOCUS_12560 117233 116487 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912008.1 protein_id gnl|my_center|LOCUS_12560 117352 118113 gene locus_tag LOCUS_12570 117352 118113 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567425.1 protein_id gnl|my_center|LOCUS_12570 118088 118363 gene locus_tag LOCUS_12580 118088 118363 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598736.1 protein_id gnl|my_center|LOCUS_12580 119267 118377 gene locus_tag LOCUS_12590 119267 118377 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101842.1 protein_id gnl|my_center|LOCUS_12590 120143 119277 gene locus_tag LOCUS_12600 120143 119277 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_12600 121372 120173 gene locus_tag LOCUS_12610 121372 120173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_12610 121633 122523 gene locus_tag LOCUS_12620 121633 122523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_12620 124175 122601 gene locus_tag LOCUS_12630 124175 122601 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263748.1 protein_id gnl|my_center|LOCUS_12630 125862 124531 gene locus_tag LOCUS_12640 125862 124531 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174832.1 protein_id gnl|my_center|LOCUS_12640 126073 125852 gene locus_tag LOCUS_12650 126073 125852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12650 127370 126222 gene locus_tag LOCUS_12660 127370 126222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 128746 127382 gene locus_tag LOCUS_12670 128746 127382 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777517.1 protein_id gnl|my_center|LOCUS_12670 128993 129550 gene locus_tag LOCUS_12680 128993 129550 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263248.1 protein_id gnl|my_center|LOCUS_12680 130676 129630 gene locus_tag LOCUS_12690 130676 129630 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775216.1 protein_id gnl|my_center|LOCUS_12690 131261 130899 gene locus_tag LOCUS_12700 131261 130899 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_12700 131967 131371 gene locus_tag LOCUS_12710 gene recR 131967 131371 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966735.1 protein_id gnl|my_center|LOCUS_12710 134106 132028 gene locus_tag LOCUS_12720 gene pbp2b 134106 132028 CDS product penicillin-binding protein PBP2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263251.1 protein_id gnl|my_center|LOCUS_12720 134511 134278 gene locus_tag LOCUS_12730 134511 134278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12730 134826 134518 gene locus_tag LOCUS_12740 134826 134518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12740 135528 135007 gene locus_tag LOCUS_12750 135528 135007 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983930.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence06 724 131 gene locus_tag LOCUS_12760 gene lepB 724 131 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983074.1 protein_id gnl|my_center|LOCUS_12760 1639 740 gene locus_tag LOCUS_12770 gene rnhC 1639 740 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092527.1 protein_id gnl|my_center|LOCUS_12770 1760 2068 gene locus_tag LOCUS_12780 1760 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448289.1 protein_id gnl|my_center|LOCUS_12780 2074 2622 gene locus_tag LOCUS_12790 2074 2622 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922634.1 protein_id gnl|my_center|LOCUS_12790 2731 5067 gene locus_tag LOCUS_12800 2731 5067 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060323.1 protein_id gnl|my_center|LOCUS_12800 5340 5636 gene locus_tag LOCUS_12810 5340 5636 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985093.1 protein_id gnl|my_center|LOCUS_12810 6631 5711 gene locus_tag LOCUS_12820 gene nadA 6631 5711 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_12820 6885 8189 gene locus_tag LOCUS_12830 6885 8189 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_12830 8215 9078 gene locus_tag LOCUS_12840 gene nadC 8215 9078 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_12840 9645 9148 gene locus_tag LOCUS_12850 9645 9148 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074563.1 protein_id gnl|my_center|LOCUS_12850 9888 10202 gene locus_tag LOCUS_12860 gene trxA 9888 10202 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263363.1 protein_id gnl|my_center|LOCUS_12860 10489 11532 gene locus_tag LOCUS_12870 10489 11532 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101497.1 protein_id gnl|my_center|LOCUS_12870 11798 11992 gene locus_tag LOCUS_12880 11798 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11999 12409 gene locus_tag LOCUS_12890 11999 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12422 12829 gene locus_tag LOCUS_12900 12422 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12842 13249 gene locus_tag LOCUS_12910 12842 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 13362 13811 gene locus_tag LOCUS_12920 13362 13811 CDS product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476157.1 protein_id gnl|my_center|LOCUS_12920 13815 14450 gene locus_tag LOCUS_12930 13815 14450 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 protein_id gnl|my_center|LOCUS_12930 14521 14901 gene locus_tag LOCUS_12940 14521 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 15049 15477 gene locus_tag LOCUS_12950 15049 15477 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002272932.1 protein_id gnl|my_center|LOCUS_12950 18240 15826 gene locus_tag LOCUS_12960 18240 15826 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262027.1 protein_id gnl|my_center|LOCUS_12960 18851 18252 gene locus_tag LOCUS_12970 18851 18252 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262026.1 protein_id gnl|my_center|LOCUS_12970 20146 19001 gene locus_tag LOCUS_12980 gene mutY 20146 19001 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263365.1 protein_id gnl|my_center|LOCUS_12980 21318 21587 gene locus_tag LOCUS_12990 21318 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194478.1 protein_id gnl|my_center|LOCUS_12990 21574 22158 gene locus_tag LOCUS_13000 gene lepB 21574 22158 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774995.1 protein_id gnl|my_center|LOCUS_13000 22214 27139 gene locus_tag LOCUS_13010 22214 27139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 27211 28605 gene locus_tag LOCUS_13020 27211 28605 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775505.1 protein_id gnl|my_center|LOCUS_13020 28828 29640 gene locus_tag LOCUS_13030 28828 29640 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_13030 29814 29978 gene locus_tag LOCUS_13040 29814 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 30187 30477 gene locus_tag LOCUS_13050 gene rpsF 30187 30477 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151773.1 protein_id gnl|my_center|LOCUS_13050 30489 30995 gene locus_tag LOCUS_13060 30489 30995 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609585.1 protein_id gnl|my_center|LOCUS_13060 31055 31294 gene locus_tag LOCUS_13070 gene rpsR 31055 31294 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 protein_id gnl|my_center|LOCUS_13070 31442 31966 gene locus_tag LOCUS_13080 31442 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 31968 32192 gene locus_tag LOCUS_13090 31968 32192 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774957.1 protein_id gnl|my_center|LOCUS_13090 32179 32610 gene locus_tag LOCUS_13100 32179 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 33306 32650 gene locus_tag LOCUS_13110 33306 32650 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922629.1 protein_id gnl|my_center|LOCUS_13110 34583 33639 gene locus_tag LOCUS_13120 34583 33639 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983147.1 protein_id gnl|my_center|LOCUS_13120 34872 37697 gene locus_tag LOCUS_13130 gene uvrA 34872 37697 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922628.1 protein_id gnl|my_center|LOCUS_13130 37752 39050 gene locus_tag LOCUS_13140 37752 39050 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265226.1 protein_id gnl|my_center|LOCUS_13140 39184 40245 gene locus_tag LOCUS_13150 39184 40245 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775324.1 protein_id gnl|my_center|LOCUS_13150 40276 40740 gene locus_tag LOCUS_13160 40276 40740 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988493.1 protein_id gnl|my_center|LOCUS_13160 41093 40779 gene locus_tag LOCUS_13170 41093 40779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987097.1 protein_id gnl|my_center|LOCUS_13170 41277 41837 gene locus_tag LOCUS_13180 gene efp 41277 41837 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262662.1 protein_id gnl|my_center|LOCUS_13180 41916 42305 gene locus_tag LOCUS_13190 41916 42305 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 protein_id gnl|my_center|LOCUS_13190 42298 42726 gene locus_tag LOCUS_13200 gene nusB 42298 42726 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204940.1 protein_id gnl|my_center|LOCUS_13200 43778 42816 gene locus_tag LOCUS_13210 43778 42816 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367770.1 protein_id gnl|my_center|LOCUS_13210 45219 43780 gene locus_tag LOCUS_13220 45219 43780 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367771.1 protein_id gnl|my_center|LOCUS_13220 45416 47374 gene locus_tag LOCUS_13230 45416 47374 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370258.1 protein_id gnl|my_center|LOCUS_13230 47529 48410 gene locus_tag LOCUS_13240 47529 48410 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262656.1 protein_id gnl|my_center|LOCUS_13240 48708 49820 gene locus_tag LOCUS_13250 48708 49820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 49817 51229 gene locus_tag LOCUS_13260 49817 51229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 51321 52352 gene locus_tag LOCUS_13270 51321 52352 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 protein_id gnl|my_center|LOCUS_13270 52355 53410 gene locus_tag LOCUS_13280 52355 53410 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027207.1 protein_id gnl|my_center|LOCUS_13280 53529 53882 gene locus_tag LOCUS_13290 gene acpS 53529 53882 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635015.1 protein_id gnl|my_center|LOCUS_13290 53956 55062 gene locus_tag LOCUS_13300 gene alr 53956 55062 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625941.1 protein_id gnl|my_center|LOCUS_13300 55152 57167 gene locus_tag LOCUS_13310 gene recG 55152 57167 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926633.1 protein_id gnl|my_center|LOCUS_13310 57658 58125 gene locus_tag LOCUS_13320 57658 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 58182 58682 gene locus_tag LOCUS_13330 58182 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 58699 58914 gene locus_tag LOCUS_13340 58699 58914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 58926 59135 gene locus_tag LOCUS_13350 58926 59135 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894739.1 protein_id gnl|my_center|LOCUS_13350 59338 59841 gene locus_tag LOCUS_13360 59338 59841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 60868 59906 gene locus_tag LOCUS_13370 60868 59906 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263467.1 protein_id gnl|my_center|LOCUS_13370 60939 62342 gene locus_tag LOCUS_13380 60939 62342 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974899.1 protein_id gnl|my_center|LOCUS_13380 62877 62425 gene locus_tag LOCUS_13390 62877 62425 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992571.1 protein_id gnl|my_center|LOCUS_13390 63207 64949 gene locus_tag LOCUS_13400 63207 64949 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922150.1 protein_id gnl|my_center|LOCUS_13400 64986 66200 gene locus_tag LOCUS_13410 64986 66200 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836593.1 protein_id gnl|my_center|LOCUS_13410 66405 67190 gene locus_tag LOCUS_13420 gene codY 66405 67190 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133183.1 protein_id gnl|my_center|LOCUS_13420 67476 67778 gene locus_tag LOCUS_13430 gene gatC 67476 67778 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703032.1 protein_id gnl|my_center|LOCUS_13430 67778 69244 gene locus_tag LOCUS_13440 gene gatA 67778 69244 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921931.1 protein_id gnl|my_center|LOCUS_13440 69244 70686 gene locus_tag LOCUS_13450 gene gatB 69244 70686 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008627.1 protein_id gnl|my_center|LOCUS_13450 70860 71771 gene locus_tag LOCUS_13460 70860 71771 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161968.1 protein_id gnl|my_center|LOCUS_13460 71895 72851 gene locus_tag LOCUS_13470 71895 72851 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161968.1 protein_id gnl|my_center|LOCUS_13470 72987 73403 gene locus_tag LOCUS_13480 72987 73403 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_13480 73413 74822 gene locus_tag LOCUS_13490 73413 74822 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_13490 74927 75643 gene locus_tag LOCUS_13500 74927 75643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 75814 76311 gene locus_tag LOCUS_13510 75814 76311 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991099.1 protein_id gnl|my_center|LOCUS_13510 76311 77429 gene locus_tag LOCUS_13520 gene yqeH 76311 77429 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391741.1 protein_id gnl|my_center|LOCUS_13520 77540 77854 gene locus_tag LOCUS_13530 gene yhbY 77540 77854 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958131.1 protein_id gnl|my_center|LOCUS_13530 77926 78564 gene locus_tag LOCUS_13540 77926 78564 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162767.1 protein_id gnl|my_center|LOCUS_13540 78554 79153 gene locus_tag LOCUS_13550 gene yqeK 78554 79153 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836603.1 protein_id gnl|my_center|LOCUS_13550 79150 79668 gene locus_tag LOCUS_13560 79150 79668 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128173.1 protein_id gnl|my_center|LOCUS_13560 79665 80018 gene locus_tag LOCUS_13570 gene rsfS 79665 80018 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_13570 80073 80810 gene locus_tag LOCUS_13580 80073 80810 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991831.1 protein_id gnl|my_center|LOCUS_13580 80838 81932 gene locus_tag LOCUS_13590 80838 81932 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263513.1 protein_id gnl|my_center|LOCUS_13590 82018 82740 gene locus_tag LOCUS_13600 82018 82740 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922653.1 protein_id gnl|my_center|LOCUS_13600 83005 83721 gene locus_tag LOCUS_13610 83005 83721 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263515.1 protein_id gnl|my_center|LOCUS_13610 83874 84560 gene locus_tag LOCUS_13620 83874 84560 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027681.1 protein_id gnl|my_center|LOCUS_13620 84585 85382 gene locus_tag LOCUS_13630 84585 85382 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714621.1 protein_id gnl|my_center|LOCUS_13630 85379 86524 gene locus_tag LOCUS_13640 85379 86524 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 protein_id gnl|my_center|LOCUS_13640 86630 87469 gene locus_tag LOCUS_13650 86630 87469 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880638.1 protein_id gnl|my_center|LOCUS_13650 87579 88463 gene locus_tag LOCUS_13660 87579 88463 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262137.1 protein_id gnl|my_center|LOCUS_13660 88649 89713 gene locus_tag LOCUS_13670 88649 89713 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985970.1 protein_id gnl|my_center|LOCUS_13670 89714 90406 gene locus_tag LOCUS_13680 89714 90406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574037.1 protein_id gnl|my_center|LOCUS_13680 91889 90516 gene locus_tag LOCUS_13690 gene brnQ 91889 90516 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769345.1 protein_id gnl|my_center|LOCUS_13690 92209 93432 gene locus_tag LOCUS_13700 gene sstT 92209 93432 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819596.1 protein_id gnl|my_center|LOCUS_13700 93632 94180 gene locus_tag LOCUS_13710 93632 94180 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095696.1 protein_id gnl|my_center|LOCUS_13710 94302 95978 gene locus_tag LOCUS_13720 94302 95978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262130.1 protein_id gnl|my_center|LOCUS_13720 95971 96801 gene locus_tag LOCUS_13730 95971 96801 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262129.1 protein_id gnl|my_center|LOCUS_13730 97501 96830 gene locus_tag LOCUS_13740 gene ktrA 97501 96830 CDS product potassium uptake transporter gating subunit KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991064.1 protein_id gnl|my_center|LOCUS_13740 98726 97512 gene locus_tag LOCUS_13750 gene ktrB 98726 97512 CDS product potassium uptake transporter channel subunit KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032459855.1 protein_id gnl|my_center|LOCUS_13750 99664 98951 gene locus_tag LOCUS_13760 gene rsmG 99664 98951 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 protein_id gnl|my_center|LOCUS_13760 99959 100510 gene locus_tag LOCUS_13770 99959 100510 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537055.1 protein_id gnl|my_center|LOCUS_13770 100624 101526 gene locus_tag LOCUS_13780 gene htpX 100624 101526 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966817.1 protein_id gnl|my_center|LOCUS_13780 101678 102211 gene locus_tag LOCUS_13790 101678 102211 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635288.1 protein_id gnl|my_center|LOCUS_13790 102451 103143 gene locus_tag LOCUS_13800 102451 103143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516681.1 protein_id gnl|my_center|LOCUS_13800 103143 104630 gene locus_tag LOCUS_13810 103143 104630 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791116.1 protein_id gnl|my_center|LOCUS_13810 104789 105283 gene locus_tag LOCUS_13820 gene nrdR 104789 105283 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985941.1 protein_id gnl|my_center|LOCUS_13820 105270 106421 gene locus_tag LOCUS_13830 105270 106421 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074512.1 protein_id gnl|my_center|LOCUS_13830 106432 107334 gene locus_tag LOCUS_13840 gene dnaI 106432 107334 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262118.1 protein_id gnl|my_center|LOCUS_13840 107469 108779 gene locus_tag LOCUS_13850 gene der 107469 108779 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244022.1 protein_id gnl|my_center|LOCUS_13850 108918 112001 gene locus_tag LOCUS_13860 108918 112001 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089135.1 protein_id gnl|my_center|LOCUS_13860 112245 112826 gene locus_tag LOCUS_13870 112245 112826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262544.1 protein_id gnl|my_center|LOCUS_13870 112862 114193 gene locus_tag LOCUS_13880 gene murC 112862 114193 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262545.1 protein_id gnl|my_center|LOCUS_13880 114247 114738 gene locus_tag LOCUS_13890 114247 114738 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586871.1 protein_id gnl|my_center|LOCUS_13890 114845 116539 gene locus_tag LOCUS_13900 gene mltG 114845 116539 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134324.1 protein_id gnl|my_center|LOCUS_13900 116623 117105 gene locus_tag LOCUS_13910 gene greA 116623 117105 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818772.1 protein_id gnl|my_center|LOCUS_13910 118118 117201 gene locus_tag LOCUS_13920 gene yidC 118118 117201 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921911.1 protein_id gnl|my_center|LOCUS_13920 118477 118199 gene locus_tag LOCUS_13930 118477 118199 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262550.1 protein_id gnl|my_center|LOCUS_13930 118520 119260 gene locus_tag LOCUS_13940 118520 119260 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990984.1 protein_id gnl|my_center|LOCUS_13940 119362 119865 gene locus_tag LOCUS_13950 119362 119865 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262552.1 protein_id gnl|my_center|LOCUS_13950 119893 120585 gene locus_tag LOCUS_13960 119893 120585 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262553.1 protein_id gnl|my_center|LOCUS_13960 120703 121944 gene locus_tag LOCUS_13970 120703 121944 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence07 53 126 gene locus_tag LOCUS_t00090 53 126 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 477 166 gene locus_tag LOCUS_13980 477 166 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263685.1 protein_id gnl|my_center|LOCUS_13980 1064 531 gene locus_tag LOCUS_13990 1064 531 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263684.1 protein_id gnl|my_center|LOCUS_13990 1925 1149 gene locus_tag LOCUS_14000 gene recX 1925 1149 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837398.1 protein_id gnl|my_center|LOCUS_14000 1982 2878 gene locus_tag LOCUS_14010 1982 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2878 4230 gene locus_tag LOCUS_14020 gene rlmD 2878 4230 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074665.1 protein_id gnl|my_center|LOCUS_14020 4353 4916 gene locus_tag LOCUS_14030 4353 4916 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_14030 5702 4971 gene locus_tag LOCUS_14040 gene pnuC 5702 4971 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772856.1 protein_id gnl|my_center|LOCUS_14040 6347 5709 gene locus_tag LOCUS_14050 6347 5709 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 protein_id gnl|my_center|LOCUS_14050 7489 6722 gene locus_tag LOCUS_14060 7489 6722 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_14060 7703 7957 gene locus_tag LOCUS_14070 7703 7957 CDS product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263678.1 protein_id gnl|my_center|LOCUS_14070 7960 8277 gene locus_tag LOCUS_14080 7960 8277 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989018.1 protein_id gnl|my_center|LOCUS_14080 8529 9107 gene locus_tag LOCUS_14090 8529 9107 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590589.1 protein_id gnl|my_center|LOCUS_14090 9107 9670 gene locus_tag LOCUS_14100 9107 9670 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021308.1 protein_id gnl|my_center|LOCUS_14100 9683 12334 gene locus_tag LOCUS_14110 9683 12334 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032177.1 protein_id gnl|my_center|LOCUS_14110 12706 12500 gene locus_tag LOCUS_14120 12706 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 13015 12713 gene locus_tag LOCUS_14130 13015 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 13149 14231 gene locus_tag LOCUS_14140 13149 14231 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263014.1 protein_id gnl|my_center|LOCUS_14140 14341 15555 gene locus_tag LOCUS_14150 14341 15555 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921998.1 protein_id gnl|my_center|LOCUS_14150 15876 16868 gene locus_tag LOCUS_14160 gene asnA 15876 16868 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748011.1 protein_id gnl|my_center|LOCUS_14160 16984 17532 gene locus_tag LOCUS_14170 gene rsmD 16984 17532 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266829.1 protein_id gnl|my_center|LOCUS_14170 17564 18061 gene locus_tag LOCUS_14180 gene coaD 17564 18061 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262038.1 protein_id gnl|my_center|LOCUS_14180 18039 19124 gene locus_tag LOCUS_14190 18039 19124 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922499.1 protein_id gnl|my_center|LOCUS_14190 19572 20903 gene locus_tag LOCUS_14200 19572 20903 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262040.1 protein_id gnl|my_center|LOCUS_14200 20933 21493 gene locus_tag LOCUS_14210 20933 21493 CDS product DUF1027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224500.1 protein_id gnl|my_center|LOCUS_14210 21514 22614 gene locus_tag LOCUS_14220 gene rlmN 21514 22614 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124990.1 protein_id gnl|my_center|LOCUS_14220 22625 23134 gene locus_tag LOCUS_14230 22625 23134 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262043.1 protein_id gnl|my_center|LOCUS_14230 23243 24988 gene locus_tag LOCUS_14240 23243 24988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022594.1 protein_id gnl|my_center|LOCUS_14240 24978 26723 gene locus_tag LOCUS_14250 24978 26723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841525.1 protein_id gnl|my_center|LOCUS_14250 26879 27757 gene locus_tag LOCUS_14260 26879 27757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027604.1 protein_id gnl|my_center|LOCUS_14260 27754 28485 gene locus_tag LOCUS_14270 27754 28485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262960.1 protein_id gnl|my_center|LOCUS_14270 28485 29573 gene locus_tag LOCUS_14280 28485 29573 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074641.1 protein_id gnl|my_center|LOCUS_14280 29575 30171 gene locus_tag LOCUS_14290 29575 30171 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262958.1 protein_id gnl|my_center|LOCUS_14290 30319 31452 gene locus_tag LOCUS_14300 30319 31452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642293.1 protein_id gnl|my_center|LOCUS_14300 32153 33511 gene locus_tag LOCUS_14310 gene trpE 32153 33511 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262051.1 protein_id gnl|my_center|LOCUS_14310 33508 34077 gene locus_tag LOCUS_14320 33508 34077 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262052.1 protein_id gnl|my_center|LOCUS_14320 34092 35096 gene locus_tag LOCUS_14330 gene trpD 34092 35096 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262053.1 protein_id gnl|my_center|LOCUS_14330 35093 35860 gene locus_tag LOCUS_14340 gene trpC 35093 35860 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836635.1 protein_id gnl|my_center|LOCUS_14340 35847 36428 gene locus_tag LOCUS_14350 35847 36428 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_14350 36425 37627 gene locus_tag LOCUS_14360 gene trpB 36425 37627 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262056.1 protein_id gnl|my_center|LOCUS_14360 37631 38413 gene locus_tag LOCUS_14370 gene trpA 37631 38413 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262057.1 protein_id gnl|my_center|LOCUS_14370 39790 38450 gene locus_tag LOCUS_14380 39790 38450 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261924.1 protein_id gnl|my_center|LOCUS_14380 40677 41201 gene locus_tag LOCUS_14390 40677 41201 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983837.1 protein_id gnl|my_center|LOCUS_14390 41328 41537 gene locus_tag LOCUS_14400 41328 41537 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983840.1 protein_id gnl|my_center|LOCUS_14400 41530 42498 gene locus_tag LOCUS_14410 41530 42498 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038547.1 protein_id gnl|my_center|LOCUS_14410 42509 42889 gene locus_tag LOCUS_14420 42509 42889 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367664.1 protein_id gnl|my_center|LOCUS_14420 43075 44919 gene locus_tag LOCUS_14430 gene typA 43075 44919 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262063.1 protein_id gnl|my_center|LOCUS_14430 45132 45404 gene locus_tag LOCUS_14440 45132 45404 CDS product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995892.1 protein_id gnl|my_center|LOCUS_14440 45547 46902 gene locus_tag LOCUS_14450 gene murD 45547 46902 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262065.1 protein_id gnl|my_center|LOCUS_14450 46905 47981 gene locus_tag LOCUS_14460 46905 47981 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516700.1 protein_id gnl|my_center|LOCUS_14460 47982 49220 gene locus_tag LOCUS_14470 47982 49220 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262067.1 protein_id gnl|my_center|LOCUS_14470 49356 50723 gene locus_tag LOCUS_14480 gene ftsA 49356 50723 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983860.1 protein_id gnl|my_center|LOCUS_14480 50744 52069 gene locus_tag LOCUS_14490 gene ftsZ 50744 52069 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983862.1 protein_id gnl|my_center|LOCUS_14490 52069 52743 gene locus_tag LOCUS_14500 52069 52743 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262070.1 protein_id gnl|my_center|LOCUS_14500 52756 53361 gene locus_tag LOCUS_14510 52756 53361 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995878.1 protein_id gnl|my_center|LOCUS_14510 53365 53622 gene locus_tag LOCUS_14520 53365 53622 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604717.1 protein_id gnl|my_center|LOCUS_14520 53619 54404 gene locus_tag LOCUS_14530 53619 54404 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171105.1 protein_id gnl|my_center|LOCUS_14530 54415 55179 gene locus_tag LOCUS_14540 54415 55179 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989099.1 protein_id gnl|my_center|LOCUS_14540 55511 58309 gene locus_tag LOCUS_14550 gene ileS 55511 58309 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922491.1 protein_id gnl|my_center|LOCUS_14550 58700 58398 gene locus_tag LOCUS_14560 58700 58398 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263571.1 protein_id gnl|my_center|LOCUS_14560 59219 58773 gene locus_tag LOCUS_14570 59219 58773 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184292.1 protein_id gnl|my_center|LOCUS_14570 61681 59396 gene locus_tag LOCUS_14580 61681 59396 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902602.1 protein_id gnl|my_center|LOCUS_14580 62055 63029 gene locus_tag LOCUS_14590 gene argF 62055 63029 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263568.1 protein_id gnl|my_center|LOCUS_14590 63152 63382 gene locus_tag LOCUS_14600 63152 63382 CDS product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983885.1 protein_id gnl|my_center|LOCUS_14600 63612 64298 gene locus_tag LOCUS_14610 63612 64298 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263566.1 protein_id gnl|my_center|LOCUS_14610 64298 65032 gene locus_tag LOCUS_14620 64298 65032 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263565.1 protein_id gnl|my_center|LOCUS_14620 65392 65868 gene locus_tag LOCUS_14630 65392 65868 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263564.1 protein_id gnl|my_center|LOCUS_14630 65865 68003 gene locus_tag LOCUS_14640 gene feoB 65865 68003 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263563.1 protein_id gnl|my_center|LOCUS_14640 68282 69136 gene locus_tag LOCUS_14650 68282 69136 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137498.1 protein_id gnl|my_center|LOCUS_14650 69133 69966 gene locus_tag LOCUS_14660 69133 69966 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263560.1 protein_id gnl|my_center|LOCUS_14660 70199 70819 gene locus_tag LOCUS_14670 70199 70819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 71031 71600 gene locus_tag LOCUS_14680 71031 71600 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231800.1 protein_id gnl|my_center|LOCUS_14680 71844 73172 gene locus_tag LOCUS_14690 gene xseA 71844 73172 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992349.1 protein_id gnl|my_center|LOCUS_14690 73162 73377 gene locus_tag LOCUS_14700 73162 73377 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983901.1 protein_id gnl|my_center|LOCUS_14700 73377 74246 gene locus_tag LOCUS_14710 73377 74246 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262106.1 protein_id gnl|my_center|LOCUS_14710 74239 75063 gene locus_tag LOCUS_14720 74239 75063 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262105.1 protein_id gnl|my_center|LOCUS_14720 75050 75520 gene locus_tag LOCUS_14730 75050 75520 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983907.1 protein_id gnl|my_center|LOCUS_14730 75533 77191 gene locus_tag LOCUS_14740 gene recN 75533 77191 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923621.1 protein_id gnl|my_center|LOCUS_14740 77316 78158 gene locus_tag LOCUS_14750 77316 78158 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034838.1 protein_id gnl|my_center|LOCUS_14750 78151 78999 gene locus_tag LOCUS_14760 78151 78999 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035227.1 protein_id gnl|my_center|LOCUS_14760 78968 79570 gene locus_tag LOCUS_14770 78968 79570 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806954.1 protein_id gnl|my_center|LOCUS_14770 79665 79940 gene locus_tag LOCUS_14780 79665 79940 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983920.1 protein_id gnl|my_center|LOCUS_14780 80138 80290 gene locus_tag LOCUS_14790 80138 80290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 80262 80507 gene locus_tag LOCUS_14800 80262 80507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 80625 82124 gene locus_tag LOCUS_14810 80625 82124 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905519.1 protein_id gnl|my_center|LOCUS_14810 83207 82272 gene locus_tag LOCUS_14820 83207 82272 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263253.1 protein_id gnl|my_center|LOCUS_14820 83524 83838 gene locus_tag LOCUS_14830 83524 83838 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868054.1 protein_id gnl|my_center|LOCUS_14830 83841 85724 gene locus_tag LOCUS_14840 83841 85724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 86084 86776 gene locus_tag LOCUS_14850 86084 86776 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240135.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence08 2506 533 gene locus_tag LOCUS_14860 gene ftsH 2506 533 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921768.1 protein_id gnl|my_center|LOCUS_14860 3094 2525 gene locus_tag LOCUS_14870 gene hpt 3094 2525 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892188.1 protein_id gnl|my_center|LOCUS_14870 4337 3072 gene locus_tag LOCUS_14880 gene tilS 4337 3072 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921767.1 protein_id gnl|my_center|LOCUS_14880 5633 4347 gene locus_tag LOCUS_14890 5633 4347 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921766.1 protein_id gnl|my_center|LOCUS_14890 5768 5646 gene locus_tag LOCUS_14900 5768 5646 CDS product SP_0009 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262640.1 protein_id gnl|my_center|LOCUS_14900 6141 5770 gene locus_tag LOCUS_14910 6141 5770 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042845.1 protein_id gnl|my_center|LOCUS_14910 6400 6128 gene locus_tag LOCUS_14920 6400 6128 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 protein_id gnl|my_center|LOCUS_14920 7090 6536 gene locus_tag LOCUS_14930 7090 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 10602 7189 gene locus_tag LOCUS_14940 gene mfd 10602 7189 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021202.1 protein_id gnl|my_center|LOCUS_14940 11261 10692 gene locus_tag LOCUS_14950 gene pth 11261 10692 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240196.1 protein_id gnl|my_center|LOCUS_14950 12452 11337 gene locus_tag LOCUS_14960 gene ychF 12452 11337 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921763.1 protein_id gnl|my_center|LOCUS_14960 12750 12556 gene locus_tag LOCUS_14970 12750 12556 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262646.1 protein_id gnl|my_center|LOCUS_14970 13645 12761 gene locus_tag LOCUS_14980 13645 12761 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026216512.1 protein_id gnl|my_center|LOCUS_14980 14912 13776 gene locus_tag LOCUS_14990 gene dnaN 14912 13776 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262647.1 protein_id gnl|my_center|LOCUS_14990 16425 15070 gene locus_tag LOCUS_15000 gene dnaA 16425 15070 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987659.1 protein_id gnl|my_center|LOCUS_15000 17412 16630 gene locus_tag LOCUS_15010 17412 16630 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074697.1 protein_id gnl|my_center|LOCUS_15010 18732 17473 gene locus_tag LOCUS_15020 18732 17473 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994926.1 protein_id gnl|my_center|LOCUS_15020 18945 19424 gene locus_tag LOCUS_15030 gene rlmH 18945 19424 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028058.1 protein_id gnl|my_center|LOCUS_15030 19581 19506 gene locus_tag LOCUS_t00100 19581 19506 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19910 19983 gene locus_tag LOCUS_t00110 19910 19983 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20014 20087 gene locus_tag LOCUS_t00120 20014 20087 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22846 20264 gene locus_tag LOCUS_15040 22846 20264 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154437.1 protein_id gnl|my_center|LOCUS_15040 24559 22937 gene locus_tag LOCUS_15050 24559 22937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899531.1 protein_id gnl|my_center|LOCUS_15050 25525 24653 gene locus_tag LOCUS_15060 25525 24653 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982011.1 protein_id gnl|my_center|LOCUS_15060 25994 27016 gene locus_tag LOCUS_15070 gene trpS 25994 27016 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922803.1 protein_id gnl|my_center|LOCUS_15070 27244 28725 gene locus_tag LOCUS_15080 gene guaB 27244 28725 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262457.1 protein_id gnl|my_center|LOCUS_15080 28967 29833 gene locus_tag LOCUS_15090 28967 29833 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398683.1 protein_id gnl|my_center|LOCUS_15090 30994 29900 gene locus_tag LOCUS_15100 gene recF 30994 29900 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262456.1 protein_id gnl|my_center|LOCUS_15100 31380 30997 gene locus_tag LOCUS_15110 gene yaaA 31380 30997 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028049.1 protein_id gnl|my_center|LOCUS_15110 32656 31514 gene locus_tag LOCUS_15120 32656 31514 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054278179.1 protein_id gnl|my_center|LOCUS_15120 33650 33096 gene locus_tag LOCUS_15130 33650 33096 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027462.1 protein_id gnl|my_center|LOCUS_15130 33805 33990 gene locus_tag LOCUS_15140 33805 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 34219 34413 gene locus_tag LOCUS_15150 34219 34413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 34425 34568 gene locus_tag LOCUS_15160 34425 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 34569 34838 gene locus_tag LOCUS_15170 34569 34838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922766.1 protein_id gnl|my_center|LOCUS_15170 34839 35678 gene locus_tag LOCUS_15180 34839 35678 CDS product phage replisome organiser protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905350.1 protein_id gnl|my_center|LOCUS_15180 35695 36540 gene locus_tag LOCUS_15190 35695 36540 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067868.1 protein_id gnl|my_center|LOCUS_15190 36939 37106 gene locus_tag LOCUS_15200 36939 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 37198 37362 gene locus_tag LOCUS_15210 37198 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 37362 38048 gene locus_tag LOCUS_15220 37362 38048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 38067 39029 gene locus_tag LOCUS_15230 38067 39029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 39062 39517 gene locus_tag LOCUS_15240 39062 39517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 40406 40236 gene locus_tag LOCUS_15250 40406 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 40605 40480 gene locus_tag LOCUS_15260 40605 40480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 42060 43304 gene locus_tag LOCUS_15270 42060 43304 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706188.1 protein_id gnl|my_center|LOCUS_15270 43305 44594 gene locus_tag LOCUS_15280 43305 44594 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922796.1 protein_id gnl|my_center|LOCUS_15280 44661 45590 gene locus_tag LOCUS_15290 44661 45590 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262452.1 protein_id gnl|my_center|LOCUS_15290 45600 46154 gene locus_tag LOCUS_15300 gene pgsA 45600 46154 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028045.1 protein_id gnl|my_center|LOCUS_15300 46151 46993 gene locus_tag LOCUS_15310 46151 46993 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262450.1 protein_id gnl|my_center|LOCUS_15310 46969 47811 gene locus_tag LOCUS_15320 46969 47811 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262449.1 protein_id gnl|my_center|LOCUS_15320 47804 48601 gene locus_tag LOCUS_15330 47804 48601 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991426.1 protein_id gnl|my_center|LOCUS_15330 48739 49332 gene locus_tag LOCUS_15340 48739 49332 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775412.1 protein_id gnl|my_center|LOCUS_15340 49545 50180 gene locus_tag LOCUS_15350 49545 50180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 50842 50207 gene locus_tag LOCUS_15360 50842 50207 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837716.1 protein_id gnl|my_center|LOCUS_15360 51805 50933 gene locus_tag LOCUS_15370 gene sdaAA 51805 50933 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922793.1 protein_id gnl|my_center|LOCUS_15370 52488 51817 gene locus_tag LOCUS_15380 gene sdaAB 52488 51817 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681579.1 protein_id gnl|my_center|LOCUS_15380 52748 53869 gene locus_tag LOCUS_15390 gene mnmA 52748 53869 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 protein_id gnl|my_center|LOCUS_15390 54120 56024 gene locus_tag LOCUS_15400 gene mnmG 54120 56024 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149487.1 protein_id gnl|my_center|LOCUS_15400 56111 58087 gene locus_tag LOCUS_15410 56111 58087 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922788.1 protein_id gnl|my_center|LOCUS_15410 58087 58539 gene locus_tag LOCUS_15420 gene rplI 58087 58539 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991410.1 protein_id gnl|my_center|LOCUS_15420 58573 59934 gene locus_tag LOCUS_15430 gene dnaB 58573 59934 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230635.1 protein_id gnl|my_center|LOCUS_15430 59959 60231 gene locus_tag LOCUS_15440 59959 60231 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278152.1 protein_id gnl|my_center|LOCUS_15440 60488 61099 gene locus_tag LOCUS_15450 gene rpsD 60488 61099 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092756.1 protein_id gnl|my_center|LOCUS_15450 61728 61189 gene locus_tag LOCUS_15460 61728 61189 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922785.1 protein_id gnl|my_center|LOCUS_15460 61861 64704 gene locus_tag LOCUS_15470 61861 64704 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472055.1 protein_id gnl|my_center|LOCUS_15470 65697 64786 gene locus_tag LOCUS_15480 65697 64786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 66278 65694 gene locus_tag LOCUS_15490 66278 65694 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198700.1 protein_id gnl|my_center|LOCUS_15490 66591 66265 gene locus_tag LOCUS_15500 66591 66265 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982104.1 protein_id gnl|my_center|LOCUS_15500 67135 66842 gene locus_tag LOCUS_15510 67135 66842 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 protein_id gnl|my_center|LOCUS_15510 67394 67849 gene locus_tag LOCUS_15520 67394 67849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 67830 68096 gene locus_tag LOCUS_15530 67830 68096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 68086 69234 gene locus_tag LOCUS_15540 gene essB 68086 69234 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 protein_id gnl|my_center|LOCUS_15540 69241 73692 gene locus_tag LOCUS_15550 gene essC 69241 73692 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 protein_id gnl|my_center|LOCUS_15550 73700 76495 gene locus_tag LOCUS_15560 gene esaA 73700 76495 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 protein_id gnl|my_center|LOCUS_15560 76563 76979 gene locus_tag LOCUS_15570 76563 76979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 76991 77272 gene locus_tag LOCUS_15580 76991 77272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 77272 77934 gene locus_tag LOCUS_15590 77272 77934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence09 304 1263 gene locus_tag LOCUS_15600 304 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1269 2336 gene locus_tag LOCUS_15610 1269 2336 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_15610 2323 4554 gene locus_tag LOCUS_15620 2323 4554 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964869.1 protein_id gnl|my_center|LOCUS_15620 4551 6491 gene locus_tag LOCUS_15630 4551 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 6743 7195 gene locus_tag LOCUS_15640 gene rimP 6743 7195 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041971671.1 protein_id gnl|my_center|LOCUS_15640 7270 8451 gene locus_tag LOCUS_15650 gene nusA 7270 8451 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380478.1 protein_id gnl|my_center|LOCUS_15650 8470 8766 gene locus_tag LOCUS_15660 8470 8766 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837436.1 protein_id gnl|my_center|LOCUS_15660 8759 9061 gene locus_tag LOCUS_15670 8759 9061 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065560.1 protein_id gnl|my_center|LOCUS_15670 9081 11777 gene locus_tag LOCUS_15680 gene infB 9081 11777 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039230.1 protein_id gnl|my_center|LOCUS_15680 12026 12376 gene locus_tag LOCUS_15690 gene rbfA 12026 12376 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262599.1 protein_id gnl|my_center|LOCUS_15690 12451 12981 gene locus_tag LOCUS_15700 12451 12981 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_15700 12993 13538 gene locus_tag LOCUS_15710 12993 13538 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262916.1 protein_id gnl|my_center|LOCUS_15710 13643 14074 gene locus_tag LOCUS_15720 13643 14074 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156042.1 protein_id gnl|my_center|LOCUS_15720 14111 16348 gene locus_tag LOCUS_15730 14111 16348 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263707.1 protein_id gnl|my_center|LOCUS_15730 16360 16566 gene locus_tag LOCUS_15740 16360 16566 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922577.1 protein_id gnl|my_center|LOCUS_15740 16668 17294 gene locus_tag LOCUS_15750 16668 17294 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020721.1 protein_id gnl|my_center|LOCUS_15750 17287 18099 gene locus_tag LOCUS_15760 17287 18099 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593336.1 protein_id gnl|my_center|LOCUS_15760 18693 18136 gene locus_tag LOCUS_15770 18693 18136 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922569.1 protein_id gnl|my_center|LOCUS_15770 18826 19671 gene locus_tag LOCUS_15780 18826 19671 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922568.1 protein_id gnl|my_center|LOCUS_15780 20210 19695 gene locus_tag LOCUS_15790 20210 19695 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074508.1 protein_id gnl|my_center|LOCUS_15790 20821 20210 gene locus_tag LOCUS_15800 20821 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 21183 22814 gene locus_tag LOCUS_15810 21183 22814 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922567.1 protein_id gnl|my_center|LOCUS_15810 22949 24097 gene locus_tag LOCUS_15820 gene nagA 22949 24097 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074509.1 protein_id gnl|my_center|LOCUS_15820 24449 25366 gene locus_tag LOCUS_15830 gene glyQ 24449 25366 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038729.1 protein_id gnl|my_center|LOCUS_15830 25366 27405 gene locus_tag LOCUS_15840 gene glyS 25366 27405 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922564.1 protein_id gnl|my_center|LOCUS_15840 27528 27785 gene locus_tag LOCUS_15850 27528 27785 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983550.1 protein_id gnl|my_center|LOCUS_15850 27944 29929 gene locus_tag LOCUS_15860 gene tkt 27944 29929 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612523.1 protein_id gnl|my_center|LOCUS_15860 30073 30366 gene locus_tag LOCUS_15870 30073 30366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 30388 31119 gene locus_tag LOCUS_15880 30388 31119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262297.1 protein_id gnl|my_center|LOCUS_15880 31124 32746 gene locus_tag LOCUS_15890 31124 32746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922559.1 protein_id gnl|my_center|LOCUS_15890 32866 33669 gene locus_tag LOCUS_15900 gene proB 32866 33669 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820352.1 protein_id gnl|my_center|LOCUS_15900 33685 34935 gene locus_tag LOCUS_15910 33685 34935 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262086.1 protein_id gnl|my_center|LOCUS_15910 35037 35996 gene locus_tag LOCUS_15920 gene rsmH 35037 35996 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180266.1 protein_id gnl|my_center|LOCUS_15920 35996 36319 gene locus_tag LOCUS_15930 gene ftsL 35996 36319 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262088.1 protein_id gnl|my_center|LOCUS_15930 36323 38587 gene locus_tag LOCUS_15940 gene pbp2X 36323 38587 CDS product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142542.1 protein_id gnl|my_center|LOCUS_15940 38594 39607 gene locus_tag LOCUS_15950 gene mraY 38594 39607 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480020.1 protein_id gnl|my_center|LOCUS_15950 39803 41146 gene locus_tag LOCUS_15960 39803 41146 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008549.1 protein_id gnl|my_center|LOCUS_15960 41312 42136 gene locus_tag LOCUS_15970 41312 42136 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473468.1 protein_id gnl|my_center|LOCUS_15970 42168 42971 gene locus_tag LOCUS_15980 42168 42971 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071299.1 protein_id gnl|my_center|LOCUS_15980 42971 43714 gene locus_tag LOCUS_15990 42971 43714 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262094.1 protein_id gnl|my_center|LOCUS_15990 43797 44021 gene locus_tag LOCUS_16000 43797 44021 CDS product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478229.1 protein_id gnl|my_center|LOCUS_16000 44088 45002 gene locus_tag LOCUS_16010 gene trxB 44088 45002 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272353.1 protein_id gnl|my_center|LOCUS_16010 45230 46690 gene locus_tag LOCUS_16020 45230 46690 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262097.1 protein_id gnl|my_center|LOCUS_16020 46690 47514 gene locus_tag LOCUS_16030 gene nadE 46690 47514 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262098.1 protein_id gnl|my_center|LOCUS_16030 47766 49103 gene locus_tag LOCUS_16040 gene pepC 47766 49103 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263054.1 protein_id gnl|my_center|LOCUS_16040 51317 49194 gene locus_tag LOCUS_16050 gene pbp1a 51317 49194 CDS product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628368.1 protein_id gnl|my_center|LOCUS_16050 52014 51406 gene locus_tag LOCUS_16060 gene recU 52014 51406 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248792.1 protein_id gnl|my_center|LOCUS_16060 52089 52607 gene locus_tag LOCUS_16070 52089 52607 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843096.1 protein_id gnl|my_center|LOCUS_16070 52734 53063 gene locus_tag LOCUS_16080 gene gpsB 52734 53063 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263050.1 protein_id gnl|my_center|LOCUS_16080 53668 54840 gene locus_tag LOCUS_16090 53668 54840 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664849.1 protein_id gnl|my_center|LOCUS_16090 54904 56424 gene locus_tag LOCUS_16100 54904 56424 CDS product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287870.1 protein_id gnl|my_center|LOCUS_16100 56572 57336 gene locus_tag LOCUS_16110 56572 57336 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048147.1 protein_id gnl|my_center|LOCUS_16110 57895 57410 gene locus_tag LOCUS_16120 57895 57410 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263047.1 protein_id gnl|my_center|LOCUS_16120 58044 59651 gene locus_tag LOCUS_16130 58044 59651 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988954.1 protein_id gnl|my_center|LOCUS_16130 59810 60427 gene locus_tag LOCUS_16140 gene gmk 59810 60427 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002997509.1 protein_id gnl|my_center|LOCUS_16140 60451 60765 gene locus_tag LOCUS_16150 60451 60765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 60910 63300 gene locus_tag LOCUS_16160 60910 63300 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101528.1 protein_id gnl|my_center|LOCUS_16160 63360 64295 gene locus_tag LOCUS_16170 gene fmt 63360 64295 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163893.1 protein_id gnl|my_center|LOCUS_16170 64285 65607 gene locus_tag LOCUS_16180 gene rsmB 64285 65607 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922539.1 protein_id gnl|my_center|LOCUS_16180 65645 66382 gene locus_tag LOCUS_16190 65645 66382 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983660.1 protein_id gnl|my_center|LOCUS_16190 66382 68256 gene locus_tag LOCUS_16200 gene pknB 66382 68256 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922538.1 protein_id gnl|my_center|LOCUS_16200 68399 69094 gene locus_tag LOCUS_16210 gene liaF 68399 69094 CDS product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714456.1 protein_id gnl|my_center|LOCUS_16210 69091 70116 gene locus_tag LOCUS_16220 69091 70116 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991890.1 protein_id gnl|my_center|LOCUS_16220 70100 70744 gene locus_tag LOCUS_16230 70100 70744 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 protein_id gnl|my_center|LOCUS_16230 70868 72268 gene locus_tag LOCUS_16240 70868 72268 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263035.1 protein_id gnl|my_center|LOCUS_16240 72268 72624 gene locus_tag LOCUS_16250 72268 72624 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263034.1 protein_id gnl|my_center|LOCUS_16250 73628 72699 gene locus_tag LOCUS_16260 gene cysK 73628 72699 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774985.1 protein_id gnl|my_center|LOCUS_16260 74352 73726 gene locus_tag LOCUS_16270 74352 73726 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108147.1 protein_id gnl|my_center|LOCUS_16270 74407 75705 gene locus_tag LOCUS_16280 74407 75705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432961.1 protein_id gnl|my_center|LOCUS_16280 75705 76370 gene locus_tag LOCUS_16290 75705 76370 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194119.1 protein_id gnl|my_center|LOCUS_16290 76447 76995 gene locus_tag LOCUS_16300 gene raiA 76447 76995 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263024.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence10 1386 454 gene locus_tag LOCUS_16310 1386 454 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138506.1 protein_id gnl|my_center|LOCUS_16310 2432 1386 gene locus_tag LOCUS_16320 2432 1386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410286.1 protein_id gnl|my_center|LOCUS_16320 3475 2444 gene locus_tag LOCUS_16330 3475 2444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764052.1 protein_id gnl|my_center|LOCUS_16330 4401 3487 gene locus_tag LOCUS_16340 4401 3487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598965.1 protein_id gnl|my_center|LOCUS_16340 6165 4513 gene locus_tag LOCUS_16350 6165 4513 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093960.1 protein_id gnl|my_center|LOCUS_16350 6365 7594 gene locus_tag LOCUS_16360 gene pbp3 6365 7594 CDS product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273614.1 protein_id gnl|my_center|LOCUS_16360 9081 7663 gene locus_tag LOCUS_16370 gene sufB 9081 7663 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289834.1 protein_id gnl|my_center|LOCUS_16370 9532 9086 gene locus_tag LOCUS_16380 9532 9086 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262744.1 protein_id gnl|my_center|LOCUS_16380 10751 9519 gene locus_tag LOCUS_16390 10751 9519 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262745.1 protein_id gnl|my_center|LOCUS_16390 12015 10753 gene locus_tag LOCUS_16400 gene sufD 12015 10753 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031280.1 protein_id gnl|my_center|LOCUS_16400 12863 12093 gene locus_tag LOCUS_16410 gene sufC 12863 12093 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262747.1 protein_id gnl|my_center|LOCUS_16410 14148 12985 gene locus_tag LOCUS_16420 14148 12985 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991122.1 protein_id gnl|my_center|LOCUS_16420 14911 14150 gene locus_tag LOCUS_16430 gene mecA 14911 14150 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425371.1 protein_id gnl|my_center|LOCUS_16430 15853 15014 gene locus_tag LOCUS_16440 15853 15014 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986031.1 protein_id gnl|my_center|LOCUS_16440 17797 15905 gene locus_tag LOCUS_16450 17797 15905 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921886.1 protein_id gnl|my_center|LOCUS_16450 17934 19505 gene locus_tag LOCUS_16460 17934 19505 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285384.1 protein_id gnl|my_center|LOCUS_16460 19505 20245 gene locus_tag LOCUS_16470 19505 20245 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189496.1 protein_id gnl|my_center|LOCUS_16470 20380 20499 gene locus_tag LOCUS_16480 20380 20499 CDS product putative metal homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818733.1 protein_id gnl|my_center|LOCUS_16480 21471 20587 gene locus_tag LOCUS_16490 21471 20587 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922650.1 protein_id gnl|my_center|LOCUS_16490 22864 21614 gene locus_tag LOCUS_16500 gene ilvA 22864 21614 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262759.1 protein_id gnl|my_center|LOCUS_16500 23993 22971 gene locus_tag LOCUS_16510 gene ilvC 23993 22971 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893657.1 protein_id gnl|my_center|LOCUS_16510 24548 24063 gene locus_tag LOCUS_16520 gene ilvN 24548 24063 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262761.1 protein_id gnl|my_center|LOCUS_16520 26244 24541 gene locus_tag LOCUS_16530 26244 24541 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262762.1 protein_id gnl|my_center|LOCUS_16530 28098 26377 gene locus_tag LOCUS_16540 gene ilvD 28098 26377 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255780.1 protein_id gnl|my_center|LOCUS_16540 29956 28286 gene locus_tag LOCUS_16550 29956 28286 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992286.1 protein_id gnl|my_center|LOCUS_16550 30321 29956 gene locus_tag LOCUS_16560 30321 29956 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262764.1 protein_id gnl|my_center|LOCUS_16560 30625 30437 gene locus_tag LOCUS_16570 gene rpmB 30625 30437 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140948.1 protein_id gnl|my_center|LOCUS_16570 30904 30832 gene locus_tag LOCUS_t00130 30904 30832 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31900 31019 gene locus_tag LOCUS_16580 31900 31019 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263577.1 protein_id gnl|my_center|LOCUS_16580 32186 32101 gene locus_tag LOCUS_t00140 32186 32101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33282 32239 gene locus_tag LOCUS_16590 33282 32239 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723859.1 protein_id gnl|my_center|LOCUS_16590 34896 33292 gene locus_tag LOCUS_16600 34896 33292 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263575.1 protein_id gnl|my_center|LOCUS_16600 35744 35172 gene locus_tag LOCUS_16610 gene rpoE 35744 35172 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418426.1 protein_id gnl|my_center|LOCUS_16610 37349 36066 gene locus_tag LOCUS_16620 gene tig 37349 36066 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107750.1 protein_id gnl|my_center|LOCUS_16620 37546 38394 gene locus_tag LOCUS_16630 37546 38394 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263423.1 protein_id gnl|my_center|LOCUS_16630 39003 38440 gene locus_tag LOCUS_16640 39003 38440 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599671.1 protein_id gnl|my_center|LOCUS_16640 39486 39019 gene locus_tag LOCUS_16650 39486 39019 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774960.1 protein_id gnl|my_center|LOCUS_16650 40240 39473 gene locus_tag LOCUS_16660 40240 39473 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263420.1 protein_id gnl|my_center|LOCUS_16660 40979 40230 gene locus_tag LOCUS_16670 gene truA 40979 40230 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199167.1 protein_id gnl|my_center|LOCUS_16670 41866 41048 gene locus_tag LOCUS_16680 41866 41048 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 protein_id gnl|my_center|LOCUS_16680 43067 41928 gene locus_tag LOCUS_16690 gene dnaJ 43067 41928 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066287.1 protein_id gnl|my_center|LOCUS_16690 43786 43172 gene locus_tag LOCUS_16700 43786 43172 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612793.1 protein_id gnl|my_center|LOCUS_16700 45741 43909 gene locus_tag LOCUS_16710 gene dnaK 45741 43909 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034648.1 protein_id gnl|my_center|LOCUS_16710 46359 45820 gene locus_tag LOCUS_16720 gene grpE 46359 45820 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263416.1 protein_id gnl|my_center|LOCUS_16720 47469 46405 gene locus_tag LOCUS_16730 gene hrcA 47469 46405 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335318.1 protein_id gnl|my_center|LOCUS_16730 48163 47573 gene locus_tag LOCUS_16740 48163 47573 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263412.1 protein_id gnl|my_center|LOCUS_16740 48933 48160 gene locus_tag LOCUS_16750 48933 48160 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263411.1 protein_id gnl|my_center|LOCUS_16750 49621 48917 gene locus_tag LOCUS_16760 49621 48917 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049272.1 protein_id gnl|my_center|LOCUS_16760 51156 49819 gene locus_tag LOCUS_16770 51156 49819 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354889.1 protein_id gnl|my_center|LOCUS_16770 51434 51168 gene locus_tag LOCUS_16780 51434 51168 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644124.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence11 242 2704 gene locus_tag LOCUS_16790 242 2704 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263357.1 protein_id gnl|my_center|LOCUS_16790 2946 3440 gene locus_tag LOCUS_16800 2946 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983066.1 protein_id gnl|my_center|LOCUS_16800 4587 3490 gene locus_tag LOCUS_16810 gene dinB 4587 3490 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904560.1 protein_id gnl|my_center|LOCUS_16810 4810 7134 gene locus_tag LOCUS_16820 gene pflB 4810 7134 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260643.1 protein_id gnl|my_center|LOCUS_16820 7195 7632 gene locus_tag LOCUS_16830 7195 7632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262620.1 protein_id gnl|my_center|LOCUS_16830 8335 7721 gene locus_tag LOCUS_16840 8335 7721 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893760.1 protein_id gnl|my_center|LOCUS_16840 9351 8431 gene locus_tag LOCUS_16850 9351 8431 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598178.1 protein_id gnl|my_center|LOCUS_16850 10094 9348 gene locus_tag LOCUS_16860 10094 9348 CDS product CppA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262622.1 protein_id gnl|my_center|LOCUS_16860 11111 10266 gene locus_tag LOCUS_16870 11111 10266 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570241.1 protein_id gnl|my_center|LOCUS_16870 11231 13513 gene locus_tag LOCUS_16880 11231 13513 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262624.1 protein_id gnl|my_center|LOCUS_16880 13653 13952 gene locus_tag LOCUS_16890 13653 13952 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262625.1 protein_id gnl|my_center|LOCUS_16890 14716 13994 gene locus_tag LOCUS_16900 14716 13994 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922644.1 protein_id gnl|my_center|LOCUS_16900 15406 14819 gene locus_tag LOCUS_16910 15406 14819 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612583.1 protein_id gnl|my_center|LOCUS_16910 16029 15481 gene locus_tag LOCUS_16920 16029 15481 CDS product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612584.1 protein_id gnl|my_center|LOCUS_16920 16217 17398 gene locus_tag LOCUS_16930 16217 17398 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836433.1 protein_id gnl|my_center|LOCUS_16930 17530 17799 gene locus_tag LOCUS_16940 gene rpsN 17530 17799 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982921.1 protein_id gnl|my_center|LOCUS_16940 18225 17983 gene locus_tag LOCUS_16950 18225 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18748 18422 gene locus_tag LOCUS_16960 18748 18422 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610953.1 protein_id gnl|my_center|LOCUS_16960 19433 18738 gene locus_tag LOCUS_16970 19433 18738 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410681.1 protein_id gnl|my_center|LOCUS_16970 20587 19577 gene locus_tag LOCUS_16980 gene tsaD 20587 19577 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655087.1 protein_id gnl|my_center|LOCUS_16980 21018 20602 gene locus_tag LOCUS_16990 gene rimI 21018 20602 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262632.1 protein_id gnl|my_center|LOCUS_16990 21712 21020 gene locus_tag LOCUS_17000 gene tsaB 21712 21020 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978604.1 protein_id gnl|my_center|LOCUS_17000 21894 22124 gene locus_tag LOCUS_17010 21894 22124 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836427.1 protein_id gnl|my_center|LOCUS_17010 22126 23808 gene locus_tag LOCUS_17020 gene rnjA 22126 23808 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310842.1 protein_id gnl|my_center|LOCUS_17020 24594 23932 gene locus_tag LOCUS_17030 24594 23932 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264906.1 protein_id gnl|my_center|LOCUS_17030 26166 24727 gene locus_tag LOCUS_17040 26166 24727 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262483.1 protein_id gnl|my_center|LOCUS_17040 30685 26168 gene locus_tag LOCUS_17050 gene gltB 30685 26168 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279635.1 protein_id gnl|my_center|LOCUS_17050 32208 30862 gene locus_tag LOCUS_17060 gene glnA 32208 30862 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262485.1 protein_id gnl|my_center|LOCUS_17060 32628 32257 gene locus_tag LOCUS_17070 32628 32257 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262486.1 protein_id gnl|my_center|LOCUS_17070 33254 32724 gene locus_tag LOCUS_17080 33254 32724 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854121.1 protein_id gnl|my_center|LOCUS_17080 34589 33393 gene locus_tag LOCUS_17090 34589 33393 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 protein_id gnl|my_center|LOCUS_17090 35780 34767 gene locus_tag LOCUS_17100 gene gap 35780 34767 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131244.1 protein_id gnl|my_center|LOCUS_17100 38067 35989 gene locus_tag LOCUS_17110 gene fusA 38067 35989 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262490.1 protein_id gnl|my_center|LOCUS_17110 38736 38266 gene locus_tag LOCUS_17120 gene rpsG 38736 38266 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262491.1 protein_id gnl|my_center|LOCUS_17120 39171 38758 gene locus_tag LOCUS_17130 gene rpsL 39171 38758 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142332.1 protein_id gnl|my_center|LOCUS_17130 40241 39426 gene locus_tag LOCUS_17140 gene purR 40241 39426 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992072.1 protein_id gnl|my_center|LOCUS_17140 41337 40396 gene locus_tag LOCUS_17150 41337 40396 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262494.1 protein_id gnl|my_center|LOCUS_17150 42601 41327 gene locus_tag LOCUS_17160 42601 41327 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960187.1 protein_id gnl|my_center|LOCUS_17160 43236 42604 gene locus_tag LOCUS_17170 43236 42604 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921882.1 protein_id gnl|my_center|LOCUS_17170 43891 43229 gene locus_tag LOCUS_17180 gene rpe 43891 43229 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_17180 44803 43898 gene locus_tag LOCUS_17190 gene rsgA 44803 43898 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921881.1 protein_id gnl|my_center|LOCUS_17190 44930 45018 gene locus_tag LOCUS_t00150 44930 45018 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45790 45062 gene locus_tag LOCUS_17200 45790 45062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 protein_id gnl|my_center|LOCUS_17200 47800 46409 gene locus_tag LOCUS_17210 47800 46409 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_17210 49175 47793 gene locus_tag LOCUS_17220 49175 47793 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_17220 50559 49165 gene locus_tag LOCUS_17230 50559 49165 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_17230 51201 50560 gene locus_tag LOCUS_17240 51201 50560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence12 14 122 gene locus_tag LOCUS_r00010 14 122 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 131 203 gene locus_tag LOCUS_t00160 131 203 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 228 300 gene locus_tag LOCUS_t00170 228 300 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 303 377 gene locus_tag LOCUS_t00180 303 377 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 385 468 gene locus_tag LOCUS_t00190 385 468 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 481 555 gene locus_tag LOCUS_t00200 481 555 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 572 643 gene locus_tag LOCUS_t00210 572 643 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 652 737 gene locus_tag LOCUS_t00220 652 737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 759 834 gene locus_tag LOCUS_t00230 759 834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 839 914 gene locus_tag LOCUS_t00240 839 914 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 918 993 gene locus_tag LOCUS_t00250 918 993 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1014 1089 gene locus_tag LOCUS_t00260 1014 1089 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1113 1202 gene locus_tag LOCUS_t00270 1113 1202 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1215 1288 gene locus_tag LOCUS_t00280 1215 1288 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1294 1366 gene locus_tag LOCUS_t00290 1294 1366 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1384 1454 gene locus_tag LOCUS_t00300 1384 1454 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1487 1562 gene locus_tag LOCUS_t00310 1487 1562 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1571 1660 gene locus_tag LOCUS_t00320 1571 1660 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1731 2558 gene locus_tag LOCUS_17250 gene mreC 1731 2558 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263142.1 protein_id gnl|my_center|LOCUS_17250 2689 3066 gene locus_tag LOCUS_17260 2689 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3168 4523 gene locus_tag LOCUS_17270 3168 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4655 5626 gene locus_tag LOCUS_17280 4655 5626 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986722.1 protein_id gnl|my_center|LOCUS_17280 5813 6988 gene locus_tag LOCUS_17290 5813 6988 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263138.1 protein_id gnl|my_center|LOCUS_17290 6978 7733 gene locus_tag LOCUS_17300 gene recO 6978 7733 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266275.1 protein_id gnl|my_center|LOCUS_17300 7869 8864 gene locus_tag LOCUS_17310 gene plsX 7869 8864 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716823.1 protein_id gnl|my_center|LOCUS_17310 8882 9124 gene locus_tag LOCUS_17320 8882 9124 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263135.1 protein_id gnl|my_center|LOCUS_17320 9249 9959 gene locus_tag LOCUS_17330 9249 9959 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184494.1 protein_id gnl|my_center|LOCUS_17330 10009 13734 gene locus_tag LOCUS_17340 10009 13734 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263132.1 protein_id gnl|my_center|LOCUS_17340 13831 15294 gene locus_tag LOCUS_17350 gene purF 13831 15294 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921648.1 protein_id gnl|my_center|LOCUS_17350 15318 15749 gene locus_tag LOCUS_17360 15318 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15760 16740 gene locus_tag LOCUS_17370 gene pyrF 15760 16740 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_17370 16776 17795 gene locus_tag LOCUS_17380 gene purM 16776 17795 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284592.1 protein_id gnl|my_center|LOCUS_17380 17795 18346 gene locus_tag LOCUS_17390 gene purN 17795 18346 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 protein_id gnl|my_center|LOCUS_17390 18417 19964 gene locus_tag LOCUS_17400 gene purH 18417 19964 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 protein_id gnl|my_center|LOCUS_17400 20331 21593 gene locus_tag LOCUS_17410 gene purD 20331 21593 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836293.1 protein_id gnl|my_center|LOCUS_17410 21583 22032 gene locus_tag LOCUS_17420 21583 22032 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_17420 22032 22520 gene locus_tag LOCUS_17430 gene purE 22032 22520 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274410.1 protein_id gnl|my_center|LOCUS_17430 22507 23598 gene locus_tag LOCUS_17440 gene purK 22507 23598 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263391.1 protein_id gnl|my_center|LOCUS_17440 23739 25037 gene locus_tag LOCUS_17450 gene purB 23739 25037 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263398.1 protein_id gnl|my_center|LOCUS_17450 25193 26095 gene locus_tag LOCUS_17460 25193 26095 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263400.1 protein_id gnl|my_center|LOCUS_17460 26268 27266 gene locus_tag LOCUS_17470 gene ruvB 26268 27266 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196634.1 protein_id gnl|my_center|LOCUS_17470 27476 27907 gene locus_tag LOCUS_17480 27476 27907 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263403.1 protein_id gnl|my_center|LOCUS_17480 27924 28304 gene locus_tag LOCUS_17490 27924 28304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074470.1 protein_id gnl|my_center|LOCUS_17490 28301 30094 gene locus_tag LOCUS_17500 28301 30094 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310757.1 protein_id gnl|my_center|LOCUS_17500 30446 31930 gene locus_tag LOCUS_17510 gene thrC 30446 31930 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_17510 31983 33263 gene locus_tag LOCUS_17520 31983 33263 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271314.1 protein_id gnl|my_center|LOCUS_17520 33544 33852 gene locus_tag LOCUS_17530 gene rpsJ 33544 33852 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262341.1 protein_id gnl|my_center|LOCUS_17530 33962 34588 gene locus_tag LOCUS_17540 gene rplC 33962 34588 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160205.1 protein_id gnl|my_center|LOCUS_17540 34612 35235 gene locus_tag LOCUS_17550 gene rplD 34612 35235 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024418.1 protein_id gnl|my_center|LOCUS_17550 35235 35531 gene locus_tag LOCUS_17560 35235 35531 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055343.1 protein_id gnl|my_center|LOCUS_17560 35549 36382 gene locus_tag LOCUS_17570 gene rplB 35549 36382 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511737.1 protein_id gnl|my_center|LOCUS_17570 36485 36760 gene locus_tag LOCUS_17580 gene rpsS 36485 36760 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533766.1 protein_id gnl|my_center|LOCUS_17580 36776 37120 gene locus_tag LOCUS_17590 gene rplV 36776 37120 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818141.1 protein_id gnl|my_center|LOCUS_17590 37133 37786 gene locus_tag LOCUS_17600 gene rpsC 37133 37786 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529929.1 protein_id gnl|my_center|LOCUS_17600 37790 38203 gene locus_tag LOCUS_17610 gene rplP 37790 38203 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262333.1 protein_id gnl|my_center|LOCUS_17610 38213 38419 gene locus_tag LOCUS_17620 gene rpmC 38213 38419 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262332.1 protein_id gnl|my_center|LOCUS_17620 38447 38707 gene locus_tag LOCUS_17630 gene rpsQ 38447 38707 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440811.1 protein_id gnl|my_center|LOCUS_17630 38732 39100 gene locus_tag LOCUS_17640 gene rplN 38732 39100 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_17640 39176 39481 gene locus_tag LOCUS_17650 gene rplX 39176 39481 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262329.1 protein_id gnl|my_center|LOCUS_17650 39510 40052 gene locus_tag LOCUS_17660 gene rplE 39510 40052 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013545.1 protein_id gnl|my_center|LOCUS_17660 40070 40255 gene locus_tag LOCUS_17670 40070 40255 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 protein_id gnl|my_center|LOCUS_17670 40419 40817 gene locus_tag LOCUS_17680 gene rpsH 40419 40817 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987748.1 protein_id gnl|my_center|LOCUS_17680 40965 41501 gene locus_tag LOCUS_17690 gene rplF 40965 41501 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262325.1 protein_id gnl|my_center|LOCUS_17690 41608 41964 gene locus_tag LOCUS_17700 gene rplR 41608 41964 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262324.1 protein_id gnl|my_center|LOCUS_17700 41983 42477 gene locus_tag LOCUS_17710 gene rpsE 41983 42477 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894506.1 protein_id gnl|my_center|LOCUS_17710 42492 42674 gene locus_tag LOCUS_17720 gene rpmD 42492 42674 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 protein_id gnl|my_center|LOCUS_17720 42815 43255 gene locus_tag LOCUS_17730 gene rplO 42815 43255 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766093.1 protein_id gnl|my_center|LOCUS_17730 43272 44576 gene locus_tag LOCUS_17740 gene secY 43272 44576 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478891.1 protein_id gnl|my_center|LOCUS_17740 44673 45329 gene locus_tag LOCUS_17750 44673 45329 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050420.1 protein_id gnl|my_center|LOCUS_17750 45447 45665 gene locus_tag LOCUS_17760 gene infA 45447 45665 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040189.1 protein_id gnl|my_center|LOCUS_17760 45825 46190 gene locus_tag LOCUS_17770 gene rpsM 45825 46190 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986615.1 protein_id gnl|my_center|LOCUS_17770 46208 46591 gene locus_tag LOCUS_17780 gene rpsK 46208 46591 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262316.1 protein_id gnl|my_center|LOCUS_17780 46640 47578 gene locus_tag LOCUS_17790 46640 47578 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568977.1 protein_id gnl|my_center|LOCUS_17790 47593 47979 gene locus_tag LOCUS_17800 gene rplQ 47593 47979 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence13 1709 351 gene locus_tag LOCUS_17810 1709 351 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262528.1 protein_id gnl|my_center|LOCUS_17810 1810 2472 gene locus_tag LOCUS_17820 1810 2472 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_17820 2649 3437 gene locus_tag LOCUS_17830 2649 3437 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893616.1 protein_id gnl|my_center|LOCUS_17830 3553 3987 gene locus_tag LOCUS_17840 3553 3987 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455488.1 protein_id gnl|my_center|LOCUS_17840 3990 4964 gene locus_tag LOCUS_17850 3990 4964 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192131.1 protein_id gnl|my_center|LOCUS_17850 5023 5247 gene locus_tag LOCUS_17860 5023 5247 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983328.1 protein_id gnl|my_center|LOCUS_17860 5411 6379 gene locus_tag LOCUS_17870 gene fabK 5411 6379 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262534.1 protein_id gnl|my_center|LOCUS_17870 6420 7340 gene locus_tag LOCUS_17880 gene fabD 6420 7340 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167634.1 protein_id gnl|my_center|LOCUS_17880 7350 8081 gene locus_tag LOCUS_17890 gene fabG 7350 8081 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176108.1 protein_id gnl|my_center|LOCUS_17890 8147 9379 gene locus_tag LOCUS_17900 gene fabF 8147 9379 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 protein_id gnl|my_center|LOCUS_17900 9382 9858 gene locus_tag LOCUS_17910 gene accB 9382 9858 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262538.1 protein_id gnl|my_center|LOCUS_17910 9855 10277 gene locus_tag LOCUS_17920 gene fabZ 9855 10277 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565430.1 protein_id gnl|my_center|LOCUS_17920 10359 11729 gene locus_tag LOCUS_17930 gene accC 10359 11729 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271042.1 protein_id gnl|my_center|LOCUS_17930 11738 12604 gene locus_tag LOCUS_17940 gene accD 11738 12604 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922590.1 protein_id gnl|my_center|LOCUS_17940 12601 13371 gene locus_tag LOCUS_17950 12601 13371 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922589.1 protein_id gnl|my_center|LOCUS_17950 14768 13491 gene locus_tag LOCUS_17960 gene serS 14768 13491 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263348.1 protein_id gnl|my_center|LOCUS_17960 15386 15015 gene locus_tag LOCUS_17970 15386 15015 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920098.1 protein_id gnl|my_center|LOCUS_17970 16375 15464 gene locus_tag LOCUS_17980 16375 15464 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910689.1 protein_id gnl|my_center|LOCUS_17980 17194 16391 gene locus_tag LOCUS_17990 17194 16391 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280328.1 protein_id gnl|my_center|LOCUS_17990 18352 17360 gene locus_tag LOCUS_18000 18352 17360 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263355.1 protein_id gnl|my_center|LOCUS_18000 19481 18681 gene locus_tag LOCUS_18010 19481 18681 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162326.1 protein_id gnl|my_center|LOCUS_18010 19585 20169 gene locus_tag LOCUS_18020 19585 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734042.1 protein_id gnl|my_center|LOCUS_18020 20274 20873 gene locus_tag LOCUS_18030 20274 20873 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027204.1 protein_id gnl|my_center|LOCUS_18030 20979 22400 gene locus_tag LOCUS_18040 20979 22400 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410400.1 protein_id gnl|my_center|LOCUS_18040 22566 23009 gene locus_tag LOCUS_18050 gene tsaE 22566 23009 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964341.1 protein_id gnl|my_center|LOCUS_18050 23002 23514 gene locus_tag LOCUS_18060 23002 23514 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865515.1 protein_id gnl|my_center|LOCUS_18060 23525 24688 gene locus_tag LOCUS_18070 23525 24688 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922584.1 protein_id gnl|my_center|LOCUS_18070 25075 24761 gene locus_tag LOCUS_18080 25075 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 25491 25072 gene locus_tag LOCUS_18090 25491 25072 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368097.1 protein_id gnl|my_center|LOCUS_18090 25555 26280 gene locus_tag LOCUS_18100 25555 26280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262608.1 protein_id gnl|my_center|LOCUS_18100 26283 27317 gene locus_tag LOCUS_18110 26283 27317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732713.1 protein_id gnl|my_center|LOCUS_18110 27387 28184 gene locus_tag LOCUS_18120 27387 28184 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155919.1 protein_id gnl|my_center|LOCUS_18120 28184 28822 gene locus_tag LOCUS_18130 gene trmB 28184 28822 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983387.1 protein_id gnl|my_center|LOCUS_18130