>Feature sequence01 <1 1063 gene locus_tag LOCUS_00010 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583170.1:peptide chain release factor 1 1402 2415 gene locus_tag LOCUS_00020 gene prmC 1402 2415 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_00020 2408 3673 gene locus_tag LOCUS_00030 gene murA 2408 3673 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771755.1 protein_id gnl|my_center|LOCUS_00030 3967 4485 gene locus_tag LOCUS_00040 3967 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4535 5554 gene locus_tag LOCUS_00050 4535 5554 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_00050 7565 6198 gene locus_tag LOCUS_00060 7565 6198 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_00060 10968 7732 gene locus_tag LOCUS_00070 10968 7732 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_00070 12089 11004 gene locus_tag LOCUS_00080 12089 11004 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_00080 14360 13284 gene locus_tag LOCUS_00090 14360 13284 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464337.1 protein_id gnl|my_center|LOCUS_00090 15099 15401 gene locus_tag LOCUS_00100 15099 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15436 17085 gene locus_tag LOCUS_00110 gene pgi 15436 17085 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_00110 17448 17302 gene locus_tag LOCUS_00120 17448 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17866 19023 gene locus_tag LOCUS_00130 17866 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654528.1 protein_id gnl|my_center|LOCUS_00130 19026 19571 gene locus_tag LOCUS_00140 19026 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20083 19832 gene locus_tag LOCUS_00150 20083 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20392 20177 gene locus_tag LOCUS_00160 20392 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22718 22542 gene locus_tag LOCUS_00170 22718 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22975 22784 gene locus_tag LOCUS_00180 22975 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23093 23314 gene locus_tag LOCUS_00190 23093 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23390 23608 gene locus_tag LOCUS_00200 23390 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23611 24324 gene locus_tag LOCUS_00210 23611 24324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_00210 25213 24995 gene locus_tag LOCUS_00220 25213 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25556 25203 gene locus_tag LOCUS_00230 25556 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25728 27713 gene locus_tag LOCUS_00240 25728 27713 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466016.1 protein_id gnl|my_center|LOCUS_00240 29425 29934 gene locus_tag LOCUS_00250 29425 29934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30787 30572 gene locus_tag LOCUS_00260 30787 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30988 31269 gene locus_tag LOCUS_00270 30988 31269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00270 32217 31894 gene locus_tag LOCUS_00280 32217 31894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32508 32239 gene locus_tag LOCUS_00290 32508 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33314 32553 gene locus_tag LOCUS_00300 33314 32553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33375 34049 gene locus_tag LOCUS_00310 33375 34049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34136 34288 gene locus_tag LOCUS_00320 34136 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34510 34932 gene locus_tag LOCUS_00330 34510 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35304 35609 gene locus_tag LOCUS_00340 35304 35609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35831 36115 gene locus_tag LOCUS_00350 35831 36115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36205 36891 gene locus_tag LOCUS_00360 36205 36891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_00360 36866 38020 gene locus_tag LOCUS_00370 36866 38020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_00370 38022 39188 gene locus_tag LOCUS_00380 38022 39188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_00380 39551 39670 gene locus_tag LOCUS_00390 39551 39670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40254 40592 gene locus_tag LOCUS_00400 40254 40592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40729 41895 gene locus_tag LOCUS_00410 40729 41895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42838 43284 gene locus_tag LOCUS_00420 42838 43284 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_00420 44257 43469 gene locus_tag LOCUS_00430 gene rsmA 44257 43469 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_00430 45575 44535 gene locus_tag LOCUS_00440 gene pdxA 45575 44535 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_00440 46215 45568 gene locus_tag LOCUS_00450 46215 45568 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_00450 46960 46283 gene locus_tag LOCUS_00460 46960 46283 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_00460 49012 47087 gene locus_tag LOCUS_00470 49012 47087 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_00470 50379 49165 gene locus_tag LOCUS_00480 50379 49165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50933 50730 gene locus_tag LOCUS_00490 50933 50730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51329 51490 gene locus_tag LOCUS_00500 51329 51490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52076 52234 gene locus_tag LOCUS_00510 52076 52234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52225 52761 gene locus_tag LOCUS_00520 52225 52761 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214447.1 protein_id gnl|my_center|LOCUS_00520 52955 53245 gene locus_tag LOCUS_00530 52955 53245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53480 53686 gene locus_tag LOCUS_00540 53480 53686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53984 54208 gene locus_tag LOCUS_00550 53984 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54174 54599 gene locus_tag LOCUS_00560 54174 54599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55069 55362 gene locus_tag LOCUS_00570 55069 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56050 56946 gene locus_tag LOCUS_00580 56050 56946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00580 57328 58374 gene locus_tag LOCUS_00590 gene dinB 57328 58374 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_00590 60963 58534 gene locus_tag LOCUS_00600 60963 58534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62062 61037 gene locus_tag LOCUS_00610 62062 61037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 63274 62141 gene locus_tag LOCUS_00620 63274 62141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 63353 63547 gene locus_tag LOCUS_00630 63353 63547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64281 63712 gene locus_tag LOCUS_00640 64281 63712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65359 64352 gene locus_tag LOCUS_00650 65359 64352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66168 65440 gene locus_tag LOCUS_00660 66168 65440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_00660 66862 66143 gene locus_tag LOCUS_00670 66862 66143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67182 66862 gene locus_tag LOCUS_00680 67182 66862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 67880 67275 gene locus_tag LOCUS_00690 gene cbiM 67880 67275 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_00690 68488 68072 gene locus_tag LOCUS_00700 gene nikR 68488 68072 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_00700 68741 69556 gene locus_tag LOCUS_00710 68741 69556 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_00710 69668 70858 gene locus_tag LOCUS_00720 69668 70858 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_00720 70979 72373 gene locus_tag LOCUS_00730 gene mgtE 70979 72373 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080209.1 protein_id gnl|my_center|LOCUS_00730 72598 72891 gene locus_tag LOCUS_00740 72598 72891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 73005 73688 gene locus_tag LOCUS_00750 73005 73688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 73760 74071 gene locus_tag LOCUS_00760 73760 74071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 74144 74746 gene locus_tag LOCUS_00770 74144 74746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 74843 75631 gene locus_tag LOCUS_00780 74843 75631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 76196 75942 gene locus_tag LOCUS_00790 76196 75942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 77162 77395 gene locus_tag LOCUS_00800 77162 77395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 77960 78094 gene locus_tag LOCUS_00810 77960 78094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 78642 78992 gene locus_tag LOCUS_00820 78642 78992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 79200 79928 gene locus_tag LOCUS_00830 79200 79928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 79883 80140 gene locus_tag LOCUS_00840 79883 80140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 80220 80462 gene locus_tag LOCUS_00850 80220 80462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 82395 81793 gene locus_tag LOCUS_00860 82395 81793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 82497 82688 gene locus_tag LOCUS_00870 82497 82688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 85981 85274 gene locus_tag LOCUS_00880 85981 85274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 87362 85962 gene locus_tag LOCUS_00890 gene ccoG 87362 85962 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_00890 87945 87364 gene locus_tag LOCUS_00900 87945 87364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 88112 87942 gene locus_tag LOCUS_00910 88112 87942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 90246 88114 gene locus_tag LOCUS_00920 gene ccoN 90246 88114 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_00920 92871 91393 gene locus_tag LOCUS_00930 92871 91393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95680 95048 gene locus_tag LOCUS_00940 95680 95048 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_00940 95922 95680 gene locus_tag LOCUS_00950 95922 95680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 99797 97335 gene locus_tag LOCUS_00960 99797 97335 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_00960 100138 99797 gene locus_tag LOCUS_00970 100138 99797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 101354 100254 gene locus_tag LOCUS_00980 gene dnaN 101354 100254 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_00980 103101 101683 gene locus_tag LOCUS_00990 gene dnaA 103101 101683 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00990 103398 103138 gene locus_tag LOCUS_01000 103398 103138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 104721 103486 gene locus_tag LOCUS_01010 104721 103486 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_01010 105803 104919 gene locus_tag LOCUS_01020 gene mtnP 105803 104919 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_01020 106711 105797 gene locus_tag LOCUS_01030 106711 105797 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_01030 107003 108379 gene locus_tag LOCUS_01040 107003 108379 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_01040 108667 109839 gene locus_tag LOCUS_01050 gene sucC 108667 109839 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 protein_id gnl|my_center|LOCUS_01050 109820 110701 gene locus_tag LOCUS_01060 gene sucD 109820 110701 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_01060 110976 113063 gene locus_tag LOCUS_01070 110976 113063 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_01070 113650 114315 gene locus_tag LOCUS_01080 113650 114315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 114400 115182 gene locus_tag LOCUS_01090 114400 115182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 115235 116872 gene locus_tag LOCUS_01100 115235 116872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117451 120276 gene locus_tag LOCUS_01110 gene uvrA 117451 120276 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 protein_id gnl|my_center|LOCUS_01110 120463 121575 gene locus_tag LOCUS_01120 120463 121575 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_01120 121837 123144 gene locus_tag LOCUS_01130 121837 123144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 123502 124260 gene locus_tag LOCUS_01140 123502 124260 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_01140 125046 124375 gene locus_tag LOCUS_01150 125046 124375 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_01150 126023 125403 gene locus_tag LOCUS_01160 126023 125403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 126552 126394 gene locus_tag LOCUS_01170 126552 126394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 127011 128006 gene locus_tag LOCUS_01180 gene hpnH 127011 128006 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_01180 130184 128109 gene locus_tag LOCUS_01190 gene shc 130184 128109 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_01190 130523 131464 gene locus_tag LOCUS_01200 130523 131464 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_01200 131927 132475 gene locus_tag LOCUS_01210 131927 132475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 133500 133808 gene locus_tag LOCUS_01220 133500 133808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 133834 134112 gene locus_tag LOCUS_01230 133834 134112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 134522 134806 gene locus_tag LOCUS_01240 134522 134806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135693 137453 gene locus_tag LOCUS_01250 135693 137453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 137537 138547 gene locus_tag LOCUS_01260 gene ftcD 137537 138547 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_01260 138883 138626 gene locus_tag LOCUS_01270 138883 138626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 139390 140688 gene locus_tag LOCUS_01280 139390 140688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732326.1 protein_id gnl|my_center|LOCUS_01280 141524 140838 gene locus_tag LOCUS_01290 141524 140838 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 protein_id gnl|my_center|LOCUS_01290 142057 141521 gene locus_tag LOCUS_01300 142057 141521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 143487 142231 gene locus_tag LOCUS_01310 143487 142231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144404 143520 gene locus_tag LOCUS_01320 144404 143520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 144436 144828 gene locus_tag LOCUS_01330 144436 144828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 145867 145289 gene locus_tag LOCUS_01340 145867 145289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 147189 145909 gene locus_tag LOCUS_01350 147189 145909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 147738 148310 gene locus_tag LOCUS_01360 147738 148310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 148564 148803 gene locus_tag LOCUS_01370 148564 148803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 148933 149223 gene locus_tag LOCUS_01380 148933 149223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 149270 149467 gene locus_tag LOCUS_01390 149270 149467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 149454 149795 gene locus_tag LOCUS_01400 149454 149795 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_01400 150199 151950 gene locus_tag LOCUS_01410 150199 151950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 151875 153338 gene locus_tag LOCUS_01420 151875 153338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 153313 154632 gene locus_tag LOCUS_01430 153313 154632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 155636 154599 gene locus_tag LOCUS_01440 155636 154599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 156045 157232 gene locus_tag LOCUS_01450 156045 157232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 158180 159682 gene locus_tag LOCUS_01460 158180 159682 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_01460 159967 160461 gene locus_tag LOCUS_01470 159967 160461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 161364 160795 gene locus_tag LOCUS_01480 161364 160795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_01480 162066 161422 gene locus_tag LOCUS_01490 162066 161422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 163368 162106 gene locus_tag LOCUS_01500 163368 162106 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_01500 163607 165349 gene locus_tag LOCUS_01510 163607 165349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 166989 165571 gene locus_tag LOCUS_01520 166989 165571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 167367 167080 gene locus_tag LOCUS_01530 167367 167080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 167895 168041 gene locus_tag LOCUS_01540 167895 168041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 168316 168597 gene locus_tag LOCUS_01550 168316 168597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 169902 170057 gene locus_tag LOCUS_01560 169902 170057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 170385 170651 gene locus_tag LOCUS_01570 170385 170651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 171275 171015 gene locus_tag LOCUS_01580 171275 171015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 171692 171943 gene locus_tag LOCUS_01590 171692 171943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 172378 172905 gene locus_tag LOCUS_01600 172378 172905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01600 172954 173409 gene locus_tag LOCUS_01610 172954 173409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 174018 173749 gene locus_tag LOCUS_01620 174018 173749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 175079 174246 gene locus_tag LOCUS_01630 gene trpA 175079 174246 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_01630 176445 175198 gene locus_tag LOCUS_01640 gene trpB 176445 175198 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_01640 178355 176745 gene locus_tag LOCUS_01650 178355 176745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 181068 179299 gene locus_tag LOCUS_01660 181068 179299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 181378 181671 gene locus_tag LOCUS_01670 181378 181671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 182217 182717 gene locus_tag LOCUS_01680 182217 182717 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_01680 182719 183018 gene locus_tag LOCUS_01690 182719 183018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 183830 183060 gene locus_tag LOCUS_01700 183830 183060 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083245.1 protein_id gnl|my_center|LOCUS_01700 184878 183853 gene locus_tag LOCUS_01710 184878 183853 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080717.1 protein_id gnl|my_center|LOCUS_01710 185083 184871 gene locus_tag LOCUS_01720 185083 184871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 186199 185363 gene locus_tag LOCUS_01730 186199 185363 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01730 186909 186292 gene locus_tag LOCUS_01740 186909 186292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_01740 188435 187014 gene locus_tag LOCUS_01750 188435 187014 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_01750 189028 188708 gene locus_tag LOCUS_01760 189028 188708 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_01760 190185 189025 gene locus_tag LOCUS_01770 gene nifS 190185 189025 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_01770 190577 190221 gene locus_tag LOCUS_01780 190577 190221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 191453 190584 gene locus_tag LOCUS_01790 191453 190584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 192751 191753 gene locus_tag LOCUS_01800 192751 191753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 193741 192764 gene locus_tag LOCUS_01810 193741 192764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 194662 193844 gene locus_tag LOCUS_01820 194662 193844 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_01820 194857 195210 gene locus_tag LOCUS_01830 194857 195210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 195493 195906 gene locus_tag LOCUS_01840 195493 195906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 196023 196226 gene locus_tag LOCUS_01850 196023 196226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 196665 196294 gene locus_tag LOCUS_01860 196665 196294 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_01860 196904 196662 gene locus_tag LOCUS_01870 196904 196662 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_01870 198032 197508 gene locus_tag LOCUS_01880 198032 197508 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_01880 198942 198787 gene locus_tag LOCUS_01890 198942 198787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 199131 198979 gene locus_tag LOCUS_01900 199131 198979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 199435 199187 gene locus_tag LOCUS_01910 199435 199187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 200112 199753 gene locus_tag LOCUS_01920 200112 199753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 200360 201415 gene locus_tag LOCUS_01930 200360 201415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 202786 201752 gene locus_tag LOCUS_01940 202786 201752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01940 203952 202855 gene locus_tag LOCUS_01950 203952 202855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01950 204466 204068 gene locus_tag LOCUS_01960 204466 204068 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_01960 204717 205253 gene locus_tag LOCUS_01970 gene hslV 204717 205253 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_01970 205256 206605 gene locus_tag LOCUS_01980 gene hslU 205256 206605 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_01980 206938 207558 gene locus_tag LOCUS_01990 206938 207558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 208180 207749 gene locus_tag LOCUS_02000 208180 207749 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 protein_id gnl|my_center|LOCUS_02000 210243 209209 gene locus_tag LOCUS_02010 210243 209209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 210537 211439 gene locus_tag LOCUS_02020 210537 211439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 211629 212639 gene locus_tag LOCUS_02030 211629 212639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 214338 212572 gene locus_tag LOCUS_02040 214338 212572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_02040 214457 216007 gene locus_tag LOCUS_02050 gene guaA 214457 216007 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_02050 217607 216261 gene locus_tag LOCUS_02060 217607 216261 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065844.1 protein_id gnl|my_center|LOCUS_02060 218006 217668 gene locus_tag LOCUS_02070 gene glnB 218006 217668 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_02070 219883 218528 gene locus_tag LOCUS_02080 219883 218528 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_02080 220475 220137 gene locus_tag LOCUS_02090 gene glnB 220475 220137 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_02090 222093 220534 gene locus_tag LOCUS_02100 222093 220534 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_02100 223026 223859 gene locus_tag LOCUS_02110 223026 223859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 223879 224817 gene locus_tag LOCUS_02120 223879 224817 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_02120 225306 226115 gene locus_tag LOCUS_02130 225306 226115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 226936 228036 gene locus_tag LOCUS_02140 226936 228036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 228368 229351 gene locus_tag LOCUS_02150 228368 229351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 229999 231507 gene locus_tag LOCUS_02160 229999 231507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 231752 231534 gene locus_tag LOCUS_02170 231752 231534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 232196 232744 gene locus_tag LOCUS_02180 232196 232744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 232684 233526 gene locus_tag LOCUS_02190 gene dapB 232684 233526 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_02190 233758 236352 gene locus_tag LOCUS_02200 gene clpB 233758 236352 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_02200 236700 236527 gene locus_tag LOCUS_02210 236700 236527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 237652 236738 gene locus_tag LOCUS_02220 237652 236738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 238472 237642 gene locus_tag LOCUS_02230 238472 237642 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_02230 238740 238531 gene locus_tag LOCUS_02240 238740 238531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 240598 238916 gene locus_tag LOCUS_02250 240598 238916 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_02250 242101 240788 gene locus_tag LOCUS_02260 242101 240788 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_02260 242895 242206 gene locus_tag LOCUS_02270 gene hisA 242895 242206 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_02270 243693 243070 gene locus_tag LOCUS_02280 gene hisH 243693 243070 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_02280 244351 243704 gene locus_tag LOCUS_02290 244351 243704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 245188 244631 gene locus_tag LOCUS_02300 245188 244631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 247804 247487 gene locus_tag LOCUS_02310 247804 247487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 249690 247780 gene locus_tag LOCUS_02320 249690 247780 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02320 250118 249849 gene locus_tag LOCUS_02330 250118 249849 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_02330 250312 250091 gene locus_tag LOCUS_02340 250312 250091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 251257 250901 gene locus_tag LOCUS_02350 251257 250901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 252659 252453 gene locus_tag LOCUS_02360 252659 252453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 253323 252928 gene locus_tag LOCUS_02370 253323 252928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 253526 253275 gene locus_tag LOCUS_02380 253526 253275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 255288 253642 gene locus_tag LOCUS_02390 255288 253642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 256868 255567 gene locus_tag LOCUS_02400 256868 255567 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679544.1 protein_id gnl|my_center|LOCUS_02400 257279 257881 gene locus_tag LOCUS_02410 257279 257881 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_02410 258496 258008 gene locus_tag LOCUS_02420 258496 258008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 259441 258569 gene locus_tag LOCUS_02430 259441 258569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 259377 259589 gene locus_tag LOCUS_02440 259377 259589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 260229 259699 gene locus_tag LOCUS_02450 260229 259699 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_02450 260794 260345 gene locus_tag LOCUS_02460 gene rayT 260794 260345 CDS product REP-associated tyrosine transposase RayT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006263.1 protein_id gnl|my_center|LOCUS_02460 261933 261262 gene locus_tag LOCUS_02470 261933 261262 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_02470 262442 261990 gene locus_tag LOCUS_02480 262442 261990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 264051 262705 gene locus_tag LOCUS_02490 264051 262705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 264233 264072 gene locus_tag LOCUS_02500 264233 264072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 265208 264792 gene locus_tag LOCUS_02510 265208 264792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02510 265808 265443 gene locus_tag LOCUS_02520 265808 265443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02520 267688 267077 gene locus_tag LOCUS_02530 267688 267077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 268158 267721 gene locus_tag LOCUS_02540 268158 267721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 270053 268194 gene locus_tag LOCUS_02550 270053 268194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 270673 270194 gene locus_tag LOCUS_02560 270673 270194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 271046 270705 gene locus_tag LOCUS_02570 271046 270705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 271410 271015 gene locus_tag LOCUS_02580 271410 271015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 271746 271423 gene locus_tag LOCUS_02590 271746 271423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 273633 273370 gene locus_tag LOCUS_02600 273633 273370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 274594 273962 gene locus_tag LOCUS_02610 274594 273962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 275090 274821 gene locus_tag LOCUS_02620 275090 274821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 275681 275436 gene locus_tag LOCUS_02630 275681 275436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 277162 276035 gene locus_tag LOCUS_02640 277162 276035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 279387 277561 gene locus_tag LOCUS_02650 279387 277561 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071015.1 protein_id gnl|my_center|LOCUS_02650 279461 279634 gene locus_tag LOCUS_02660 279461 279634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 280205 279786 gene locus_tag LOCUS_02670 280205 279786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 281811 280393 gene locus_tag LOCUS_02680 281811 280393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 282485 281808 gene locus_tag LOCUS_02690 282485 281808 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_02690 282790 283893 gene locus_tag LOCUS_02700 282790 283893 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_02700 286403 284379 gene locus_tag LOCUS_02710 286403 284379 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_02710 288118 286433 gene locus_tag LOCUS_02720 288118 286433 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612386.1 protein_id gnl|my_center|LOCUS_02720 288738 288115 gene locus_tag LOCUS_02730 288738 288115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 289419 289060 gene locus_tag LOCUS_02740 289419 289060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 290440 289571 gene locus_tag LOCUS_02750 290440 289571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 290986 290444 gene locus_tag LOCUS_02760 290986 290444 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_02760 291774 291929 gene locus_tag LOCUS_02770 291774 291929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 292098 294731 gene locus_tag LOCUS_02780 292098 294731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 294977 295141 gene locus_tag LOCUS_02790 294977 295141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 296039 296605 gene locus_tag LOCUS_02800 296039 296605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 297520 299433 gene locus_tag LOCUS_02810 297520 299433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_02810 299735 300919 gene locus_tag LOCUS_02820 299735 300919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 301517 304444 gene locus_tag LOCUS_02830 301517 304444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_02830 304568 305410 gene locus_tag LOCUS_02840 304568 305410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 305428 306897 gene locus_tag LOCUS_02850 305428 306897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 306914 307543 gene locus_tag LOCUS_02860 306914 307543 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_02860 307558 307971 gene locus_tag LOCUS_02870 307558 307971 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_02870 308124 308654 gene locus_tag LOCUS_02880 308124 308654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 308660 310072 gene locus_tag LOCUS_02890 308660 310072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 310276 310716 gene locus_tag LOCUS_02900 310276 310716 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941761.1 protein_id gnl|my_center|LOCUS_02900 311420 313240 gene locus_tag LOCUS_02910 311420 313240 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965989.1 protein_id gnl|my_center|LOCUS_02910 315435 313732 gene locus_tag LOCUS_02920 315435 313732 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_02920 315693 317474 gene locus_tag LOCUS_02930 315693 317474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_02930 318462 318025 gene locus_tag LOCUS_02940 gene moaC 318462 318025 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_02940 318789 318568 gene locus_tag LOCUS_02950 318789 318568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 318968 318771 gene locus_tag LOCUS_02960 318968 318771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 319262 319477 gene locus_tag LOCUS_02970 319262 319477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 319456 320022 gene locus_tag LOCUS_02980 319456 320022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 321621 320650 gene locus_tag LOCUS_02990 gene moaA 321621 320650 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_02990 323015 321633 gene locus_tag LOCUS_03000 323015 321633 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_03000 326611 323030 gene locus_tag LOCUS_03010 326611 323030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 327854 326901 gene locus_tag LOCUS_03020 327854 326901 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_03020 328631 328023 gene locus_tag LOCUS_03030 328631 328023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 329166 330428 gene locus_tag LOCUS_03040 gene clpX 329166 330428 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_03040 333244 330536 gene locus_tag LOCUS_03050 333244 330536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 333621 333406 gene locus_tag LOCUS_03060 333621 333406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 333757 334404 gene locus_tag LOCUS_03070 gene fsa 333757 334404 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_03070 334625 334386 gene locus_tag LOCUS_03080 334625 334386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 334944 334615 gene locus_tag LOCUS_03090 334944 334615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 337226 337077 gene locus_tag LOCUS_03100 337226 337077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 338856 339761 gene locus_tag LOCUS_03110 338856 339761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 339800 340333 gene locus_tag LOCUS_03120 339800 340333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 340674 341633 gene locus_tag LOCUS_03130 gene miaA 340674 341633 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_03130 341689 343458 gene locus_tag LOCUS_03140 341689 343458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 343770 344675 gene locus_tag LOCUS_03150 343770 344675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 344691 345485 gene locus_tag LOCUS_03160 344691 345485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 345522 345722 gene locus_tag LOCUS_03170 345522 345722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 345719 346066 gene locus_tag LOCUS_03180 gene mazF9 345719 346066 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_03180 346157 348691 gene locus_tag LOCUS_03190 346157 348691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 348795 349292 gene locus_tag LOCUS_03200 348795 349292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 349313 349684 gene locus_tag LOCUS_03210 349313 349684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 349693 350460 gene locus_tag LOCUS_03220 349693 350460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 350460 351938 gene locus_tag LOCUS_03230 350460 351938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 353264 352338 gene locus_tag LOCUS_03240 353264 352338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 353675 353313 gene locus_tag LOCUS_03250 353675 353313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 355728 353920 gene locus_tag LOCUS_03260 355728 353920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_03260 357777 356386 gene locus_tag LOCUS_03270 357777 356386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 359663 358590 gene locus_tag LOCUS_03280 gene mnmA 359663 358590 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_03280 360831 360346 gene locus_tag LOCUS_03290 360831 360346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 361138 361545 gene locus_tag LOCUS_03300 361138 361545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 361874 362809 gene locus_tag LOCUS_03310 gene sppA 361874 362809 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941487.1 protein_id gnl|my_center|LOCUS_03310 364270 362879 gene locus_tag LOCUS_03320 364270 362879 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_03320 366726 364267 gene locus_tag LOCUS_03330 366726 364267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 367132 367545 gene locus_tag LOCUS_03340 367132 367545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 368496 367570 gene locus_tag LOCUS_03350 gene cysQ 368496 367570 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_03350 369805 368642 gene locus_tag LOCUS_03360 369805 368642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 372408 371347 gene locus_tag LOCUS_03370 372408 371347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 373864 373574 gene locus_tag LOCUS_03380 373864 373574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 374437 374186 gene locus_tag LOCUS_03390 374437 374186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 376373 374994 gene locus_tag LOCUS_03400 376373 374994 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03400 378203 376620 gene locus_tag LOCUS_03410 378203 376620 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03410 380678 378750 gene locus_tag LOCUS_03420 gene nuoL 380678 378750 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_03420 380988 380686 gene locus_tag LOCUS_03430 gene nuoK 380988 380686 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_03430 381499 380990 gene locus_tag LOCUS_03440 381499 380990 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_03440 381937 381518 gene locus_tag LOCUS_03450 gene nuoI 381937 381518 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_03450 382932 381934 gene locus_tag LOCUS_03460 gene nuoH 382932 381934 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_03460 383212 382925 gene locus_tag LOCUS_03470 383212 382925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 383649 383419 gene locus_tag LOCUS_03480 383649 383419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 383965 383627 gene locus_tag LOCUS_03490 383965 383627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 387125 384453 gene locus_tag LOCUS_03500 gene fdhF 387125 384453 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_03500 388972 387122 gene locus_tag LOCUS_03510 gene nuoF 388972 387122 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_03510 389860 389366 gene locus_tag LOCUS_03520 gene nuoE 389860 389366 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_03520 391059 389869 gene locus_tag LOCUS_03530 gene nuoD 391059 389869 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_03530 391556 391056 gene locus_tag LOCUS_03540 391556 391056 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_03540 392048 391581 gene locus_tag LOCUS_03550 392048 391581 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_03550 392392 392039 gene locus_tag LOCUS_03560 392392 392039 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_03560 392916 395351 gene locus_tag LOCUS_03570 392916 395351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 395421 395792 gene locus_tag LOCUS_03580 395421 395792 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03580 396246 396097 gene locus_tag LOCUS_03590 396246 396097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 396341 398779 gene locus_tag LOCUS_03600 396341 398779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 398796 399233 gene locus_tag LOCUS_03610 398796 399233 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_03610 399578 399327 gene locus_tag LOCUS_03620 399578 399327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 400677 400123 gene locus_tag LOCUS_03630 400677 400123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 401438 403690 gene locus_tag LOCUS_03640 401438 403690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 403707 404144 gene locus_tag LOCUS_03650 403707 404144 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_03650 404342 405577 gene locus_tag LOCUS_03660 gene anmK 404342 405577 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_03660 405949 405779 gene locus_tag LOCUS_03670 405949 405779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 406445 405942 gene locus_tag LOCUS_03680 406445 405942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 406693 406385 gene locus_tag LOCUS_03690 406693 406385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 407129 406887 gene locus_tag LOCUS_03700 407129 406887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 407250 407023 gene locus_tag LOCUS_03710 407250 407023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 407474 407247 gene locus_tag LOCUS_03720 407474 407247 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_03720 407999 407745 gene locus_tag LOCUS_03730 407999 407745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 408193 407996 gene locus_tag LOCUS_03740 408193 407996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 408459 408244 gene locus_tag LOCUS_03750 408459 408244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 409580 408702 gene locus_tag LOCUS_03760 409580 408702 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909126.1 protein_id gnl|my_center|LOCUS_03760 410800 409724 gene locus_tag LOCUS_03770 410800 409724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 414133 410933 gene locus_tag LOCUS_03780 414133 410933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 414756 414193 gene locus_tag LOCUS_03790 414756 414193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 416767 414803 gene locus_tag LOCUS_03800 416767 414803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 418025 416751 gene locus_tag LOCUS_03810 418025 416751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 418815 418588 gene locus_tag LOCUS_03820 418815 418588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 419095 418808 gene locus_tag LOCUS_03830 419095 418808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 419701 419486 gene locus_tag LOCUS_03840 419701 419486 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_03840 420607 420813 gene locus_tag LOCUS_03850 420607 420813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 420958 421620 gene locus_tag LOCUS_03860 gene pyrE 420958 421620 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_03860 422837 421749 gene locus_tag LOCUS_03870 gene ychF 422837 421749 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_03870 423419 424867 gene locus_tag LOCUS_03880 423419 424867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 424904 425509 gene locus_tag LOCUS_03890 424904 425509 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_03890 425752 425946 gene locus_tag LOCUS_03900 425752 425946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 426068 426385 gene locus_tag LOCUS_03910 426068 426385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 426367 426528 gene locus_tag LOCUS_03920 426367 426528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 426725 427138 gene locus_tag LOCUS_03930 426725 427138 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_03930 427369 427794 gene locus_tag LOCUS_03940 427369 427794 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064659.1 protein_id gnl|my_center|LOCUS_03940 428446 429402 gene locus_tag LOCUS_03950 428446 429402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 429405 431024 gene locus_tag LOCUS_03960 429405 431024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 431684 432358 gene locus_tag LOCUS_03970 431684 432358 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_03970 433576 432404 gene locus_tag LOCUS_03980 433576 432404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 434746 433724 gene locus_tag LOCUS_03990 434746 433724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_03990 435287 434955 gene locus_tag LOCUS_04000 gene cutA 435287 434955 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_04000 435708 435292 gene locus_tag LOCUS_04010 435708 435292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 435964 435716 gene locus_tag LOCUS_04020 435964 435716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 437185 435968 gene locus_tag LOCUS_04030 437185 435968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 438211 437468 gene locus_tag LOCUS_04040 438211 437468 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_04040 439859 438471 gene locus_tag LOCUS_04050 439859 438471 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_04050 440988 440602 gene locus_tag LOCUS_04060 440988 440602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 441442 441794 gene locus_tag LOCUS_tm00010 441442 441794 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 443014 442148 gene locus_tag LOCUS_04070 443014 442148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 444074 444865 gene locus_tag LOCUS_04080 gene elyC 444074 444865 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 protein_id gnl|my_center|LOCUS_04080 445267 445091 gene locus_tag LOCUS_04090 445267 445091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 445488 445264 gene locus_tag LOCUS_04100 445488 445264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 446660 445689 gene locus_tag LOCUS_04110 gene hflC 446660 445689 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_04110 447661 446657 gene locus_tag LOCUS_04120 gene hflK 447661 446657 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_04120 447970 447758 gene locus_tag LOCUS_04130 447970 447758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 448738 448052 gene locus_tag LOCUS_04140 448738 448052 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_04140 449273 448893 gene locus_tag LOCUS_04150 449273 448893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 449550 449317 gene locus_tag LOCUS_04160 449550 449317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 452417 449883 gene locus_tag LOCUS_04170 452417 449883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 453894 452872 gene locus_tag LOCUS_04180 453894 452872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 454457 453891 gene locus_tag LOCUS_04190 454457 453891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 454929 454510 gene locus_tag LOCUS_04200 454929 454510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 455506 455363 gene locus_tag LOCUS_04210 455506 455363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 456627 455626 gene locus_tag LOCUS_04220 456627 455626 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_04220 457655 456651 gene locus_tag LOCUS_04230 gene ilvC 457655 456651 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_04230 458185 457706 gene locus_tag LOCUS_04240 gene ilvN 458185 457706 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_04240 458826 458188 gene locus_tag LOCUS_04250 gene rsxA 458826 458188 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04250 459451 458819 gene locus_tag LOCUS_04260 459451 458819 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_04260 460023 461075 gene locus_tag LOCUS_04270 460023 461075 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814543.1 protein_id gnl|my_center|LOCUS_04270 461166 462248 gene locus_tag LOCUS_04280 461166 462248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 462840 463046 gene locus_tag LOCUS_04290 462840 463046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 463130 463564 gene locus_tag LOCUS_04300 463130 463564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 464741 463950 gene locus_tag LOCUS_04310 464741 463950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 465745 464747 gene locus_tag LOCUS_04320 465745 464747 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_04320 465953 466189 gene locus_tag LOCUS_04330 gene thiS 465953 466189 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_04330 466209 466970 gene locus_tag LOCUS_04340 466209 466970 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_04340 467073 467837 gene locus_tag LOCUS_04350 gene hisF 467073 467837 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_04350 469138 468410 gene locus_tag LOCUS_04360 469138 468410 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_04360 470847 469192 gene locus_tag LOCUS_04370 470847 469192 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_04370 472917 471118 gene locus_tag LOCUS_04380 gene dnaG 472917 471118 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528211.1 protein_id gnl|my_center|LOCUS_04380 473130 473588 gene locus_tag LOCUS_04390 gene nuoE 473130 473588 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_04390 473575 475359 gene locus_tag LOCUS_04400 gene nuoF 473575 475359 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_04400 475362 477443 gene locus_tag LOCUS_04410 475362 477443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 479176 478001 gene locus_tag LOCUS_04420 479176 478001 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_04420 480783 479386 gene locus_tag LOCUS_04430 480783 479386 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_04430 482198 482980 gene locus_tag LOCUS_04440 482198 482980 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943383.1 protein_id gnl|my_center|LOCUS_04440 483239 484519 gene locus_tag LOCUS_04450 483239 484519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266612.1 protein_id gnl|my_center|LOCUS_04450 484869 485378 gene locus_tag LOCUS_04460 484869 485378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 485375 486184 gene locus_tag LOCUS_04470 gene mpgP 485375 486184 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_04470 486198 487415 gene locus_tag LOCUS_04480 486198 487415 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_04480 487531 488790 gene locus_tag LOCUS_04490 487531 488790 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_04490 489011 490060 gene locus_tag LOCUS_04500 489011 490060 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_04500 491286 490075 gene locus_tag LOCUS_04510 491286 490075 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_04510 493212 491464 gene locus_tag LOCUS_04520 493212 491464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 494416 495186 gene locus_tag LOCUS_04530 494416 495186 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205364.1 protein_id gnl|my_center|LOCUS_04530 495532 495344 gene locus_tag LOCUS_04540 495532 495344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 495641 495566 gene locus_tag LOCUS_t00010 495641 495566 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 495991 496752 gene locus_tag LOCUS_04550 495991 496752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 496727 497290 gene locus_tag LOCUS_04560 496727 497290 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_04560 498194 497253 gene locus_tag LOCUS_04570 gene speE 498194 497253 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_04570 498614 498225 gene locus_tag LOCUS_04580 gene speD 498614 498225 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_04580 498905 498756 gene locus_tag LOCUS_04590 498905 498756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 498972 500387 gene locus_tag LOCUS_04600 gene murC 498972 500387 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_04600 500642 500472 gene locus_tag LOCUS_04610 500642 500472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 500922 501296 gene locus_tag LOCUS_04620 500922 501296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 501489 501863 gene locus_tag LOCUS_04630 gene sdhC 501489 501863 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_04630 501963 503687 gene locus_tag LOCUS_04640 501963 503687 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_04640 505799 505467 gene locus_tag LOCUS_04650 505799 505467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 506560 505886 gene locus_tag LOCUS_04660 gene clpP 506560 505886 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631995.1 protein_id gnl|my_center|LOCUS_04660 507898 506591 gene locus_tag LOCUS_04670 gene tig 507898 506591 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_04670 508010 507936 gene locus_tag LOCUS_t00020 508010 507936 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 508114 508030 gene locus_tag LOCUS_t00030 508114 508030 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 508481 508406 gene locus_tag LOCUS_t00040 508481 508406 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 508588 508512 gene locus_tag LOCUS_t00050 508588 508512 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 508900 508824 gene locus_tag LOCUS_t00060 508900 508824 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 509011 508935 gene locus_tag LOCUS_t00070 509011 508935 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 509869 509444 gene locus_tag LOCUS_04680 509869 509444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04680 510381 509887 gene locus_tag LOCUS_04690 510381 509887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 511256 511089 gene locus_tag LOCUS_04700 511256 511089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 511705 511322 gene locus_tag LOCUS_04710 511705 511322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 511930 511715 gene locus_tag LOCUS_04720 511930 511715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 513230 512136 gene locus_tag LOCUS_04730 513230 512136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 514349 514179 gene locus_tag LOCUS_04740 514349 514179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 514606 514403 gene locus_tag LOCUS_04750 514606 514403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 514964 514587 gene locus_tag LOCUS_04760 514964 514587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 516134 515208 gene locus_tag LOCUS_04770 516134 515208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 516545 516183 gene locus_tag LOCUS_04780 516545 516183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 517242 517060 gene locus_tag LOCUS_04790 517242 517060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 518449 519267 gene locus_tag LOCUS_04800 518449 519267 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525967.1 protein_id gnl|my_center|LOCUS_04800 520344 519349 gene locus_tag LOCUS_04810 520344 519349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 521561 520365 gene locus_tag LOCUS_04820 521561 520365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 522291 521581 gene locus_tag LOCUS_04830 522291 521581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 522991 522284 gene locus_tag LOCUS_04840 522991 522284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 525137 522996 gene locus_tag LOCUS_04850 525137 522996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 526195 525302 gene locus_tag LOCUS_04860 526195 525302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 526512 526360 gene locus_tag LOCUS_04870 526512 526360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 526840 526640 gene locus_tag LOCUS_04880 526840 526640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 527287 526856 gene locus_tag LOCUS_04890 527287 526856 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_04890 527616 527284 gene locus_tag LOCUS_04900 527616 527284 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_04900 528075 527695 gene locus_tag LOCUS_04910 528075 527695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 528710 528384 gene locus_tag LOCUS_04920 528710 528384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 529024 528710 gene locus_tag LOCUS_04930 529024 528710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 529956 529618 gene locus_tag LOCUS_04940 529956 529618 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_04940 530143 529949 gene locus_tag LOCUS_04950 530143 529949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 530691 530275 gene locus_tag LOCUS_04960 gene vapC20 530691 530275 CDS product type II toxin-antitoxin system toxin 23S rRNA-specific endonuclease VapC20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413180.1 protein_id gnl|my_center|LOCUS_04960 530916 530695 gene locus_tag LOCUS_04970 530916 530695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 532644 531169 gene locus_tag LOCUS_04980 532644 531169 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_04980 533206 532685 gene locus_tag LOCUS_04990 533206 532685 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921477.1 protein_id gnl|my_center|LOCUS_04990 535076 533286 gene locus_tag LOCUS_05000 gene ilvB 535076 533286 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_05000 536286 535087 gene locus_tag LOCUS_05010 536286 535087 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_05010 537214 536270 gene locus_tag LOCUS_05020 537214 536270 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_05020 537438 537217 gene locus_tag LOCUS_05030 537438 537217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 537826 537431 gene locus_tag LOCUS_05040 537826 537431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 538789 537851 gene locus_tag LOCUS_05050 538789 537851 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_05050 539964 538804 gene locus_tag LOCUS_05060 539964 538804 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_05060 540979 539987 gene locus_tag LOCUS_05070 540979 539987 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_05070 541686 540976 gene locus_tag LOCUS_05080 gene hddC 541686 540976 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_05080 543428 541692 gene locus_tag LOCUS_05090 543428 541692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_05090 544473 544093 gene locus_tag LOCUS_05100 544473 544093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 545772 544768 gene locus_tag LOCUS_05110 545772 544768 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_05110 546286 545906 gene locus_tag LOCUS_05120 546286 545906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 546957 546454 gene locus_tag LOCUS_05130 546957 546454 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_05130 547220 546957 gene locus_tag LOCUS_05140 547220 546957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 548839 549018 gene locus_tag LOCUS_05150 548839 549018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 549228 549028 gene locus_tag LOCUS_05160 549228 549028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 549631 549317 gene locus_tag LOCUS_05170 549631 549317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 549952 550134 gene locus_tag LOCUS_05180 549952 550134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 550534 550229 gene locus_tag LOCUS_05190 550534 550229 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_05190 550734 550531 gene locus_tag LOCUS_05200 550734 550531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 551341 551051 gene locus_tag LOCUS_05210 551341 551051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 552009 551875 gene locus_tag LOCUS_05220 552009 551875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 552274 552083 gene locus_tag LOCUS_05230 552274 552083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 552720 552394 gene locus_tag LOCUS_05240 552720 552394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 553057 552881 gene locus_tag LOCUS_05250 553057 552881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 553439 553287 gene locus_tag LOCUS_05260 553439 553287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 554596 553820 gene locus_tag LOCUS_05270 554596 553820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 555314 554562 gene locus_tag LOCUS_05280 555314 554562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 555858 555574 gene locus_tag LOCUS_05290 555858 555574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 556066 555869 gene locus_tag LOCUS_05300 556066 555869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 558579 557173 gene locus_tag LOCUS_05310 558579 557173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_05310 559367 558576 gene locus_tag LOCUS_05320 559367 558576 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_05320 560441 559602 gene locus_tag LOCUS_05330 gene atpG 560441 559602 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_05330 561940 560444 gene locus_tag LOCUS_05340 gene atpA 561940 560444 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_05340 562681 561941 gene locus_tag LOCUS_05350 562681 561941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 562944 562678 gene locus_tag LOCUS_05360 562944 562678 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_05360 563622 562957 gene locus_tag LOCUS_05370 563622 562957 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_05370 563897 563619 gene locus_tag LOCUS_05380 563897 563619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 564301 563897 gene locus_tag LOCUS_05390 564301 563897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 565662 564298 gene locus_tag LOCUS_05400 gene atpD 565662 564298 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082059.1 protein_id gnl|my_center|LOCUS_05400 566553 567641 gene locus_tag LOCUS_05410 gene aroB 566553 567641 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_05410 567756 568859 gene locus_tag LOCUS_05420 gene dprA 567756 568859 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_05420 569353 569802 gene locus_tag LOCUS_05430 569353 569802 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_05430 569823 570227 gene locus_tag LOCUS_05440 569823 570227 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939713.1 protein_id gnl|my_center|LOCUS_05440 570871 571236 gene locus_tag LOCUS_05450 570871 571236 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_05450 571264 571458 gene locus_tag LOCUS_05460 571264 571458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 571559 571906 gene locus_tag LOCUS_05470 571559 571906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 571950 572315 gene locus_tag LOCUS_05480 571950 572315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 572487 573695 gene locus_tag LOCUS_05490 572487 573695 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_05490 573862 574737 gene locus_tag LOCUS_05500 573862 574737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 574793 575557 gene locus_tag LOCUS_05510 574793 575557 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_05510 575688 576212 gene locus_tag LOCUS_05520 575688 576212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 576773 578032 gene locus_tag LOCUS_05530 576773 578032 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_05530 578066 578569 gene locus_tag LOCUS_05540 578066 578569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 578905 579564 gene locus_tag LOCUS_05550 578905 579564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 580412 579483 gene locus_tag LOCUS_05560 580412 579483 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_05560 581487 581182 gene locus_tag LOCUS_05570 581487 581182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 581868 581584 gene locus_tag LOCUS_05580 581868 581584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 583219 583467 gene locus_tag LOCUS_05590 583219 583467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 583445 583519 gene locus_tag LOCUS_t00080 583445 583519 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 585568 583610 gene locus_tag LOCUS_05600 585568 583610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 586078 586695 gene locus_tag LOCUS_05610 586078 586695 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 protein_id gnl|my_center|LOCUS_05610 587325 588764 gene locus_tag LOCUS_05620 587325 588764 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_05620 588941 588865 gene locus_tag LOCUS_t00090 588941 588865 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 589203 590006 gene locus_tag LOCUS_05630 gene amrB 589203 590006 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_05630 590166 591026 gene locus_tag LOCUS_05640 590166 591026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 591234 593363 gene locus_tag LOCUS_05650 591234 593363 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_05650 594709 593447 gene locus_tag LOCUS_05660 594709 593447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 595248 594712 gene locus_tag LOCUS_05670 595248 594712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 596114 595593 gene locus_tag LOCUS_05680 596114 595593 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201132289.1 protein_id gnl|my_center|LOCUS_05680 596586 596209 gene locus_tag LOCUS_05690 596586 596209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 598178 596817 gene locus_tag LOCUS_05700 598178 596817 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_05700 598986 598165 gene locus_tag LOCUS_05710 598986 598165 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_05710 599272 599066 gene locus_tag LOCUS_05720 gene cspB 599272 599066 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_05720 601590 599473 gene locus_tag LOCUS_05730 gene pnp 601590 599473 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_05730 601974 601708 gene locus_tag LOCUS_05740 gene rpsO 601974 601708 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_05740 604168 602249 gene locus_tag LOCUS_05750 604168 602249 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942144.1 protein_id gnl|my_center|LOCUS_05750 605669 605226 gene locus_tag LOCUS_05760 605669 605226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05760 606295 605666 gene locus_tag LOCUS_05770 606295 605666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 606585 606310 gene locus_tag LOCUS_05780 606585 606310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 607083 606748 gene locus_tag LOCUS_05790 607083 606748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 609077 607101 gene locus_tag LOCUS_05800 609077 607101 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_05800 609453 609082 gene locus_tag LOCUS_05810 609453 609082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 609877 609476 gene locus_tag LOCUS_05820 609877 609476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 610918 610169 gene locus_tag LOCUS_05830 610918 610169 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674311.1 protein_id gnl|my_center|LOCUS_05830 612513 610933 gene locus_tag LOCUS_05840 612513 610933 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_05840 613609 612962 gene locus_tag LOCUS_05850 613609 612962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 613865 613557 gene locus_tag LOCUS_05860 613865 613557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05860 615027 614023 gene locus_tag LOCUS_05870 615027 614023 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_05870 615172 615351 gene locus_tag LOCUS_05880 615172 615351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 616738 615368 gene locus_tag LOCUS_05890 616738 615368 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023105.1 protein_id gnl|my_center|LOCUS_05890 617495 616869 gene locus_tag LOCUS_05900 617495 616869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 619706 617712 gene locus_tag LOCUS_05910 619706 617712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 620875 620657 gene locus_tag LOCUS_05920 620875 620657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 622347 621058 gene locus_tag LOCUS_05930 622347 621058 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940349.1 protein_id gnl|my_center|LOCUS_05930 622577 623944 gene locus_tag LOCUS_05940 622577 623944 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05940 623965 624774 gene locus_tag LOCUS_05950 623965 624774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 625222 625488 gene locus_tag LOCUS_05960 625222 625488 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_05960 625500 625766 gene locus_tag LOCUS_05970 625500 625766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 627777 625858 gene locus_tag LOCUS_05980 627777 625858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 630030 627961 gene locus_tag LOCUS_05990 630030 627961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 631275 630232 gene locus_tag LOCUS_06000 gene holB 631275 630232 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_06000 631629 631336 gene locus_tag LOCUS_06010 631629 631336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 632520 634076 gene locus_tag LOCUS_06020 gene rny 632520 634076 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_06020 634080 635894 gene locus_tag LOCUS_06030 gene mnmG 634080 635894 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_06030 635933 638041 gene locus_tag LOCUS_06040 635933 638041 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_06040 638035 639168 gene locus_tag LOCUS_06050 638035 639168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 639218 639961 gene locus_tag LOCUS_06060 639218 639961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 639993 642068 gene locus_tag LOCUS_06070 639993 642068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 642071 642292 gene locus_tag LOCUS_06080 642071 642292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 642900 642691 gene locus_tag LOCUS_06090 642900 642691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 643057 642881 gene locus_tag LOCUS_06100 643057 642881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 643211 643014 gene locus_tag LOCUS_06110 643211 643014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 643493 643266 gene locus_tag LOCUS_06120 643493 643266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 643879 643724 gene locus_tag LOCUS_06130 643879 643724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 644617 644054 gene locus_tag LOCUS_06140 644617 644054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 644819 644604 gene locus_tag LOCUS_06150 644819 644604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 647062 645392 gene locus_tag LOCUS_06160 647062 645392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 647295 648167 gene locus_tag LOCUS_06170 647295 648167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 648460 649269 gene locus_tag LOCUS_06180 gene thiF 648460 649269 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_06180 649271 649840 gene locus_tag LOCUS_06190 649271 649840 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_06190 649945 651084 gene locus_tag LOCUS_06200 649945 651084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 651242 652573 gene locus_tag LOCUS_06210 651242 652573 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_06210 653237 652644 gene locus_tag LOCUS_06220 gene lpoB 653237 652644 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 protein_id gnl|my_center|LOCUS_06220 653684 653256 gene locus_tag LOCUS_06230 653684 653256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 655304 653829 gene locus_tag LOCUS_06240 655304 653829 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_06240 656467 655565 gene locus_tag LOCUS_06250 656467 655565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 657776 656643 gene locus_tag LOCUS_06260 657776 656643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 658349 659431 gene locus_tag LOCUS_06270 658349 659431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 659428 660267 gene locus_tag LOCUS_06280 659428 660267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 661425 660811 gene locus_tag LOCUS_06290 661425 660811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 662212 661622 gene locus_tag LOCUS_06300 662212 661622 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_06300 662870 662325 gene locus_tag LOCUS_06310 662870 662325 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_06310 663617 662880 gene locus_tag LOCUS_06320 663617 662880 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_06320 664710 663619 gene locus_tag LOCUS_06330 664710 663619 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_06330 664953 664750 gene locus_tag LOCUS_06340 664953 664750 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_06340 665779 664940 gene locus_tag LOCUS_06350 665779 664940 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_06350 667817 665883 gene locus_tag LOCUS_06360 gene dxs 667817 665883 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_06360 668122 667871 gene locus_tag LOCUS_06370 668122 667871 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_06370 669459 668221 gene locus_tag LOCUS_06380 gene xseA 669459 668221 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_06380 670263 669466 gene locus_tag LOCUS_06390 670263 669466 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_06390 670760 670260 gene locus_tag LOCUS_06400 gene coaD 670760 670260 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_06400 673627 670778 gene locus_tag LOCUS_06410 673627 670778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 674743 673637 gene locus_tag LOCUS_06420 674743 673637 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_06420 675109 675182 gene locus_tag LOCUS_t00100 675109 675182 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 675287 676894 gene locus_tag LOCUS_06430 gene nadB 675287 676894 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_06430 677010 677423 gene locus_tag LOCUS_06440 677010 677423 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881317.1 protein_id gnl|my_center|LOCUS_06440 677424 679526 gene locus_tag LOCUS_06450 677424 679526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 679564 680247 gene locus_tag LOCUS_06460 679564 680247 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_06460 680583 683921 gene locus_tag LOCUS_06470 680583 683921 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_06470 683923 684222 gene locus_tag LOCUS_06480 683923 684222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 684674 685033 gene locus_tag LOCUS_06490 684674 685033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 685353 689201 gene locus_tag LOCUS_06500 685353 689201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 690495 689623 gene locus_tag LOCUS_06510 690495 689623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 691044 691835 gene locus_tag LOCUS_06520 691044 691835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 691841 692260 gene locus_tag LOCUS_06530 691841 692260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 692270 692911 gene locus_tag LOCUS_06540 692270 692911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 694057 694632 gene locus_tag LOCUS_06550 694057 694632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 694589 694834 gene locus_tag LOCUS_06560 694589 694834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 695642 695857 gene locus_tag LOCUS_06570 695642 695857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 695873 696109 gene locus_tag LOCUS_06580 695873 696109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 696636 696310 gene locus_tag LOCUS_06590 696636 696310 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_06590 696979 696638 gene locus_tag LOCUS_06600 696979 696638 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_06600 697966 697511 gene locus_tag LOCUS_06610 697966 697511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 697966 698133 gene locus_tag LOCUS_06620 697966 698133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 698783 698529 gene locus_tag LOCUS_06630 698783 698529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 699556 698858 gene locus_tag LOCUS_06640 699556 698858 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_06640 700222 700064 gene locus_tag LOCUS_06650 700222 700064 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_06650 700807 700352 gene locus_tag LOCUS_06660 700807 700352 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339709.1 protein_id gnl|my_center|LOCUS_06660 701293 700880 gene locus_tag LOCUS_06670 701293 700880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319306.1 protein_id gnl|my_center|LOCUS_06670 701784 701302 gene locus_tag LOCUS_06680 701784 701302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 701971 701717 gene locus_tag LOCUS_06690 701971 701717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 702991 702137 gene locus_tag LOCUS_06700 702991 702137 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_06700 703287 703027 gene locus_tag LOCUS_06710 703287 703027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 704514 703339 gene locus_tag LOCUS_06720 704514 703339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_06720 705797 704622 gene locus_tag LOCUS_06730 705797 704622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 706141 706374 gene locus_tag LOCUS_06740 706141 706374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 709281 706558 gene locus_tag LOCUS_06750 gene mgtA 709281 706558 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_06750 709851 711734 gene locus_tag LOCUS_06760 709851 711734 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_06760 711994 712509 gene locus_tag LOCUS_06770 711994 712509 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_06770 712487 713506 gene locus_tag LOCUS_06780 712487 713506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 714676 713612 gene locus_tag LOCUS_06790 gene corA 714676 713612 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_06790 716181 714787 gene locus_tag LOCUS_06800 716181 714787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_06800 716863 716315 gene locus_tag LOCUS_06810 716863 716315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 718764 717208 gene locus_tag LOCUS_06820 718764 717208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 719717 719007 gene locus_tag LOCUS_06830 719717 719007 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_06830 720966 719749 gene locus_tag LOCUS_06840 720966 719749 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822361.1 protein_id gnl|my_center|LOCUS_06840 721694 722308 gene locus_tag LOCUS_06850 721694 722308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 722437 722931 gene locus_tag LOCUS_06860 722437 722931 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_06860 723141 724559 gene locus_tag LOCUS_06870 gene gndA 723141 724559 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_06870 724563 726089 gene locus_tag LOCUS_06880 gene zwf 724563 726089 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_06880 726243 726854 gene locus_tag LOCUS_06890 gene pgl 726243 726854 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_06890 727326 728318 gene locus_tag LOCUS_06900 gene hemB 727326 728318 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_06900 728397 729170 gene locus_tag LOCUS_06910 728397 729170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 730756 729332 gene locus_tag LOCUS_06920 730756 729332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 731725 731480 gene locus_tag LOCUS_06930 731725 731480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 732212 731835 gene locus_tag LOCUS_06940 732212 731835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 732531 732250 gene locus_tag LOCUS_06950 732531 732250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06950 732667 732464 gene locus_tag LOCUS_06960 732667 732464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 735239 733899 gene locus_tag LOCUS_06970 735239 733899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 735495 735959 gene locus_tag LOCUS_06980 gene ribE 735495 735959 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_06980 736309 737577 gene locus_tag LOCUS_06990 736309 737577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 737629 738900 gene locus_tag LOCUS_07000 737629 738900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 738897 739619 gene locus_tag LOCUS_07010 738897 739619 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688398.1 protein_id gnl|my_center|LOCUS_07010 739716 740324 gene locus_tag LOCUS_07020 739716 740324 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_07020 740515 741798 gene locus_tag LOCUS_07030 740515 741798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 742156 742575 gene locus_tag LOCUS_07040 742156 742575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 742861 744237 gene locus_tag LOCUS_07050 gene hydG 742861 744237 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393235.1 protein_id gnl|my_center|LOCUS_07050 745830 744460 gene locus_tag LOCUS_07060 745830 744460 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_07060 746698 745817 gene locus_tag LOCUS_07070 746698 745817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 746815 747048 gene locus_tag LOCUS_07080 746815 747048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 747352 747771 gene locus_tag LOCUS_07090 747352 747771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 748806 749324 gene locus_tag LOCUS_07100 748806 749324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 749949 750074 gene locus_tag LOCUS_07110 749949 750074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 750393 750638 gene locus_tag LOCUS_07120 750393 750638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 750650 750895 gene locus_tag LOCUS_07130 750650 750895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 751280 751480 gene locus_tag LOCUS_07140 751280 751480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 751782 751489 gene locus_tag LOCUS_07150 751782 751489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 751827 754490 gene locus_tag LOCUS_07160 gene polA 751827 754490 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_07160 754490 755101 gene locus_tag LOCUS_07170 gene coaE 754490 755101 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_07170 755128 756465 gene locus_tag LOCUS_07180 gene rho 755128 756465 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_07180 762529 757493 gene locus_tag LOCUS_07190 762529 757493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 763308 762526 gene locus_tag LOCUS_07200 763308 762526 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_07200 763847 763305 gene locus_tag LOCUS_07210 763847 763305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 765871 765200 gene locus_tag LOCUS_07220 765871 765200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 766495 765890 gene locus_tag LOCUS_07230 766495 765890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 767473 767072 gene locus_tag LOCUS_07240 767473 767072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 768270 768001 gene locus_tag LOCUS_07250 768270 768001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 768613 768257 gene locus_tag LOCUS_07260 768613 768257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 770108 768714 gene locus_tag LOCUS_07270 770108 768714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 770398 770234 gene locus_tag LOCUS_07280 770398 770234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 770729 770385 gene locus_tag LOCUS_07290 770729 770385 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280560.1 protein_id gnl|my_center|LOCUS_07290 771043 770726 gene locus_tag LOCUS_07300 771043 770726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 772630 771602 gene locus_tag LOCUS_07310 772630 771602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 773070 772837 gene locus_tag LOCUS_07320 773070 772837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 773558 773361 gene locus_tag LOCUS_07330 773558 773361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 777923 773649 gene locus_tag LOCUS_07340 777923 773649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 778956 778276 gene locus_tag LOCUS_07350 778956 778276 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_07350 780138 779908 gene locus_tag LOCUS_07360 780138 779908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 780577 780128 gene locus_tag LOCUS_07370 780577 780128 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_07370 781027 780746 gene locus_tag LOCUS_07380 781027 780746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 781394 780981 gene locus_tag LOCUS_07390 781394 780981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 781682 781443 gene locus_tag LOCUS_07400 781682 781443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 783055 781793 gene locus_tag LOCUS_07410 783055 781793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 784230 783133 gene locus_tag LOCUS_07420 784230 783133 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782235.1 protein_id gnl|my_center|LOCUS_07420 784949 784269 gene locus_tag LOCUS_07430 784949 784269 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390554.1 protein_id gnl|my_center|LOCUS_07430 785969 784956 gene locus_tag LOCUS_07440 785969 784956 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_07440 786400 785966 gene locus_tag LOCUS_07450 786400 785966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 787458 786400 gene locus_tag LOCUS_07460 787458 786400 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_07460 788465 787449 gene locus_tag LOCUS_07470 gene pseG 788465 787449 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_07470 789172 788474 gene locus_tag LOCUS_07480 789172 788474 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_07480 790236 789166 gene locus_tag LOCUS_07490 790236 789166 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_07490 790937 790299 gene locus_tag LOCUS_07500 790937 790299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 791408 791109 gene locus_tag LOCUS_07510 791408 791109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 791918 791421 gene locus_tag LOCUS_07520 791918 791421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 793495 791921 gene locus_tag LOCUS_07530 793495 791921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 793694 793461 gene locus_tag LOCUS_07540 793694 793461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 794690 793707 gene locus_tag LOCUS_07550 gene pseB 794690 793707 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_07550 796771 796355 gene locus_tag LOCUS_07560 796771 796355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 797287 796919 gene locus_tag LOCUS_07570 797287 796919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 798473 798276 gene locus_tag LOCUS_07580 798473 798276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 799173 799403 gene locus_tag LOCUS_07590 799173 799403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 800883 800317 gene locus_tag LOCUS_07600 800883 800317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 801059 800874 gene locus_tag LOCUS_07610 801059 800874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 802337 802825 gene locus_tag LOCUS_07620 802337 802825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 803510 803797 gene locus_tag LOCUS_07630 803510 803797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 803776 804093 gene locus_tag LOCUS_07640 803776 804093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 804840 804490 gene locus_tag LOCUS_07650 804840 804490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 805694 805906 gene locus_tag LOCUS_07660 805694 805906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 806280 806050 gene locus_tag LOCUS_07670 806280 806050 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_07670 806769 806323 gene locus_tag LOCUS_07680 gene nifU 806769 806323 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_07680 807961 806798 gene locus_tag LOCUS_07690 gene nifS 807961 806798 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_07690 810172 807983 gene locus_tag LOCUS_07700 gene pcrA 810172 807983 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_07700 810825 810169 gene locus_tag LOCUS_07710 810825 810169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 812287 810947 gene locus_tag LOCUS_07720 gene der 812287 810947 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_07720 813637 812432 gene locus_tag LOCUS_07730 813637 812432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 814107 813820 gene locus_tag LOCUS_07740 814107 813820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 815302 814184 gene locus_tag LOCUS_07750 gene dnaJ 815302 814184 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 protein_id gnl|my_center|LOCUS_07750 817440 815821 gene locus_tag LOCUS_07760 gene groL 817440 815821 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_07760 817780 817490 gene locus_tag LOCUS_07770 gene groES 817780 817490 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_07770 819561 817870 gene locus_tag LOCUS_07780 gene groL 819561 817870 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_07780 820073 820837 gene locus_tag LOCUS_07790 820073 820837 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_07790 821537 820932 gene locus_tag LOCUS_07800 821537 820932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 822494 821721 gene locus_tag LOCUS_07810 822494 821721 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_07810 823118 823804 gene locus_tag LOCUS_07820 823118 823804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 823871 824074 gene locus_tag LOCUS_07830 823871 824074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 824987 824253 gene locus_tag LOCUS_07840 824987 824253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 825398 827287 gene locus_tag LOCUS_07850 825398 827287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 827559 829442 gene locus_tag LOCUS_07860 827559 829442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07860 829476 829841 gene locus_tag LOCUS_07870 829476 829841 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258669.1 protein_id gnl|my_center|LOCUS_07870 829962 830723 gene locus_tag LOCUS_07880 829962 830723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 830895 831188 gene locus_tag LOCUS_07890 830895 831188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 831274 831564 gene locus_tag LOCUS_07900 831274 831564 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_07900 831603 831929 gene locus_tag LOCUS_07910 gene trxA 831603 831929 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_07910 832714 831935 gene locus_tag LOCUS_07920 gene trpC 832714 831935 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946569.1 protein_id gnl|my_center|LOCUS_07920 833147 832698 gene locus_tag LOCUS_07930 833147 832698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 833420 833148 gene locus_tag LOCUS_07940 833420 833148 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_07940 833765 833689 gene locus_tag LOCUS_t00110 833765 833689 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 833982 835247 gene locus_tag LOCUS_07950 gene purD 833982 835247 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_07950 836171 835269 gene locus_tag LOCUS_07960 gene nadC 836171 835269 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545113.1 protein_id gnl|my_center|LOCUS_07960 836436 838826 gene locus_tag LOCUS_07970 gene lon 836436 838826 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941591.1 protein_id gnl|my_center|LOCUS_07970 838842 839315 gene locus_tag LOCUS_07980 838842 839315 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_07980 839399 839815 gene locus_tag LOCUS_07990 839399 839815 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_07990 839886 841337 gene locus_tag LOCUS_08000 839886 841337 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_08000 841392 842096 gene locus_tag LOCUS_08010 841392 842096 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_08010 842186 843580 gene locus_tag LOCUS_08020 842186 843580 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_08020 843684 844166 gene locus_tag LOCUS_08030 843684 844166 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_08030 844923 844423 gene locus_tag LOCUS_08040 844923 844423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 846230 845004 gene locus_tag LOCUS_08050 846230 845004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 846534 847232 gene locus_tag LOCUS_08060 846534 847232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 847691 847278 gene locus_tag LOCUS_08070 gene arfB 847691 847278 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_08070 848750 847710 gene locus_tag LOCUS_08080 848750 847710 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_08080 851892 849448 gene locus_tag LOCUS_08090 851892 849448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 853921 852038 gene locus_tag LOCUS_08100 853921 852038 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_08100 854549 854103 gene locus_tag LOCUS_08110 854549 854103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_08110 856388 854904 gene locus_tag LOCUS_08120 856388 854904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 857124 856390 gene locus_tag LOCUS_08130 857124 856390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 857592 857221 gene locus_tag LOCUS_08140 857592 857221 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_08140 860222 857766 gene locus_tag LOCUS_08150 860222 857766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 862549 860219 gene locus_tag LOCUS_08160 862549 860219 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_08160 863252 862761 gene locus_tag LOCUS_08170 863252 862761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 864379 864131 gene locus_tag LOCUS_08180 gene rpmA 864379 864131 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_08180 864827 864513 gene locus_tag LOCUS_08190 gene rplU 864827 864513 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020642.1 protein_id gnl|my_center|LOCUS_08190 866397 864868 gene locus_tag LOCUS_08200 866397 864868 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_08200 866958 866401 gene locus_tag LOCUS_08210 866958 866401 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_08210 869666 867630 gene locus_tag LOCUS_08220 gene ptsP 869666 867630 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_08220 870579 870109 gene locus_tag LOCUS_08230 870579 870109 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_08230 870975 870616 gene locus_tag LOCUS_08240 gene raiA 870975 870616 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_08240 871820 871071 gene locus_tag LOCUS_08250 871820 871071 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_08250 872886 871813 gene locus_tag LOCUS_08260 gene lptG 872886 871813 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_08260 873375 872902 gene locus_tag LOCUS_08270 gene folK 873375 872902 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_08270 874061 874720 gene locus_tag LOCUS_08280 874061 874720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 875193 874999 gene locus_tag LOCUS_08290 875193 874999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 875776 875213 gene locus_tag LOCUS_08300 875776 875213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 876334 876173 gene locus_tag LOCUS_08310 876334 876173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 876388 877785 gene locus_tag LOCUS_08320 876388 877785 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_08320 878760 880865 gene locus_tag LOCUS_08330 878760 880865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 881816 880941 gene locus_tag LOCUS_08340 881816 880941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 882039 881800 gene locus_tag LOCUS_08350 882039 881800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 882329 885676 gene locus_tag LOCUS_08360 882329 885676 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_08360 885825 889160 gene locus_tag LOCUS_08370 885825 889160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 889308 889535 gene locus_tag LOCUS_08380 889308 889535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 889532 890092 gene locus_tag LOCUS_08390 889532 890092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 890095 892281 gene locus_tag LOCUS_08400 890095 892281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 892283 892513 gene locus_tag LOCUS_08410 892283 892513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 892522 892710 gene locus_tag LOCUS_08420 892522 892710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 893044 893835 gene locus_tag LOCUS_08430 893044 893835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 893804 894277 gene locus_tag LOCUS_08440 893804 894277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 894277 894627 gene locus_tag LOCUS_08450 894277 894627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 894751 895338 gene locus_tag LOCUS_08460 894751 895338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 897483 895516 gene locus_tag LOCUS_08470 gene uvrB 897483 895516 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_08470 897965 897561 gene locus_tag LOCUS_08480 897965 897561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 900593 898209 gene locus_tag LOCUS_08490 900593 898209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 902257 901232 gene locus_tag LOCUS_08500 902257 901232 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948809.1 protein_id gnl|my_center|LOCUS_08500 904491 902272 gene locus_tag LOCUS_08510 904491 902272 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055063916.1 protein_id gnl|my_center|LOCUS_08510 908509 904811 gene locus_tag LOCUS_08520 908509 904811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 908837 909010 gene locus_tag LOCUS_08530 908837 909010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 909149 909373 gene locus_tag LOCUS_08540 909149 909373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 910380 910742 gene locus_tag LOCUS_08550 910380 910742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 910739 911818 gene locus_tag LOCUS_08560 gene ugpC 910739 911818 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_08560 911919 912179 gene locus_tag LOCUS_08570 911919 912179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 912176 912514 gene locus_tag LOCUS_08580 912176 912514 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_08580 913039 914676 gene locus_tag LOCUS_08590 gene groL 913039 914676 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_08590 914871 915323 gene locus_tag LOCUS_08600 914871 915323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 915362 917779 gene locus_tag LOCUS_08610 gene lon 915362 917779 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08610 917954 918985 gene locus_tag LOCUS_08620 gene argC 917954 918985 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_08620 919114 919416 gene locus_tag LOCUS_08630 919114 919416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 919543 919968 gene locus_tag LOCUS_08640 919543 919968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 920451 920047 gene locus_tag LOCUS_08650 920451 920047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 921024 920659 gene locus_tag LOCUS_08660 921024 920659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 921598 921050 gene locus_tag LOCUS_08670 921598 921050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 921681 922064 gene locus_tag LOCUS_08680 921681 922064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 924512 923136 gene locus_tag LOCUS_08690 924512 923136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 924742 924479 gene locus_tag LOCUS_08700 924742 924479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 925896 924739 gene locus_tag LOCUS_08710 925896 924739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 926174 925881 gene locus_tag LOCUS_08720 926174 925881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 926299 926171 gene locus_tag LOCUS_08730 926299 926171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 926610 926362 gene locus_tag LOCUS_08740 926610 926362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 926888 926568 gene locus_tag LOCUS_08750 926888 926568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 927322 927152 gene locus_tag LOCUS_08760 927322 927152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 928501 927848 gene locus_tag LOCUS_08770 928501 927848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 929531 928491 gene locus_tag LOCUS_08780 929531 928491 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_08780 930982 929528 gene locus_tag LOCUS_08790 930982 929528 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_08790 932055 931189 gene locus_tag LOCUS_08800 932055 931189 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965285.1 protein_id gnl|my_center|LOCUS_08800 932540 932052 gene locus_tag LOCUS_08810 932540 932052 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142043.1 protein_id gnl|my_center|LOCUS_08810 934067 932580 gene locus_tag LOCUS_08820 934067 932580 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_08820 935569 934064 gene locus_tag LOCUS_08830 935569 934064 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_08830 935910 935725 gene locus_tag LOCUS_08840 935910 935725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 936385 937329 gene locus_tag LOCUS_08850 936385 937329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 937951 937499 gene locus_tag LOCUS_08860 937951 937499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 939000 937972 gene locus_tag LOCUS_08870 939000 937972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 939373 939098 gene locus_tag LOCUS_08880 939373 939098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 939584 939318 gene locus_tag LOCUS_08890 939584 939318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 941387 939624 gene locus_tag LOCUS_08900 gene aspS 941387 939624 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881092.1 protein_id gnl|my_center|LOCUS_08900 942912 941602 gene locus_tag LOCUS_08910 gene hisS 942912 941602 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_08910 943821 944030 gene locus_tag LOCUS_08920 943821 944030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 944027 944323 gene locus_tag LOCUS_08930 944027 944323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 944412 945005 gene locus_tag LOCUS_08940 944412 945005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 945111 945677 gene locus_tag LOCUS_08950 945111 945677 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08950 945879 946193 gene locus_tag LOCUS_08960 945879 946193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 946178 946420 gene locus_tag LOCUS_08970 946178 946420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 948945 946999 gene locus_tag LOCUS_08980 gene msbA 948945 946999 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_08980 950433 949225 gene locus_tag LOCUS_08990 950433 949225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_08990 953228 950688 gene locus_tag LOCUS_09000 953228 950688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 955728 953428 gene locus_tag LOCUS_09010 955728 953428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 956534 955974 gene locus_tag LOCUS_09020 956534 955974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 958096 956678 gene locus_tag LOCUS_09030 gene mtaB 958096 956678 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_09030 959046 958384 gene locus_tag LOCUS_09040 959046 958384 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_09040 960724 959252 gene locus_tag LOCUS_09050 gene ppcA 960724 959252 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_09050 961392 961646 gene locus_tag LOCUS_09060 961392 961646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 961537 961968 gene locus_tag LOCUS_09070 961537 961968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 961984 962130 gene locus_tag LOCUS_09080 961984 962130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 962171 962353 gene locus_tag LOCUS_09090 962171 962353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 963435 962290 gene locus_tag LOCUS_09100 963435 962290 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_09100 964684 963725 gene locus_tag LOCUS_09110 964684 963725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 966400 965507 gene locus_tag LOCUS_09120 966400 965507 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_09120 968190 966406 gene locus_tag LOCUS_09130 968190 966406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 969736 968303 gene locus_tag LOCUS_09140 969736 968303 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_09140 970677 970000 gene locus_tag LOCUS_09150 970677 970000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 971110 972717 gene locus_tag LOCUS_09160 971110 972717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 972856 972686 gene locus_tag LOCUS_09170 972856 972686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 973013 973342 gene locus_tag LOCUS_09180 973013 973342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 973365 973991 gene locus_tag LOCUS_09190 973365 973991 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_09190 974456 975160 gene locus_tag LOCUS_09200 974456 975160 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333519.1 protein_id gnl|my_center|LOCUS_09200 976869 976048 gene locus_tag LOCUS_09210 976869 976048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 977635 976892 gene locus_tag LOCUS_09220 977635 976892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_09220 978360 977635 gene locus_tag LOCUS_09230 978360 977635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_09230 979538 978477 gene locus_tag LOCUS_09240 979538 978477 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_09240 979833 980051 gene locus_tag LOCUS_09250 979833 980051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 980808 981170 gene locus_tag LOCUS_09260 980808 981170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 982382 981948 gene locus_tag LOCUS_09270 982382 981948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 984906 982459 gene locus_tag LOCUS_09280 984906 982459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 985641 985916 gene locus_tag LOCUS_09290 985641 985916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 985956 987083 gene locus_tag LOCUS_09300 985956 987083 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_09300 987130 988926 gene locus_tag LOCUS_09310 987130 988926 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_09310 989678 988935 gene locus_tag LOCUS_09320 989678 988935 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389076.1 protein_id gnl|my_center|LOCUS_09320 990170 990502 gene locus_tag LOCUS_09330 990170 990502 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391614.1 protein_id gnl|my_center|LOCUS_09330 990505 990921 gene locus_tag LOCUS_09340 990505 990921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 990942 991811 gene locus_tag LOCUS_09350 990942 991811 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_09350 991916 993376 gene locus_tag LOCUS_09360 991916 993376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 993454 994317 gene locus_tag LOCUS_09370 gene modA 993454 994317 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_09370 994314 995096 gene locus_tag LOCUS_09380 994314 995096 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932352.1 protein_id gnl|my_center|LOCUS_09380 995920 995549 gene locus_tag LOCUS_09390 995920 995549 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_09390 996321 996043 gene locus_tag LOCUS_09400 996321 996043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 997028 996432 gene locus_tag LOCUS_09410 997028 996432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 998251 997028 gene locus_tag LOCUS_09420 998251 997028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_09420 998859 998470 gene locus_tag LOCUS_09430 998859 998470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 999219 999067 gene locus_tag LOCUS_09440 999219 999067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 999985 999602 gene locus_tag LOCUS_09450 999985 999602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1001665 1000457 gene locus_tag LOCUS_09460 1001665 1000457 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887595.1 protein_id gnl|my_center|LOCUS_09460 1002112 1001765 gene locus_tag LOCUS_09470 1002112 1001765 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_09470 1002379 1002221 gene locus_tag LOCUS_09480 1002379 1002221 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_09480 1002780 1002487 gene locus_tag LOCUS_09490 1002780 1002487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1004376 1003666 gene locus_tag LOCUS_09500 1004376 1003666 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 protein_id gnl|my_center|LOCUS_09500 1005249 1004737 gene locus_tag LOCUS_09510 1005249 1004737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1005776 1005246 gene locus_tag LOCUS_09520 1005776 1005246 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_09520 1006689 1006147 gene locus_tag LOCUS_09530 gene folK 1006689 1006147 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215151.1 protein_id gnl|my_center|LOCUS_09530 1007056 1006682 gene locus_tag LOCUS_09540 gene folX 1007056 1006682 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_09540 1007949 1007185 gene locus_tag LOCUS_09550 1007949 1007185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_09550 1008618 1007974 gene locus_tag LOCUS_09560 gene folE 1008618 1007974 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_09560 1009536 1009300 gene locus_tag LOCUS_09570 1009536 1009300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1009750 1009472 gene locus_tag LOCUS_09580 1009750 1009472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1010801 1010673 gene locus_tag LOCUS_09590 1010801 1010673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1011110 1010904 gene locus_tag LOCUS_09600 1011110 1010904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1012896 1011232 gene locus_tag LOCUS_09610 1012896 1011232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1013086 1012901 gene locus_tag LOCUS_09620 1013086 1012901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1013427 1013083 gene locus_tag LOCUS_09630 1013427 1013083 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_09630 1013736 1013548 gene locus_tag LOCUS_09640 1013736 1013548 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_09640 1014410 1014619 gene locus_tag LOCUS_09650 1014410 1014619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1016397 1014793 gene locus_tag LOCUS_09660 1016397 1014793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1018675 1017074 gene locus_tag LOCUS_09670 gene dnaK 1018675 1017074 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_09670 1019388 1018774 gene locus_tag LOCUS_09680 1019388 1018774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1020002 1020817 gene locus_tag LOCUS_09690 gene proC 1020002 1020817 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_09690 1020819 1022831 gene locus_tag LOCUS_09700 gene tkt 1020819 1022831 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_09700 1022960 1023442 gene locus_tag LOCUS_09710 1022960 1023442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1024627 1023779 gene locus_tag LOCUS_09720 1024627 1023779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1026138 1024663 gene locus_tag LOCUS_09730 1026138 1024663 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_09730 1026608 1027732 gene locus_tag LOCUS_09740 1026608 1027732 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147341.1 protein_id gnl|my_center|LOCUS_09740 1027880 1028326 gene locus_tag LOCUS_09750 1027880 1028326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1028332 1028781 gene locus_tag LOCUS_09760 1028332 1028781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 1030738 1029305 gene locus_tag LOCUS_09770 gene hpnJ 1030738 1029305 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_09770 1031102 1032127 gene locus_tag LOCUS_09780 1031102 1032127 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055919.1 protein_id gnl|my_center|LOCUS_09780 1032485 1032114 gene locus_tag LOCUS_09790 1032485 1032114 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_09790 1033303 1032482 gene locus_tag LOCUS_09800 gene hpnK 1033303 1032482 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_09800 1034047 1036797 gene locus_tag LOCUS_09810 1034047 1036797 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_09810 1037750 1037079 gene locus_tag LOCUS_09820 1037750 1037079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1039869 1038277 gene locus_tag LOCUS_09830 1039869 1038277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1041674 1040031 gene locus_tag LOCUS_09840 1041674 1040031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1043409 1042105 gene locus_tag LOCUS_09850 1043409 1042105 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253865.1 protein_id gnl|my_center|LOCUS_09850 1043738 1044766 gene locus_tag LOCUS_09860 1043738 1044766 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_09860 1044753 1045307 gene locus_tag LOCUS_09870 1044753 1045307 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396860.1 protein_id gnl|my_center|LOCUS_09870 1045504 1046130 gene locus_tag LOCUS_09880 1045504 1046130 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_09880 1046308 1047312 gene locus_tag LOCUS_09890 gene obgE 1046308 1047312 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_09890 1047327 1048091 gene locus_tag LOCUS_09900 1047327 1048091 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_09900 1048780 1048337 gene locus_tag LOCUS_09910 1048780 1048337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1049224 1049811 gene locus_tag LOCUS_09920 1049224 1049811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1049804 1050496 gene locus_tag LOCUS_09930 1049804 1050496 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_09930 1050490 1052277 gene locus_tag LOCUS_09940 1050490 1052277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1052793 1052302 gene locus_tag LOCUS_09950 1052793 1052302 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_09950 1053030 1053965 gene locus_tag LOCUS_09960 1053030 1053965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1056078 1054120 gene locus_tag LOCUS_09970 1056078 1054120 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_09970 1057437 1056745 gene locus_tag LOCUS_09980 1057437 1056745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1057849 1058991 gene locus_tag LOCUS_09990 1057849 1058991 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_09990 1059228 1059818 gene locus_tag LOCUS_10000 gene ruvA 1059228 1059818 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_10000 1059831 1060895 gene locus_tag LOCUS_10010 gene ruvB 1059831 1060895 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_10010 1060917 1061552 gene locus_tag LOCUS_10020 1060917 1061552 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_10020 1061616 1062803 gene locus_tag LOCUS_10030 1061616 1062803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1062829 1063935 gene locus_tag LOCUS_10040 gene tgt 1062829 1063935 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_10040 1064037 1064438 gene locus_tag LOCUS_10050 1064037 1064438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1064519 1067995 gene locus_tag LOCUS_10060 1064519 1067995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1068478 1069317 gene locus_tag LOCUS_10070 1068478 1069317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1069536 1070681 gene locus_tag LOCUS_10080 1069536 1070681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1070846 1072072 gene locus_tag LOCUS_10090 gene ahbC 1070846 1072072 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_10090 1072609 1072190 gene locus_tag LOCUS_10100 1072609 1072190 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_10100 1073232 1072672 gene locus_tag LOCUS_10110 1073232 1072672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1073929 1073396 gene locus_tag LOCUS_10120 1073929 1073396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1074489 1074677 gene locus_tag LOCUS_10130 1074489 1074677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1075561 1075241 gene locus_tag LOCUS_10140 1075561 1075241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1075896 1075621 gene locus_tag LOCUS_10150 1075896 1075621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1076151 1075930 gene locus_tag LOCUS_10160 1076151 1075930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1076453 1076139 gene locus_tag LOCUS_10170 1076453 1076139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1076640 1077329 gene locus_tag LOCUS_10180 1076640 1077329 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 protein_id gnl|my_center|LOCUS_10180 1077515 1077682 gene locus_tag LOCUS_10190 1077515 1077682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1077807 1078646 gene locus_tag LOCUS_10200 1077807 1078646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1078883 1079362 gene locus_tag LOCUS_10210 1078883 1079362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1079813 1080085 gene locus_tag LOCUS_10220 1079813 1080085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1080096 1080290 gene locus_tag LOCUS_10230 1080096 1080290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1080458 1082119 gene locus_tag LOCUS_10240 1080458 1082119 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545239.1 protein_id gnl|my_center|LOCUS_10240 1082522 1082211 gene locus_tag LOCUS_10250 1082522 1082211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1084282 1082522 gene locus_tag LOCUS_10260 gene dnaK 1084282 1082522 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_10260 1085078 1084284 gene locus_tag LOCUS_10270 1085078 1084284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1085574 1085278 gene locus_tag LOCUS_10280 1085574 1085278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1086322 1085780 gene locus_tag LOCUS_10290 1086322 1085780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 1087452 1086253 gene locus_tag LOCUS_10300 1087452 1086253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 1091009 1088610 gene locus_tag LOCUS_10310 1091009 1088610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1092009 1091293 gene locus_tag LOCUS_10320 1092009 1091293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1092682 1092110 gene locus_tag LOCUS_10330 1092682 1092110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1093260 1092751 gene locus_tag LOCUS_10340 1093260 1092751 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_10340 1094278 1093421 gene locus_tag LOCUS_10350 1094278 1093421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1095786 1094278 gene locus_tag LOCUS_10360 1095786 1094278 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_10360 1096386 1095814 gene locus_tag LOCUS_10370 1096386 1095814 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022152.1 protein_id gnl|my_center|LOCUS_10370 1097500 1096559 gene locus_tag LOCUS_10380 1097500 1096559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_10380 1098951 1097704 gene locus_tag LOCUS_10390 1098951 1097704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1099105 1100223 gene locus_tag LOCUS_10400 1099105 1100223 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_10400 1100283 1100696 gene locus_tag LOCUS_10410 1100283 1100696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1101267 1100836 gene locus_tag LOCUS_10420 1101267 1100836 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_10420 1102440 1103597 gene locus_tag LOCUS_10430 1102440 1103597 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261804.1 protein_id gnl|my_center|LOCUS_10430 1103590 1106685 gene locus_tag LOCUS_10440 gene vmeV 1103590 1106685 CDS product multidrug efflux RND transporter permease subunit VmeV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 protein_id gnl|my_center|LOCUS_10440 1106772 1107245 gene locus_tag LOCUS_10450 1106772 1107245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10450 1107227 1108162 gene locus_tag LOCUS_10460 1107227 1108162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 1108159 1108395 gene locus_tag LOCUS_10470 1108159 1108395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1108935 1108672 gene locus_tag LOCUS_10480 1108935 1108672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1109356 1110138 gene locus_tag LOCUS_10490 1109356 1110138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1111300 1110857 gene locus_tag LOCUS_10500 1111300 1110857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1111725 1115717 gene locus_tag LOCUS_10510 1111725 1115717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1115720 1115974 gene locus_tag LOCUS_10520 1115720 1115974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1116043 1116372 gene locus_tag LOCUS_10530 1116043 1116372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1117056 1118177 gene locus_tag LOCUS_10540 gene mqnE 1117056 1118177 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_10540 1118317 1120242 gene locus_tag LOCUS_10550 1118317 1120242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_10550 1120409 1121176 gene locus_tag LOCUS_10560 1120409 1121176 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_10560 1122345 1121293 gene locus_tag LOCUS_10570 1122345 1121293 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464337.1 protein_id gnl|my_center|LOCUS_10570 1122630 1124180 gene locus_tag LOCUS_10580 1122630 1124180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1125212 1124694 gene locus_tag LOCUS_10590 1125212 1124694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1125613 1126821 gene locus_tag LOCUS_10600 1125613 1126821 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_10600 1127301 1128428 gene locus_tag LOCUS_10610 1127301 1128428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1128538 1129593 gene locus_tag LOCUS_10620 1128538 1129593 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_10620 1129709 1130404 gene locus_tag LOCUS_10630 1129709 1130404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1131048 1130863 gene locus_tag LOCUS_10640 1131048 1130863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1131323 1133173 gene locus_tag LOCUS_10650 gene mrdA 1131323 1133173 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_10650 1133223 1134314 gene locus_tag LOCUS_10660 gene rodA 1133223 1134314 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_10660 1134327 1136198 gene locus_tag LOCUS_10670 1134327 1136198 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_10670 1136394 1137152 gene locus_tag LOCUS_10680 gene kdsB 1136394 1137152 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_10680 1137145 1138740 gene locus_tag LOCUS_10690 1137145 1138740 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_10690 1139633 1138767 gene locus_tag LOCUS_10700 1139633 1138767 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_10700 1139781 1140584 gene locus_tag LOCUS_10710 1139781 1140584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1142299 1140719 gene locus_tag LOCUS_10720 gene serA 1142299 1140719 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_10720 1142589 1143662 gene locus_tag LOCUS_10730 1142589 1143662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1143664 1144455 gene locus_tag LOCUS_10740 1143664 1144455 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_10740 1146106 1144871 gene locus_tag LOCUS_10750 1146106 1144871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1147376 1146192 gene locus_tag LOCUS_10760 1147376 1146192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1148393 1150063 gene locus_tag LOCUS_10770 1148393 1150063 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_10770 1150248 1151228 gene locus_tag LOCUS_10780 1150248 1151228 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545765.1 protein_id gnl|my_center|LOCUS_10780 1151245 1152732 gene locus_tag LOCUS_10790 gene trpE 1151245 1152732 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_10790 1152833 1152991 gene locus_tag LOCUS_10800 1152833 1152991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1153695 1153180 gene locus_tag LOCUS_10810 1153695 1153180 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_10810 1154465 1153695 gene locus_tag LOCUS_10820 1154465 1153695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1156286 1154532 gene locus_tag LOCUS_10830 1156286 1154532 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_10830 1157013 1156342 gene locus_tag LOCUS_10840 gene cmk 1157013 1156342 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849378.1 protein_id gnl|my_center|LOCUS_10840 1158400 1157405 gene locus_tag LOCUS_10850 1158400 1157405 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_10850 1158822 1158397 gene locus_tag LOCUS_10860 1158822 1158397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1159600 1161744 gene locus_tag LOCUS_10870 1159600 1161744 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454756.1 protein_id gnl|my_center|LOCUS_10870 1162182 1162613 gene locus_tag LOCUS_10880 1162182 1162613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1162735 1163139 gene locus_tag LOCUS_10890 1162735 1163139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1163339 1164802 gene locus_tag LOCUS_10900 1163339 1164802 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107018483.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10900 1164863 1165057 gene locus_tag LOCUS_10910 1164863 1165057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1165114 1165644 gene locus_tag LOCUS_10920 1165114 1165644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1165948 1166196 gene locus_tag LOCUS_10930 1165948 1166196 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_10930 1166196 1166552 gene locus_tag LOCUS_10940 1166196 1166552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1167970 1166756 gene locus_tag LOCUS_10950 gene tyrS 1167970 1166756 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_10950 1168835 1168056 gene locus_tag LOCUS_10960 1168835 1168056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1169226 1168828 gene locus_tag LOCUS_10970 1169226 1168828 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_10970 1170892 1169546 gene locus_tag LOCUS_10980 1170892 1169546 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_10980 1172474 1170900 gene locus_tag LOCUS_10990 1172474 1170900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1173722 1172658 gene locus_tag LOCUS_11000 1173722 1172658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1174333 1175142 gene locus_tag LOCUS_11010 1174333 1175142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1175123 1175578 gene locus_tag LOCUS_11020 1175123 1175578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11020 1175646 1175978 gene locus_tag LOCUS_11030 1175646 1175978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 1176162 1176776 gene locus_tag LOCUS_11040 1176162 1176776 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310428.1 protein_id gnl|my_center|LOCUS_11040 1177523 1176954 gene locus_tag LOCUS_11050 1177523 1176954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11050 1178205 1177516 gene locus_tag LOCUS_11060 1178205 1177516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 1178806 1178246 gene locus_tag LOCUS_11070 1178806 1178246 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_11070 1179016 1180359 gene locus_tag LOCUS_11080 gene miaB 1179016 1180359 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_11080 1182070 1180835 gene locus_tag LOCUS_11090 gene argJ 1182070 1180835 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_11090 1182508 1182140 gene locus_tag LOCUS_11100 1182508 1182140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1183895 1182867 gene locus_tag LOCUS_11110 gene trpD 1183895 1182867 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_11110 1184175 1184423 gene locus_tag LOCUS_11120 1184175 1184423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1184714 1184436 gene locus_tag LOCUS_11130 1184714 1184436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1185070 1184828 gene locus_tag LOCUS_11140 1185070 1184828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1187610 1185517 gene locus_tag LOCUS_11150 1187610 1185517 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_11150 1188742 1188008 gene locus_tag LOCUS_11160 1188742 1188008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1190132 1188852 gene locus_tag LOCUS_11170 1190132 1188852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1191002 1190154 gene locus_tag LOCUS_11180 1191002 1190154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_11180 1191456 1192133 gene locus_tag LOCUS_11190 1191456 1192133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1194845 1196398 gene locus_tag LOCUS_11200 1194845 1196398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1196615 1196878 gene locus_tag LOCUS_11210 1196615 1196878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1197249 1197827 gene locus_tag LOCUS_11220 1197249 1197827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1198035 1199918 gene locus_tag LOCUS_11230 1198035 1199918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1203537 1200193 gene locus_tag LOCUS_11240 1203537 1200193 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118819.1 protein_id gnl|my_center|LOCUS_11240 1204076 1203600 gene locus_tag LOCUS_11250 1204076 1203600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11250 1204624 1204157 gene locus_tag LOCUS_11260 1204624 1204157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 1205337 1205978 gene locus_tag LOCUS_11270 1205337 1205978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1207253 1206000 gene locus_tag LOCUS_11280 1207253 1206000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_11280 1207432 1207656 gene locus_tag LOCUS_11290 1207432 1207656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1208453 1207686 gene locus_tag LOCUS_11300 1208453 1207686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1210815 1209613 gene locus_tag LOCUS_11310 gene larC 1210815 1209613 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_11310 1210950 1211567 gene locus_tag LOCUS_11320 gene nadD 1210950 1211567 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_11320 1211568 1212113 gene locus_tag LOCUS_11330 1211568 1212113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1214824 1213142 gene locus_tag LOCUS_11340 1214824 1213142 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_11340 1214952 1215629 gene locus_tag LOCUS_11350 1214952 1215629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_11350 1216538 1216140 gene locus_tag LOCUS_11360 1216538 1216140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1217150 1216908 gene locus_tag LOCUS_11370 1217150 1216908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1218132 1217500 gene locus_tag LOCUS_11380 1218132 1217500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1218974 1219984 gene locus_tag LOCUS_11390 gene amrS 1218974 1219984 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_11390 1220112 1220567 gene locus_tag LOCUS_11400 1220112 1220567 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_11400 1221147 1220755 gene locus_tag LOCUS_11410 1221147 1220755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1222499 1221648 gene locus_tag LOCUS_11420 gene ilvE 1222499 1221648 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528132.1 protein_id gnl|my_center|LOCUS_11420 1223914 1222478 gene locus_tag LOCUS_11430 gene pabB 1223914 1222478 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_11430 1224135 1225025 gene locus_tag LOCUS_11440 gene xerC 1224135 1225025 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_11440 1227468 1225558 gene locus_tag LOCUS_11450 gene htpG 1227468 1225558 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939912.1 protein_id gnl|my_center|LOCUS_11450 1228060 1228617 gene locus_tag LOCUS_11460 1228060 1228617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1229106 1229993 gene locus_tag LOCUS_11470 gene glyQ 1229106 1229993 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_11470 1233752 1230285 gene locus_tag LOCUS_11480 1233752 1230285 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_11480 1234136 1234945 gene locus_tag LOCUS_11490 1234136 1234945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1235076 1236068 gene locus_tag LOCUS_11500 1235076 1236068 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_11500 1237989 1236196 gene locus_tag LOCUS_11510 1237989 1236196 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_11510 1238422 1238048 gene locus_tag LOCUS_11520 1238422 1238048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1240297 1238819 gene locus_tag LOCUS_11530 1240297 1238819 CDS product ISNCY-like element ISRm17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970069.1 protein_id gnl|my_center|LOCUS_11530 1241471 1240605 gene locus_tag LOCUS_11540 gene ubiA 1241471 1240605 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_11540 1242524 1241736 gene locus_tag LOCUS_11550 1242524 1241736 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_11550 1244189 1242594 gene locus_tag LOCUS_11560 1244189 1242594 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393673.1 protein_id gnl|my_center|LOCUS_11560 1245661 1244186 gene locus_tag LOCUS_11570 1245661 1244186 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_11570 1246328 1245663 gene locus_tag LOCUS_11580 1246328 1245663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_11580 1247152 1246334 gene locus_tag LOCUS_11590 1247152 1246334 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_11590 1247505 1247278 gene locus_tag LOCUS_11600 1247505 1247278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1249151 1247544 gene locus_tag LOCUS_11610 gene hyfB 1249151 1247544 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_11610 1249312 1249488 gene locus_tag LOCUS_11620 1249312 1249488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1250209 1250613 gene locus_tag LOCUS_11630 1250209 1250613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1250706 1250993 gene locus_tag LOCUS_11640 gene groES 1250706 1250993 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_11640 1251010 1252623 gene locus_tag LOCUS_11650 gene groL 1251010 1252623 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_11650 1253045 1254433 gene locus_tag LOCUS_11660 gene purB 1253045 1254433 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_11660 1254498 1255115 gene locus_tag LOCUS_11670 gene thiE 1254498 1255115 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_11670 1255474 1255857 gene locus_tag LOCUS_11680 gene hisI 1255474 1255857 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_11680 1256086 1256757 gene locus_tag LOCUS_11690 1256086 1256757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1257002 1256820 gene locus_tag LOCUS_11700 1257002 1256820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1257252 1259141 gene locus_tag LOCUS_11710 1257252 1259141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1259128 1259979 gene locus_tag LOCUS_11720 gene ccsB 1259128 1259979 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_11720 1260007 1260285 gene locus_tag LOCUS_11730 1260007 1260285 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_11730 1260287 1260580 gene locus_tag LOCUS_11740 1260287 1260580 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883135.1 protein_id gnl|my_center|LOCUS_11740 1260599 1263415 gene locus_tag LOCUS_11750 gene ileS 1260599 1263415 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_11750 1263612 1263974 gene locus_tag LOCUS_11760 1263612 1263974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1266066 1264111 gene locus_tag LOCUS_11770 1266066 1264111 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_11770 1266521 1267852 gene locus_tag LOCUS_11780 1266521 1267852 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_11780 1268004 1270412 gene locus_tag LOCUS_11790 1268004 1270412 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120873.1 protein_id gnl|my_center|LOCUS_11790 1271694 1270381 gene locus_tag LOCUS_11800 gene mnmE 1271694 1270381 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 protein_id gnl|my_center|LOCUS_11800 1273113 1271719 gene locus_tag LOCUS_11810 1273113 1271719 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_11810 1273476 1274666 gene locus_tag LOCUS_11820 1273476 1274666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1274673 1275326 gene locus_tag LOCUS_11830 1274673 1275326 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_11830 1275338 1277848 gene locus_tag LOCUS_11840 gene gyrA 1275338 1277848 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_11840 1278195 1278986 gene locus_tag LOCUS_11850 1278195 1278986 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_11850 1278949 1279947 gene locus_tag LOCUS_11860 1278949 1279947 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_11860 1280427 1280215 gene locus_tag LOCUS_11870 1280427 1280215 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_11870 1282387 1280603 gene locus_tag LOCUS_11880 gene pepF 1282387 1280603 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_11880 1282692 1282384 gene locus_tag LOCUS_11890 1282692 1282384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1283179 1282727 gene locus_tag LOCUS_11900 1283179 1282727 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158145.1 protein_id gnl|my_center|LOCUS_11900 1283862 1284443 gene locus_tag LOCUS_11910 1283862 1284443 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937452.1 protein_id gnl|my_center|LOCUS_11910 1284510 1285247 gene locus_tag LOCUS_11920 1284510 1285247 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_11920 1285510 1285689 gene locus_tag LOCUS_11930 1285510 1285689 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_11930 1285689 1287380 gene locus_tag LOCUS_11940 gene yidC 1285689 1287380 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_11940 1287461 1288867 gene locus_tag LOCUS_11950 gene mnmE 1287461 1288867 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_11950 1288869 1289345 gene locus_tag LOCUS_11960 1288869 1289345 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_11960 1289716 1290186 gene locus_tag LOCUS_11970 gene nrdR 1289716 1290186 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_11970 1290238 1292676 gene locus_tag LOCUS_11980 gene nrdD 1290238 1292676 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869385.1 protein_id gnl|my_center|LOCUS_11980 1292746 1293480 gene locus_tag LOCUS_11990 1292746 1293480 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_11990 1293530 1293709 gene locus_tag LOCUS_12000 1293530 1293709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1294465 1298088 gene locus_tag LOCUS_12010 gene smc 1294465 1298088 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_12010 1298454 1300256 gene locus_tag LOCUS_12020 1298454 1300256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1300477 1301304 gene locus_tag LOCUS_12030 1300477 1301304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1301420 1301692 gene locus_tag LOCUS_12040 1301420 1301692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1301853 1302122 gene locus_tag LOCUS_12050 1301853 1302122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1302119 1302304 gene locus_tag LOCUS_12060 1302119 1302304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1302342 1303253 gene locus_tag LOCUS_12070 gene focA 1302342 1303253 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816739.1 protein_id gnl|my_center|LOCUS_12070 1303259 1304149 gene locus_tag LOCUS_12080 1303259 1304149 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_12080 1304238 1304624 gene locus_tag LOCUS_12090 1304238 1304624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1304823 1305536 gene locus_tag LOCUS_12100 1304823 1305536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1305848 1306096 gene locus_tag LOCUS_12110 1305848 1306096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1306268 1307149 gene locus_tag LOCUS_12120 1306268 1307149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1307579 1308652 gene locus_tag LOCUS_12130 1307579 1308652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1309055 1309798 gene locus_tag LOCUS_12140 1309055 1309798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1309856 1311580 gene locus_tag LOCUS_12150 1309856 1311580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1311559 1311954 gene locus_tag LOCUS_12160 1311559 1311954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1312080 1313030 gene locus_tag LOCUS_12170 1312080 1313030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1313081 1313851 gene locus_tag LOCUS_12180 1313081 1313851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1313929 1315536 gene locus_tag LOCUS_12190 1313929 1315536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1315552 1317054 gene locus_tag LOCUS_12200 1315552 1317054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1317057 1317623 gene locus_tag LOCUS_12210 1317057 1317623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1317668 1318972 gene locus_tag LOCUS_12220 1317668 1318972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1319433 1319981 gene locus_tag LOCUS_12230 1319433 1319981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1320419 1321384 gene locus_tag LOCUS_12240 1320419 1321384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1321438 1322670 gene locus_tag LOCUS_12250 1321438 1322670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1322685 1323482 gene locus_tag LOCUS_12260 1322685 1323482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1323482 1324450 gene locus_tag LOCUS_12270 1323482 1324450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1324496 1327942 gene locus_tag LOCUS_12280 1324496 1327942 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945118.1 protein_id gnl|my_center|LOCUS_12280 1328058 1328786 gene locus_tag LOCUS_12290 1328058 1328786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1329925 1328903 gene locus_tag LOCUS_12300 1329925 1328903 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_12300 1331273 1330014 gene locus_tag LOCUS_12310 1331273 1330014 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_12310 1332204 1331254 gene locus_tag LOCUS_12320 gene prfB 1332204 1331254 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881199.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12320 1333078 1333641 gene locus_tag LOCUS_12330 gene rsmD 1333078 1333641 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_12330 1333638 1334525 gene locus_tag LOCUS_12340 gene ispE 1333638 1334525 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_12340 1334538 1334993 gene locus_tag LOCUS_12350 1334538 1334993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1335252 1336865 gene locus_tag LOCUS_12360 gene ilvB 1335252 1336865 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_12360 1336947 1337771 gene locus_tag LOCUS_12370 1336947 1337771 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_12370 1337772 1338506 gene locus_tag LOCUS_12380 1337772 1338506 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_12380 1338653 1339687 gene locus_tag LOCUS_12390 gene tdh 1338653 1339687 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_12390 1339751 1340929 gene locus_tag LOCUS_12400 1339751 1340929 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_12400 1341017 1341517 gene locus_tag LOCUS_12410 1341017 1341517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1341453 1341608 gene locus_tag LOCUS_12420 1341453 1341608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1341620 1342006 gene locus_tag LOCUS_12430 1341620 1342006 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007798.1 protein_id gnl|my_center|LOCUS_12430 1342003 1342644 gene locus_tag LOCUS_12440 1342003 1342644 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249588.1 protein_id gnl|my_center|LOCUS_12440 1342637 1343548 gene locus_tag LOCUS_12450 1342637 1343548 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_12450 1343827 1344030 gene locus_tag LOCUS_12460 1343827 1344030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1344036 1344332 gene locus_tag LOCUS_12470 1344036 1344332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1344422 1345141 gene locus_tag LOCUS_12480 1344422 1345141 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_12480 1345284 1345490 gene locus_tag LOCUS_12490 1345284 1345490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1345707 1347563 gene locus_tag LOCUS_12500 1345707 1347563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1348520 1347654 gene locus_tag LOCUS_12510 gene rfbD 1348520 1347654 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890806.1 protein_id gnl|my_center|LOCUS_12510 1350346 1348517 gene locus_tag LOCUS_12520 gene msbA 1350346 1348517 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_12520 1350740 1352473 gene locus_tag LOCUS_12530 1350740 1352473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1353293 1354390 gene locus_tag LOCUS_12540 gene gcvT 1353293 1354390 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_12540 1354387 1354776 gene locus_tag LOCUS_12550 gene gcvH 1354387 1354776 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_12550 1355120 1355650 gene locus_tag LOCUS_12560 1355120 1355650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1355877 1355695 gene locus_tag LOCUS_12570 1355877 1355695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1356524 1356105 gene locus_tag LOCUS_12580 gene rnk 1356524 1356105 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_12580 1357262 1356981 gene locus_tag LOCUS_12590 1357262 1356981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1357833 1357342 gene locus_tag LOCUS_12600 1357833 1357342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1358213 1358593 gene locus_tag LOCUS_12610 1358213 1358593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1358715 1358939 gene locus_tag LOCUS_12620 1358715 1358939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1358954 1359247 gene locus_tag LOCUS_12630 1358954 1359247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12630 >Feature sequence02 603 58 gene locus_tag LOCUS_12640 603 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2252 861 gene locus_tag LOCUS_12650 2252 861 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_12650 3180 2335 gene locus_tag LOCUS_12660 3180 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12660 4207 3164 gene locus_tag LOCUS_12670 4207 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4997 4287 gene locus_tag LOCUS_12680 4997 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6762 5416 gene locus_tag LOCUS_12690 6762 5416 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_12690 7274 6804 gene locus_tag LOCUS_12700 gene accB 7274 6804 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 protein_id gnl|my_center|LOCUS_12700 8561 7494 gene locus_tag LOCUS_12710 8561 7494 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102862.1 protein_id gnl|my_center|LOCUS_12710 9995 8646 gene locus_tag LOCUS_12720 gene dnaA 9995 8646 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_12720 10725 11438 gene locus_tag LOCUS_12730 10725 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 11620 12171 gene locus_tag LOCUS_12740 gene hpt 11620 12171 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_12740 12323 14164 gene locus_tag LOCUS_12750 12323 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 14630 14391 gene locus_tag LOCUS_12760 14630 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 14824 14627 gene locus_tag LOCUS_12770 14824 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 15151 14903 gene locus_tag LOCUS_12780 15151 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 17570 15561 gene locus_tag LOCUS_12790 gene pheT 17570 15561 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_12790 18633 17617 gene locus_tag LOCUS_12800 gene pheS 18633 17617 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_12800 19158 18796 gene locus_tag LOCUS_12810 gene rplT 19158 18796 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_12810 19394 19197 gene locus_tag LOCUS_12820 gene rpmI 19394 19197 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172638.1 protein_id gnl|my_center|LOCUS_12820 20078 19626 gene locus_tag LOCUS_12830 gene infC 20078 19626 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_12830 22070 20148 gene locus_tag LOCUS_12840 gene thrS 22070 20148 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_12840 22571 23434 gene locus_tag LOCUS_12850 gene mtnP 22571 23434 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_12850 24304 23486 gene locus_tag LOCUS_12860 gene pgeF 24304 23486 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 protein_id gnl|my_center|LOCUS_12860 24722 24468 gene locus_tag LOCUS_12870 24722 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 25083 24691 gene locus_tag LOCUS_12880 25083 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 25685 26755 gene locus_tag LOCUS_12890 25685 26755 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 protein_id gnl|my_center|LOCUS_12890 26739 27428 gene locus_tag LOCUS_12900 26739 27428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 28006 27653 gene locus_tag LOCUS_12910 28006 27653 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_12910 28730 28068 gene locus_tag LOCUS_12920 28730 28068 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_12920 32972 28929 gene locus_tag LOCUS_12930 32972 28929 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876975.1 protein_id gnl|my_center|LOCUS_12930 33355 32969 gene locus_tag LOCUS_12940 33355 32969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 35610 33418 gene locus_tag LOCUS_12950 35610 33418 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_12950 36658 36152 gene locus_tag LOCUS_12960 36658 36152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 37144 36836 gene locus_tag LOCUS_12970 37144 36836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 38920 39240 gene locus_tag LOCUS_12980 38920 39240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 39386 39676 gene locus_tag LOCUS_12990 39386 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 39892 39650 gene locus_tag LOCUS_13000 39892 39650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 42063 40324 gene locus_tag LOCUS_13010 42063 40324 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_13010 42406 43398 gene locus_tag LOCUS_13020 42406 43398 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_13020 43404 44261 gene locus_tag LOCUS_13030 43404 44261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 44258 45694 gene locus_tag LOCUS_13040 44258 45694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 45691 46710 gene locus_tag LOCUS_13050 45691 46710 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135747.1 protein_id gnl|my_center|LOCUS_13050 46851 47213 gene locus_tag LOCUS_13060 46851 47213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 47262 48188 gene locus_tag LOCUS_13070 47262 48188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 48610 49185 gene locus_tag LOCUS_13080 48610 49185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 49276 50286 gene locus_tag LOCUS_13090 49276 50286 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_13090 50654 52567 gene locus_tag LOCUS_13100 50654 52567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 54745 53555 gene locus_tag LOCUS_13110 54745 53555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 55279 55704 gene locus_tag LOCUS_13120 gene tnpA 55279 55704 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_13120 56110 55772 gene locus_tag LOCUS_13130 56110 55772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 56492 56340 gene locus_tag LOCUS_13140 56492 56340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 57353 56673 gene locus_tag LOCUS_13150 gene nth 57353 56673 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_13150 59402 57705 gene locus_tag LOCUS_13160 gene argS 59402 57705 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_13160 60614 59637 gene locus_tag LOCUS_13170 gene trpS 60614 59637 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173293.1 protein_id gnl|my_center|LOCUS_13170 61894 60707 gene locus_tag LOCUS_13180 61894 60707 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_13180 62422 61922 gene locus_tag LOCUS_13190 62422 61922 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814552.1 protein_id gnl|my_center|LOCUS_13190 62774 62520 gene locus_tag LOCUS_13200 62774 62520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 63849 62833 gene locus_tag LOCUS_13210 gene aroF 63849 62833 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_13210 64317 64652 gene locus_tag LOCUS_13220 64317 64652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 64804 65859 gene locus_tag LOCUS_13230 64804 65859 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536857.1 protein_id gnl|my_center|LOCUS_13230 66158 67159 gene locus_tag LOCUS_13240 gene speY 66158 67159 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_13240 68158 67583 gene locus_tag LOCUS_13250 68158 67583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 68763 68521 gene locus_tag LOCUS_13260 68763 68521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 68735 68965 gene locus_tag LOCUS_13270 68735 68965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 72291 69061 gene locus_tag LOCUS_13280 72291 69061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 72440 74323 gene locus_tag LOCUS_13290 72440 74323 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_13290 74926 74390 gene locus_tag LOCUS_13300 74926 74390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 79226 75849 gene locus_tag LOCUS_13310 79226 75849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 80412 79315 gene locus_tag LOCUS_13320 80412 79315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 84288 80782 gene locus_tag LOCUS_13330 84288 80782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 85849 85127 gene locus_tag LOCUS_13340 gene cobI 85849 85127 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_13340 86719 85925 gene locus_tag LOCUS_13350 86719 85925 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_13350 87195 86863 gene locus_tag LOCUS_13360 87195 86863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 87376 87173 gene locus_tag LOCUS_13370 87376 87173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 87700 87545 gene locus_tag LOCUS_13380 87700 87545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 88443 87793 gene locus_tag LOCUS_13390 88443 87793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 89501 88428 gene locus_tag LOCUS_13400 gene cbiD 89501 88428 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392602.1 protein_id gnl|my_center|LOCUS_13400 90680 89667 gene locus_tag LOCUS_13410 90680 89667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 90817 91029 gene locus_tag LOCUS_13420 90817 91029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 91791 90934 gene locus_tag LOCUS_13430 gene dusB 91791 90934 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_13430 92156 92884 gene locus_tag LOCUS_13440 gene ubiE 92156 92884 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_13440 93159 93232 gene locus_tag LOCUS_t00120 93159 93232 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 93854 93558 gene locus_tag LOCUS_13450 93854 93558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 94699 94112 gene locus_tag LOCUS_13460 94699 94112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 95142 96113 gene locus_tag LOCUS_13470 95142 96113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 96194 96367 gene locus_tag LOCUS_13480 96194 96367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 96584 96823 gene locus_tag LOCUS_13490 96584 96823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 97092 96886 gene locus_tag LOCUS_13500 97092 96886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 99032 98064 gene locus_tag LOCUS_13510 99032 98064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 99576 99109 gene locus_tag LOCUS_13520 99576 99109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 99842 99621 gene locus_tag LOCUS_13530 99842 99621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 100053 100208 gene locus_tag LOCUS_13540 100053 100208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 100716 100874 gene locus_tag LOCUS_13550 100716 100874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 100861 102918 gene locus_tag LOCUS_13560 100861 102918 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_13560 103702 104235 gene locus_tag LOCUS_13570 103702 104235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 105365 104907 gene locus_tag LOCUS_13580 105365 104907 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_13580 107157 105406 gene locus_tag LOCUS_13590 107157 105406 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_13590 107762 107154 gene locus_tag LOCUS_13600 107762 107154 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_13600 108377 107952 gene locus_tag LOCUS_13610 gene tnpA 108377 107952 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_13610 110324 109011 gene locus_tag LOCUS_13620 110324 109011 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_13620 112074 110305 gene locus_tag LOCUS_13630 112074 110305 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_13630 112606 112064 gene locus_tag LOCUS_13640 112606 112064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 113239 112607 gene locus_tag LOCUS_13650 113239 112607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 114271 114651 gene locus_tag LOCUS_13660 gene tnpA 114271 114651 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_13660 114960 115337 gene locus_tag LOCUS_13670 114960 115337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 115529 116155 gene locus_tag LOCUS_13680 115529 116155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 116344 116547 gene locus_tag LOCUS_13690 116344 116547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 116833 117177 gene locus_tag LOCUS_13700 116833 117177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 119125 118181 gene locus_tag LOCUS_13710 119125 118181 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529905.1 protein_id gnl|my_center|LOCUS_13710 119730 119455 gene locus_tag LOCUS_13720 119730 119455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 120063 119827 gene locus_tag LOCUS_13730 120063 119827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 122022 120340 gene locus_tag LOCUS_13740 122022 120340 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_13740 123247 122645 gene locus_tag LOCUS_13750 gene wrbA 123247 122645 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 protein_id gnl|my_center|LOCUS_13750 124271 124645 gene locus_tag LOCUS_13760 124271 124645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 124840 125055 gene locus_tag LOCUS_13770 124840 125055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 125190 125549 gene locus_tag LOCUS_13780 125190 125549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 125556 125942 gene locus_tag LOCUS_13790 125556 125942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13790 125967 126149 gene locus_tag LOCUS_13800 125967 126149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 129392 127971 gene locus_tag LOCUS_13810 129392 127971 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_13810 130203 129565 gene locus_tag LOCUS_13820 130203 129565 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_13820 130349 130885 gene locus_tag LOCUS_13830 130349 130885 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_13830 131871 130939 gene locus_tag LOCUS_13840 131871 130939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 132994 131861 gene locus_tag LOCUS_13850 132994 131861 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_13850 134010 133027 gene locus_tag LOCUS_13860 134010 133027 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_13860 134784 134227 gene locus_tag LOCUS_13870 gene efp 134784 134227 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_13870 136006 134810 gene locus_tag LOCUS_13880 gene hemW 136006 134810 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_13880 136444 137169 gene locus_tag LOCUS_13890 136444 137169 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_13890 138030 138596 gene locus_tag LOCUS_13900 138030 138596 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_13900 138749 139201 gene locus_tag LOCUS_13910 138749 139201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 139245 139724 gene locus_tag LOCUS_13920 139245 139724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 141616 142164 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccttctacatcaggtcaatgatttccaca 142644 142369 gene locus_tag LOCUS_13930 gene cas2 142644 142369 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_13930 143649 142648 gene locus_tag LOCUS_13940 gene cas1 143649 142648 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_13940 144575 143631 gene locus_tag LOCUS_13950 144575 143631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 144817 144578 gene locus_tag LOCUS_13960 144817 144578 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546514.1 protein_id gnl|my_center|LOCUS_13960 145719 144814 gene locus_tag LOCUS_13970 145719 144814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 145960 145790 gene locus_tag LOCUS_13980 145960 145790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 146336 146016 gene locus_tag LOCUS_13990 146336 146016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 147642 146419 gene locus_tag LOCUS_14000 gene csm5 147642 146419 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_14000 148721 147639 gene locus_tag LOCUS_14010 gene csm4 148721 147639 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876703.1 protein_id gnl|my_center|LOCUS_14010 149548 148718 gene locus_tag LOCUS_14020 gene csm3 149548 148718 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_14020 149979 149548 gene locus_tag LOCUS_14030 gene csm2 149979 149548 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296332.1 protein_id gnl|my_center|LOCUS_14030 152404 149984 gene locus_tag LOCUS_14040 gene cas10 152404 149984 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_14040 152751 153083 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccttctacatcaggtcaataattcccac 153528 153376 gene locus_tag LOCUS_14050 153528 153376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 154339 153917 gene locus_tag LOCUS_14060 154339 153917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 154725 154649 gene locus_tag LOCUS_t00130 154725 154649 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 155002 155679 gene locus_tag LOCUS_14070 gene tsaB 155002 155679 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_14070 156189 155737 gene locus_tag LOCUS_14080 156189 155737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 157235 156213 gene locus_tag LOCUS_14090 gene rfbB 157235 156213 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_14090 157771 157367 gene locus_tag LOCUS_14100 157771 157367 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_14100 159189 157774 gene locus_tag LOCUS_14110 gene atpD 159189 157774 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_14110 160199 159327 gene locus_tag LOCUS_14120 160199 159327 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_14120 161717 160203 gene locus_tag LOCUS_14130 gene atpA 161717 160203 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_14130 162387 161839 gene locus_tag LOCUS_14140 162387 161839 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_14140 162886 162377 gene locus_tag LOCUS_14150 162886 162377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 163183 162911 gene locus_tag LOCUS_14160 gene atpE 163183 162911 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_14160 163683 163357 gene locus_tag LOCUS_14170 163683 163357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 164565 163792 gene locus_tag LOCUS_14180 164565 163792 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_14180 165174 164800 gene locus_tag LOCUS_14190 165174 164800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 165472 165218 gene locus_tag LOCUS_14200 165472 165218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 166101 165481 gene locus_tag LOCUS_14210 166101 165481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 167451 166159 gene locus_tag LOCUS_14220 gene hemL 167451 166159 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_14220 167567 168196 gene locus_tag LOCUS_14230 gene purN 167567 168196 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_14230 168212 169081 gene locus_tag LOCUS_14240 168212 169081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 169217 171010 gene locus_tag LOCUS_14250 169217 171010 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_14250 171203 172081 gene locus_tag LOCUS_14260 171203 172081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 172138 173124 gene locus_tag LOCUS_14270 172138 173124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 173132 176035 gene locus_tag LOCUS_14280 173132 176035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 176285 176530 gene locus_tag LOCUS_14290 176285 176530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 176533 176883 gene locus_tag LOCUS_14300 176533 176883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 176915 177922 gene locus_tag LOCUS_14310 176915 177922 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_14310 177929 180589 gene locus_tag LOCUS_14320 177929 180589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 180608 181600 gene locus_tag LOCUS_14330 180608 181600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 183293 182106 gene locus_tag LOCUS_14340 183293 182106 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_14340 184507 183770 gene locus_tag LOCUS_14350 184507 183770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 184969 185430 gene locus_tag LOCUS_14360 184969 185430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 186476 186243 gene locus_tag LOCUS_14370 186476 186243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 186578 186775 gene locus_tag LOCUS_14380 186578 186775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 186969 187898 gene locus_tag LOCUS_14390 186969 187898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 189116 187956 gene locus_tag LOCUS_14400 189116 187956 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776226.1 protein_id gnl|my_center|LOCUS_14400 189865 189116 gene locus_tag LOCUS_14410 189865 189116 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 protein_id gnl|my_center|LOCUS_14410 190073 190927 gene locus_tag LOCUS_14420 190073 190927 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_14420 190917 191999 gene locus_tag LOCUS_14430 gene mqnC 190917 191999 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_14430 193161 192211 gene locus_tag LOCUS_14440 193161 192211 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 protein_id gnl|my_center|LOCUS_14440 194687 193161 gene locus_tag LOCUS_14450 194687 193161 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_14450 195132 194680 gene locus_tag LOCUS_14460 195132 194680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 195020 195346 gene locus_tag LOCUS_14470 195020 195346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 196098 196430 gene locus_tag LOCUS_14480 196098 196430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 197156 197338 gene locus_tag LOCUS_14490 197156 197338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 198167 197664 gene locus_tag LOCUS_14500 198167 197664 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_14500 198865 198179 gene locus_tag LOCUS_14510 198865 198179 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894969.1 protein_id gnl|my_center|LOCUS_14510 199306 198890 gene locus_tag LOCUS_14520 199306 198890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 199806 200774 gene locus_tag LOCUS_14530 199806 200774 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224290.1 protein_id gnl|my_center|LOCUS_14530 200741 202543 gene locus_tag LOCUS_14540 gene lepA 200741 202543 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583469.1 protein_id gnl|my_center|LOCUS_14540 202557 204062 gene locus_tag LOCUS_14550 202557 204062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 204065 204883 gene locus_tag LOCUS_14560 gene lptB 204065 204883 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_14560 204973 205719 gene locus_tag LOCUS_14570 204973 205719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 205736 205954 gene locus_tag LOCUS_14580 205736 205954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 206076 206303 gene locus_tag LOCUS_14590 206076 206303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 206338 206823 gene locus_tag LOCUS_14600 206338 206823 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_14600 206816 207505 gene locus_tag LOCUS_14610 gene ispD 206816 207505 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_14610 207557 208231 gene locus_tag LOCUS_14620 207557 208231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 208431 209117 gene locus_tag LOCUS_14630 208431 209117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_14630 209221 210654 gene locus_tag LOCUS_14640 gene lysS 209221 210654 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_14640 211405 210953 gene locus_tag LOCUS_14650 211405 210953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 211617 211414 gene locus_tag LOCUS_14660 211617 211414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 212028 212870 gene locus_tag LOCUS_14670 212028 212870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 213958 216114 gene locus_tag LOCUS_14680 213958 216114 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_14680 217707 216124 gene locus_tag LOCUS_14690 217707 216124 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_14690 219583 218126 gene locus_tag LOCUS_14700 gene rpoN 219583 218126 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_14700 220301 219654 gene locus_tag LOCUS_14710 gene recR 220301 219654 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_14710 220638 220291 gene locus_tag LOCUS_14720 220638 220291 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_14720 222326 220650 gene locus_tag LOCUS_14730 gene dnaX 222326 220650 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_14730 223009 222917 gene locus_tag LOCUS_t00140 223009 222917 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 223201 223112 gene locus_tag LOCUS_t00150 223201 223112 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 224093 223596 gene locus_tag LOCUS_14740 gene tadA 224093 223596 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_14740 224473 224398 gene locus_tag LOCUS_t00160 224473 224398 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 224887 225240 gene locus_tag LOCUS_14750 224887 225240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 225481 225708 gene locus_tag LOCUS_14760 225481 225708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 225671 226354 gene locus_tag LOCUS_14770 225671 226354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 227121 226357 gene locus_tag LOCUS_14780 227121 226357 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_14780 227503 227126 gene locus_tag LOCUS_14790 227503 227126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 228058 227858 gene locus_tag LOCUS_14800 228058 227858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 228230 228361 gene locus_tag LOCUS_14810 228230 228361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 229049 229819 gene locus_tag LOCUS_14820 229049 229819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 229803 230165 gene locus_tag LOCUS_14830 229803 230165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 230254 231042 gene locus_tag LOCUS_14840 gene cbiQ 230254 231042 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964676.1 protein_id gnl|my_center|LOCUS_14840 231036 231911 gene locus_tag LOCUS_14850 231036 231911 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_14850 232162 233256 gene locus_tag LOCUS_14860 gene cobD 232162 233256 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_14860 233820 235355 gene locus_tag LOCUS_14870 233820 235355 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_14870 236001 235534 gene locus_tag LOCUS_14880 236001 235534 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_14880 236322 236038 gene locus_tag LOCUS_14890 236322 236038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 237657 237821 gene locus_tag LOCUS_14900 237657 237821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14900 238510 239529 gene locus_tag LOCUS_14910 238510 239529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 240069 239797 gene locus_tag LOCUS_14920 240069 239797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 241486 242547 gene locus_tag LOCUS_14930 241486 242547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 242697 242939 gene locus_tag LOCUS_14940 242697 242939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 246220 246047 gene locus_tag LOCUS_14950 246220 246047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 246779 246498 gene locus_tag LOCUS_14960 246779 246498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 249001 248123 gene locus_tag LOCUS_14970 249001 248123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 249537 249172 gene locus_tag LOCUS_14980 249537 249172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 250489 249752 gene locus_tag LOCUS_14990 250489 249752 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_14990 250918 252948 gene locus_tag LOCUS_15000 250918 252948 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_15000 253537 253061 gene locus_tag LOCUS_15010 gene bfr 253537 253061 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_15010 253982 253686 gene locus_tag LOCUS_15020 253982 253686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15020 255546 254866 gene locus_tag LOCUS_15030 gene istB 255546 254866 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 256610 255543 gene locus_tag LOCUS_15040 256610 255543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 256766 257491 gene locus_tag LOCUS_15050 256766 257491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 258102 257971 gene locus_tag LOCUS_15060 258102 257971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 258767 258291 gene locus_tag LOCUS_15070 258767 258291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 258959 259231 gene locus_tag LOCUS_15080 258959 259231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 259458 259733 gene locus_tag LOCUS_15090 259458 259733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 260922 260641 gene locus_tag LOCUS_15100 260922 260641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 261416 261282 gene locus_tag LOCUS_15110 261416 261282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 261939 261562 gene locus_tag LOCUS_15120 261939 261562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 262340 262143 gene locus_tag LOCUS_15130 262340 262143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 262550 262350 gene locus_tag LOCUS_15140 262550 262350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 263238 262873 gene locus_tag LOCUS_15150 263238 262873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 267170 263763 gene locus_tag LOCUS_15160 267170 263763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 268192 267191 gene locus_tag LOCUS_15170 gene egtD 268192 267191 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146537107.1 protein_id gnl|my_center|LOCUS_15170 268471 268770 gene locus_tag LOCUS_15180 268471 268770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 268722 268961 gene locus_tag LOCUS_15190 268722 268961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 269599 269526 gene locus_tag LOCUS_t00170 269599 269526 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 270504 269671 gene locus_tag LOCUS_15200 gene kdsA 270504 269671 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_15200 271021 270551 gene locus_tag LOCUS_15210 271021 270551 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_15210 274650 271072 gene locus_tag LOCUS_15220 gene nifJ 274650 271072 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_15220 275663 274944 gene locus_tag LOCUS_15230 275663 274944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 276539 275778 gene locus_tag LOCUS_15240 276539 275778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 278681 277986 gene locus_tag LOCUS_15250 278681 277986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 278872 278639 gene locus_tag LOCUS_15260 278872 278639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 279349 278915 gene locus_tag LOCUS_15270 279349 278915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 280123 279911 gene locus_tag LOCUS_15280 280123 279911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 280496 280287 gene locus_tag LOCUS_15290 280496 280287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 281346 280798 gene locus_tag LOCUS_15300 281346 280798 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_15300 281711 281421 gene locus_tag LOCUS_15310 281711 281421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 283245 282286 gene locus_tag LOCUS_15320 283245 282286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 284387 283431 gene locus_tag LOCUS_15330 284387 283431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 284743 284390 gene locus_tag LOCUS_15340 284743 284390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 286480 284765 gene locus_tag LOCUS_15350 286480 284765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 288141 286720 gene locus_tag LOCUS_15360 288141 286720 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_15360 288673 288500 gene locus_tag LOCUS_15370 288673 288500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 290185 289175 gene locus_tag LOCUS_15380 290185 289175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 291691 290306 gene locus_tag LOCUS_15390 291691 290306 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021797.1 protein_id gnl|my_center|LOCUS_15390 292477 292013 gene locus_tag LOCUS_15400 292477 292013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 294016 292607 gene locus_tag LOCUS_15410 294016 292607 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_15410 294775 294020 gene locus_tag LOCUS_15420 294775 294020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 295160 294792 gene locus_tag LOCUS_15430 295160 294792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 297261 295609 gene locus_tag LOCUS_15440 297261 295609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 297458 298051 gene locus_tag LOCUS_15450 297458 298051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 298130 298849 gene locus_tag LOCUS_15460 gene lolD 298130 298849 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210923.1 protein_id gnl|my_center|LOCUS_15460 298881 299738 gene locus_tag LOCUS_15470 gene ilvE 298881 299738 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_15470 300219 299740 gene locus_tag LOCUS_15480 gene lspA 300219 299740 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358651.1 protein_id gnl|my_center|LOCUS_15480 300600 300226 gene locus_tag LOCUS_15490 300600 300226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 301853 300909 gene locus_tag LOCUS_15500 301853 300909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 302639 301950 gene locus_tag LOCUS_15510 302639 301950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 303810 302845 gene locus_tag LOCUS_15520 303810 302845 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_15520 304466 304017 gene locus_tag LOCUS_15530 gene pyrI 304466 304017 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_15530 305389 304463 gene locus_tag LOCUS_15540 gene pyrB 305389 304463 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_15540 305796 306467 gene locus_tag LOCUS_15550 305796 306467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 306595 306762 gene locus_tag LOCUS_15560 306595 306762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 306767 308962 gene locus_tag LOCUS_15570 306767 308962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 308962 309342 gene locus_tag LOCUS_15580 308962 309342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 309569 309940 gene locus_tag LOCUS_15590 309569 309940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 309937 310773 gene locus_tag LOCUS_15600 309937 310773 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773261.1 protein_id gnl|my_center|LOCUS_15600 310934 311083 gene locus_tag LOCUS_15610 310934 311083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 311432 311262 gene locus_tag LOCUS_15620 311432 311262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 311685 312857 gene locus_tag LOCUS_15630 311685 312857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 313134 314429 gene locus_tag LOCUS_15640 313134 314429 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_15640 314439 315632 gene locus_tag LOCUS_15650 314439 315632 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_15650 315644 315796 gene locus_tag LOCUS_15660 315644 315796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 315909 316412 gene locus_tag LOCUS_15670 315909 316412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 317024 316455 gene locus_tag LOCUS_15680 317024 316455 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_15680 318074 317160 gene locus_tag LOCUS_15690 gene focA 318074 317160 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462425.1 protein_id gnl|my_center|LOCUS_15690 319611 318238 gene locus_tag LOCUS_15700 319611 318238 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_15700 320282 319635 gene locus_tag LOCUS_15710 320282 319635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 321974 320331 gene locus_tag LOCUS_15720 321974 320331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 323140 322166 gene locus_tag LOCUS_15730 323140 322166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 323392 323772 gene locus_tag LOCUS_15740 gene rnpA 323392 323772 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_15740 324705 323995 gene locus_tag LOCUS_15750 324705 323995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 325273 326154 gene locus_tag LOCUS_15760 325273 326154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 326141 327511 gene locus_tag LOCUS_15770 326141 327511 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_15770 327640 330348 gene locus_tag LOCUS_15780 327640 330348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 331161 330661 gene locus_tag LOCUS_15790 331161 330661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 334109 332274 gene locus_tag LOCUS_15800 gene glgP 334109 332274 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_15800 334976 334425 gene locus_tag LOCUS_15810 334976 334425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 336939 335662 gene locus_tag LOCUS_15820 336939 335662 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_15820 338411 336951 gene locus_tag LOCUS_15830 338411 336951 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_15830 338755 338408 gene locus_tag LOCUS_15840 338755 338408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 339416 338991 gene locus_tag LOCUS_15850 339416 338991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 339819 339670 gene locus_tag LOCUS_15860 339819 339670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 343010 339906 gene locus_tag LOCUS_15870 343010 339906 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_15870 343590 343324 gene locus_tag LOCUS_15880 343590 343324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 345253 343697 gene locus_tag LOCUS_15890 345253 343697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 347367 345388 gene locus_tag LOCUS_15900 347367 345388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 348024 347437 gene locus_tag LOCUS_15910 348024 347437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 350758 348002 gene locus_tag LOCUS_15920 350758 348002 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_15920 351694 350783 gene locus_tag LOCUS_15930 351694 350783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 352229 351870 gene locus_tag LOCUS_15940 352229 351870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 353321 353097 gene locus_tag LOCUS_15950 353321 353097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 355482 353314 gene locus_tag LOCUS_15960 gene glgX 355482 353314 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_15960 357205 355586 gene locus_tag LOCUS_15970 357205 355586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 357559 357332 gene locus_tag LOCUS_15980 357559 357332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 359651 357798 gene locus_tag LOCUS_15990 359651 357798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 360936 359719 gene locus_tag LOCUS_16000 360936 359719 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_16000 361597 361118 gene locus_tag LOCUS_16010 361597 361118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 362540 362106 gene locus_tag LOCUS_16020 362540 362106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 364174 363050 gene locus_tag LOCUS_16030 gene lpxB 364174 363050 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_16030 365751 364528 gene locus_tag LOCUS_16040 365751 364528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 368704 366185 gene locus_tag LOCUS_16050 368704 366185 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_16050 369793 369290 gene locus_tag LOCUS_16060 369793 369290 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730476.1 protein_id gnl|my_center|LOCUS_16060 371212 369863 gene locus_tag LOCUS_16070 371212 369863 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_16070 372457 373935 gene locus_tag LOCUS_16080 372457 373935 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_16080 374542 374159 gene locus_tag LOCUS_16090 374542 374159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 374743 375294 gene locus_tag LOCUS_16100 374743 375294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 376166 375378 gene locus_tag LOCUS_16110 gene soj 376166 375378 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_16110 376551 378308 gene locus_tag LOCUS_16120 376551 378308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 378896 378330 gene locus_tag LOCUS_16130 378896 378330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 380363 379056 gene locus_tag LOCUS_16140 gene rimO 380363 379056 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_16140 382617 380356 gene locus_tag LOCUS_16150 382617 380356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 383170 382775 gene locus_tag LOCUS_16160 gene dut 383170 382775 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_16160 383679 383230 gene locus_tag LOCUS_16170 383679 383230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 384320 383775 gene locus_tag LOCUS_16180 gene gmk 384320 383775 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_16180 385268 384384 gene locus_tag LOCUS_16190 385268 384384 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_16190 385871 385464 gene locus_tag LOCUS_16200 385871 385464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 386696 385911 gene locus_tag LOCUS_16210 386696 385911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 387782 386703 gene locus_tag LOCUS_16220 gene pheA 387782 386703 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_16220 388159 388692 gene locus_tag LOCUS_16230 388159 388692 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_16230 388676 389389 gene locus_tag LOCUS_16240 388676 389389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 389448 389681 gene locus_tag LOCUS_16250 389448 389681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 390352 389837 gene locus_tag LOCUS_16260 390352 389837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 391005 390361 gene locus_tag LOCUS_16270 391005 390361 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_16270 391959 391015 gene locus_tag LOCUS_16280 391959 391015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 392666 392028 gene locus_tag LOCUS_16290 392666 392028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 393465 392755 gene locus_tag LOCUS_16300 393465 392755 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_16300 394259 393471 gene locus_tag LOCUS_16310 394259 393471 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_16310 395207 394551 gene locus_tag LOCUS_16320 395207 394551 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_16320 395613 395194 gene locus_tag LOCUS_16330 395613 395194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 397958 395613 gene locus_tag LOCUS_16340 397958 395613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 399621 398065 gene locus_tag LOCUS_16350 399621 398065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 400368 399865 gene locus_tag LOCUS_16360 400368 399865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 401162 402520 gene locus_tag LOCUS_16370 401162 402520 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_16370 402531 403592 gene locus_tag LOCUS_16380 402531 403592 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_16380 404731 405042 gene locus_tag LOCUS_16390 404731 405042 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_16390 406990 405140 gene locus_tag LOCUS_16400 gene typA 406990 405140 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_16400 407719 408051 gene locus_tag LOCUS_16410 407719 408051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 408061 408291 gene locus_tag LOCUS_16420 408061 408291 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_16420 408939 408424 gene locus_tag LOCUS_16430 408939 408424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 410876 409920 gene locus_tag LOCUS_16440 410876 409920 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_16440 411766 410873 gene locus_tag LOCUS_16450 411766 410873 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_16450 412902 411814 gene locus_tag LOCUS_16460 412902 411814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 414004 412970 gene locus_tag LOCUS_16470 414004 412970 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_16470 415584 413974 gene locus_tag LOCUS_16480 415584 413974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 417423 415867 gene locus_tag LOCUS_16490 417423 415867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 417844 417599 gene locus_tag LOCUS_16500 417844 417599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 418925 418692 gene locus_tag LOCUS_16510 418925 418692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 419516 420145 gene locus_tag LOCUS_16520 419516 420145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 422864 420657 gene locus_tag LOCUS_16530 422864 420657 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_16530 423452 424324 gene locus_tag LOCUS_16540 423452 424324 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_16540 426388 424853 gene locus_tag LOCUS_16550 426388 424853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 427413 428777 gene locus_tag LOCUS_16560 gene bioA 427413 428777 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_16560 428805 429518 gene locus_tag LOCUS_16570 gene bioD 428805 429518 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_16570 429567 430511 gene locus_tag LOCUS_16580 429567 430511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 431028 432359 gene locus_tag LOCUS_16590 gene thiC 431028 432359 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_16590 432578 434188 gene locus_tag LOCUS_16600 432578 434188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 434237 435238 gene locus_tag LOCUS_16610 434237 435238 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_16610 435758 436000 gene locus_tag LOCUS_16620 435758 436000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 436090 437400 gene locus_tag LOCUS_16630 436090 437400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16630 438110 437490 gene locus_tag LOCUS_16640 438110 437490 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_16640 438484 441990 gene locus_tag LOCUS_16650 438484 441990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 442767 442396 gene locus_tag LOCUS_16660 442767 442396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 443200 442778 gene locus_tag LOCUS_16670 443200 442778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 444539 444467 gene locus_tag LOCUS_t00180 444539 444467 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 445439 444663 gene locus_tag LOCUS_16680 445439 444663 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_16680 446343 445423 gene locus_tag LOCUS_16690 446343 445423 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496573.1 protein_id gnl|my_center|LOCUS_16690 447085 446345 gene locus_tag LOCUS_16700 447085 446345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 447981 447217 gene locus_tag LOCUS_16710 447981 447217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 448237 448164 gene locus_tag LOCUS_t00190 448237 448164 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 449102 448239 gene locus_tag LOCUS_16720 449102 448239 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_16720 450724 449468 gene locus_tag LOCUS_16730 450724 449468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 451695 450994 gene locus_tag LOCUS_16740 451695 450994 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811443.1 protein_id gnl|my_center|LOCUS_16740 453591 451903 gene locus_tag LOCUS_16750 453591 451903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 454327 453827 gene locus_tag LOCUS_16760 454327 453827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 454708 456705 gene locus_tag LOCUS_16770 454708 456705 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107187.1 protein_id gnl|my_center|LOCUS_16770 457169 456849 gene locus_tag LOCUS_16780 457169 456849 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_16780 457761 459110 gene locus_tag LOCUS_16790 457761 459110 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947936.1 protein_id gnl|my_center|LOCUS_16790 460483 459470 gene locus_tag LOCUS_16800 460483 459470 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_16800 460713 461711 gene locus_tag LOCUS_16810 460713 461711 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_16810 461785 463437 gene locus_tag LOCUS_16820 461785 463437 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225695.1 protein_id gnl|my_center|LOCUS_16820 466210 463634 gene locus_tag LOCUS_16830 466210 463634 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_16830 468056 466215 gene locus_tag LOCUS_16840 468056 466215 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_16840 468916 468233 gene locus_tag LOCUS_16850 468916 468233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 470336 468918 gene locus_tag LOCUS_16860 gene pyk 470336 468918 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_16860 470732 470493 gene locus_tag LOCUS_16870 470732 470493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 471557 470859 gene locus_tag LOCUS_16880 gene radC 471557 470859 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_16880 471854 472405 gene locus_tag LOCUS_16890 471854 472405 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021943.1 protein_id gnl|my_center|LOCUS_16890 472428 472730 gene locus_tag LOCUS_16900 472428 472730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 473486 475174 gene locus_tag LOCUS_16910 473486 475174 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_16910 475207 476112 gene locus_tag LOCUS_16920 gene xerD 475207 476112 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_16920 478001 477087 gene locus_tag LOCUS_16930 478001 477087 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 479192 481033 gene locus_tag LOCUS_16940 479192 481033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 481027 481281 gene locus_tag LOCUS_16950 481027 481281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 481649 482536 gene locus_tag LOCUS_16960 481649 482536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 482880 482665 gene locus_tag LOCUS_16970 482880 482665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 482774 483454 gene locus_tag LOCUS_16980 482774 483454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 483458 484189 gene locus_tag LOCUS_16990 483458 484189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 484591 484734 gene locus_tag LOCUS_17000 484591 484734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 484785 484958 gene locus_tag LOCUS_17010 484785 484958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 485209 485475 gene locus_tag LOCUS_17020 485209 485475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 485964 486149 gene locus_tag LOCUS_17030 485964 486149 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_17030 486136 486399 gene locus_tag LOCUS_17040 486136 486399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 487667 486522 gene locus_tag LOCUS_17050 487667 486522 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_17050 488060 488248 gene locus_tag LOCUS_17060 488060 488248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 488833 488958 gene locus_tag LOCUS_17070 488833 488958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 490366 489275 gene locus_tag LOCUS_17080 490366 489275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 491420 491022 gene locus_tag LOCUS_17090 491420 491022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 491979 491581 gene locus_tag LOCUS_17100 491979 491581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 493169 492006 gene locus_tag LOCUS_17110 gene nirF 493169 492006 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_17110 494245 493157 gene locus_tag LOCUS_17120 gene nirJ 494245 493157 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_17120 495938 494229 gene locus_tag LOCUS_17130 gene nirN 495938 494229 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_17130 496363 495938 gene locus_tag LOCUS_17140 496363 495938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 498299 496434 gene locus_tag LOCUS_17150 gene nirS 498299 496434 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_17150 499400 499729 gene locus_tag LOCUS_17160 499400 499729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 500194 500433 gene locus_tag LOCUS_17170 500194 500433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 500702 500980 gene locus_tag LOCUS_17180 500702 500980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 501045 501437 gene locus_tag LOCUS_17190 501045 501437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 501734 503998 gene locus_tag LOCUS_17200 501734 503998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 504696 504127 gene locus_tag LOCUS_17210 504696 504127 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_17210 507367 505379 gene locus_tag LOCUS_17220 507367 505379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 508236 507364 gene locus_tag LOCUS_17230 508236 507364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 509075 508233 gene locus_tag LOCUS_17240 509075 508233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 509862 511175 gene locus_tag LOCUS_17250 509862 511175 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_17250 513434 514909 gene locus_tag LOCUS_17260 513434 514909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 516182 517039 gene locus_tag LOCUS_17270 516182 517039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 517915 517181 gene locus_tag LOCUS_17280 517915 517181 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_17280 519284 518082 gene locus_tag LOCUS_17290 519284 518082 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_17290 520079 519450 gene locus_tag LOCUS_17300 520079 519450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 520475 522838 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattccttataggtgcaatgagac 523419 523153 gene locus_tag LOCUS_17310 gene cas2 523419 523153 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_17310 523622 523422 gene locus_tag LOCUS_17320 523622 523422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 524512 523616 gene locus_tag LOCUS_17330 gene cas1b 524512 523616 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_17330 524824 524540 gene locus_tag LOCUS_17340 524824 524540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 526096 524837 gene locus_tag LOCUS_17350 526096 524837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 526928 526416 gene locus_tag LOCUS_17360 gene cas4 526928 526416 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_17360 527331 526942 gene locus_tag LOCUS_17370 527331 526942 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_17370 527555 527328 gene locus_tag LOCUS_17380 527555 527328 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932024.1 protein_id gnl|my_center|LOCUS_17380 528708 527947 gene locus_tag LOCUS_17390 528708 527947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255976.1 protein_id gnl|my_center|LOCUS_17390 529693 528710 gene locus_tag LOCUS_17400 529693 528710 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255977.1 protein_id gnl|my_center|LOCUS_17400 531402 529696 gene locus_tag LOCUS_17410 531402 529696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 533825 531399 gene locus_tag LOCUS_17420 533825 531399 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255980.1 protein_id gnl|my_center|LOCUS_17420 534661 533822 gene locus_tag LOCUS_17430 534661 533822 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963647.1 protein_id gnl|my_center|LOCUS_17430 535458 534661 gene locus_tag LOCUS_17440 535458 534661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963648.1 protein_id gnl|my_center|LOCUS_17440 536109 535861 gene locus_tag LOCUS_17450 536109 535861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 537220 536213 gene locus_tag LOCUS_17460 gene cas6 537220 536213 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496476.1 protein_id gnl|my_center|LOCUS_17460 537933 538955 gene locus_tag LOCUS_17470 537933 538955 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_17470 538957 539475 gene locus_tag LOCUS_17480 538957 539475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 539648 539854 gene locus_tag LOCUS_17490 539648 539854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 539851 540030 gene locus_tag LOCUS_17500 539851 540030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 540087 541268 gene locus_tag LOCUS_17510 540087 541268 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_17510 542457 541594 gene locus_tag LOCUS_17520 542457 541594 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692612.1 protein_id gnl|my_center|LOCUS_17520 543175 542504 gene locus_tag LOCUS_17530 gene mntB 543175 542504 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_17530 543714 543247 gene locus_tag LOCUS_17540 543714 543247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 545422 544496 gene locus_tag LOCUS_17550 545422 544496 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_17550 547177 545537 gene locus_tag LOCUS_17560 547177 545537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_17560 548227 550008 gene locus_tag LOCUS_17570 548227 550008 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 protein_id gnl|my_center|LOCUS_17570 550749 552011 gene locus_tag LOCUS_17580 550749 552011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 552889 553095 gene locus_tag LOCUS_17590 552889 553095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 553160 553813 gene locus_tag LOCUS_17600 553160 553813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 553813 554628 gene locus_tag LOCUS_17610 553813 554628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 554621 555370 gene locus_tag LOCUS_17620 554621 555370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256161.1 protein_id gnl|my_center|LOCUS_17620 555612 556166 gene locus_tag LOCUS_17630 555612 556166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 556529 557884 gene locus_tag LOCUS_17640 556529 557884 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_17640 558881 563011 gene locus_tag LOCUS_17650 558881 563011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 563430 564434 gene locus_tag LOCUS_17660 563430 564434 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_17660 565002 565421 gene locus_tag LOCUS_17670 565002 565421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 567048 565711 gene locus_tag LOCUS_17680 567048 565711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 567679 568962 gene locus_tag LOCUS_17690 567679 568962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 569163 570536 gene locus_tag LOCUS_17700 569163 570536 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_17700 571419 572378 gene locus_tag LOCUS_17710 571419 572378 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_17710 572700 573719 gene locus_tag LOCUS_17720 572700 573719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 578713 573992 gene locus_tag LOCUS_17730 578713 573992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 579918 579670 gene locus_tag LOCUS_17740 579918 579670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 581202 582425 gene locus_tag LOCUS_17750 581202 582425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 583574 582564 gene locus_tag LOCUS_17760 583574 582564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 584065 583631 gene locus_tag LOCUS_17770 584065 583631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 585654 584077 gene locus_tag LOCUS_17780 585654 584077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 587067 586393 gene locus_tag LOCUS_17790 587067 586393 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_17790 588454 587273 gene locus_tag LOCUS_17800 588454 587273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 589859 589626 gene locus_tag LOCUS_17810 589859 589626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 591622 591389 gene locus_tag LOCUS_17820 591622 591389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 593363 591651 gene locus_tag LOCUS_17830 593363 591651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 597255 593563 gene locus_tag LOCUS_17840 597255 593563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 600911 597891 gene locus_tag LOCUS_17850 600911 597891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 602443 601373 gene locus_tag LOCUS_17860 602443 601373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 603793 603266 gene locus_tag LOCUS_17870 603793 603266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 605923 604247 gene locus_tag LOCUS_17880 605923 604247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 606128 605823 gene locus_tag LOCUS_17890 606128 605823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 606300 606085 gene locus_tag LOCUS_17900 606300 606085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 607376 606219 gene locus_tag LOCUS_17910 607376 606219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17910 608552 608337 gene locus_tag LOCUS_17920 608552 608337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 609226 609032 gene locus_tag LOCUS_17930 609226 609032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 609711 609430 gene locus_tag LOCUS_17940 609711 609430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 609907 609767 gene locus_tag LOCUS_17950 609907 609767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 612536 612814 gene locus_tag LOCUS_17960 612536 612814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 612837 613262 gene locus_tag LOCUS_17970 612837 613262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 613348 613593 gene locus_tag LOCUS_17980 613348 613593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 613593 614255 gene locus_tag LOCUS_17990 613593 614255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17990 614252 614545 gene locus_tag LOCUS_18000 614252 614545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18000 614607 614918 gene locus_tag LOCUS_18010 614607 614918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 615063 615356 gene locus_tag LOCUS_18020 615063 615356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 615950 615534 gene locus_tag LOCUS_18030 615950 615534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 618018 616684 gene locus_tag LOCUS_18040 618018 616684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_18040 618316 618098 gene locus_tag LOCUS_18050 618316 618098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 619297 618410 gene locus_tag LOCUS_18060 619297 618410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_18060 620173 619367 gene locus_tag LOCUS_18070 620173 619367 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_18070 621974 620679 gene locus_tag LOCUS_18080 621974 620679 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_18080 622534 621971 gene locus_tag LOCUS_18090 gene rfbC 622534 621971 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_18090 623896 622664 gene locus_tag LOCUS_18100 623896 622664 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_18100 624975 623893 gene locus_tag LOCUS_18110 gene rfbG 624975 623893 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_18110 625742 624969 gene locus_tag LOCUS_18120 gene rfbF 625742 624969 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_18120 629625 627532 gene locus_tag LOCUS_18130 629625 627532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 636796 630578 gene locus_tag LOCUS_18140 636796 630578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 637475 638440 gene locus_tag LOCUS_18150 637475 638440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 639768 638632 gene locus_tag LOCUS_18160 639768 638632 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261146.1 protein_id gnl|my_center|LOCUS_18160 640254 639880 gene locus_tag LOCUS_18170 640254 639880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 641342 640311 gene locus_tag LOCUS_18180 641342 640311 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_18180 642260 641655 gene locus_tag LOCUS_18190 642260 641655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 644472 643354 gene locus_tag LOCUS_18200 644472 643354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 644993 644826 gene locus_tag LOCUS_18210 644993 644826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 645519 644950 gene locus_tag LOCUS_18220 645519 644950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 645914 645600 gene locus_tag LOCUS_18230 645914 645600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 646866 646447 gene locus_tag LOCUS_18240 646866 646447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 647435 646968 gene locus_tag LOCUS_18250 647435 646968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 648006 647932 gene locus_tag LOCUS_t00200 648006 647932 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 648834 648016 gene locus_tag LOCUS_18260 gene accD 648834 648016 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_18260 649901 649203 gene locus_tag LOCUS_18270 gene rpe 649901 649203 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_18270 651156 649963 gene locus_tag LOCUS_18280 651156 649963 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_18280 652332 651331 gene locus_tag LOCUS_18290 gene gap 652332 651331 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_18290 652697 652530 gene locus_tag LOCUS_18300 652697 652530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 653173 653799 gene locus_tag LOCUS_18310 653173 653799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 655273 653861 gene locus_tag LOCUS_18320 655273 653861 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_18320 657257 655452 gene locus_tag LOCUS_18330 657257 655452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 658058 659140 gene locus_tag LOCUS_18340 gene waaF 658058 659140 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_18340 660193 659237 gene locus_tag LOCUS_18350 660193 659237 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_18350 660972 660409 gene locus_tag LOCUS_18360 gene rfbC 660972 660409 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_18360 661852 660962 gene locus_tag LOCUS_18370 gene rfbA 661852 660962 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_18370 662155 662511 gene locus_tag LOCUS_18380 662155 662511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 662649 665300 gene locus_tag LOCUS_18390 662649 665300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 666682 665552 gene locus_tag LOCUS_18400 gene gmd 666682 665552 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_18400 667016 667513 gene locus_tag LOCUS_18410 667016 667513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 668999 667617 gene locus_tag LOCUS_18420 668999 667617 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_18420 670502 669012 gene locus_tag LOCUS_18430 670502 669012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 672031 670499 gene locus_tag LOCUS_18440 672031 670499 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_18440 672624 672424 gene locus_tag LOCUS_18450 672624 672424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 673562 672753 gene locus_tag LOCUS_18460 673562 672753 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_18460 673970 675655 gene locus_tag LOCUS_18470 gene hutU 673970 675655 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_18470 676324 676692 gene locus_tag LOCUS_18480 676324 676692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 677302 677523 gene locus_tag LOCUS_18490 677302 677523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 677520 678281 gene locus_tag LOCUS_18500 677520 678281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928717.1 protein_id gnl|my_center|LOCUS_18500 678423 678770 gene locus_tag LOCUS_18510 678423 678770 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928718.1 protein_id gnl|my_center|LOCUS_18510 678770 679393 gene locus_tag LOCUS_18520 678770 679393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 679496 679786 gene locus_tag LOCUS_18530 679496 679786 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_18530 679779 680150 gene locus_tag LOCUS_18540 679779 680150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 680398 681126 gene locus_tag LOCUS_18550 680398 681126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 681114 682352 gene locus_tag LOCUS_18560 681114 682352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 682633 682935 gene locus_tag LOCUS_18570 682633 682935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 683149 683454 gene locus_tag LOCUS_18580 683149 683454 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_18580 683444 683794 gene locus_tag LOCUS_18590 683444 683794 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_18590 683791 683994 gene locus_tag LOCUS_18600 683791 683994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 684035 684361 gene locus_tag LOCUS_18610 684035 684361 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_18610 684364 686424 gene locus_tag LOCUS_18620 gene recG 684364 686424 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_18620 686727 687932 gene locus_tag LOCUS_18630 686727 687932 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_18630 688051 688773 gene locus_tag LOCUS_18640 688051 688773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_18640 689705 691567 gene locus_tag LOCUS_18650 gene ftsH 689705 691567 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528329.1 protein_id gnl|my_center|LOCUS_18650 691695 692750 gene locus_tag LOCUS_18660 691695 692750 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_18660 694969 693158 gene locus_tag LOCUS_18670 694969 693158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 696099 694957 gene locus_tag LOCUS_18680 696099 694957 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_18680 697103 696102 gene locus_tag LOCUS_18690 gene ispG 697103 696102 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_18690 698424 698086 gene locus_tag LOCUS_18700 698424 698086 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_18700 698770 698414 gene locus_tag LOCUS_18710 698770 698414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 699135 698950 gene locus_tag LOCUS_18720 699135 698950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 699932 699705 gene locus_tag LOCUS_18730 699932 699705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 702258 700519 gene locus_tag LOCUS_18740 702258 700519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 705938 702879 gene locus_tag LOCUS_18750 705938 702879 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_18750 706785 707618 gene locus_tag LOCUS_18760 gene dapF 706785 707618 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_18760 707724 708614 gene locus_tag LOCUS_18770 707724 708614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 709165 708611 gene locus_tag LOCUS_18780 gene rpiB 709165 708611 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_18780 709748 709116 gene locus_tag LOCUS_18790 709748 709116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 710458 712170 gene locus_tag LOCUS_18800 710458 712170 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_18800 712175 714415 gene locus_tag LOCUS_18810 712175 714415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 714491 714568 gene locus_tag LOCUS_t00210 714491 714568 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 714689 716245 gene locus_tag LOCUS_18820 714689 716245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 716603 716367 gene locus_tag LOCUS_18830 716603 716367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 716917 717282 gene locus_tag LOCUS_18840 716917 717282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 717908 718582 gene locus_tag LOCUS_18850 717908 718582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 718892 723694 gene locus_tag LOCUS_18860 718892 723694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 724024 724239 gene locus_tag LOCUS_18870 724024 724239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 724217 724630 gene locus_tag LOCUS_18880 724217 724630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 724731 726857 gene locus_tag LOCUS_18890 724731 726857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 727410 727126 gene locus_tag LOCUS_18900 gene rpsT 727410 727126 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_18900 727753 730074 gene locus_tag LOCUS_18910 gene topA 727753 730074 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_18910 730242 730610 gene locus_tag LOCUS_18920 730242 730610 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_18920 731290 731544 gene locus_tag LOCUS_18930 731290 731544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 731812 732081 gene locus_tag LOCUS_18940 731812 732081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 732459 732791 gene locus_tag LOCUS_18950 732459 732791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 733174 733332 gene locus_tag LOCUS_18960 733174 733332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 733378 733632 gene locus_tag LOCUS_18970 733378 733632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 733714 734103 gene locus_tag LOCUS_18980 733714 734103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 734411 734617 gene locus_tag LOCUS_18990 734411 734617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18990 734614 735207 gene locus_tag LOCUS_19000 734614 735207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 735457 735807 gene locus_tag LOCUS_19010 735457 735807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19010 735801 736100 gene locus_tag LOCUS_19020 735801 736100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19020 736311 736502 gene locus_tag LOCUS_19030 736311 736502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 736492 737064 gene locus_tag LOCUS_19040 736492 737064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 737231 737734 gene locus_tag LOCUS_19050 gene purE 737231 737734 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_19050 737982 738755 gene locus_tag LOCUS_19060 737982 738755 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_19060 738955 740916 gene locus_tag LOCUS_19070 gene cooS 738955 740916 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_19070 740946 743129 gene locus_tag LOCUS_19080 gene acsB 740946 743129 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_19080 743496 744122 gene locus_tag LOCUS_19090 743496 744122 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 protein_id gnl|my_center|LOCUS_19090 744967 746307 gene locus_tag LOCUS_19100 gene acsC 744967 746307 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_19100 746538 748472 gene locus_tag LOCUS_19110 746538 748472 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_19110 748487 749257 gene locus_tag LOCUS_19120 748487 749257 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_19120 749443 750399 gene locus_tag LOCUS_19130 gene cdhD 749443 750399 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_19130 750431 751216 gene locus_tag LOCUS_19140 750431 751216 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_19140 751779 752192 gene locus_tag LOCUS_19150 751779 752192 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_19150 752691 753641 gene locus_tag LOCUS_19160 752691 753641 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938291.1 protein_id gnl|my_center|LOCUS_19160 754159 755109 gene locus_tag LOCUS_19170 754159 755109 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_19170 755929 757917 gene locus_tag LOCUS_19180 755929 757917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 758083 759438 gene locus_tag LOCUS_19190 gene trkA 758083 759438 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_19190 759472 760956 gene locus_tag LOCUS_19200 759472 760956 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_19200 761269 761345 gene locus_tag LOCUS_t00220 761269 761345 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 761427 761726 gene locus_tag LOCUS_19210 761427 761726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 761736 762014 gene locus_tag LOCUS_19220 761736 762014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 762773 763270 gene locus_tag LOCUS_19230 762773 763270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 763503 764084 gene locus_tag LOCUS_19240 763503 764084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 764271 764786 gene locus_tag LOCUS_19250 764271 764786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 765024 765506 gene locus_tag LOCUS_19260 765024 765506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 766428 766811 gene locus_tag LOCUS_19270 766428 766811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 767333 767716 gene locus_tag LOCUS_19280 767333 767716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 768784 773475 gene locus_tag LOCUS_19290 768784 773475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 773994 774122 gene locus_tag LOCUS_19300 773994 774122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 774119 774370 gene locus_tag LOCUS_19310 774119 774370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 774831 775448 gene locus_tag LOCUS_19320 gene phoU 774831 775448 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_19320 775517 775744 gene locus_tag LOCUS_19330 775517 775744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 775741 775965 gene locus_tag LOCUS_19340 775741 775965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 776199 776489 gene locus_tag LOCUS_19350 776199 776489 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_19350 778069 778950 gene locus_tag LOCUS_19360 778069 778950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 779824 779024 gene locus_tag LOCUS_19370 gene murI 779824 779024 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_19370 780157 780465 gene locus_tag LOCUS_19380 780157 780465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 780991 781251 gene locus_tag LOCUS_19390 780991 781251 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_19390 781481 782815 gene locus_tag LOCUS_19400 781481 782815 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_19400 783003 783941 gene locus_tag LOCUS_19410 gene arcC 783003 783941 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_19410 786093 787004 gene locus_tag LOCUS_19420 786093 787004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 788149 787172 gene locus_tag LOCUS_19430 788149 787172 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_19430 789658 788402 gene locus_tag LOCUS_19440 789658 788402 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_19440 790163 789624 gene locus_tag LOCUS_19450 790163 789624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 791431 790139 gene locus_tag LOCUS_19460 gene eno 791431 790139 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_19460 792009 792332 gene locus_tag LOCUS_19470 792009 792332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 792543 793745 gene locus_tag LOCUS_19480 792543 793745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 794815 794459 gene locus_tag LOCUS_19490 794815 794459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 794960 794781 gene locus_tag LOCUS_19500 794960 794781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 795499 794936 gene locus_tag LOCUS_19510 795499 794936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 796215 795541 gene locus_tag LOCUS_19520 796215 795541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 796744 796238 gene locus_tag LOCUS_19530 796744 796238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 796926 796741 gene locus_tag LOCUS_19540 796926 796741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 797450 797022 gene locus_tag LOCUS_19550 797450 797022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 797718 797464 gene locus_tag LOCUS_19560 797718 797464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 798008 797712 gene locus_tag LOCUS_19570 798008 797712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 798949 798731 gene locus_tag LOCUS_19580 798949 798731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 799199 798960 gene locus_tag LOCUS_19590 799199 798960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 799551 799393 gene locus_tag LOCUS_19600 799551 799393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 799855 799568 gene locus_tag LOCUS_19610 799855 799568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19610 800036 799812 gene locus_tag LOCUS_19620 800036 799812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 800652 800221 gene locus_tag LOCUS_19630 800652 800221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 801283 801047 gene locus_tag LOCUS_19640 801283 801047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 802596 801823 gene locus_tag LOCUS_19650 802596 801823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 803210 802656 gene locus_tag LOCUS_19660 803210 802656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 803711 803238 gene locus_tag LOCUS_19670 803711 803238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 804251 803868 gene locus_tag LOCUS_19680 804251 803868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19680 804683 804513 gene locus_tag LOCUS_19690 804683 804513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 805206 804928 gene locus_tag LOCUS_19700 805206 804928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 805446 805225 gene locus_tag LOCUS_19710 805446 805225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 805833 805684 gene locus_tag LOCUS_19720 805833 805684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 805891 806328 gene locus_tag LOCUS_19730 805891 806328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 806488 806291 gene locus_tag LOCUS_19740 806488 806291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 806939 806661 gene locus_tag LOCUS_19750 806939 806661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 807171 806926 gene locus_tag LOCUS_19760 807171 806926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 807353 807532 gene locus_tag LOCUS_19770 807353 807532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 808625 808110 gene locus_tag LOCUS_19780 808625 808110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 809322 808630 gene locus_tag LOCUS_19790 809322 808630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 809517 809329 gene locus_tag LOCUS_19800 809517 809329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 810124 809615 gene locus_tag LOCUS_19810 810124 809615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 810584 810072 gene locus_tag LOCUS_19820 810584 810072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 811181 810825 gene locus_tag LOCUS_19830 811181 810825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 811544 811212 gene locus_tag LOCUS_19840 811544 811212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19840 811801 811592 gene locus_tag LOCUS_19850 811801 811592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 812472 812254 gene locus_tag LOCUS_19860 812472 812254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 812681 812472 gene locus_tag LOCUS_19870 812681 812472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 814360 814136 gene locus_tag LOCUS_19880 814360 814136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 814710 814519 gene locus_tag LOCUS_19890 814710 814519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 815388 815224 gene locus_tag LOCUS_19900 815388 815224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 817714 816386 gene locus_tag LOCUS_19910 817714 816386 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_19910 818109 820334 gene locus_tag LOCUS_19920 gene greA 818109 820334 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064092.1 protein_id gnl|my_center|LOCUS_19920 821104 821301 gene locus_tag LOCUS_19930 821104 821301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 823921 822188 gene locus_tag LOCUS_19940 823921 822188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 826389 824242 gene locus_tag LOCUS_19950 826389 824242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 828000 826477 gene locus_tag LOCUS_19960 828000 826477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 829874 828246 gene locus_tag LOCUS_19970 829874 828246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 833297 829887 gene locus_tag LOCUS_19980 833297 829887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 833586 834053 gene locus_tag LOCUS_19990 gene ruvC 833586 834053 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_19990 834211 835107 gene locus_tag LOCUS_20000 834211 835107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 835926 835213 gene locus_tag LOCUS_20010 gene lolA 835926 835213 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946715.1 protein_id gnl|my_center|LOCUS_20010 836518 835907 gene locus_tag LOCUS_20020 836518 835907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 837355 838458 gene locus_tag LOCUS_20030 837355 838458 CDS product IS4-like element IS421 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300563.1 protein_id gnl|my_center|LOCUS_20030 846676 838895 gene locus_tag LOCUS_20040 846676 838895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 849971 846690 gene locus_tag LOCUS_20050 849971 846690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 851646 850177 gene locus_tag LOCUS_20060 851646 850177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 851762 851950 gene locus_tag LOCUS_20070 851762 851950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 853168 854577 gene locus_tag LOCUS_20080 853168 854577 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_20080 854617 856152 gene locus_tag LOCUS_20090 854617 856152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 856142 856522 gene locus_tag LOCUS_20100 856142 856522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 856672 857610 gene locus_tag LOCUS_20110 856672 857610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 857874 859709 gene locus_tag LOCUS_20120 857874 859709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 860147 859908 gene locus_tag LOCUS_20130 860147 859908 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_20130 860437 860144 gene locus_tag LOCUS_20140 860437 860144 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_20140 861016 861927 gene locus_tag LOCUS_20150 861016 861927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 861958 863280 gene locus_tag LOCUS_20160 861958 863280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 863322 864692 gene locus_tag LOCUS_20170 gene atoC 863322 864692 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_20170 865129 865506 gene locus_tag LOCUS_20180 gene flgB 865129 865506 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081560.1 protein_id gnl|my_center|LOCUS_20180 865518 865961 gene locus_tag LOCUS_20190 gene flgC 865518 865961 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_20190 865972 866271 gene locus_tag LOCUS_20200 865972 866271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 866638 866405 gene locus_tag LOCUS_20210 866638 866405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 867615 866887 gene locus_tag LOCUS_20220 gene thyX 867615 866887 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_20220 868218 867691 gene locus_tag LOCUS_20230 gene cobO 868218 867691 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_20230 868627 868454 gene locus_tag LOCUS_20240 868627 868454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 869104 868631 gene locus_tag LOCUS_20250 869104 868631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 869426 869217 gene locus_tag LOCUS_20260 869426 869217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 870097 869423 gene locus_tag LOCUS_20270 870097 869423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20270 873795 870346 gene locus_tag LOCUS_20280 873795 870346 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_20280 874263 874460 gene locus_tag LOCUS_20290 874263 874460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 874531 874752 gene locus_tag LOCUS_20300 874531 874752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 874827 875033 gene locus_tag LOCUS_20310 874827 875033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 875050 876510 gene locus_tag LOCUS_20320 gene gcvPB 875050 876510 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_20320 877470 876958 gene locus_tag LOCUS_20330 877470 876958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 879351 877774 gene locus_tag LOCUS_20340 879351 877774 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546886.1 protein_id gnl|my_center|LOCUS_20340 880133 879423 gene locus_tag LOCUS_20350 880133 879423 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190719.1 protein_id gnl|my_center|LOCUS_20350 880701 880294 gene locus_tag LOCUS_20360 880701 880294 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_20360 882321 880975 gene locus_tag LOCUS_20370 882321 880975 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_20370 883425 882340 gene locus_tag LOCUS_20380 883425 882340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20380 883897 885285 gene locus_tag LOCUS_20390 gene gltX 883897 885285 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444383.1 protein_id gnl|my_center|LOCUS_20390 885482 886045 gene locus_tag LOCUS_20400 gene thpR 885482 886045 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_20400 886143 887237 gene locus_tag LOCUS_20410 gene recA 886143 887237 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388318.1 protein_id gnl|my_center|LOCUS_20410 887241 889898 gene locus_tag LOCUS_20420 gene alaS 887241 889898 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_20420 890552 891568 gene locus_tag LOCUS_20430 gene plsX 890552 891568 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_20430 891608 892603 gene locus_tag LOCUS_20440 891608 892603 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_20440 892610 893530 gene locus_tag LOCUS_20450 gene fabD 892610 893530 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_20450 893575 893808 gene locus_tag LOCUS_20460 893575 893808 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_20460 893809 895053 gene locus_tag LOCUS_20470 gene fabF 893809 895053 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_20470 895409 896416 gene locus_tag LOCUS_20480 gene lpxD 895409 896416 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_20480 896437 898263 gene locus_tag LOCUS_20490 gene glmS 896437 898263 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_20490 898939 898307 gene locus_tag LOCUS_20500 898939 898307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 899192 901285 gene locus_tag LOCUS_20510 899192 901285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 901780 902391 gene locus_tag LOCUS_20520 gene cysC 901780 902391 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_20520 902526 903521 gene locus_tag LOCUS_20530 902526 903521 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_20530 904845 903571 gene locus_tag LOCUS_20540 904845 903571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 905825 905268 gene locus_tag LOCUS_20550 905825 905268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 906519 907310 gene locus_tag LOCUS_20560 906519 907310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 907303 908865 gene locus_tag LOCUS_20570 gene metG 907303 908865 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_20570 908883 909704 gene locus_tag LOCUS_20580 908883 909704 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20580 909813 909900 gene locus_tag LOCUS_t00230 909813 909900 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 911784 910117 gene locus_tag LOCUS_20590 911784 910117 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 protein_id gnl|my_center|LOCUS_20590 912623 912060 gene locus_tag LOCUS_20600 gene folE 912623 912060 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_20600 913504 912635 gene locus_tag LOCUS_20610 gene dapA 913504 912635 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_20610 914384 913635 gene locus_tag LOCUS_20620 914384 913635 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_20620 915391 914381 gene locus_tag LOCUS_20630 915391 914381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 916215 915394 gene locus_tag LOCUS_20640 gene cdaA 916215 915394 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_20640 917092 916208 gene locus_tag LOCUS_20650 gene folP 917092 916208 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_20650 917758 917294 gene locus_tag LOCUS_20660 917758 917294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 918791 917865 gene locus_tag LOCUS_20670 918791 917865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 919561 918788 gene locus_tag LOCUS_20680 gene recO 919561 918788 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545948.1 protein_id gnl|my_center|LOCUS_20680 920011 919577 gene locus_tag LOCUS_20690 gene ybeY 920011 919577 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_20690 921071 920079 gene locus_tag LOCUS_20700 921071 920079 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_20700 921919 921074 gene locus_tag LOCUS_20710 921919 921074 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_20710 922632 921916 gene locus_tag LOCUS_20720 922632 921916 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_20720 923909 922629 gene locus_tag LOCUS_20730 923909 922629 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_20730 924416 924739 gene locus_tag LOCUS_20740 924416 924739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 924764 925417 gene locus_tag LOCUS_20750 924764 925417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 925487 926689 gene locus_tag LOCUS_20760 925487 926689 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671534.1 protein_id gnl|my_center|LOCUS_20760 926829 927188 gene locus_tag LOCUS_20770 926829 927188 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268933.1 protein_id gnl|my_center|LOCUS_20770 927270 927842 gene locus_tag LOCUS_20780 gene ppiB 927270 927842 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256006.1 protein_id gnl|my_center|LOCUS_20780 927959 928216 gene locus_tag LOCUS_20790 927959 928216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 929605 928283 gene locus_tag LOCUS_20800 929605 928283 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_20800 930044 930859 gene locus_tag LOCUS_20810 930044 930859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 931982 931140 gene locus_tag LOCUS_20820 931982 931140 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_20820 933298 931979 gene locus_tag LOCUS_20830 933298 931979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 934358 933507 gene locus_tag LOCUS_20840 934358 933507 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_20840 935860 934370 gene locus_tag LOCUS_20850 935860 934370 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_20850 936681 936935 gene locus_tag LOCUS_20860 936681 936935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 936963 937349 gene locus_tag LOCUS_20870 936963 937349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 938132 938551 gene locus_tag LOCUS_20880 938132 938551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 938877 939131 gene locus_tag LOCUS_20890 938877 939131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 939858 939196 gene locus_tag LOCUS_20900 939858 939196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 940205 940444 gene locus_tag LOCUS_20910 940205 940444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 940795 940445 gene locus_tag LOCUS_20920 940795 940445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 941628 943250 gene locus_tag LOCUS_20930 941628 943250 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169351683.1 protein_id gnl|my_center|LOCUS_20930 943810 945558 gene locus_tag LOCUS_20940 gene kaiC 943810 945558 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_20940 945555 945890 gene locus_tag LOCUS_20950 945555 945890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 946020 946379 gene locus_tag LOCUS_20960 946020 946379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 946376 948355 gene locus_tag LOCUS_20970 946376 948355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 948543 948875 gene locus_tag LOCUS_20980 948543 948875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 949016 949195 gene locus_tag LOCUS_20990 949016 949195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 949347 949670 gene locus_tag LOCUS_21000 949347 949670 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389255.1 protein_id gnl|my_center|LOCUS_21000 950113 950298 gene locus_tag LOCUS_21010 950113 950298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 950422 950946 gene locus_tag LOCUS_21020 950422 950946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 950849 951478 gene locus_tag LOCUS_21030 950849 951478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 951611 951892 gene locus_tag LOCUS_21040 951611 951892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 951801 951983 gene locus_tag LOCUS_21050 951801 951983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 952022 952201 gene locus_tag LOCUS_21060 952022 952201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 952447 952596 gene locus_tag LOCUS_21070 952447 952596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 954412 955065 gene locus_tag LOCUS_21080 954412 955065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 955622 956914 gene locus_tag LOCUS_21090 955622 956914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 956964 957086 gene locus_tag LOCUS_21100 956964 957086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 957297 957620 gene locus_tag LOCUS_21110 957297 957620 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_21110 957959 958246 gene locus_tag LOCUS_21120 957959 958246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 958372 958569 gene locus_tag LOCUS_21130 958372 958569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 958747 959232 gene locus_tag LOCUS_21140 958747 959232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 959257 959667 gene locus_tag LOCUS_21150 959257 959667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 959685 960041 gene locus_tag LOCUS_21160 959685 960041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 960823 961002 gene locus_tag LOCUS_21170 960823 961002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 961126 961386 gene locus_tag LOCUS_21180 961126 961386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 961627 962316 gene locus_tag LOCUS_21190 961627 962316 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_21190 962333 962539 gene locus_tag LOCUS_21200 962333 962539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 962778 964223 gene locus_tag LOCUS_21210 962778 964223 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_21210 965368 965655 gene locus_tag LOCUS_21220 965368 965655 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_21220 966132 966947 gene locus_tag LOCUS_21230 966132 966947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_21230 968093 968689 gene locus_tag LOCUS_21240 968093 968689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 969051 969905 gene locus_tag LOCUS_21250 969051 969905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 969981 970166 gene locus_tag LOCUS_21260 969981 970166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 970298 971074 gene locus_tag LOCUS_21270 970298 971074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 971755 971441 gene locus_tag LOCUS_21280 971755 971441 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_21280 971974 971768 gene locus_tag LOCUS_21290 971974 971768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 973589 972033 gene locus_tag LOCUS_21300 973589 972033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 974151 974885 gene locus_tag LOCUS_21310 974151 974885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 974869 975078 gene locus_tag LOCUS_21320 974869 975078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 976169 975936 gene locus_tag LOCUS_21330 976169 975936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 976711 976550 gene locus_tag LOCUS_21340 976711 976550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 978462 978229 gene locus_tag LOCUS_21350 978462 978229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 978701 978444 gene locus_tag LOCUS_21360 978701 978444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 978779 979108 gene locus_tag LOCUS_21370 978779 979108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 979959 979708 gene locus_tag LOCUS_21380 979959 979708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 980166 979996 gene locus_tag LOCUS_21390 980166 979996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 980780 980499 gene locus_tag LOCUS_21400 980780 980499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 981656 981847 gene locus_tag LOCUS_21410 981656 981847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 981948 982532 gene locus_tag LOCUS_21420 981948 982532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 982702 982887 gene locus_tag LOCUS_21430 982702 982887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 983021 983500 gene locus_tag LOCUS_21440 983021 983500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 983865 984869 gene locus_tag LOCUS_21450 983865 984869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 984903 985082 gene locus_tag LOCUS_21460 984903 985082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 985416 985030 gene locus_tag LOCUS_21470 985416 985030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 986394 986215 gene locus_tag LOCUS_21480 986394 986215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 986686 986372 gene locus_tag LOCUS_21490 986686 986372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21490 986991 986683 gene locus_tag LOCUS_21500 986991 986683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 987755 987946 gene locus_tag LOCUS_21510 987755 987946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 988459 988247 gene locus_tag LOCUS_21520 988459 988247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 988675 988466 gene locus_tag LOCUS_21530 988675 988466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 990131 988917 gene locus_tag LOCUS_21540 990131 988917 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_21540 990893 990162 gene locus_tag LOCUS_21550 990893 990162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 992047 990929 gene locus_tag LOCUS_21560 992047 990929 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 protein_id gnl|my_center|LOCUS_21560 992425 994239 gene locus_tag LOCUS_21570 992425 994239 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_21570 994756 994304 gene locus_tag LOCUS_21580 994756 994304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 995399 995199 gene locus_tag LOCUS_21590 995399 995199 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_21590 995848 996084 gene locus_tag LOCUS_21600 995848 996084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 996756 996217 gene locus_tag LOCUS_21610 gene tsaE 996756 996217 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964341.1 protein_id gnl|my_center|LOCUS_21610 997761 996841 gene locus_tag LOCUS_21620 gene thiL 997761 996841 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_21620 998413 999315 gene locus_tag LOCUS_21630 gene lafA 998413 999315 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_21630 999621 999439 gene locus_tag LOCUS_21640 999621 999439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1003153 999875 gene locus_tag LOCUS_21650 gene mfd 1003153 999875 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_21650 1003331 1003510 gene locus_tag LOCUS_21660 1003331 1003510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1003482 1004900 gene locus_tag LOCUS_21670 gene xdhA 1003482 1004900 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 protein_id gnl|my_center|LOCUS_21670 1004887 1007169 gene locus_tag LOCUS_21680 gene xdhB 1004887 1007169 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185657.1 protein_id gnl|my_center|LOCUS_21680 1007195 1007518 gene locus_tag LOCUS_21690 1007195 1007518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1008466 1007660 gene locus_tag LOCUS_21700 gene fetB 1008466 1007660 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_21700 1009215 1008463 gene locus_tag LOCUS_21710 1009215 1008463 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_21710 1010145 1009963 gene locus_tag LOCUS_21720 1010145 1009963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1010820 1010245 gene locus_tag LOCUS_21730 1010820 1010245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21730 1011401 1011207 gene locus_tag LOCUS_21740 1011401 1011207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1011748 1011398 gene locus_tag LOCUS_21750 1011748 1011398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1012015 1011755 gene locus_tag LOCUS_21760 1012015 1011755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1012251 1012021 gene locus_tag LOCUS_21770 1012251 1012021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1012949 1012245 gene locus_tag LOCUS_21780 1012949 1012245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 1016539 1013789 gene locus_tag LOCUS_21790 1016539 1013789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1017033 1017488 gene locus_tag LOCUS_21800 1017033 1017488 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_21800 1017620 1018882 gene locus_tag LOCUS_21810 1017620 1018882 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_21810 1019398 1021161 gene locus_tag LOCUS_21820 1019398 1021161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1021249 1021779 gene locus_tag LOCUS_21830 1021249 1021779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21830 1021807 1022094 gene locus_tag LOCUS_21840 1021807 1022094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21840 1022316 1025372 gene locus_tag LOCUS_21850 1022316 1025372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1025383 1026789 gene locus_tag LOCUS_21860 1025383 1026789 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_21860 1027422 1027637 gene locus_tag LOCUS_21870 1027422 1027637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21870 1027674 1027892 gene locus_tag LOCUS_21880 1027674 1027892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1027938 1028984 gene locus_tag LOCUS_21890 1027938 1028984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1028981 1029727 gene locus_tag LOCUS_21900 1028981 1029727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1029778 1030209 gene locus_tag LOCUS_21910 1029778 1030209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1030565 1031467 gene locus_tag LOCUS_21920 1030565 1031467 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948640.1 protein_id gnl|my_center|LOCUS_21920 1033183 1031990 gene locus_tag LOCUS_21930 1033183 1031990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1033773 1033183 gene locus_tag LOCUS_21940 gene hisB 1033773 1033183 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_21940 1037065 1034063 gene locus_tag LOCUS_21950 1037065 1034063 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_21950 1038338 1037067 gene locus_tag LOCUS_21960 gene malQ 1038338 1037067 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880435.1 protein_id gnl|my_center|LOCUS_21960 1038978 1038649 gene locus_tag LOCUS_21970 1038978 1038649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1041473 1039044 gene locus_tag LOCUS_21980 1041473 1039044 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_21980 1043304 1041481 gene locus_tag LOCUS_21990 gene treZ 1043304 1041481 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_21990 1045250 1043301 gene locus_tag LOCUS_22000 gene glgB 1045250 1043301 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_22000 1045785 1045282 gene locus_tag LOCUS_22010 1045785 1045282 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_22010 1046023 1045772 gene locus_tag LOCUS_22020 1046023 1045772 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_22020 1049431 1046099 gene locus_tag LOCUS_22030 gene treS 1049431 1046099 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942997.1 protein_id gnl|my_center|LOCUS_22030 1051431 1049446 gene locus_tag LOCUS_22040 1051431 1049446 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_22040 1051950 1053737 gene locus_tag LOCUS_22050 gene mutL 1051950 1053737 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596727.1 protein_id gnl|my_center|LOCUS_22050 1053965 1054330 gene locus_tag LOCUS_22060 gene queD 1053965 1054330 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_22060 1054345 1055643 gene locus_tag LOCUS_22070 1054345 1055643 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_22070 1055681 1056181 gene locus_tag LOCUS_22080 1055681 1056181 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_22080 1056168 1057235 gene locus_tag LOCUS_22090 1056168 1057235 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_22090 1057243 1059723 gene locus_tag LOCUS_22100 1057243 1059723 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_22100 1060060 1061421 gene locus_tag LOCUS_22110 gene radA 1060060 1061421 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_22110 1061418 1062425 gene locus_tag LOCUS_22120 1061418 1062425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1062522 1063280 gene locus_tag LOCUS_22130 gene surE 1062522 1063280 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_22130 1064688 1063405 gene locus_tag LOCUS_22140 1064688 1063405 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_22140 1065258 1065183 gene locus_tag LOCUS_t00240 1065258 1065183 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1065776 1067524 gene locus_tag LOCUS_22150 gene ftsH 1065776 1067524 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_22150 1068380 1067700 gene locus_tag LOCUS_22160 1068380 1067700 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_22160 1069858 1068494 gene locus_tag LOCUS_22170 1069858 1068494 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_22170 1071149 1070277 gene locus_tag LOCUS_22180 gene hisG 1071149 1070277 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_22180 1071523 1071146 gene locus_tag LOCUS_22190 gene rbfA 1071523 1071146 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931015.1 protein_id gnl|my_center|LOCUS_22190 1071902 1071579 gene locus_tag LOCUS_22200 1071902 1071579 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 protein_id gnl|my_center|LOCUS_22200 1074432 1072204 gene locus_tag LOCUS_22210 gene infB 1074432 1072204 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_22210 1075555 1074482 gene locus_tag LOCUS_22220 1075555 1074482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1076101 1076664 gene locus_tag LOCUS_22230 1076101 1076664 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_22230 1076703 1077671 gene locus_tag LOCUS_22240 gene pyrF 1076703 1077671 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_22240 1077811 1078371 gene locus_tag LOCUS_22250 1077811 1078371 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_22250 1078626 1079114 gene locus_tag LOCUS_22260 1078626 1079114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1079143 1081035 gene locus_tag LOCUS_22270 1079143 1081035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1081270 1081342 gene locus_tag LOCUS_t00250 1081270 1081342 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1081472 1081556 gene locus_tag LOCUS_t00260 1081472 1081556 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1081857 1082945 gene locus_tag LOCUS_22280 1081857 1082945 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_22280 1082942 1083715 gene locus_tag LOCUS_22290 gene ccsA 1082942 1083715 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_22290 1083807 1084775 gene locus_tag LOCUS_22300 1083807 1084775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1086575 1084836 gene locus_tag LOCUS_22310 1086575 1084836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1087983 1086607 gene locus_tag LOCUS_22320 1087983 1086607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1089222 1088086 gene locus_tag LOCUS_22330 gene wecB 1089222 1088086 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306792.1 protein_id gnl|my_center|LOCUS_22330 1090314 1089232 gene locus_tag LOCUS_22340 1090314 1089232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1091269 1090352 gene locus_tag LOCUS_22350 1091269 1090352 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512068.1 protein_id gnl|my_center|LOCUS_22350 1092762 1091263 gene locus_tag LOCUS_22360 1092762 1091263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1093578 1094129 gene locus_tag LOCUS_22370 1093578 1094129 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250077.1 protein_id gnl|my_center|LOCUS_22370 1094107 1094973 gene locus_tag LOCUS_22380 1094107 1094973 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_22380 1094970 1095539 gene locus_tag LOCUS_22390 1094970 1095539 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_22390 1096244 1097470 gene locus_tag LOCUS_22400 1096244 1097470 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_22400 1097609 1099165 gene locus_tag LOCUS_22410 1097609 1099165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1099438 1100433 gene locus_tag LOCUS_22420 1099438 1100433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1100430 1101014 gene locus_tag LOCUS_22430 1100430 1101014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1101240 1101629 gene locus_tag LOCUS_22440 1101240 1101629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1101655 1103574 gene locus_tag LOCUS_22450 1101655 1103574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1103597 1104928 gene locus_tag LOCUS_22460 1103597 1104928 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_22460 1105268 1105852 gene locus_tag LOCUS_22470 1105268 1105852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1106036 1106215 gene locus_tag LOCUS_22480 1106036 1106215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1106524 1108293 gene locus_tag LOCUS_22490 1106524 1108293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1108945 1108268 gene locus_tag LOCUS_22500 1108945 1108268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1109789 1109031 gene locus_tag LOCUS_22510 1109789 1109031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence03 75 6020 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcctcataggtagaatgaaaac 6425 6159 gene locus_tag LOCUS_22520 gene cas2 6425 6159 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_22520 7420 6425 gene locus_tag LOCUS_22530 gene cas1b 7420 6425 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_22530 7930 7427 gene locus_tag LOCUS_22540 gene cas4 7930 7427 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546197.1 protein_id gnl|my_center|LOCUS_22540 10481 7923 gene locus_tag LOCUS_22550 10481 7923 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_22550 11262 10465 gene locus_tag LOCUS_22560 11262 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 11616 11284 gene locus_tag LOCUS_22570 11616 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 11797 11603 gene locus_tag LOCUS_22580 11797 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 12811 11831 gene locus_tag LOCUS_22590 gene cas7b 12811 11831 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_22590 14775 12808 gene locus_tag LOCUS_22600 14775 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 15534 14779 gene locus_tag LOCUS_22610 gene cas6 15534 14779 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_22610 16913 15834 gene locus_tag LOCUS_22620 gene cobT 16913 15834 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_22620 17086 18801 gene locus_tag LOCUS_22630 17086 18801 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_22630 18807 20555 gene locus_tag LOCUS_22640 18807 20555 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_22640 20894 22147 gene locus_tag LOCUS_22650 20894 22147 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_22650 22296 22895 gene locus_tag LOCUS_22660 22296 22895 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_22660 24155 22968 gene locus_tag LOCUS_22670 24155 22968 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986928.1 protein_id gnl|my_center|LOCUS_22670 24874 24386 gene locus_tag LOCUS_22680 24874 24386 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393736.1 protein_id gnl|my_center|LOCUS_22680 29230 24938 gene locus_tag LOCUS_22690 29230 24938 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_22690 30866 29574 gene locus_tag LOCUS_22700 gene leuC 30866 29574 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_22700 31273 30947 gene locus_tag LOCUS_22710 31273 30947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 32318 31470 gene locus_tag LOCUS_22720 gene htpX 32318 31470 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_22720 33728 32751 gene locus_tag LOCUS_22730 33728 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 34854 34030 gene locus_tag LOCUS_22740 34854 34030 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_22740 35770 34868 gene locus_tag LOCUS_22750 35770 34868 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_22750 36602 35781 gene locus_tag LOCUS_22760 36602 35781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 38058 36796 gene locus_tag LOCUS_22770 38058 36796 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_22770 38172 39317 gene locus_tag LOCUS_22780 gene aroC 38172 39317 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_22780 40328 40155 gene locus_tag LOCUS_22790 40328 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 40765 40592 gene locus_tag LOCUS_22800 40765 40592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 41402 41473 gene locus_tag LOCUS_t00270 41402 41473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41596 41680 gene locus_tag LOCUS_t00280 41596 41680 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 42396 42466 gene locus_tag LOCUS_t00290 42396 42466 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42884 42958 gene locus_tag LOCUS_t00300 42884 42958 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43102 44304 gene locus_tag LOCUS_22810 gene tuf 43102 44304 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_22810 44509 44585 gene locus_tag LOCUS_t00310 44509 44585 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 44630 45091 gene locus_tag LOCUS_22820 44630 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 45222 45770 gene locus_tag LOCUS_22830 gene nusG 45222 45770 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_22830 45786 46211 gene locus_tag LOCUS_22840 gene rplK 45786 46211 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_22840 46258 46938 gene locus_tag LOCUS_22850 gene rplA 46258 46938 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081511.1 protein_id gnl|my_center|LOCUS_22850 46974 47501 gene locus_tag LOCUS_22860 gene rplJ 46974 47501 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_22860 47537 47953 gene locus_tag LOCUS_22870 gene rplL 47537 47953 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_22870 47991 51683 gene locus_tag LOCUS_22880 gene rpoB 47991 51683 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_22880 51839 55948 gene locus_tag LOCUS_22890 gene rpoC 51839 55948 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_22890 55963 56334 gene locus_tag LOCUS_22900 gene rpsL 55963 56334 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_22900 56360 56842 gene locus_tag LOCUS_22910 gene rpsG 56360 56842 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_22910 56864 58921 gene locus_tag LOCUS_22920 gene fusA 56864 58921 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_22920 58958 60160 gene locus_tag LOCUS_22930 gene tuf 58958 60160 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_22930 60252 60560 gene locus_tag LOCUS_22940 gene rpsJ 60252 60560 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_22940 60598 61221 gene locus_tag LOCUS_22950 gene rplC 60598 61221 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_22950 61241 61852 gene locus_tag LOCUS_22960 gene rplD 61241 61852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_22960 61870 62151 gene locus_tag LOCUS_22970 gene rplW 61870 62151 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166911.1 protein_id gnl|my_center|LOCUS_22970 62180 63025 gene locus_tag LOCUS_22980 gene rplB 62180 63025 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_22980 63051 63317 gene locus_tag LOCUS_22990 gene rpsS 63051 63317 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_22990 63391 63732 gene locus_tag LOCUS_23000 gene rplV 63391 63732 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_23000 63750 64409 gene locus_tag LOCUS_23010 gene rpsC 63750 64409 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_23010 64402 64812 gene locus_tag LOCUS_23020 gene rplP 64402 64812 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_23020 64809 65027 gene locus_tag LOCUS_23030 gene rpmC 64809 65027 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_23030 65036 65308 gene locus_tag LOCUS_23040 gene rpsQ 65036 65308 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461671.1 protein_id gnl|my_center|LOCUS_23040 65331 65699 gene locus_tag LOCUS_23050 gene rplN 65331 65699 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_23050 65742 66077 gene locus_tag LOCUS_23060 gene rplX 65742 66077 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 protein_id gnl|my_center|LOCUS_23060 66070 66636 gene locus_tag LOCUS_23070 gene rplE 66070 66636 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_23070 66647 66832 gene locus_tag LOCUS_23080 66647 66832 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_23080 66866 67264 gene locus_tag LOCUS_23090 gene rpsH 66866 67264 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_23090 67291 67851 gene locus_tag LOCUS_23100 gene rplF 67291 67851 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_23100 67875 68243 gene locus_tag LOCUS_23110 gene rplR 67875 68243 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925411.1 protein_id gnl|my_center|LOCUS_23110 68274 68759 gene locus_tag LOCUS_23120 68274 68759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 68756 69199 gene locus_tag LOCUS_23130 gene rplO 68756 69199 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986622.1 protein_id gnl|my_center|LOCUS_23130 69196 70578 gene locus_tag LOCUS_23140 gene secY 69196 70578 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_23140 70575 71252 gene locus_tag LOCUS_23150 70575 71252 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_23150 71264 72010 gene locus_tag LOCUS_23160 gene map 71264 72010 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_23160 72032 72250 gene locus_tag LOCUS_23170 gene infA 72032 72250 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_23170 72436 72819 gene locus_tag LOCUS_23180 gene rpsM 72436 72819 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_23180 72884 73720 gene locus_tag LOCUS_23190 72884 73720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 74010 74387 gene locus_tag LOCUS_23200 gene rpsK 74010 74387 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_23200 74353 75048 gene locus_tag LOCUS_23210 gene rpsD 74353 75048 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_23210 75195 76211 gene locus_tag LOCUS_23220 75195 76211 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_23220 76216 76791 gene locus_tag LOCUS_23230 76216 76791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 76929 77435 gene locus_tag LOCUS_23240 76929 77435 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_23240 77422 77889 gene locus_tag LOCUS_23250 77422 77889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 79426 79734 gene locus_tag LOCUS_23260 79426 79734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 80346 80498 gene locus_tag LOCUS_23270 80346 80498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 80500 80679 gene locus_tag LOCUS_23280 80500 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 81041 83161 gene locus_tag LOCUS_23290 81041 83161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23290 83321 83806 gene locus_tag LOCUS_23300 83321 83806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23300 84043 84705 gene locus_tag LOCUS_23310 84043 84705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 85365 85441 gene locus_tag LOCUS_t00320 85365 85441 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 87655 86930 gene locus_tag LOCUS_23320 87655 86930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23320 88751 89095 gene locus_tag LOCUS_23330 88751 89095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 89421 89591 gene locus_tag LOCUS_23340 89421 89591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 91343 91618 gene locus_tag LOCUS_23350 91343 91618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 93553 92075 gene locus_tag LOCUS_23360 93553 92075 CDS product ISNCY-like element ISRm17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970069.1 protein_id gnl|my_center|LOCUS_23360 94668 93769 gene locus_tag LOCUS_23370 94668 93769 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927126.1 protein_id gnl|my_center|LOCUS_23370 95146 96345 gene locus_tag LOCUS_23380 95146 96345 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_23380 96713 97456 gene locus_tag LOCUS_23390 96713 97456 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714845.1 protein_id gnl|my_center|LOCUS_23390 99336 97618 gene locus_tag LOCUS_23400 99336 97618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 99743 99354 gene locus_tag LOCUS_23410 99743 99354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 100607 100350 gene locus_tag LOCUS_23420 100607 100350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 101387 101061 gene locus_tag LOCUS_23430 101387 101061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 101628 101873 gene locus_tag LOCUS_23440 101628 101873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 102717 102070 gene locus_tag LOCUS_23450 102717 102070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 105052 103961 gene locus_tag LOCUS_23460 105052 103961 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_23460 105294 105049 gene locus_tag LOCUS_23470 105294 105049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 106267 105311 gene locus_tag LOCUS_23480 106267 105311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 106687 108711 gene locus_tag LOCUS_23490 gene ligA 106687 108711 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_23490 108819 110180 gene locus_tag LOCUS_23500 108819 110180 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141444.1 protein_id gnl|my_center|LOCUS_23500 110181 111230 gene locus_tag LOCUS_23510 gene pilT 110181 111230 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_23510 111250 112356 gene locus_tag LOCUS_23520 gene pilU 111250 112356 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_23520 112388 112582 gene locus_tag LOCUS_23530 112388 112582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 112774 112577 gene locus_tag LOCUS_23540 112774 112577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 113132 112872 gene locus_tag LOCUS_23550 113132 112872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_23550 113329 113129 gene locus_tag LOCUS_23560 113329 113129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 113840 113460 gene locus_tag LOCUS_23570 113840 113460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 114527 113877 gene locus_tag LOCUS_23580 114527 113877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 115214 114978 gene locus_tag LOCUS_23590 115214 114978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 115889 115221 gene locus_tag LOCUS_23600 115889 115221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 116443 116111 gene locus_tag LOCUS_23610 116443 116111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 116738 116436 gene locus_tag LOCUS_23620 116738 116436 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_23620 118151 117546 gene locus_tag LOCUS_23630 118151 117546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 119258 118227 gene locus_tag LOCUS_23640 gene floA 119258 118227 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_23640 119853 119392 gene locus_tag LOCUS_23650 119853 119392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 121625 120063 gene locus_tag LOCUS_23660 121625 120063 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_23660 122580 123485 gene locus_tag LOCUS_23670 gene argB 122580 123485 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_23670 123592 124773 gene locus_tag LOCUS_23680 123592 124773 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_23680 124790 125713 gene locus_tag LOCUS_23690 gene argF 124790 125713 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_23690 125718 126434 gene locus_tag LOCUS_23700 gene rph 125718 126434 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_23700 126523 127164 gene locus_tag LOCUS_23710 126523 127164 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_23710 128380 127298 gene locus_tag LOCUS_23720 128380 127298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 129511 128678 gene locus_tag LOCUS_23730 129511 128678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 129953 129690 gene locus_tag LOCUS_23740 129953 129690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23740 130448 130576 gene locus_tag LOCUS_23750 130448 130576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 130956 131138 gene locus_tag LOCUS_23760 130956 131138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 132686 132024 gene locus_tag LOCUS_23770 132686 132024 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_23770 133873 133049 gene locus_tag LOCUS_23780 133873 133049 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_23780 134573 136303 gene locus_tag LOCUS_23790 gene acsA 134573 136303 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_23790 136476 137117 gene locus_tag LOCUS_23800 136476 137117 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 protein_id gnl|my_center|LOCUS_23800 137486 137830 gene locus_tag LOCUS_23810 137486 137830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 138245 138643 gene locus_tag LOCUS_23820 138245 138643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 138707 139378 gene locus_tag LOCUS_23830 138707 139378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 140356 139421 gene locus_tag LOCUS_23840 140356 139421 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_23840 141168 141599 gene locus_tag LOCUS_23850 141168 141599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 142684 141734 gene locus_tag LOCUS_23860 142684 141734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 143877 142681 gene locus_tag LOCUS_23870 143877 142681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 145520 144072 gene locus_tag LOCUS_23880 145520 144072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 146560 145727 gene locus_tag LOCUS_23890 146560 145727 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_23890 147114 147800 gene locus_tag LOCUS_23900 147114 147800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 147935 148492 gene locus_tag LOCUS_23910 147935 148492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_23910 148607 149803 gene locus_tag LOCUS_23920 148607 149803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 150215 150006 gene locus_tag LOCUS_23930 150215 150006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 150532 151314 gene locus_tag LOCUS_23940 150532 151314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 151522 151716 gene locus_tag LOCUS_23950 151522 151716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 151818 152372 gene locus_tag LOCUS_23960 151818 152372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 153367 156276 gene locus_tag LOCUS_23970 153367 156276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 156316 156567 gene locus_tag LOCUS_23980 156316 156567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 157572 156619 gene locus_tag LOCUS_23990 157572 156619 CDS product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 157838 157569 gene locus_tag LOCUS_24000 157838 157569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 158928 157981 gene locus_tag LOCUS_24010 158928 157981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24010 160871 158952 gene locus_tag LOCUS_24020 160871 158952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24020 163039 160946 gene locus_tag LOCUS_24030 163039 160946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 163715 163359 gene locus_tag LOCUS_24040 163715 163359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24040 164343 163702 gene locus_tag LOCUS_24050 164343 163702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24050 164685 164494 gene locus_tag LOCUS_24060 164685 164494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 166798 164750 gene locus_tag LOCUS_24070 166798 164750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 168010 166958 gene locus_tag LOCUS_24080 168010 166958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24080 169285 169446 gene locus_tag LOCUS_24090 169285 169446 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_24090 169634 170071 gene locus_tag LOCUS_24100 169634 170071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 170068 171012 gene locus_tag LOCUS_24110 gene trxB 170068 171012 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888615.1 protein_id gnl|my_center|LOCUS_24110 171075 171518 gene locus_tag LOCUS_24120 171075 171518 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_24120 172509 173954 gene locus_tag LOCUS_24130 172509 173954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 173976 174356 gene locus_tag LOCUS_24140 173976 174356 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_24140 174501 175286 gene locus_tag LOCUS_24150 174501 175286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 175312 176898 gene locus_tag LOCUS_24160 175312 176898 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_24160 176952 177392 gene locus_tag LOCUS_24170 176952 177392 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_24170 177553 178068 gene locus_tag LOCUS_24180 177553 178068 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537230.1 protein_id gnl|my_center|LOCUS_24180 178130 178597 gene locus_tag LOCUS_24190 178130 178597 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_24190 178749 179930 gene locus_tag LOCUS_24200 178749 179930 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880777.1 protein_id gnl|my_center|LOCUS_24200 180104 180763 gene locus_tag LOCUS_24210 180104 180763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 183494 180876 gene locus_tag LOCUS_24220 183494 180876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 183937 186225 gene locus_tag LOCUS_24230 gene priA 183937 186225 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_24230 186878 186315 gene locus_tag LOCUS_24240 186878 186315 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_24240 187856 187086 gene locus_tag LOCUS_24250 187856 187086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 188604 187849 gene locus_tag LOCUS_24260 188604 187849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 188899 188648 gene locus_tag LOCUS_24270 188899 188648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 189332 190207 gene locus_tag LOCUS_24280 189332 190207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 190204 190671 gene locus_tag LOCUS_24290 190204 190671 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966079.1 protein_id gnl|my_center|LOCUS_24290 190677 191147 gene locus_tag LOCUS_24300 gene ahbB 190677 191147 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_24300 192455 191466 gene locus_tag LOCUS_24310 192455 191466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 193300 192500 gene locus_tag LOCUS_24320 193300 192500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 194207 193452 gene locus_tag LOCUS_24330 gene larB 194207 193452 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_24330 194784 194617 gene locus_tag LOCUS_24340 194784 194617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 194896 194744 gene locus_tag LOCUS_24350 194896 194744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 195531 195352 gene locus_tag LOCUS_24360 195531 195352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 195689 195534 gene locus_tag LOCUS_24370 195689 195534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 197204 196194 gene locus_tag LOCUS_24380 gene tsaD 197204 196194 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_24380 198214 197759 gene locus_tag LOCUS_24390 198214 197759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 198736 198263 gene locus_tag LOCUS_24400 198736 198263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24400 199127 198669 gene locus_tag LOCUS_24410 199127 198669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 199930 199538 gene locus_tag LOCUS_24420 199930 199538 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615868.1 protein_id gnl|my_center|LOCUS_24420 200492 200007 gene locus_tag LOCUS_24430 200492 200007 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_24430 200846 200754 gene locus_tag LOCUS_t00330 200846 200754 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 201060 200971 gene locus_tag LOCUS_t00340 201060 200971 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 201471 201064 gene locus_tag LOCUS_24440 201471 201064 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_24440 201869 202708 gene locus_tag LOCUS_24450 gene uppP 201869 202708 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_24450 202705 203415 gene locus_tag LOCUS_24460 202705 203415 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_24460 203426 204031 gene locus_tag LOCUS_24470 gene ubiX 203426 204031 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266526.1 protein_id gnl|my_center|LOCUS_24470 204069 204359 gene locus_tag LOCUS_24480 204069 204359 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_24480 204366 205454 gene locus_tag LOCUS_24490 gene sppA 204366 205454 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_24490 205656 207134 gene locus_tag LOCUS_24500 gene cysS 205656 207134 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_24500 207139 208500 gene locus_tag LOCUS_24510 207139 208500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24510 208490 208753 gene locus_tag LOCUS_24520 208490 208753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 208866 209120 gene locus_tag LOCUS_24530 208866 209120 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_24530 209775 209155 gene locus_tag LOCUS_24540 209775 209155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 210356 210658 gene locus_tag LOCUS_24550 210356 210658 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_24550 210739 212001 gene locus_tag LOCUS_24560 210739 212001 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_24560 212073 212588 gene locus_tag LOCUS_24570 gene mobB 212073 212588 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_24570 212739 213164 gene locus_tag LOCUS_24580 212739 213164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 214106 213420 gene locus_tag LOCUS_24590 gene bshB1 214106 213420 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_24590 215835 214513 gene locus_tag LOCUS_24600 215835 214513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 216827 215880 gene locus_tag LOCUS_24610 216827 215880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 217901 217464 gene locus_tag LOCUS_24620 217901 217464 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545112.1 protein_id gnl|my_center|LOCUS_24620 219120 218023 gene locus_tag LOCUS_24630 219120 218023 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_24630 220467 219418 gene locus_tag LOCUS_24640 220467 219418 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_24640 220858 225009 gene locus_tag LOCUS_24650 220858 225009 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_24650 227340 225184 gene locus_tag LOCUS_24660 gene recQ 227340 225184 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_24660 227636 227493 gene locus_tag LOCUS_24670 227636 227493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 228495 227662 gene locus_tag LOCUS_24680 228495 227662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 229961 231067 gene locus_tag LOCUS_24690 229961 231067 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_24690 232660 231386 gene locus_tag LOCUS_24700 232660 231386 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_24700 234427 232685 gene locus_tag LOCUS_24710 234427 232685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 234881 235255 gene locus_tag LOCUS_24720 234881 235255 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_24720 235333 235857 gene locus_tag LOCUS_24730 235333 235857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 235881 236903 gene locus_tag LOCUS_24740 235881 236903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 236926 238710 gene locus_tag LOCUS_24750 236926 238710 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_24750 238753 239265 gene locus_tag LOCUS_24760 238753 239265 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_24760 239204 239509 gene locus_tag LOCUS_24770 239204 239509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 239412 241013 gene locus_tag LOCUS_24780 239412 241013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 241120 241602 gene locus_tag LOCUS_24790 241120 241602 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020070.1 protein_id gnl|my_center|LOCUS_24790 241716 242279 gene locus_tag LOCUS_24800 241716 242279 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_24800 242276 242641 gene locus_tag LOCUS_24810 242276 242641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_24810 242974 243807 gene locus_tag LOCUS_24820 242974 243807 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_24820 243852 244892 gene locus_tag LOCUS_24830 243852 244892 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_24830 246281 244878 gene locus_tag LOCUS_24840 246281 244878 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_24840 247495 246437 gene locus_tag LOCUS_24850 247495 246437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 248458 247610 gene locus_tag LOCUS_24860 248458 247610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 249645 250079 gene locus_tag LOCUS_24870 249645 250079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 250194 250745 gene locus_tag LOCUS_24880 250194 250745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 250857 251498 gene locus_tag LOCUS_24890 250857 251498 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_24890 253225 251858 gene locus_tag LOCUS_24900 gene gnfM 253225 251858 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_24900 255913 253571 gene locus_tag LOCUS_24910 255913 253571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 256750 257916 gene locus_tag LOCUS_24920 256750 257916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 257983 258975 gene locus_tag LOCUS_24930 257983 258975 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_24930 259891 261447 gene locus_tag LOCUS_24940 259891 261447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 261913 262605 gene locus_tag LOCUS_24950 261913 262605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 262664 263011 gene locus_tag LOCUS_24960 262664 263011 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_24960 263008 263340 gene locus_tag LOCUS_24970 263008 263340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 264837 263707 gene locus_tag LOCUS_24980 264837 263707 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393790.1 protein_id gnl|my_center|LOCUS_24980 265242 266333 gene locus_tag LOCUS_24990 gene focA 265242 266333 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816739.1 protein_id gnl|my_center|LOCUS_24990 266884 267798 gene locus_tag LOCUS_25000 266884 267798 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388064.1 protein_id gnl|my_center|LOCUS_25000 268213 269358 gene locus_tag LOCUS_25010 268213 269358 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_25010 269696 270136 gene locus_tag LOCUS_25020 gene gcvH 269696 270136 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_25020 270145 271191 gene locus_tag LOCUS_25030 270145 271191 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_25030 271188 272210 gene locus_tag LOCUS_25040 271188 272210 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_25040 273289 272393 gene locus_tag LOCUS_25050 273289 272393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 275026 273884 gene locus_tag LOCUS_25060 gene leuB 275026 273884 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799846.1 protein_id gnl|my_center|LOCUS_25060 275708 275157 gene locus_tag LOCUS_25070 gene amrA 275708 275157 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_25070 277385 275787 gene locus_tag LOCUS_25080 277385 275787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 278025 277396 gene locus_tag LOCUS_25090 278025 277396 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_25090 278519 280183 gene locus_tag LOCUS_25100 gene ilvD 278519 280183 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_25100 280246 280319 gene locus_tag LOCUS_t00350 280246 280319 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 280431 281354 gene locus_tag LOCUS_25110 280431 281354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 281364 282332 gene locus_tag LOCUS_25120 281364 282332 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_25120 282360 282998 gene locus_tag LOCUS_25130 282360 282998 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_25130 283013 283567 gene locus_tag LOCUS_25140 gene pth 283013 283567 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_25140 283619 284032 gene locus_tag LOCUS_25150 gene rpsF 283619 284032 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_25150 284142 284582 gene locus_tag LOCUS_25160 284142 284582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 284857 285315 gene locus_tag LOCUS_25170 gene rplI 284857 285315 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_25170 285335 286678 gene locus_tag LOCUS_25180 gene dnaB 285335 286678 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_25180 286675 289053 gene locus_tag LOCUS_25190 gene bamA 286675 289053 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_25190 289128 289691 gene locus_tag LOCUS_25200 289128 289691 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_25200 289695 290564 gene locus_tag LOCUS_25210 gene lpxC 289695 290564 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141863.1 protein_id gnl|my_center|LOCUS_25210 290820 291638 gene locus_tag LOCUS_25220 gene lpxA 290820 291638 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_25220 291848 292876 gene locus_tag LOCUS_25230 291848 292876 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_25230 292880 293107 gene locus_tag LOCUS_25240 292880 293107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 293201 293506 gene locus_tag LOCUS_25250 293201 293506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 293517 293825 gene locus_tag LOCUS_25260 293517 293825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 293851 294087 gene locus_tag LOCUS_25270 293851 294087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 294136 295911 gene locus_tag LOCUS_25280 294136 295911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 296085 296447 gene locus_tag LOCUS_25290 296085 296447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 296579 296941 gene locus_tag LOCUS_25300 gene panD 296579 296941 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_25300 297016 297807 gene locus_tag LOCUS_25310 gene lgt 297016 297807 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_25310 299113 297818 gene locus_tag LOCUS_25320 gene hflX 299113 297818 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_25320 299851 299123 gene locus_tag LOCUS_25330 299851 299123 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_25330 299934 301358 gene locus_tag LOCUS_25340 299934 301358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 301679 301948 gene locus_tag LOCUS_25350 301679 301948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 301945 302244 gene locus_tag LOCUS_25360 301945 302244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 302479 302796 gene locus_tag LOCUS_25370 302479 302796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 302802 303083 gene locus_tag LOCUS_25380 302802 303083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 303676 304572 gene locus_tag LOCUS_25390 gene lafA 303676 304572 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_25390 304740 306527 gene locus_tag LOCUS_25400 gene fliD 304740 306527 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080294.1 protein_id gnl|my_center|LOCUS_25400 306567 307019 gene locus_tag LOCUS_25410 306567 307019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 307050 307361 gene locus_tag LOCUS_25420 307050 307361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 307501 308034 gene locus_tag LOCUS_25430 307501 308034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 309437 308220 gene locus_tag LOCUS_25440 309437 308220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 310702 309803 gene locus_tag LOCUS_25450 gene lafA 310702 309803 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_25450 312456 310747 gene locus_tag LOCUS_25460 312456 310747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 313639 313031 gene locus_tag LOCUS_25470 313639 313031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 314274 313642 gene locus_tag LOCUS_25480 314274 313642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 316015 314603 gene locus_tag LOCUS_25490 316015 314603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 316723 316304 gene locus_tag LOCUS_25500 316723 316304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 317217 316948 gene locus_tag LOCUS_25510 317217 316948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 317680 317381 gene locus_tag LOCUS_25520 317680 317381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 317969 319489 gene locus_tag LOCUS_25530 317969 319489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 319763 320095 gene locus_tag LOCUS_25540 319763 320095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 322501 320291 gene locus_tag LOCUS_25550 322501 320291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 325007 322959 gene locus_tag LOCUS_25560 325007 322959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 325734 327374 gene locus_tag LOCUS_25570 325734 327374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 327621 328553 gene locus_tag LOCUS_25580 327621 328553 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_25580 329127 328732 gene locus_tag LOCUS_25590 gene rpsI 329127 328732 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_25590 329571 329137 gene locus_tag LOCUS_25600 gene rplM 329571 329137 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_25600 329936 330409 gene locus_tag LOCUS_25610 329936 330409 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_25610 331284 330553 gene locus_tag LOCUS_25620 331284 330553 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_25620 331795 333441 gene locus_tag LOCUS_25630 331795 333441 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_25630 334117 333647 gene locus_tag LOCUS_25640 gene ndk 334117 333647 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809738.1 protein_id gnl|my_center|LOCUS_25640 334669 334124 gene locus_tag LOCUS_25650 334669 334124 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_25650 336406 334676 gene locus_tag LOCUS_25660 336406 334676 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_25660 336912 337412 gene locus_tag LOCUS_25670 336912 337412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 338322 338729 gene locus_tag LOCUS_25680 338322 338729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 338775 339155 gene locus_tag LOCUS_25690 338775 339155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 339382 341901 gene locus_tag LOCUS_25700 339382 341901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 342221 342757 gene locus_tag LOCUS_25710 342221 342757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 343287 342826 gene locus_tag LOCUS_25720 343287 342826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 344081 343284 gene locus_tag LOCUS_25730 344081 343284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 344464 344976 gene locus_tag LOCUS_25740 gene def 344464 344976 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_25740 345030 345992 gene locus_tag LOCUS_25750 gene fmt 345030 345992 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_25750 346024 346467 gene locus_tag LOCUS_25760 346024 346467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 346448 347857 gene locus_tag LOCUS_25770 gene rsmB 346448 347857 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_25770 347994 349229 gene locus_tag LOCUS_25780 347994 349229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 349369 350115 gene locus_tag LOCUS_25790 349369 350115 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_25790 350190 350336 gene locus_tag LOCUS_25800 350190 350336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 350329 350634 gene locus_tag LOCUS_25810 350329 350634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 350709 351113 gene locus_tag LOCUS_25820 350709 351113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 351181 351936 gene locus_tag LOCUS_25830 351181 351936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 352515 352676 gene locus_tag LOCUS_25840 352515 352676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 353581 353450 gene locus_tag LOCUS_25850 353581 353450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 354249 353905 gene locus_tag LOCUS_25860 354249 353905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 355028 354318 gene locus_tag LOCUS_25870 355028 354318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 355107 355412 gene locus_tag LOCUS_25880 355107 355412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 355400 355576 gene locus_tag LOCUS_25890 355400 355576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 357691 357966 gene locus_tag LOCUS_25900 357691 357966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 359896 359354 gene locus_tag LOCUS_25910 359896 359354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 360279 360539 gene locus_tag LOCUS_25920 360279 360539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 360467 360811 gene locus_tag LOCUS_25930 360467 360811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 360919 361149 gene locus_tag LOCUS_25940 360919 361149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 361228 361491 gene locus_tag LOCUS_25950 361228 361491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 361893 362378 gene locus_tag LOCUS_25960 361893 362378 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459578.1 protein_id gnl|my_center|LOCUS_25960 362862 363110 gene locus_tag LOCUS_25970 362862 363110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 363738 363112 gene locus_tag LOCUS_25980 363738 363112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 364555 364184 gene locus_tag LOCUS_25990 364555 364184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 366322 366131 gene locus_tag LOCUS_26000 366322 366131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 366621 366310 gene locus_tag LOCUS_26010 366621 366310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 368515 368363 gene locus_tag LOCUS_26020 368515 368363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 369597 369073 gene locus_tag LOCUS_26030 369597 369073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 370296 369742 gene locus_tag LOCUS_26040 370296 369742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 370800 370555 gene locus_tag LOCUS_26050 370800 370555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 371278 372159 gene locus_tag LOCUS_26060 371278 372159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 372555 372719 gene locus_tag LOCUS_26070 372555 372719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 372811 372736 gene locus_tag LOCUS_t00360 372811 372736 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 373234 375735 gene locus_tag LOCUS_26080 gene leuS 373234 375735 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_26080 376552 376373 gene locus_tag LOCUS_26090 376552 376373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 377656 377084 gene locus_tag LOCUS_26100 377656 377084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26100 378134 377637 gene locus_tag LOCUS_26110 378134 377637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 379099 378764 gene locus_tag LOCUS_26120 379099 378764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 379861 379115 gene locus_tag LOCUS_26130 379861 379115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 381033 381398 gene locus_tag LOCUS_26140 381033 381398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 381433 381666 gene locus_tag LOCUS_26150 381433 381666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 381672 381905 gene locus_tag LOCUS_26160 381672 381905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 382017 382322 gene locus_tag LOCUS_26170 382017 382322 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_26170 382598 382359 gene locus_tag LOCUS_26180 382598 382359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 382857 382591 gene locus_tag LOCUS_26190 382857 382591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 384016 382871 gene locus_tag LOCUS_26200 384016 382871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_26200 384991 384044 gene locus_tag LOCUS_26210 384991 384044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 385871 385029 gene locus_tag LOCUS_26220 385871 385029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 386905 385904 gene locus_tag LOCUS_26230 386905 385904 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_26230 387817 386921 gene locus_tag LOCUS_26240 387817 386921 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527266.1 protein_id gnl|my_center|LOCUS_26240 389644 387833 gene locus_tag LOCUS_26250 389644 387833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 390524 389739 gene locus_tag LOCUS_26260 390524 389739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 391720 390686 gene locus_tag LOCUS_26270 391720 390686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 392997 391765 gene locus_tag LOCUS_26280 392997 391765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 393488 393054 gene locus_tag LOCUS_26290 393488 393054 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 protein_id gnl|my_center|LOCUS_26290 393901 393497 gene locus_tag LOCUS_26300 393901 393497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 395024 393921 gene locus_tag LOCUS_26310 395024 393921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 396034 395078 gene locus_tag LOCUS_26320 396034 395078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 397391 396273 gene locus_tag LOCUS_26330 397391 396273 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_26330 398462 397842 gene locus_tag LOCUS_26340 398462 397842 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_26340 399551 398532 gene locus_tag LOCUS_26350 399551 398532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 400357 399569 gene locus_tag LOCUS_26360 gene flgG 400357 399569 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_26360 401106 400378 gene locus_tag LOCUS_26370 gene flgG 401106 400378 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_26370 401478 401651 gene locus_tag LOCUS_26380 401478 401651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 401981 401568 gene locus_tag LOCUS_26390 401981 401568 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249289.1 protein_id gnl|my_center|LOCUS_26390 402214 401978 gene locus_tag LOCUS_26400 402214 401978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 402338 402198 gene locus_tag LOCUS_26410 402338 402198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 404304 402706 gene locus_tag LOCUS_26420 404304 402706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 404863 404450 gene locus_tag LOCUS_26430 gene flgD 404863 404450 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395285.1 protein_id gnl|my_center|LOCUS_26430 406800 404875 gene locus_tag LOCUS_26440 406800 404875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 408076 407396 gene locus_tag LOCUS_26450 408076 407396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 408694 408173 gene locus_tag LOCUS_26460 408694 408173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 409697 409011 gene locus_tag LOCUS_26470 gene thiE 409697 409011 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_26470 410112 411539 gene locus_tag LOCUS_26480 gene purF 410112 411539 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_26480 411564 412556 gene locus_tag LOCUS_26490 411564 412556 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827587.1 protein_id gnl|my_center|LOCUS_26490 412570 412764 gene locus_tag LOCUS_26500 412570 412764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 412920 413108 gene locus_tag LOCUS_26510 412920 413108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 413166 413675 gene locus_tag LOCUS_26520 413166 413675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 413928 414707 gene locus_tag LOCUS_26530 413928 414707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 414773 415096 gene locus_tag LOCUS_26540 414773 415096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 415248 415532 gene locus_tag LOCUS_26550 415248 415532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 415536 415757 gene locus_tag LOCUS_26560 415536 415757 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393299.1 protein_id gnl|my_center|LOCUS_26560 416248 416496 gene locus_tag LOCUS_26570 416248 416496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 416489 416833 gene locus_tag LOCUS_26580 416489 416833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 416874 418295 gene locus_tag LOCUS_26590 416874 418295 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_26590 418298 419326 gene locus_tag LOCUS_26600 418298 419326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 419293 420393 gene locus_tag LOCUS_26610 gene purM 419293 420393 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_26610 421800 420532 gene locus_tag LOCUS_26620 421800 420532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 422532 424295 gene locus_tag LOCUS_26630 422532 424295 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_26630 424690 427332 gene locus_tag LOCUS_26640 gene secA 424690 427332 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_26640 427415 428731 gene locus_tag LOCUS_26650 gene waaA 427415 428731 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_26650 428728 429894 gene locus_tag LOCUS_26660 gene metK 428728 429894 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_26660 430054 430260 gene locus_tag LOCUS_26670 430054 430260 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_26670 430244 430492 gene locus_tag LOCUS_26680 430244 430492 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_26680 430577 430981 gene locus_tag LOCUS_26690 430577 430981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 431310 432620 gene locus_tag LOCUS_26700 431310 432620 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_26700 432886 434154 gene locus_tag LOCUS_26710 gene thrC 432886 434154 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_26710 434600 434806 gene locus_tag LOCUS_26720 434600 434806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 434952 435137 gene locus_tag LOCUS_26730 434952 435137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 435128 435286 gene locus_tag LOCUS_26740 435128 435286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 435657 435953 gene locus_tag LOCUS_26750 435657 435953 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_26750 435919 436164 gene locus_tag LOCUS_26760 435919 436164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 436406 437470 gene locus_tag LOCUS_26770 436406 437470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 437672 437944 gene locus_tag LOCUS_26780 437672 437944 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_26780 437931 438197 gene locus_tag LOCUS_26790 437931 438197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 438250 439356 gene locus_tag LOCUS_26800 438250 439356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 439585 439328 gene locus_tag LOCUS_26810 439585 439328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 440213 439863 gene locus_tag LOCUS_26820 440213 439863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 440565 440867 gene locus_tag LOCUS_26830 440565 440867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 441315 441998 gene locus_tag LOCUS_26840 441315 441998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26840 442136 442609 gene locus_tag LOCUS_26850 442136 442609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 442699 443748 gene locus_tag LOCUS_26860 442699 443748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 444043 444324 gene locus_tag LOCUS_26870 444043 444324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26870 444409 444705 gene locus_tag LOCUS_26880 444409 444705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 444905 445993 gene locus_tag LOCUS_26890 444905 445993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26890 445987 447612 gene locus_tag LOCUS_26900 445987 447612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26900 448345 447791 gene locus_tag LOCUS_26910 448345 447791 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_26910 448746 450146 gene locus_tag LOCUS_26920 gene ahcY 448746 450146 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765398.1 protein_id gnl|my_center|LOCUS_26920 450485 450769 gene locus_tag LOCUS_26930 450485 450769 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_26930 451816 451064 gene locus_tag LOCUS_26940 451816 451064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26940 452466 451855 gene locus_tag LOCUS_26950 452466 451855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26950 453632 452553 gene locus_tag LOCUS_26960 453632 452553 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_26960 455172 453730 gene locus_tag LOCUS_26970 455172 453730 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_26970 456369 455422 gene locus_tag LOCUS_26980 456369 455422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 458532 456427 gene locus_tag LOCUS_26990 458532 456427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 459305 458520 gene locus_tag LOCUS_27000 459305 458520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 462315 460042 gene locus_tag LOCUS_27010 462315 460042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 463679 462312 gene locus_tag LOCUS_27020 463679 462312 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_27020 465336 463735 gene locus_tag LOCUS_27030 465336 463735 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_27030 465570 466940 gene locus_tag LOCUS_27040 465570 466940 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 protein_id gnl|my_center|LOCUS_27040 467828 466983 gene locus_tag LOCUS_27050 467828 466983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 469274 468114 gene locus_tag LOCUS_27060 gene iolM 469274 468114 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_27060 470857 469271 gene locus_tag LOCUS_27070 470857 469271 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_27070 471693 471007 gene locus_tag LOCUS_27080 471693 471007 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_27080 474358 472232 gene locus_tag LOCUS_27090 gene glyS 474358 472232 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_27090 475659 474361 gene locus_tag LOCUS_27100 475659 474361 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_27100 476254 475997 gene locus_tag LOCUS_27110 476254 475997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 476996 476424 gene locus_tag LOCUS_27120 476996 476424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 478378 477095 gene locus_tag LOCUS_27130 gene gabT 478378 477095 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_27130 480541 478526 gene locus_tag LOCUS_27140 480541 478526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 482312 481050 gene locus_tag LOCUS_27150 482312 481050 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031442.1 protein_id gnl|my_center|LOCUS_27150 484601 482418 gene locus_tag LOCUS_27160 484601 482418 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_27160 485276 484710 gene locus_tag LOCUS_27170 485276 484710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 486190 485825 gene locus_tag LOCUS_27180 486190 485825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 487428 486187 gene locus_tag LOCUS_27190 487428 486187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 489037 489378 gene locus_tag LOCUS_27200 489037 489378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 489682 491448 gene locus_tag LOCUS_27210 489682 491448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 491852 492073 gene locus_tag LOCUS_27220 491852 492073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 493399 493602 gene locus_tag LOCUS_27230 493399 493602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 494444 493989 gene locus_tag LOCUS_27240 494444 493989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 495932 498943 gene locus_tag LOCUS_27250 495932 498943 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_27250 499457 500737 gene locus_tag LOCUS_27260 499457 500737 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_27260 501109 501843 gene locus_tag LOCUS_27270 501109 501843 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_27270 502008 503522 gene locus_tag LOCUS_27280 gene guaB 502008 503522 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070955.1 protein_id gnl|my_center|LOCUS_27280 505105 505293 gene locus_tag LOCUS_27290 505105 505293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 506472 505546 gene locus_tag LOCUS_27300 506472 505546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 506829 506521 gene locus_tag LOCUS_27310 506829 506521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 508329 508622 gene locus_tag LOCUS_27320 508329 508622 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_27320 508641 508958 gene locus_tag LOCUS_27330 508641 508958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 509125 509517 gene locus_tag LOCUS_27340 509125 509517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 509684 510217 gene locus_tag LOCUS_27350 509684 510217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 510448 511197 gene locus_tag LOCUS_27360 510448 511197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 511520 511900 gene locus_tag LOCUS_27370 511520 511900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 512706 515015 gene locus_tag LOCUS_27380 512706 515015 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_27380 515193 516506 gene locus_tag LOCUS_27390 515193 516506 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_27390 517095 516739 gene locus_tag LOCUS_27400 517095 516739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 517913 517653 gene locus_tag LOCUS_27410 517913 517653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 518323 518177 gene locus_tag LOCUS_27420 518323 518177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 519848 519612 gene locus_tag LOCUS_27430 519848 519612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27430 520826 520563 gene locus_tag LOCUS_27440 520826 520563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 521442 521068 gene locus_tag LOCUS_27450 521442 521068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 522083 521937 gene locus_tag LOCUS_27460 522083 521937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 523345 522983 gene locus_tag LOCUS_27470 523345 522983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27470 523815 523330 gene locus_tag LOCUS_27480 523815 523330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27480 525109 524966 gene locus_tag LOCUS_27490 525109 524966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 525613 525284 gene locus_tag LOCUS_27500 525613 525284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27500 526171 525926 gene locus_tag LOCUS_27510 526171 525926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27510 526848 527018 gene locus_tag LOCUS_27520 526848 527018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 527358 527567 gene locus_tag LOCUS_27530 527358 527567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27530 527953 528282 gene locus_tag LOCUS_27540 527953 528282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 529057 529197 gene locus_tag LOCUS_27550 529057 529197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 531215 531496 gene locus_tag LOCUS_27560 531215 531496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 531986 532366 gene locus_tag LOCUS_27570 531986 532366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 532871 533044 gene locus_tag LOCUS_27580 532871 533044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27580 533041 533364 gene locus_tag LOCUS_27590 533041 533364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 533593 533802 gene locus_tag LOCUS_27600 533593 533802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 533806 534822 gene locus_tag LOCUS_27610 533806 534822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 534837 538274 gene locus_tag LOCUS_27620 534837 538274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 538261 538929 gene locus_tag LOCUS_27630 538261 538929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 539214 539402 gene locus_tag LOCUS_27640 539214 539402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 539481 539696 gene locus_tag LOCUS_27650 539481 539696 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393808.1 protein_id gnl|my_center|LOCUS_27650 539983 540348 gene locus_tag LOCUS_27660 539983 540348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 541463 541278 gene locus_tag LOCUS_27670 541463 541278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 542298 542663 gene locus_tag LOCUS_27680 542298 542663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 542895 543143 gene locus_tag LOCUS_27690 542895 543143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 543862 547251 gene locus_tag LOCUS_27700 543862 547251 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_27700 547248 547886 gene locus_tag LOCUS_27710 547248 547886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 547926 548252 gene locus_tag LOCUS_27720 547926 548252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27720 548252 548590 gene locus_tag LOCUS_27730 548252 548590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 548800 550539 gene locus_tag LOCUS_27740 548800 550539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 550931 551602 gene locus_tag LOCUS_27750 550931 551602 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_27750 551605 552993 gene locus_tag LOCUS_27760 551605 552993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_27760 554226 553273 gene locus_tag LOCUS_27770 554226 553273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 556066 554630 gene locus_tag LOCUS_27780 556066 554630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 556402 556250 gene locus_tag LOCUS_27790 556402 556250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 559576 556523 gene locus_tag LOCUS_27800 559576 556523 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_27800 560682 559573 gene locus_tag LOCUS_27810 560682 559573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 562156 560687 gene locus_tag LOCUS_27820 562156 560687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 563158 562439 gene locus_tag LOCUS_27830 563158 562439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 563883 563158 gene locus_tag LOCUS_27840 gene cmoA 563883 563158 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 protein_id gnl|my_center|LOCUS_27840 564260 563895 gene locus_tag LOCUS_27850 564260 563895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 564965 564453 gene locus_tag LOCUS_27860 564965 564453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 566226 566408 gene locus_tag LOCUS_27870 566226 566408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 568821 568039 gene locus_tag LOCUS_27880 568821 568039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_27880 570135 569314 gene locus_tag LOCUS_27890 570135 569314 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904518.1 protein_id gnl|my_center|LOCUS_27890 570646 571863 gene locus_tag LOCUS_27900 570646 571863 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_27900 571928 574465 gene locus_tag LOCUS_27910 571928 574465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 574477 576360 gene locus_tag LOCUS_27920 574477 576360 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_27920 576408 576992 gene locus_tag LOCUS_27930 576408 576992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 577986 577075 gene locus_tag LOCUS_27940 gene folD 577986 577075 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_27940 578565 579326 gene locus_tag LOCUS_27950 578565 579326 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 protein_id gnl|my_center|LOCUS_27950 579641 581158 gene locus_tag LOCUS_27960 579641 581158 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_27960 581155 583980 gene locus_tag LOCUS_27970 gene uvrA 581155 583980 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583250.1 protein_id gnl|my_center|LOCUS_27970 585850 584177 gene locus_tag LOCUS_27980 gene gspE 585850 584177 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_27980 586593 586153 gene locus_tag LOCUS_27990 gene gspG 586593 586153 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_27990 587499 586807 gene locus_tag LOCUS_28000 587499 586807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 588167 588607 gene locus_tag LOCUS_28010 588167 588607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 588591 589955 gene locus_tag LOCUS_28020 588591 589955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 590107 590490 gene locus_tag LOCUS_28030 590107 590490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 590607 591833 gene locus_tag LOCUS_28040 590607 591833 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101427.1 protein_id gnl|my_center|LOCUS_28040 591835 593142 gene locus_tag LOCUS_28050 591835 593142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 593432 594331 gene locus_tag LOCUS_28060 593432 594331 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_28060 594716 595849 gene locus_tag LOCUS_28070 594716 595849 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_28070 596099 596344 gene locus_tag LOCUS_28080 596099 596344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 596608 597585 gene locus_tag LOCUS_28090 596608 597585 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_28090 597805 598446 gene locus_tag LOCUS_28100 597805 598446 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_28100 598954 599928 gene locus_tag LOCUS_28110 gene bfmBAB 598954 599928 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398638.1 protein_id gnl|my_center|LOCUS_28110 599944 601194 gene locus_tag LOCUS_28120 599944 601194 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257660.1 protein_id gnl|my_center|LOCUS_28120 601145 601843 gene locus_tag LOCUS_28130 gene lipB 601145 601843 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_28130 601834 605220 gene locus_tag LOCUS_28140 601834 605220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 605913 607178 gene locus_tag LOCUS_28150 605913 607178 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_28150 608026 608274 gene locus_tag LOCUS_28160 608026 608274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 609140 610171 gene locus_tag LOCUS_28170 609140 610171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28170 610357 610527 gene locus_tag LOCUS_28180 610357 610527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 612079 613296 gene locus_tag LOCUS_28190 612079 613296 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101427.1 protein_id gnl|my_center|LOCUS_28190 613404 614183 gene locus_tag LOCUS_28200 613404 614183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 614763 615353 gene locus_tag LOCUS_28210 614763 615353 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_28210 616230 615367 gene locus_tag LOCUS_28220 616230 615367 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_28220 617944 616232 gene locus_tag LOCUS_28230 617944 616232 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_28230 618300 620624 gene locus_tag LOCUS_28240 618300 620624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 620986 621792 gene locus_tag LOCUS_28250 620986 621792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 622267 622342 gene locus_tag LOCUS_t00370 622267 622342 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 622354 622995 gene locus_tag LOCUS_28260 622354 622995 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_28260 623009 623659 gene locus_tag LOCUS_28270 623009 623659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 623665 624663 gene locus_tag LOCUS_28280 623665 624663 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_28280 624808 625041 gene locus_tag LOCUS_28290 624808 625041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 626104 628710 gene locus_tag LOCUS_28300 626104 628710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 629119 629394 gene locus_tag LOCUS_28310 629119 629394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 629372 629602 gene locus_tag LOCUS_28320 629372 629602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 630820 630011 gene locus_tag LOCUS_28330 gene larE 630820 630011 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_28330 631794 630886 gene locus_tag LOCUS_28340 gene nadA 631794 630886 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_28340 632013 632201 gene locus_tag LOCUS_28350 632013 632201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 632559 634043 gene locus_tag LOCUS_28360 632559 634043 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_28360 634234 634683 gene locus_tag LOCUS_28370 634234 634683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 635511 634711 gene locus_tag LOCUS_28380 635511 634711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 636255 635590 gene locus_tag LOCUS_28390 636255 635590 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_28390 636683 636483 gene locus_tag LOCUS_28400 636683 636483 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_28400 639278 637803 gene locus_tag LOCUS_28410 639278 637803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_28410 640124 639933 gene locus_tag LOCUS_28420 640124 639933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 640349 640630 gene locus_tag LOCUS_28430 640349 640630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 640634 641074 gene locus_tag LOCUS_28440 640634 641074 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_28440 641231 642580 gene locus_tag LOCUS_28450 641231 642580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 644321 642552 gene locus_tag LOCUS_28460 644321 642552 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583735.1 protein_id gnl|my_center|LOCUS_28460 645790 644726 gene locus_tag LOCUS_28470 gene queA 645790 644726 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_28470 646143 646583 gene locus_tag LOCUS_28480 gene mraZ 646143 646583 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_28480 646693 647592 gene locus_tag LOCUS_28490 gene rsmH 646693 647592 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_28490 647594 647959 gene locus_tag LOCUS_28500 647594 647959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 648377 650092 gene locus_tag LOCUS_28510 648377 650092 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_28510 650207 650470 gene locus_tag LOCUS_28520 650207 650470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 650497 651966 gene locus_tag LOCUS_28530 650497 651966 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_28530 651980 653428 gene locus_tag LOCUS_28540 651980 653428 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_28540 653450 654526 gene locus_tag LOCUS_28550 gene mraY 653450 654526 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 protein_id gnl|my_center|LOCUS_28550 654551 655750 gene locus_tag LOCUS_28560 gene spoVE 654551 655750 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_28560 655884 657440 gene locus_tag LOCUS_28570 655884 657440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 657634 658758 gene locus_tag LOCUS_28580 gene murG 657634 658758 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_28580 659127 660521 gene locus_tag LOCUS_28590 gene murC 659127 660521 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_28590 660534 661538 gene locus_tag LOCUS_28600 660534 661538 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_28600 661519 662439 gene locus_tag LOCUS_28610 661519 662439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 662737 662823 gene locus_tag LOCUS_t00380 662737 662823 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 662942 664954 gene locus_tag LOCUS_28620 gene gspD 662942 664954 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326512.1 protein_id gnl|my_center|LOCUS_28620 664967 665434 gene locus_tag LOCUS_28630 664967 665434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 665427 666230 gene locus_tag LOCUS_28640 665427 666230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 666359 667156 gene locus_tag LOCUS_28650 666359 667156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 667369 668637 gene locus_tag LOCUS_28660 667369 668637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 668640 669242 gene locus_tag LOCUS_28670 668640 669242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 669502 670536 gene locus_tag LOCUS_28680 669502 670536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 670787 671077 gene locus_tag LOCUS_28690 670787 671077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 671081 671764 gene locus_tag LOCUS_28700 671081 671764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 672100 673041 gene locus_tag LOCUS_28710 gene mdh 672100 673041 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_28710 673688 674194 gene locus_tag LOCUS_28720 673688 674194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 674588 674782 gene locus_tag LOCUS_28730 674588 674782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 674818 675006 gene locus_tag LOCUS_28740 674818 675006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 675046 675480 gene locus_tag LOCUS_28750 675046 675480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 676455 676826 gene locus_tag LOCUS_28760 676455 676826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 677417 678547 gene locus_tag LOCUS_28770 677417 678547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 678785 678976 gene locus_tag LOCUS_28780 678785 678976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 679883 682021 gene locus_tag LOCUS_28790 679883 682021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 682053 682232 gene locus_tag LOCUS_28800 682053 682232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 683382 682258 gene locus_tag LOCUS_28810 gene alr 683382 682258 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_28810 684572 683397 gene locus_tag LOCUS_28820 684572 683397 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_28820 685799 684798 gene locus_tag LOCUS_28830 gene bioB 685799 684798 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_28830 687100 686015 gene locus_tag LOCUS_28840 687100 686015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 687752 688339 gene locus_tag LOCUS_28850 687752 688339 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_28850 688339 689160 gene locus_tag LOCUS_28860 688339 689160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 689415 690041 gene locus_tag LOCUS_28870 689415 690041 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_28870 691103 690195 gene locus_tag LOCUS_28880 691103 690195 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_28880 691522 691352 gene locus_tag LOCUS_28890 691522 691352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 692065 693219 gene locus_tag LOCUS_28900 692065 693219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28900 693207 694754 gene locus_tag LOCUS_28910 693207 694754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28910 696146 695031 gene locus_tag LOCUS_28920 696146 695031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 696597 696352 gene locus_tag LOCUS_28930 696597 696352 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963300.1 protein_id gnl|my_center|LOCUS_28930 696906 696628 gene locus_tag LOCUS_28940 696906 696628 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615953.1 protein_id gnl|my_center|LOCUS_28940 697656 697138 gene locus_tag LOCUS_28950 697656 697138 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_28950 698374 699162 gene locus_tag LOCUS_28960 698374 699162 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_28960 699577 700773 gene locus_tag LOCUS_28970 699577 700773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 702577 703530 gene locus_tag LOCUS_28980 702577 703530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 703636 703965 gene locus_tag LOCUS_28990 703636 703965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 704175 703933 gene locus_tag LOCUS_29000 704175 703933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 704828 706327 gene locus_tag LOCUS_29010 704828 706327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 706658 706858 gene locus_tag LOCUS_29020 706658 706858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 706855 707073 gene locus_tag LOCUS_29030 706855 707073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 708072 707743 gene locus_tag LOCUS_29040 708072 707743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 708398 708063 gene locus_tag LOCUS_29050 708398 708063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 708769 708464 gene locus_tag LOCUS_29060 708769 708464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 709324 710109 gene locus_tag LOCUS_29070 709324 710109 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_29070 710543 710779 gene locus_tag LOCUS_29080 710543 710779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 710784 710987 gene locus_tag LOCUS_29090 710784 710987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 711056 711382 gene locus_tag LOCUS_29100 711056 711382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 711485 711994 gene locus_tag LOCUS_29110 711485 711994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 712076 712534 gene locus_tag LOCUS_29120 712076 712534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 712728 713111 gene locus_tag LOCUS_29130 712728 713111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 713154 713516 gene locus_tag LOCUS_29140 713154 713516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 713713 713925 gene locus_tag LOCUS_29150 713713 713925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 714754 714924 gene locus_tag LOCUS_29160 714754 714924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 717957 715765 gene locus_tag LOCUS_29170 gene rnr 717957 715765 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_29170 719228 718284 gene locus_tag LOCUS_29180 719228 718284 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_29180 719987 720145 gene locus_tag LOCUS_29190 719987 720145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 721634 720333 gene locus_tag LOCUS_29200 721634 720333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 721851 721675 gene locus_tag LOCUS_29210 721851 721675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29210 722381 721908 gene locus_tag LOCUS_29220 722381 721908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 722813 723841 gene locus_tag LOCUS_29230 722813 723841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 723988 725349 gene locus_tag LOCUS_29240 723988 725349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 725399 726430 gene locus_tag LOCUS_29250 gene galT 725399 726430 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_29250 726427 727890 gene locus_tag LOCUS_29260 726427 727890 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_29260 728158 729867 gene locus_tag LOCUS_29270 728158 729867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 729891 730274 gene locus_tag LOCUS_29280 729891 730274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 730258 731490 gene locus_tag LOCUS_29290 gene glgC 730258 731490 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_29290 731849 731541 gene locus_tag LOCUS_29300 731849 731541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 732460 733140 gene locus_tag LOCUS_29310 732460 733140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 733522 734310 gene locus_tag LOCUS_29320 733522 734310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 734508 735983 gene locus_tag LOCUS_29330 734508 735983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 736101 737528 gene locus_tag LOCUS_29340 736101 737528 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976528.1 protein_id gnl|my_center|LOCUS_29340 737804 739471 gene locus_tag LOCUS_29350 737804 739471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 739679 740098 gene locus_tag LOCUS_29360 739679 740098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 740229 741665 gene locus_tag LOCUS_29370 740229 741665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 741828 742814 gene locus_tag LOCUS_29380 741828 742814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 742811 743140 gene locus_tag LOCUS_29390 742811 743140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 743685 744659 gene locus_tag LOCUS_29400 743685 744659 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_29400 744726 745817 gene locus_tag LOCUS_29410 744726 745817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 745821 748379 gene locus_tag LOCUS_29420 745821 748379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 748476 749531 gene locus_tag LOCUS_29430 748476 749531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 749606 749923 gene locus_tag LOCUS_29440 749606 749923 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964910.1 protein_id gnl|my_center|LOCUS_29440 750335 750997 gene locus_tag LOCUS_29450 750335 750997 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459001.1 protein_id gnl|my_center|LOCUS_29450 751000 753291 gene locus_tag LOCUS_29460 751000 753291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 753811 754281 gene locus_tag LOCUS_29470 753811 754281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 754457 756208 gene locus_tag LOCUS_29480 754457 756208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 756162 756713 gene locus_tag LOCUS_29490 756162 756713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 757262 757921 gene locus_tag LOCUS_29500 757262 757921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 757985 759625 gene locus_tag LOCUS_29510 757985 759625 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_29510 759622 760698 gene locus_tag LOCUS_29520 759622 760698 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_29520 760702 762048 gene locus_tag LOCUS_29530 760702 762048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 762045 763115 gene locus_tag LOCUS_29540 762045 763115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 763240 763395 gene locus_tag LOCUS_29550 763240 763395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 763392 763844 gene locus_tag LOCUS_29560 763392 763844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 763841 764362 gene locus_tag LOCUS_29570 763841 764362 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_29570 764346 767603 gene locus_tag LOCUS_29580 764346 767603 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_29580 768433 768242 gene locus_tag LOCUS_29590 768433 768242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 769729 768536 gene locus_tag LOCUS_29600 gene lhgO 769729 768536 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_29600 770273 771034 gene locus_tag LOCUS_29610 gene cobK 770273 771034 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_29610 771132 771287 gene locus_tag LOCUS_29620 771132 771287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 771365 772024 gene locus_tag LOCUS_29630 771365 772024 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_29630 772086 773243 gene locus_tag LOCUS_29640 772086 773243 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_29640 774897 773356 gene locus_tag LOCUS_29650 774897 773356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 775773 775141 gene locus_tag LOCUS_29660 775773 775141 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_29660 777893 776259 gene locus_tag LOCUS_29670 777893 776259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 778549 778253 gene locus_tag LOCUS_29680 778549 778253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 779264 778959 gene locus_tag LOCUS_29690 779264 778959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 781635 779605 gene locus_tag LOCUS_29700 781635 779605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 781984 781703 gene locus_tag LOCUS_29710 781984 781703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 782014 783336 gene locus_tag LOCUS_29720 782014 783336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29720 784771 784541 gene locus_tag LOCUS_29730 784771 784541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 787164 785920 gene locus_tag LOCUS_29740 gene icd 787164 785920 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_29740 787594 787854 gene locus_tag LOCUS_29750 787594 787854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 787903 788352 gene locus_tag LOCUS_29760 gene fabZ 787903 788352 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456699.1 protein_id gnl|my_center|LOCUS_29760 788371 789591 gene locus_tag LOCUS_29770 gene fabF 788371 789591 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_29770 789690 790928 gene locus_tag LOCUS_29780 gene fabF 789690 790928 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938500.1 protein_id gnl|my_center|LOCUS_29780 790934 792403 gene locus_tag LOCUS_29790 gene crtI 790934 792403 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_29790 792408 793868 gene locus_tag LOCUS_29800 792408 793868 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_29800 793927 794055 gene locus_tag LOCUS_29810 793927 794055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 794056 795480 gene locus_tag LOCUS_29820 gene lpdA 794056 795480 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_29820 795977 795795 gene locus_tag LOCUS_29830 795977 795795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 796335 795931 gene locus_tag LOCUS_29840 796335 795931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29840 796820 796266 gene locus_tag LOCUS_29850 796820 796266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29850 797130 796837 gene locus_tag LOCUS_29860 797130 796837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29860 797702 797154 gene locus_tag LOCUS_29870 797702 797154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 798479 798225 gene locus_tag LOCUS_29880 798479 798225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29880 799930 799739 gene locus_tag LOCUS_29890 799930 799739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 800836 801141 gene locus_tag LOCUS_29900 800836 801141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 801138 801380 gene locus_tag LOCUS_29910 801138 801380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 801420 801704 gene locus_tag LOCUS_29920 801420 801704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 801717 802613 gene locus_tag LOCUS_29930 801717 802613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 802844 803011 gene locus_tag LOCUS_29940 802844 803011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 803160 804218 gene locus_tag LOCUS_29950 803160 804218 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_29950 804802 804542 gene locus_tag LOCUS_29960 804802 804542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 804912 805430 gene locus_tag LOCUS_29970 804912 805430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 805971 806198 gene locus_tag LOCUS_29980 805971 806198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29980 807103 806405 gene locus_tag LOCUS_29990 807103 806405 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_29990 808812 807124 gene locus_tag LOCUS_30000 gene ispH 808812 807124 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_30000 809175 809903 gene locus_tag LOCUS_30010 809175 809903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 810033 811331 gene locus_tag LOCUS_30020 810033 811331 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_30020 811971 811345 gene locus_tag LOCUS_30030 811971 811345 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_30030 813237 811981 gene locus_tag LOCUS_30040 gene dacB 813237 811981 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_30040 813932 813510 gene locus_tag LOCUS_30050 813932 813510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 814552 814109 gene locus_tag LOCUS_30060 gene smpB 814552 814109 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_30060 814936 815021 gene locus_tag LOCUS_t00390 814936 815021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 816019 816489 gene locus_tag LOCUS_30070 gene bfr 816019 816489 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_30070 816886 817125 gene locus_tag LOCUS_30080 816886 817125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 817519 817680 gene locus_tag LOCUS_30090 817519 817680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 819284 817911 gene locus_tag LOCUS_30100 819284 817911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 819627 820217 gene locus_tag LOCUS_30110 819627 820217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 820374 821117 gene locus_tag LOCUS_30120 gene fabG 820374 821117 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_30120 821483 821827 gene locus_tag LOCUS_30130 821483 821827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 822143 822910 gene locus_tag LOCUS_30140 822143 822910 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_30140 823945 823652 gene locus_tag LOCUS_30150 823945 823652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30150 824314 824039 gene locus_tag LOCUS_30160 824314 824039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30160 825603 825163 gene locus_tag LOCUS_30170 825603 825163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 828197 828394 gene locus_tag LOCUS_30180 828197 828394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 829311 828769 gene locus_tag LOCUS_30190 829311 828769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 829389 829547 gene locus_tag LOCUS_30200 829389 829547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 829683 829874 gene locus_tag LOCUS_30210 829683 829874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 830085 829831 gene locus_tag LOCUS_30220 830085 829831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 831702 831998 gene locus_tag LOCUS_30230 831702 831998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 832238 832393 gene locus_tag LOCUS_30240 832238 832393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 832390 832554 gene locus_tag LOCUS_30250 832390 832554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 833546 833364 gene locus_tag LOCUS_30260 833546 833364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 833699 834151 gene locus_tag LOCUS_30270 833699 834151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 834299 834108 gene locus_tag LOCUS_30280 834299 834108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 834595 834287 gene locus_tag LOCUS_30290 834595 834287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 835101 834874 gene locus_tag LOCUS_30300 835101 834874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 835033 835251 gene locus_tag LOCUS_30310 835033 835251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 838191 836356 gene locus_tag LOCUS_30320 838191 836356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 838840 838199 gene locus_tag LOCUS_30330 838840 838199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 839130 838825 gene locus_tag LOCUS_30340 839130 838825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 840006 839152 gene locus_tag LOCUS_30350 840006 839152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 842173 840077 gene locus_tag LOCUS_30360 842173 840077 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_30360 842872 843231 gene locus_tag LOCUS_30370 842872 843231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 843259 843624 gene locus_tag LOCUS_30380 843259 843624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 843612 844199 gene locus_tag LOCUS_30390 843612 844199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 844356 845546 gene locus_tag LOCUS_30400 844356 845546 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_30400 846016 846714 gene locus_tag LOCUS_30410 846016 846714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882802.1 protein_id gnl|my_center|LOCUS_30410 848581 846749 gene locus_tag LOCUS_30420 848581 846749 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_30420 849040 849642 gene locus_tag LOCUS_30430 849040 849642 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943370.1 protein_id gnl|my_center|LOCUS_30430 849798 850868 gene locus_tag LOCUS_30440 849798 850868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_30440 850873 853989 gene locus_tag LOCUS_30450 850873 853989 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_30450 854935 855123 gene locus_tag LOCUS_30460 854935 855123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 855670 855155 gene locus_tag LOCUS_30470 855670 855155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 856138 856341 gene locus_tag LOCUS_30480 856138 856341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 857039 856350 gene locus_tag LOCUS_30490 857039 856350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 858533 858946 gene locus_tag LOCUS_30500 858533 858946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 859222 860592 gene locus_tag LOCUS_30510 859222 860592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 860641 860886 gene locus_tag LOCUS_30520 860641 860886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 860914 862533 gene locus_tag LOCUS_30530 860914 862533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 863337 863648 gene locus_tag LOCUS_30540 863337 863648 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_30540 867115 864275 gene locus_tag LOCUS_30550 867115 864275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 867972 867139 gene locus_tag LOCUS_30560 867972 867139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 869893 868193 gene locus_tag LOCUS_30570 869893 868193 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_30570 870905 870078 gene locus_tag LOCUS_30580 870905 870078 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_30580 871415 870909 gene locus_tag LOCUS_30590 871415 870909 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_30590 873080 871692 gene locus_tag LOCUS_30600 873080 871692 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_30600 874124 873108 gene locus_tag LOCUS_30610 gene fbp 874124 873108 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_30610 874786 874388 gene locus_tag LOCUS_30620 874786 874388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 875084 874743 gene locus_tag LOCUS_30630 875084 874743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 875327 875103 gene locus_tag LOCUS_30640 875327 875103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 875615 876148 gene locus_tag LOCUS_30650 875615 876148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 876308 876111 gene locus_tag LOCUS_30660 876308 876111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 876760 876338 gene locus_tag LOCUS_30670 876760 876338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 876992 876747 gene locus_tag LOCUS_30680 876992 876747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 877450 877022 gene locus_tag LOCUS_30690 877450 877022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 877783 877505 gene locus_tag LOCUS_30700 877783 877505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 878450 877890 gene locus_tag LOCUS_30710 878450 877890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 879147 878455 gene locus_tag LOCUS_30720 879147 878455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 880277 879144 gene locus_tag LOCUS_30730 880277 879144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 881015 880659 gene locus_tag LOCUS_30740 881015 880659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 882695 881046 gene locus_tag LOCUS_30750 882695 881046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence04 172 558 gene locus_tag LOCUS_30760 172 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 545 3943 gene locus_tag LOCUS_30770 545 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 5004 4078 gene locus_tag LOCUS_30780 5004 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 5415 5053 gene locus_tag LOCUS_30790 5415 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 6323 7909 gene locus_tag LOCUS_r00010 6323 7909 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7992 8069 gene locus_tag LOCUS_t00400 7992 8069 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8096 8171 gene locus_tag LOCUS_t00410 8096 8171 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8391 11382 gene locus_tag LOCUS_r00020 8391 11382 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11561 11663 gene locus_tag LOCUS_r00030 11561 11663 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11809 12261 gene locus_tag LOCUS_30800 11809 12261 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_30800 12288 12521 gene locus_tag LOCUS_30810 gene rpmB 12288 12521 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_30810 12552 12839 gene locus_tag LOCUS_30820 gene gatC 12552 12839 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_30820 12865 14325 gene locus_tag LOCUS_30830 gene gatA 12865 14325 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242878.1 protein_id gnl|my_center|LOCUS_30830 14356 15798 gene locus_tag LOCUS_30840 gene gatB 14356 15798 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_30840 16039 16305 gene locus_tag LOCUS_30850 16039 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 16686 17459 gene locus_tag LOCUS_30860 16686 17459 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 protein_id gnl|my_center|LOCUS_30860 17602 18651 gene locus_tag LOCUS_30870 gene mtnA 17602 18651 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_30870 19040 19321 gene locus_tag LOCUS_30880 19040 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 20758 19634 gene locus_tag LOCUS_30890 20758 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 20830 21072 gene locus_tag LOCUS_30900 20830 21072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 22886 21078 gene locus_tag LOCUS_30910 22886 21078 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_30910 23609 23220 gene locus_tag LOCUS_30920 23609 23220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 23852 25189 gene locus_tag LOCUS_30930 gene thrC 23852 25189 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_30930 25303 26352 gene locus_tag LOCUS_30940 25303 26352 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_30940 26538 27302 gene locus_tag LOCUS_30950 26538 27302 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_30950 28604 28855 gene locus_tag LOCUS_30960 28604 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 30329 30003 gene locus_tag LOCUS_30970 30329 30003 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_30970 31030 30326 gene locus_tag LOCUS_30980 31030 30326 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_30980 31470 31027 gene locus_tag LOCUS_30990 31470 31027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 32264 32521 gene locus_tag LOCUS_31000 32264 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 33598 34773 gene locus_tag LOCUS_31010 33598 34773 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496601.1 protein_id gnl|my_center|LOCUS_31010 34959 36728 gene locus_tag LOCUS_31020 34959 36728 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_31020 37487 36741 gene locus_tag LOCUS_31030 37487 36741 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_31030 38739 37549 gene locus_tag LOCUS_31040 38739 37549 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_31040 39230 40987 gene locus_tag LOCUS_31050 gene ftsH 39230 40987 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_31050 41123 41620 gene locus_tag LOCUS_31060 41123 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 42095 42310 gene locus_tag LOCUS_31070 42095 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 42303 43349 gene locus_tag LOCUS_31080 42303 43349 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140560.1 protein_id gnl|my_center|LOCUS_31080 43698 46028 gene locus_tag LOCUS_31090 43698 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 46250 48370 gene locus_tag LOCUS_31100 46250 48370 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_31100 48538 49608 gene locus_tag LOCUS_31110 48538 49608 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545048.1 protein_id gnl|my_center|LOCUS_31110 51305 50034 gene locus_tag LOCUS_31120 gene thiC 51305 50034 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_31120 52056 51274 gene locus_tag LOCUS_31130 52056 51274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 53902 52187 gene locus_tag LOCUS_31140 gene recN 53902 52187 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_31140 54283 53957 gene locus_tag LOCUS_31150 54283 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 55159 54425 gene locus_tag LOCUS_31160 gene truA 55159 54425 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_31160 55539 55922 gene locus_tag LOCUS_31170 55539 55922 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_31170 56032 57777 gene locus_tag LOCUS_31180 56032 57777 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_31180 57810 58286 gene locus_tag LOCUS_31190 gene ispF 57810 58286 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_31190 58310 59002 gene locus_tag LOCUS_31200 58310 59002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 60602 59283 gene locus_tag LOCUS_31210 gene serS 60602 59283 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_31210 61937 64222 gene locus_tag LOCUS_31220 61937 64222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 64267 64557 gene locus_tag LOCUS_31230 64267 64557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 64762 66588 gene locus_tag LOCUS_31240 gene glmS 64762 66588 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_31240 67273 67842 gene locus_tag LOCUS_31250 67273 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 68637 71189 gene locus_tag LOCUS_31260 68637 71189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 72470 73048 gene locus_tag LOCUS_31270 72470 73048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31270 72996 73772 gene locus_tag LOCUS_31280 72996 73772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31280 74176 74415 gene locus_tag LOCUS_31290 74176 74415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 77187 77378 gene locus_tag LOCUS_31300 77187 77378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31300 77706 77437 gene locus_tag LOCUS_31310 77706 77437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 77946 78089 gene locus_tag LOCUS_31320 77946 78089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 78538 79704 gene locus_tag LOCUS_31330 gene gmd 78538 79704 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_31330 80051 80890 gene locus_tag LOCUS_31340 80051 80890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_31340 80996 81358 gene locus_tag LOCUS_31350 80996 81358 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_31350 81416 82726 gene locus_tag LOCUS_31360 81416 82726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_31360 82726 83175 gene locus_tag LOCUS_31370 82726 83175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 83196 84467 gene locus_tag LOCUS_31380 83196 84467 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 protein_id gnl|my_center|LOCUS_31380 84470 85999 gene locus_tag LOCUS_31390 84470 85999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 86047 86919 gene locus_tag LOCUS_31400 gene gmd 86047 86919 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771834.1 protein_id gnl|my_center|LOCUS_31400 87276 88256 gene locus_tag LOCUS_31410 87276 88256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 88253 89386 gene locus_tag LOCUS_31420 88253 89386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 89549 90751 gene locus_tag LOCUS_31430 89549 90751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 90751 91119 gene locus_tag LOCUS_31440 90751 91119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 91251 92096 gene locus_tag LOCUS_31450 91251 92096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 92171 93061 gene locus_tag LOCUS_31460 92171 93061 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_31460 93079 93228 gene locus_tag LOCUS_31470 93079 93228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 93351 94481 gene locus_tag LOCUS_31480 93351 94481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 94555 95304 gene locus_tag LOCUS_31490 94555 95304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 95956 95732 gene locus_tag LOCUS_31500 95956 95732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 96322 96032 gene locus_tag LOCUS_31510 96322 96032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 96321 96791 gene locus_tag LOCUS_31520 96321 96791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 96827 97621 gene locus_tag LOCUS_31530 96827 97621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 97618 98412 gene locus_tag LOCUS_31540 97618 98412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 98470 99078 gene locus_tag LOCUS_31550 98470 99078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 99291 100340 gene locus_tag LOCUS_31560 99291 100340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_31560 100425 101090 gene locus_tag LOCUS_31570 100425 101090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 102176 102691 gene locus_tag LOCUS_31580 102176 102691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 102738 103682 gene locus_tag LOCUS_31590 102738 103682 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_31590 103869 104555 gene locus_tag LOCUS_31600 103869 104555 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085895.1 protein_id gnl|my_center|LOCUS_31600 104678 105796 gene locus_tag LOCUS_31610 104678 105796 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_31610 105851 107026 gene locus_tag LOCUS_31620 105851 107026 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_31620 108154 108552 gene locus_tag LOCUS_31630 108154 108552 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_31630 108957 109136 gene locus_tag LOCUS_31640 108957 109136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 109133 109375 gene locus_tag LOCUS_31650 109133 109375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 109653 109913 gene locus_tag LOCUS_31660 109653 109913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 110299 110652 gene locus_tag LOCUS_31670 110299 110652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 110820 113627 gene locus_tag LOCUS_31680 110820 113627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 113868 115031 gene locus_tag LOCUS_31690 gene wlbF 113868 115031 CDS product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 protein_id gnl|my_center|LOCUS_31690 115060 115272 gene locus_tag LOCUS_31700 115060 115272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 115525 115809 gene locus_tag LOCUS_31710 115525 115809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 115970 115806 gene locus_tag LOCUS_31720 115970 115806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31720 116514 116753 gene locus_tag LOCUS_31730 116514 116753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 116887 117249 gene locus_tag LOCUS_31740 116887 117249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 118577 118233 gene locus_tag LOCUS_31750 118577 118233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 119254 120585 gene locus_tag LOCUS_31760 119254 120585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 121121 121996 gene locus_tag LOCUS_31770 121121 121996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 122121 122252 gene locus_tag LOCUS_31780 122121 122252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 122734 123876 gene locus_tag LOCUS_31790 122734 123876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 123895 127149 gene locus_tag LOCUS_31800 123895 127149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 127455 128030 gene locus_tag LOCUS_31810 127455 128030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 128515 128240 gene locus_tag LOCUS_31820 128515 128240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 130492 131877 gene locus_tag LOCUS_31830 130492 131877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 132337 132789 gene locus_tag LOCUS_31840 132337 132789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 132882 133133 gene locus_tag LOCUS_31850 132882 133133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 135212 133569 gene locus_tag LOCUS_31860 135212 133569 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_31860 136608 135238 gene locus_tag LOCUS_31870 136608 135238 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_31870 138093 137137 gene locus_tag LOCUS_31880 138093 137137 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_31880 140174 138426 gene locus_tag LOCUS_31890 140174 138426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 140672 143713 gene locus_tag LOCUS_31900 140672 143713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 144609 144142 gene locus_tag LOCUS_31910 144609 144142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 144937 144626 gene locus_tag LOCUS_31920 144937 144626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 145680 145495 gene locus_tag LOCUS_31930 145680 145495 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_31930 147219 146113 gene locus_tag LOCUS_31940 gene rlmN 147219 146113 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_31940 148938 147319 gene locus_tag LOCUS_31950 gene murJ 148938 147319 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_31950 150660 149146 gene locus_tag LOCUS_31960 150660 149146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 151369 150809 gene locus_tag LOCUS_31970 151369 150809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 151827 154199 gene locus_tag LOCUS_31980 151827 154199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 154189 154818 gene locus_tag LOCUS_31990 154189 154818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 154856 156379 gene locus_tag LOCUS_32000 gene rfaE1 154856 156379 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_32000 156483 157082 gene locus_tag LOCUS_32010 156483 157082 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_32010 157079 157642 gene locus_tag LOCUS_32020 gene gmhB 157079 157642 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_32020 159425 158022 gene locus_tag LOCUS_32030 159425 158022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 159472 159810 gene locus_tag LOCUS_32040 159472 159810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 160060 161730 gene locus_tag LOCUS_32050 160060 161730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 162056 162364 gene locus_tag LOCUS_32060 162056 162364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 163140 163511 gene locus_tag LOCUS_32070 163140 163511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 163696 164196 gene locus_tag LOCUS_32080 163696 164196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 164931 165134 gene locus_tag LOCUS_32090 164931 165134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 165897 166241 gene locus_tag LOCUS_32100 165897 166241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 167714 167481 gene locus_tag LOCUS_32110 167714 167481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 169862 168588 gene locus_tag LOCUS_32120 gene murA 169862 168588 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_32120 170814 169843 gene locus_tag LOCUS_32130 gene prmC 170814 169843 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_32130 172030 170951 gene locus_tag LOCUS_32140 gene prfA 172030 170951 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_32140 172273 172043 gene locus_tag LOCUS_32150 gene rpmE 172273 172043 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_32150 172679 174031 gene locus_tag LOCUS_32160 gene ffh 172679 174031 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 protein_id gnl|my_center|LOCUS_32160 174053 174310 gene locus_tag LOCUS_32170 174053 174310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 174314 174994 gene locus_tag LOCUS_32180 gene trmD 174314 174994 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967234.1 protein_id gnl|my_center|LOCUS_32180 175035 175382 gene locus_tag LOCUS_32190 gene rplS 175035 175382 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_32190 175516 175965 gene locus_tag LOCUS_32200 175516 175965 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_32200 176210 177625 gene locus_tag LOCUS_32210 176210 177625 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_32210 177612 178100 gene locus_tag LOCUS_32220 177612 178100 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_32220 178489 179514 gene locus_tag LOCUS_32230 178489 179514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 179511 180614 gene locus_tag LOCUS_32240 179511 180614 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_32240 180690 181373 gene locus_tag LOCUS_32250 180690 181373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 181367 182785 gene locus_tag LOCUS_32260 181367 182785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 182798 184435 gene locus_tag LOCUS_32270 gene nqrF 182798 184435 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648666.1 protein_id gnl|my_center|LOCUS_32270 184691 185593 gene locus_tag LOCUS_32280 gene murB 184691 185593 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598636.1 protein_id gnl|my_center|LOCUS_32280 185629 186120 gene locus_tag LOCUS_32290 185629 186120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 187219 186266 gene locus_tag LOCUS_32300 187219 186266 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_32300 188469 187282 gene locus_tag LOCUS_32310 188469 187282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 190011 188971 gene locus_tag LOCUS_32320 190011 188971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 191455 190001 gene locus_tag LOCUS_32330 gene crtH 191455 190001 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_32330 193851 191452 gene locus_tag LOCUS_32340 193851 191452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 194833 193985 gene locus_tag LOCUS_32350 194833 193985 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_32350 195270 194830 gene locus_tag LOCUS_32360 gene fabZ 195270 194830 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565430.1 protein_id gnl|my_center|LOCUS_32360 195524 195267 gene locus_tag LOCUS_32370 195524 195267 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_32370 196273 195521 gene locus_tag LOCUS_32380 gene fabG 196273 195521 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_32380 197619 196258 gene locus_tag LOCUS_32390 197619 196258 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_32390 198668 197616 gene locus_tag LOCUS_32400 gene nirJ2 198668 197616 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_32400 199968 198661 gene locus_tag LOCUS_32410 199968 198661 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_32410 200552 199965 gene locus_tag LOCUS_32420 200552 199965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 201730 200549 gene locus_tag LOCUS_32430 gene fabF 201730 200549 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_32430 202788 201727 gene locus_tag LOCUS_32440 202788 201727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 203875 202814 gene locus_tag LOCUS_32450 gene fabF 203875 202814 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 protein_id gnl|my_center|LOCUS_32450 205077 203863 gene locus_tag LOCUS_32460 gene fabF 205077 203863 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_32460 206095 205271 gene locus_tag LOCUS_32470 206095 205271 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024069.1 protein_id gnl|my_center|LOCUS_32470 206883 206092 gene locus_tag LOCUS_32480 206883 206092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 209190 207097 gene locus_tag LOCUS_32490 209190 207097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 210116 209655 gene locus_tag LOCUS_32500 210116 209655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_32500 210399 210103 gene locus_tag LOCUS_32510 210399 210103 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_32510 211830 210667 gene locus_tag LOCUS_32520 211830 210667 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_32520 213151 211808 gene locus_tag LOCUS_32530 213151 211808 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_32530 213942 213376 gene locus_tag LOCUS_32540 213942 213376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 214892 214011 gene locus_tag LOCUS_32550 214892 214011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 215964 214906 gene locus_tag LOCUS_32560 215964 214906 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546289.1 protein_id gnl|my_center|LOCUS_32560 216589 215957 gene locus_tag LOCUS_32570 216589 215957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 217323 216589 gene locus_tag LOCUS_32580 217323 216589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 218175 217456 gene locus_tag LOCUS_32590 218175 217456 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_32590 219351 218914 gene locus_tag LOCUS_32600 219351 218914 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_32600 219892 219404 gene locus_tag LOCUS_32610 219892 219404 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771036.1 protein_id gnl|my_center|LOCUS_32610 220080 220304 gene locus_tag LOCUS_32620 220080 220304 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_32620 220923 220315 gene locus_tag LOCUS_32630 220923 220315 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_32630 221222 221043 gene locus_tag LOCUS_32640 221222 221043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 222723 221146 gene locus_tag LOCUS_32650 gene purH 222723 221146 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_32650 223681 222746 gene locus_tag LOCUS_32660 223681 222746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 224436 223834 gene locus_tag LOCUS_32670 224436 223834 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_32670 224887 224441 gene locus_tag LOCUS_32680 gene mlaD 224887 224441 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_32680 225845 225099 gene locus_tag LOCUS_32690 225845 225099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_32690 226536 225859 gene locus_tag LOCUS_32700 226536 225859 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_32700 227824 226976 gene locus_tag LOCUS_32710 gene floA 227824 226976 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_32710 229175 228159 gene locus_tag LOCUS_32720 229175 228159 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_32720 232075 229463 gene locus_tag LOCUS_32730 gene mutS 232075 229463 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_32730 232539 232072 gene locus_tag LOCUS_32740 232539 232072 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060865.1 protein_id gnl|my_center|LOCUS_32740 233654 232656 gene locus_tag LOCUS_32750 233654 232656 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_32750 235065 233920 gene locus_tag LOCUS_32760 235065 233920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 235563 235811 gene locus_tag LOCUS_32770 235563 235811 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_32770 235812 236036 gene locus_tag LOCUS_32780 235812 236036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 236169 238460 gene locus_tag LOCUS_32790 gene bcsA 236169 238460 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880909.1 protein_id gnl|my_center|LOCUS_32790 238457 239767 gene locus_tag LOCUS_32800 238457 239767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 239845 240600 gene locus_tag LOCUS_32810 239845 240600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 240593 241627 gene locus_tag LOCUS_32820 240593 241627 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972929.1 protein_id gnl|my_center|LOCUS_32820 241835 245665 gene locus_tag LOCUS_32830 241835 245665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 246049 246228 gene locus_tag LOCUS_32840 246049 246228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 247218 246574 gene locus_tag LOCUS_32850 247218 246574 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_32850 248808 247243 gene locus_tag LOCUS_32860 248808 247243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 249707 248811 gene locus_tag LOCUS_32870 gene era 249707 248811 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_32870 250576 249797 gene locus_tag LOCUS_32880 gene udp 250576 249797 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419708.1 protein_id gnl|my_center|LOCUS_32880 250971 252293 gene locus_tag LOCUS_32890 gene hisD 250971 252293 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_32890 252350 253417 gene locus_tag LOCUS_32900 gene hisC 252350 253417 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_32900 253616 254053 gene locus_tag LOCUS_32910 253616 254053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 254721 254083 gene locus_tag LOCUS_32920 254721 254083 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261708.1 protein_id gnl|my_center|LOCUS_32920 255488 254994 gene locus_tag LOCUS_32930 255488 254994 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278813.1 protein_id gnl|my_center|LOCUS_32930 255749 257197 gene locus_tag LOCUS_32940 gene tilS 255749 257197 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_32940 259159 257327 gene locus_tag LOCUS_32950 259159 257327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 260864 259449 gene locus_tag LOCUS_32960 260864 259449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 261296 262834 gene locus_tag LOCUS_32970 261296 262834 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_32970 264259 263066 gene locus_tag LOCUS_32980 gene nifS 264259 263066 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_32980 265110 264256 gene locus_tag LOCUS_32990 gene nifU 265110 264256 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_32990 265693 267072 gene locus_tag LOCUS_33000 265693 267072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 267142 268125 gene locus_tag LOCUS_33010 gene pstS 267142 268125 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_33010 268257 270521 gene locus_tag LOCUS_33020 268257 270521 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_33020 270518 272119 gene locus_tag LOCUS_33030 gene pstA 270518 272119 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_33030 272184 272951 gene locus_tag LOCUS_33040 gene pstB 272184 272951 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 protein_id gnl|my_center|LOCUS_33040 273083 273748 gene locus_tag LOCUS_33050 gene phoU 273083 273748 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_33050 274967 273894 gene locus_tag LOCUS_33060 274967 273894 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_33060 278646 275314 gene locus_tag LOCUS_33070 278646 275314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 279322 279134 gene locus_tag LOCUS_33080 279322 279134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 280433 279426 gene locus_tag LOCUS_33090 280433 279426 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_33090 280732 283113 gene locus_tag LOCUS_33100 280732 283113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 283696 283277 gene locus_tag LOCUS_33110 283696 283277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 283920 283792 gene locus_tag LOCUS_33120 283920 283792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 285481 284612 gene locus_tag LOCUS_33130 285481 284612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 287319 285478 gene locus_tag LOCUS_33140 287319 285478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 288654 287779 gene locus_tag LOCUS_33150 288654 287779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 289585 288671 gene locus_tag LOCUS_33160 289585 288671 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_33160 290737 289742 gene locus_tag LOCUS_33170 290737 289742 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_33170 291430 290915 gene locus_tag LOCUS_33180 291430 290915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 292472 291495 gene locus_tag LOCUS_33190 292472 291495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 293427 292546 gene locus_tag LOCUS_33200 293427 292546 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_33200 294426 293437 gene locus_tag LOCUS_33210 294426 293437 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_33210 295116 295460 gene locus_tag LOCUS_33220 295116 295460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 295541 296584 gene locus_tag LOCUS_33230 gene rtcA 295541 296584 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_33230 296931 296674 gene locus_tag LOCUS_33240 296931 296674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 297395 297472 gene locus_tag LOCUS_t00420 297395 297472 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 300095 297561 gene locus_tag LOCUS_33250 300095 297561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 301895 300369 gene locus_tag LOCUS_33260 gene cobA 301895 300369 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_33260 304362 302578 gene locus_tag LOCUS_33270 304362 302578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 306091 304349 gene locus_tag LOCUS_33280 306091 304349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 306174 306476 gene locus_tag LOCUS_33290 306174 306476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 307173 306649 gene locus_tag LOCUS_33300 307173 306649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 308168 307179 gene locus_tag LOCUS_33310 308168 307179 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_33310 309652 308618 gene locus_tag LOCUS_33320 309652 308618 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_33320 309820 310083 gene locus_tag LOCUS_33330 309820 310083 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_33330 311059 310229 gene locus_tag LOCUS_33340 311059 310229 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_33340 311546 311130 gene locus_tag LOCUS_33350 311546 311130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 311994 311521 gene locus_tag LOCUS_33360 311994 311521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 313653 312307 gene locus_tag LOCUS_33370 gene glnA 313653 312307 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_33370 314050 314253 gene locus_tag LOCUS_33380 314050 314253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 314775 315479 gene locus_tag LOCUS_33390 gene rpsB 314775 315479 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_33390 315666 316253 gene locus_tag LOCUS_33400 gene tsf 315666 316253 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_33400 316267 317010 gene locus_tag LOCUS_33410 gene pyrH 316267 317010 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810668.1 protein_id gnl|my_center|LOCUS_33410 317016 317576 gene locus_tag LOCUS_33420 gene frr 317016 317576 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_33420 317662 317736 gene locus_tag LOCUS_t00430 317662 317736 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 317754 317830 gene locus_tag LOCUS_t00440 317754 317830 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 318694 318188 gene locus_tag LOCUS_33430 318694 318188 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_33430 319147 318698 gene locus_tag LOCUS_33440 319147 318698 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 protein_id gnl|my_center|LOCUS_33440 319625 319825 gene locus_tag LOCUS_33450 319625 319825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 320146 321420 gene locus_tag LOCUS_33460 320146 321420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 321562 321398 gene locus_tag LOCUS_33470 321562 321398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 322238 321588 gene locus_tag LOCUS_33480 gene lexA 322238 321588 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_33480 322347 322574 gene locus_tag LOCUS_33490 322347 322574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 322456 322701 gene locus_tag LOCUS_33500 322456 322701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 322719 322925 gene locus_tag LOCUS_33510 322719 322925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 323217 324560 gene locus_tag LOCUS_33520 gene murD 323217 324560 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_33520 325336 325025 gene locus_tag LOCUS_33530 325336 325025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 325782 325522 gene locus_tag LOCUS_33540 325782 325522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 325886 326065 gene locus_tag LOCUS_33550 325886 326065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 327634 328881 gene locus_tag LOCUS_33560 327634 328881 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_33560 328866 329474 gene locus_tag LOCUS_33570 328866 329474 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250376.1 protein_id gnl|my_center|LOCUS_33570 330812 329586 gene locus_tag LOCUS_33580 330812 329586 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_33580 331654 332775 gene locus_tag LOCUS_33590 gene carA 331654 332775 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_33590 333095 336370 gene locus_tag LOCUS_33600 gene carB 333095 336370 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_33600 336469 337812 gene locus_tag LOCUS_33610 gene gcvPA 336469 337812 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_33610 338568 337864 gene locus_tag LOCUS_33620 338568 337864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 339452 338595 gene locus_tag LOCUS_33630 339452 338595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 339922 340173 gene locus_tag LOCUS_33640 339922 340173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 340283 340513 gene locus_tag LOCUS_33650 340283 340513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 340610 342862 gene locus_tag LOCUS_33660 340610 342862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 342760 343818 gene locus_tag LOCUS_33670 342760 343818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 344979 343972 gene locus_tag LOCUS_33680 344979 343972 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_33680 346011 345052 gene locus_tag LOCUS_33690 346011 345052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_33690 346724 346131 gene locus_tag LOCUS_33700 346724 346131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 347092 347406 gene locus_tag LOCUS_33710 347092 347406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 348507 347554 gene locus_tag LOCUS_33720 348507 347554 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263895.1 protein_id gnl|my_center|LOCUS_33720 349109 348837 gene locus_tag LOCUS_33730 349109 348837 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_33730 350773 349151 gene locus_tag LOCUS_33740 350773 349151 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_33740 351528 351052 gene locus_tag LOCUS_33750 351528 351052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 352151 351951 gene locus_tag LOCUS_33760 352151 351951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 352725 352306 gene locus_tag LOCUS_33770 gene sugE 352725 352306 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941368.1 protein_id gnl|my_center|LOCUS_33770 353044 352823 gene locus_tag LOCUS_33780 353044 352823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 354719 353547 gene locus_tag LOCUS_33790 354719 353547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 358218 356674 gene locus_tag LOCUS_33800 358218 356674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 358385 360268 gene locus_tag LOCUS_33810 358385 360268 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_33810 361633 360335 gene locus_tag LOCUS_33820 361633 360335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 362185 362634 gene locus_tag LOCUS_33830 362185 362634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 362640 363164 gene locus_tag LOCUS_33840 362640 363164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 363177 365138 gene locus_tag LOCUS_33850 363177 365138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 365222 366139 gene locus_tag LOCUS_33860 gene flgL 365222 366139 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_33860 366403 366852 gene locus_tag LOCUS_33870 366403 366852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 367093 367386 gene locus_tag LOCUS_33880 367093 367386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 367465 368553 gene locus_tag LOCUS_33890 367465 368553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 369723 368704 gene locus_tag LOCUS_33900 369723 368704 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_33900 370655 369873 gene locus_tag LOCUS_33910 gene lsrF 370655 369873 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219792.1 protein_id gnl|my_center|LOCUS_33910 371669 370932 gene locus_tag LOCUS_33920 gene cysE 371669 370932 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_33920 372598 371669 gene locus_tag LOCUS_33930 gene cysK 372598 371669 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_33930 372825 373025 gene locus_tag LOCUS_33940 372825 373025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 373477 374421 gene locus_tag LOCUS_33950 373477 374421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_33950 374422 375132 gene locus_tag LOCUS_33960 374422 375132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_33960 375129 376832 gene locus_tag LOCUS_33970 375129 376832 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_33970 376996 379425 gene locus_tag LOCUS_33980 376996 379425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 379468 380868 gene locus_tag LOCUS_33990 379468 380868 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869463.1 protein_id gnl|my_center|LOCUS_33990 381220 381894 gene locus_tag LOCUS_34000 381220 381894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_34000 381872 383302 gene locus_tag LOCUS_34010 381872 383302 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_34010 383480 384601 gene locus_tag LOCUS_34020 gene waaF 383480 384601 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_34020 385664 384864 gene locus_tag LOCUS_34030 385664 384864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 387675 386689 gene locus_tag LOCUS_34040 gene cbiB 387675 386689 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_34040 387911 388126 gene locus_tag LOCUS_34050 387911 388126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 388357 388187 gene locus_tag LOCUS_34060 388357 388187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 389607 388930 gene locus_tag LOCUS_34070 389607 388930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34070 390036 389818 gene locus_tag LOCUS_34080 390036 389818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34080 390438 390085 gene locus_tag LOCUS_34090 390438 390085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34090 390769 390377 gene locus_tag LOCUS_34100 390769 390377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 391851 390976 gene locus_tag LOCUS_34110 391851 390976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 392042 392296 gene locus_tag LOCUS_34120 392042 392296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 392709 392840 gene locus_tag LOCUS_34130 392709 392840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 393691 393308 gene locus_tag LOCUS_34140 393691 393308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 394810 394298 gene locus_tag LOCUS_34150 394810 394298 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_34150 395578 395072 gene locus_tag LOCUS_34160 395578 395072 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_34160 396122 395712 gene locus_tag LOCUS_34170 396122 395712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 396582 396157 gene locus_tag LOCUS_34180 396582 396157 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_34180 396960 398498 gene locus_tag LOCUS_34190 396960 398498 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941027.1 protein_id gnl|my_center|LOCUS_34190 399206 398508 gene locus_tag LOCUS_34200 399206 398508 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_34200 400391 399210 gene locus_tag LOCUS_34210 400391 399210 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_34210 402244 400592 gene locus_tag LOCUS_34220 gene nuoF 402244 400592 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_34220 402894 402424 gene locus_tag LOCUS_34230 gene nuoE 402894 402424 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_34230 403835 403050 gene locus_tag LOCUS_34240 403835 403050 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_34240 406999 404132 gene locus_tag LOCUS_34250 gene purL 406999 404132 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_34250 407882 407013 gene locus_tag LOCUS_34260 407882 407013 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_34260 408456 409061 gene locus_tag LOCUS_34270 408456 409061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 409523 409119 gene locus_tag LOCUS_34280 409523 409119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 410029 410331 gene locus_tag LOCUS_34290 410029 410331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 411513 413267 gene locus_tag LOCUS_34300 411513 413267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 413297 414325 gene locus_tag LOCUS_34310 gene fliG 413297 414325 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_34310 414322 415023 gene locus_tag LOCUS_34320 414322 415023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 415023 416342 gene locus_tag LOCUS_34330 gene fliI 415023 416342 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_34330 416451 416915 gene locus_tag LOCUS_34340 416451 416915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 416937 417662 gene locus_tag LOCUS_34350 416937 417662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 417736 418296 gene locus_tag LOCUS_34360 417736 418296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 418345 419301 gene locus_tag LOCUS_34370 gene fliM 418345 419301 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_34370 419333 419695 gene locus_tag LOCUS_34380 419333 419695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 419867 419649 gene locus_tag LOCUS_34390 419867 419649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 420482 420288 gene locus_tag LOCUS_34400 420482 420288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 420466 420897 gene locus_tag LOCUS_34410 420466 420897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 421085 421885 gene locus_tag LOCUS_34420 gene fliP 421085 421885 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_34420 422341 422610 gene locus_tag LOCUS_34430 gene fliQ 422341 422610 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_34430 422746 423534 gene locus_tag LOCUS_34440 422746 423534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34440 423541 424590 gene locus_tag LOCUS_34450 423541 424590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34450 424734 426755 gene locus_tag LOCUS_34460 gene flhA 424734 426755 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_34460 426970 427815 gene locus_tag LOCUS_34470 426970 427815 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_34470 428472 428759 gene locus_tag LOCUS_34480 428472 428759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 428896 429675 gene locus_tag LOCUS_34490 428896 429675 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_34490 431420 429786 gene locus_tag LOCUS_34500 431420 429786 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065098.1 protein_id gnl|my_center|LOCUS_34500 432789 431422 gene locus_tag LOCUS_34510 432789 431422 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_34510 433589 433389 gene locus_tag LOCUS_34520 433589 433389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 434815 435654 gene locus_tag LOCUS_34530 434815 435654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 435830 437497 gene locus_tag LOCUS_34540 435830 437497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 438334 437651 gene locus_tag LOCUS_34550 438334 437651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 438687 439586 gene locus_tag LOCUS_34560 438687 439586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 439592 440530 gene locus_tag LOCUS_34570 439592 440530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 441868 442134 gene locus_tag LOCUS_34580 441868 442134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 442732 443451 gene locus_tag LOCUS_34590 442732 443451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 443448 444719 gene locus_tag LOCUS_34600 443448 444719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence05 2149 281 gene locus_tag LOCUS_34610 gene dnaK 2149 281 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_34610 2881 2198 gene locus_tag LOCUS_34620 gene grpE 2881 2198 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_34620 3807 8504 gene locus_tag LOCUS_34630 3807 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 8565 10490 gene locus_tag LOCUS_34640 8565 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 10587 10763 gene locus_tag LOCUS_34650 10587 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 10984 11970 gene locus_tag LOCUS_34660 10984 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 13440 13024 gene locus_tag LOCUS_34670 13440 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 13534 13379 gene locus_tag LOCUS_34680 13534 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 14034 15041 gene locus_tag LOCUS_34690 14034 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 15187 15471 gene locus_tag LOCUS_34700 15187 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 15985 17271 gene locus_tag LOCUS_34710 15985 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 17452 17790 gene locus_tag LOCUS_34720 17452 17790 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219522.1 protein_id gnl|my_center|LOCUS_34720 18305 17832 gene locus_tag LOCUS_34730 18305 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 18726 20399 gene locus_tag LOCUS_34740 18726 20399 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_34740 20399 20716 gene locus_tag LOCUS_34750 20399 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 20812 21981 gene locus_tag LOCUS_34760 gene sat 20812 21981 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_34760 22149 22222 gene locus_tag LOCUS_t00450 22149 22222 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22633 24369 gene locus_tag LOCUS_34770 gene polX 22633 24369 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_34770 24881 24573 gene locus_tag LOCUS_34780 24881 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 25576 25316 gene locus_tag LOCUS_34790 25576 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_34790 25777 25577 gene locus_tag LOCUS_34800 25777 25577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 26192 26578 gene locus_tag LOCUS_34810 26192 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 27188 27484 gene locus_tag LOCUS_34820 27188 27484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 28397 29089 gene locus_tag LOCUS_34830 28397 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34830 30707 29868 gene locus_tag LOCUS_34840 30707 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 31240 31440 gene locus_tag LOCUS_34850 31240 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 33772 31787 gene locus_tag LOCUS_34860 33772 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 34609 34472 gene locus_tag LOCUS_34870 34609 34472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 35277 34933 gene locus_tag LOCUS_34880 35277 34933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 36033 35374 gene locus_tag LOCUS_34890 36033 35374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 36522 36283 gene locus_tag LOCUS_34900 36522 36283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 37089 36544 gene locus_tag LOCUS_34910 37089 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 37607 37107 gene locus_tag LOCUS_34920 37607 37107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 38733 38293 gene locus_tag LOCUS_34930 38733 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 39108 38953 gene locus_tag LOCUS_34940 39108 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 39815 39621 gene locus_tag LOCUS_34950 39815 39621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 40708 40448 gene locus_tag LOCUS_34960 40708 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 41728 41054 gene locus_tag LOCUS_34970 41728 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 42652 41939 gene locus_tag LOCUS_34980 42652 41939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 43716 42676 gene locus_tag LOCUS_34990 43716 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 45066 43843 gene locus_tag LOCUS_35000 45066 43843 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_35000 46063 45086 gene locus_tag LOCUS_35010 46063 45086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 46954 46712 gene locus_tag LOCUS_35020 46954 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 47829 47413 gene locus_tag LOCUS_35030 47829 47413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35030 48158 47904 gene locus_tag LOCUS_35040 48158 47904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35040 48360 49751 gene locus_tag LOCUS_35050 48360 49751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 50466 50819 gene locus_tag LOCUS_35060 50466 50819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 50985 51215 gene locus_tag LOCUS_35070 50985 51215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 51124 51312 gene locus_tag LOCUS_35080 51124 51312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 51557 51739 gene locus_tag LOCUS_35090 51557 51739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 51954 52145 gene locus_tag LOCUS_35100 51954 52145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 52105 53055 gene locus_tag LOCUS_35110 52105 53055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 52997 53200 gene locus_tag LOCUS_35120 52997 53200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 53690 53367 gene locus_tag LOCUS_35130 53690 53367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 54013 54216 gene locus_tag LOCUS_35140 54013 54216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 54203 54529 gene locus_tag LOCUS_35150 54203 54529 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_35150 55141 55452 gene locus_tag LOCUS_35160 55141 55452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 55468 55668 gene locus_tag LOCUS_35170 55468 55668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 56410 56649 gene locus_tag LOCUS_35180 56410 56649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 57285 56731 gene locus_tag LOCUS_35190 57285 56731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 57914 57714 gene locus_tag LOCUS_35200 57914 57714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 58137 57937 gene locus_tag LOCUS_35210 58137 57937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 60522 59734 gene locus_tag LOCUS_35220 60522 59734 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_35220 60947 60525 gene locus_tag LOCUS_35230 60947 60525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 61108 60944 gene locus_tag LOCUS_35240 61108 60944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 61578 61081 gene locus_tag LOCUS_35250 61578 61081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 62083 61631 gene locus_tag LOCUS_35260 62083 61631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 62562 62122 gene locus_tag LOCUS_35270 62562 62122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 63536 63147 gene locus_tag LOCUS_35280 63536 63147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 65397 63523 gene locus_tag LOCUS_35290 65397 63523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 66148 65657 gene locus_tag LOCUS_35300 66148 65657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 66458 66249 gene locus_tag LOCUS_35310 66458 66249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 66897 66709 gene locus_tag LOCUS_35320 66897 66709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 67499 66888 gene locus_tag LOCUS_35330 67499 66888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 67979 67803 gene locus_tag LOCUS_35340 67979 67803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 69061 69318 gene locus_tag LOCUS_35350 69061 69318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 69350 69559 gene locus_tag LOCUS_35360 69350 69559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35360 70212 70406 gene locus_tag LOCUS_35370 70212 70406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35370 70468 70719 gene locus_tag LOCUS_35380 70468 70719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35380 71022 71438 gene locus_tag LOCUS_35390 71022 71438 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 protein_id gnl|my_center|LOCUS_35390 71445 72083 gene locus_tag LOCUS_35400 71445 72083 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405105.1 protein_id gnl|my_center|LOCUS_35400 72118 73863 gene locus_tag LOCUS_35410 gene nuoC 72118 73863 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619059.1 protein_id gnl|my_center|LOCUS_35410 73879 74343 gene locus_tag LOCUS_35420 gene nuoE 73879 74343 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 protein_id gnl|my_center|LOCUS_35420 74343 75623 gene locus_tag LOCUS_35430 gene nuoF 74343 75623 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365587.1 protein_id gnl|my_center|LOCUS_35430 75627 78341 gene locus_tag LOCUS_35440 gene nuoG 75627 78341 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 protein_id gnl|my_center|LOCUS_35440 78841 79797 gene locus_tag LOCUS_35450 gene nuoH 78841 79797 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705661.1 protein_id gnl|my_center|LOCUS_35450 79833 80348 gene locus_tag LOCUS_35460 gene nuoI 79833 80348 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172752.1 protein_id gnl|my_center|LOCUS_35460 80358 80927 gene locus_tag LOCUS_35470 gene nuoJ 80358 80927 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500212.1 protein_id gnl|my_center|LOCUS_35470 80924 81232 gene locus_tag LOCUS_35480 gene nuoK 80924 81232 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_35480 81234 83114 gene locus_tag LOCUS_35490 gene nuoL 81234 83114 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 protein_id gnl|my_center|LOCUS_35490 83111 84748 gene locus_tag LOCUS_35500 gene nuoM 83111 84748 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705657.1 protein_id gnl|my_center|LOCUS_35500 84735 86192 gene locus_tag LOCUS_35510 gene nuoN 84735 86192 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_35510 86531 87280 gene locus_tag LOCUS_35520 86531 87280 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405187.1 protein_id gnl|my_center|LOCUS_35520 87280 88797 gene locus_tag LOCUS_35530 87280 88797 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_35530 89580 89356 gene locus_tag LOCUS_35540 89580 89356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 90233 90451 gene locus_tag LOCUS_35550 90233 90451 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_35550 90967 90704 gene locus_tag LOCUS_35560 90967 90704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 91091 90972 gene locus_tag LOCUS_35570 91091 90972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 91226 91363 gene locus_tag LOCUS_35580 91226 91363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 91640 92770 gene locus_tag LOCUS_35590 91640 92770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 92969 94975 gene locus_tag LOCUS_35600 gene tkt 92969 94975 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_35600 95024 95464 gene locus_tag LOCUS_35610 95024 95464 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_35610 95691 96833 gene locus_tag LOCUS_35620 95691 96833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 96873 98303 gene locus_tag LOCUS_35630 gene gndA 96873 98303 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_35630 98227 99834 gene locus_tag LOCUS_35640 gene zwf 98227 99834 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_35640 100267 100437 gene locus_tag LOCUS_35650 100267 100437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 100434 100826 gene locus_tag LOCUS_35660 100434 100826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 101075 100830 gene locus_tag LOCUS_35670 101075 100830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 101415 101951 gene locus_tag LOCUS_35680 101415 101951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 102674 104062 gene locus_tag LOCUS_35690 102674 104062 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_35690 104102 104659 gene locus_tag LOCUS_35700 gene cysC 104102 104659 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_35700 107233 104738 gene locus_tag LOCUS_35710 107233 104738 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_35710 107422 108246 gene locus_tag LOCUS_35720 gene cobS 107422 108246 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_35720 108381 108902 gene locus_tag LOCUS_35730 gene cobU 108381 108902 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 protein_id gnl|my_center|LOCUS_35730 108902 109894 gene locus_tag LOCUS_35740 108902 109894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 109957 110604 gene locus_tag LOCUS_35750 gene fsa 109957 110604 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_35750 110882 111835 gene locus_tag LOCUS_35760 110882 111835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 112020 111832 gene locus_tag LOCUS_35770 112020 111832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 112497 113849 gene locus_tag LOCUS_35780 112497 113849 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_35780 115425 113851 gene locus_tag LOCUS_35790 115425 113851 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_35790 117537 116659 gene locus_tag LOCUS_35800 117537 116659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 118262 117543 gene locus_tag LOCUS_35810 118262 117543 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_35810 120540 120022 gene locus_tag LOCUS_35820 120540 120022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 121203 123212 gene locus_tag LOCUS_35830 121203 123212 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_35830 123374 124180 gene locus_tag LOCUS_35840 123374 124180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 124498 124289 gene locus_tag LOCUS_35850 124498 124289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 125491 124520 gene locus_tag LOCUS_35860 125491 124520 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_35860 126654 125560 gene locus_tag LOCUS_35870 gene waaC 126654 125560 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_35870 127034 127882 gene locus_tag LOCUS_35880 127034 127882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 127908 128534 gene locus_tag LOCUS_35890 gene plsY 127908 128534 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_35890 128989 129231 gene locus_tag LOCUS_35900 128989 129231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 129682 132855 gene locus_tag LOCUS_35910 129682 132855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 133118 139312 gene locus_tag LOCUS_35920 133118 139312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 139533 139772 gene locus_tag LOCUS_35930 139533 139772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 139974 141125 gene locus_tag LOCUS_35940 139974 141125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_35940 142169 142444 gene locus_tag LOCUS_35950 142169 142444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 142531 144102 gene locus_tag LOCUS_35960 142531 144102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 144708 144457 gene locus_tag LOCUS_35970 144708 144457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 147074 145245 gene locus_tag LOCUS_35980 gene dsbD 147074 145245 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 protein_id gnl|my_center|LOCUS_35980 147369 148319 gene locus_tag LOCUS_35990 gene hemC 147369 148319 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_35990 149096 149284 gene locus_tag LOCUS_36000 149096 149284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 150528 151856 gene locus_tag LOCUS_36010 150528 151856 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_36010 151895 152959 gene locus_tag LOCUS_36020 151895 152959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 153345 156236 gene locus_tag LOCUS_36030 153345 156236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 156397 156630 gene locus_tag LOCUS_36040 156397 156630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 156883 157128 gene locus_tag LOCUS_36050 156883 157128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 157495 157938 gene locus_tag LOCUS_36060 157495 157938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 158192 158773 gene locus_tag LOCUS_36070 158192 158773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 158973 159140 gene locus_tag LOCUS_36080 158973 159140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 159797 159627 gene locus_tag LOCUS_36090 159797 159627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 160543 159845 gene locus_tag LOCUS_36100 160543 159845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36100 161091 160537 gene locus_tag LOCUS_36110 161091 160537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 162513 161476 gene locus_tag LOCUS_36120 162513 161476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 163481 162822 gene locus_tag LOCUS_36130 163481 162822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 164186 163761 gene locus_tag LOCUS_36140 164186 163761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 164331 164149 gene locus_tag LOCUS_36150 164331 164149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 164462 164995 gene locus_tag LOCUS_36160 164462 164995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 165474 164983 gene locus_tag LOCUS_36170 165474 164983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 165584 165766 gene locus_tag LOCUS_36180 165584 165766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 166059 166229 gene locus_tag LOCUS_36190 166059 166229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 166453 166644 gene locus_tag LOCUS_36200 166453 166644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 166632 167000 gene locus_tag LOCUS_36210 166632 167000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 167919 167464 gene locus_tag LOCUS_36220 167919 167464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 168242 167925 gene locus_tag LOCUS_36230 168242 167925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 168701 168393 gene locus_tag LOCUS_36240 168701 168393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 170423 170785 gene locus_tag LOCUS_36250 170423 170785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 170929 171435 gene locus_tag LOCUS_36260 170929 171435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 171978 171778 gene locus_tag LOCUS_36270 171978 171778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 172239 172436 gene locus_tag LOCUS_36280 172239 172436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 172921 173106 gene locus_tag LOCUS_36290 172921 173106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 173434 173907 gene locus_tag LOCUS_36300 173434 173907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 176275 177384 gene locus_tag LOCUS_36310 176275 177384 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_36310 177464 178966 gene locus_tag LOCUS_36320 177464 178966 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_36320 179678 179028 gene locus_tag LOCUS_36330 179678 179028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 180815 179898 gene locus_tag LOCUS_36340 180815 179898 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_36340 182018 180867 gene locus_tag LOCUS_36350 182018 180867 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_36350 183181 182156 gene locus_tag LOCUS_36360 gene thiF 183181 182156 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 protein_id gnl|my_center|LOCUS_36360 183860 183183 gene locus_tag LOCUS_36370 183860 183183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_36370 184138 183920 gene locus_tag LOCUS_36380 184138 183920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 184381 184157 gene locus_tag LOCUS_36390 184381 184157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 184633 185529 gene locus_tag LOCUS_36400 gene ccsB 184633 185529 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_36400 185755 187047 gene locus_tag LOCUS_36410 gene hemA 185755 187047 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_36410 187791 187114 gene locus_tag LOCUS_36420 gene queC 187791 187114 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_36420 188430 187795 gene locus_tag LOCUS_36430 188430 187795 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_36430 188505 189026 gene locus_tag LOCUS_36440 gene rlmH 188505 189026 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_36440 189456 189683 gene locus_tag LOCUS_36450 189456 189683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 189769 189924 gene locus_tag LOCUS_36460 189769 189924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 190386 190580 gene locus_tag LOCUS_36470 190386 190580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 190918 191343 gene locus_tag LOCUS_36480 gene tnpA 190918 191343 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_36480 192183 191452 gene locus_tag LOCUS_36490 gene cobM 192183 191452 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948631.1 protein_id gnl|my_center|LOCUS_36490 192602 192237 gene locus_tag LOCUS_36500 192602 192237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 193277 192870 gene locus_tag LOCUS_36510 193277 192870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 195316 193610 gene locus_tag LOCUS_36520 195316 193610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 195617 195886 gene locus_tag LOCUS_36530 195617 195886 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814848.1 protein_id gnl|my_center|LOCUS_36530 195883 196146 gene locus_tag LOCUS_36540 195883 196146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 196252 197757 gene locus_tag LOCUS_36550 196252 197757 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_36550 197762 199246 gene locus_tag LOCUS_36560 gene aroE 197762 199246 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_36560 199345 199908 gene locus_tag LOCUS_36570 199345 199908 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_36570 200300 199998 gene locus_tag LOCUS_36580 200300 199998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 200881 201234 gene locus_tag LOCUS_36590 200881 201234 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 protein_id gnl|my_center|LOCUS_36590 201426 203498 gene locus_tag LOCUS_36600 201426 203498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 204158 203631 gene locus_tag LOCUS_36610 204158 203631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881242.1 protein_id gnl|my_center|LOCUS_36610 204931 204191 gene locus_tag LOCUS_36620 204931 204191 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_36620 205327 205725 gene locus_tag LOCUS_36630 gene acpS 205327 205725 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_36630 205749 207230 gene locus_tag LOCUS_36640 205749 207230 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_36640 207334 208545 gene locus_tag LOCUS_36650 gene fabF 207334 208545 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_36650 208564 209799 gene locus_tag LOCUS_36660 gene fabF 208564 209799 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_36660 210211 209864 gene locus_tag LOCUS_36670 210211 209864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 210533 210219 gene locus_tag LOCUS_36680 210533 210219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 210743 211087 gene locus_tag LOCUS_36690 210743 211087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 211219 211437 gene locus_tag LOCUS_36700 211219 211437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 212559 213161 gene locus_tag LOCUS_36710 gene hxlB 212559 213161 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_36710 215863 213167 gene locus_tag LOCUS_36720 215863 213167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 216095 215877 gene locus_tag LOCUS_36730 216095 215877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 216699 216115 gene locus_tag LOCUS_36740 216699 216115 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_36740 216861 217781 gene locus_tag LOCUS_36750 gene prsA 216861 217781 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_36750 218900 220240 gene locus_tag LOCUS_36760 gene rsxC 218900 220240 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_36760 220291 221322 gene locus_tag LOCUS_36770 220291 221322 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_36770 221326 222057 gene locus_tag LOCUS_36780 221326 222057 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_36780 222095 222622 gene locus_tag LOCUS_36790 gene scpB 222095 222622 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_36790 223030 225924 gene locus_tag LOCUS_36800 223030 225924 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_36800 226194 227234 gene locus_tag LOCUS_36810 226194 227234 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_36810 227234 229009 gene locus_tag LOCUS_36820 227234 229009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_36820 229271 231028 gene locus_tag LOCUS_36830 229271 231028 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_36830 231228 231416 gene locus_tag LOCUS_36840 231228 231416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 231404 231718 gene locus_tag LOCUS_36850 231404 231718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 231728 233170 gene locus_tag LOCUS_36860 231728 233170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 233058 233990 gene locus_tag LOCUS_36870 233058 233990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36870 233905 234405 gene locus_tag LOCUS_36880 233905 234405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36880 234913 235845 gene locus_tag LOCUS_36890 234913 235845 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_36890 236150 237769 gene locus_tag LOCUS_36900 236150 237769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 237779 240973 gene locus_tag LOCUS_36910 237779 240973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 241371 241003 gene locus_tag LOCUS_36920 241371 241003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 241598 242992 gene locus_tag LOCUS_36930 241598 242992 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_36930 243333 243764 gene locus_tag LOCUS_36940 243333 243764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 243804 244250 gene locus_tag LOCUS_36950 gene glnB 243804 244250 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654045.1 protein_id gnl|my_center|LOCUS_36950 244506 245963 gene locus_tag LOCUS_36960 244506 245963 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_36960 247026 247736 gene locus_tag LOCUS_36970 gene nfi 247026 247736 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_36970 247905 249602 gene locus_tag LOCUS_36980 247905 249602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 249639 251075 gene locus_tag LOCUS_36990 249639 251075 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_36990 251235 251801 gene locus_tag LOCUS_37000 251235 251801 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_37000 251808 253313 gene locus_tag LOCUS_37010 251808 253313 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_37010 253406 254161 gene locus_tag LOCUS_37020 253406 254161 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081262.1 protein_id gnl|my_center|LOCUS_37020 254388 254690 gene locus_tag LOCUS_37030 254388 254690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 255196 254837 gene locus_tag LOCUS_37040 255196 254837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 255796 256395 gene locus_tag LOCUS_37050 255796 256395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 257126 256608 gene locus_tag LOCUS_37060 257126 256608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 257620 257420 gene locus_tag LOCUS_37070 257620 257420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 257792 257640 gene locus_tag LOCUS_37080 257792 257640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 257982 257779 gene locus_tag LOCUS_37090 257982 257779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 258130 258315 gene locus_tag LOCUS_37100 258130 258315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 258724 258428 gene locus_tag LOCUS_37110 258724 258428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 258902 258708 gene locus_tag LOCUS_37120 258902 258708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 259810 259328 gene locus_tag LOCUS_37130 259810 259328 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027607744.1 protein_id gnl|my_center|LOCUS_37130 260338 260063 gene locus_tag LOCUS_37140 260338 260063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 260940 260671 gene locus_tag LOCUS_37150 260940 260671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 261194 260940 gene locus_tag LOCUS_37160 261194 260940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 261349 261200 gene locus_tag LOCUS_37170 261349 261200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 261863 261354 gene locus_tag LOCUS_37180 261863 261354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 262492 261917 gene locus_tag LOCUS_37190 262492 261917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 263060 262494 gene locus_tag LOCUS_37200 263060 262494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 266224 263081 gene locus_tag LOCUS_37210 266224 263081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 266871 266221 gene locus_tag LOCUS_37220 266871 266221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 269000 266868 gene locus_tag LOCUS_37230 269000 266868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 269867 269136 gene locus_tag LOCUS_37240 269867 269136 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_37240 270424 270158 gene locus_tag LOCUS_37250 270424 270158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 271768 272169 gene locus_tag LOCUS_37260 271768 272169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 272373 272170 gene locus_tag LOCUS_37270 272373 272170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 272648 272370 gene locus_tag LOCUS_37280 272648 272370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 274005 273769 gene locus_tag LOCUS_37290 274005 273769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 274465 274139 gene locus_tag LOCUS_37300 274465 274139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 275860 275597 gene locus_tag LOCUS_37310 275860 275597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 276940 276722 gene locus_tag LOCUS_37320 276940 276722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 277305 277090 gene locus_tag LOCUS_37330 277305 277090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 278658 277369 gene locus_tag LOCUS_37340 278658 277369 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_37340 279418 278678 gene locus_tag LOCUS_37350 279418 278678 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_37350 280242 279415 gene locus_tag LOCUS_37360 280242 279415 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_37360 281276 280245 gene locus_tag LOCUS_37370 281276 280245 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_37370 282176 281418 gene locus_tag LOCUS_37380 gene cobJ 282176 281418 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_37380 282979 282170 gene locus_tag LOCUS_37390 282979 282170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 284255 283164 gene locus_tag LOCUS_37400 gene dnaJ 284255 283164 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_37400 293414 284814 gene locus_tag LOCUS_37410 293414 284814 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705673.1 protein_id gnl|my_center|LOCUS_37410 294698 293964 gene locus_tag LOCUS_37420 294698 293964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 296563 296132 gene locus_tag LOCUS_37430 296563 296132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37430 297363 297109 gene locus_tag LOCUS_37440 297363 297109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence06 450 13 gene locus_tag LOCUS_37450 450 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 1005 589 gene locus_tag LOCUS_37460 1005 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 2387 1137 gene locus_tag LOCUS_37470 2387 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3548 2409 gene locus_tag LOCUS_37480 3548 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 5674 3593 gene locus_tag LOCUS_37490 5674 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 6500 5940 gene locus_tag LOCUS_37500 6500 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 8089 7199 gene locus_tag LOCUS_37510 8089 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 8840 8133 gene locus_tag LOCUS_37520 8840 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 9231 8842 gene locus_tag LOCUS_37530 9231 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 9668 9312 gene locus_tag LOCUS_37540 9668 9312 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_37540 10028 9747 gene locus_tag LOCUS_37550 10028 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 10581 10231 gene locus_tag LOCUS_37560 10581 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 11477 11184 gene locus_tag LOCUS_37570 11477 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 11607 11888 gene locus_tag LOCUS_37580 11607 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 12092 12274 gene locus_tag LOCUS_37590 12092 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 13479 13754 gene locus_tag LOCUS_37600 13479 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 14770 15084 gene locus_tag LOCUS_37610 14770 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 15132 15551 gene locus_tag LOCUS_37620 15132 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 16868 16698 gene locus_tag LOCUS_37630 16868 16698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 17349 17032 gene locus_tag LOCUS_37640 17349 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37640 17812 17585 gene locus_tag LOCUS_37650 17812 17585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 19296 20600 gene locus_tag LOCUS_37660 19296 20600 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_37660 20635 22086 gene locus_tag LOCUS_37670 20635 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 22091 25243 gene locus_tag LOCUS_37680 22091 25243 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103123.1 protein_id gnl|my_center|LOCUS_37680 25372 25710 gene locus_tag LOCUS_37690 25372 25710 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_37690 26172 25927 gene locus_tag LOCUS_37700 26172 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 26936 26724 gene locus_tag LOCUS_37710 26936 26724 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_37710 27120 26947 gene locus_tag LOCUS_37720 27120 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 28412 27390 gene locus_tag LOCUS_37730 28412 27390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_37730 29935 28409 gene locus_tag LOCUS_37740 29935 28409 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_37740 30331 30071 gene locus_tag LOCUS_37750 30331 30071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 31516 30512 gene locus_tag LOCUS_37760 31516 30512 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_37760 32445 31657 gene locus_tag LOCUS_37770 32445 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 33155 34069 gene locus_tag LOCUS_37780 33155 34069 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_37780 35314 34685 gene locus_tag LOCUS_37790 35314 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967367.1 protein_id gnl|my_center|LOCUS_37790 36205 35318 gene locus_tag LOCUS_37800 36205 35318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 37380 36202 gene locus_tag LOCUS_37810 37380 36202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_37810 37697 37443 gene locus_tag LOCUS_37820 37697 37443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 38546 37716 gene locus_tag LOCUS_37830 38546 37716 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_37830 39735 41027 gene locus_tag LOCUS_37840 39735 41027 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269234.1 protein_id gnl|my_center|LOCUS_37840 41090 42640 gene locus_tag LOCUS_37850 41090 42640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 42675 43025 gene locus_tag LOCUS_37860 42675 43025 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_37860 43212 46232 gene locus_tag LOCUS_37870 43212 46232 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_37870 47511 46672 gene locus_tag LOCUS_37880 47511 46672 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_37880 48038 48205 gene locus_tag LOCUS_37890 48038 48205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 49374 48271 gene locus_tag LOCUS_37900 gene ribD 49374 48271 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987156.1 protein_id gnl|my_center|LOCUS_37900 50804 49377 gene locus_tag LOCUS_37910 gene aroA 50804 49377 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072383.1 protein_id gnl|my_center|LOCUS_37910 51021 52997 gene locus_tag LOCUS_37920 gene cooS 51021 52997 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272665.1 protein_id gnl|my_center|LOCUS_37920 53945 53736 gene locus_tag LOCUS_37930 53945 53736 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_37930 54194 55168 gene locus_tag LOCUS_37940 54194 55168 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_37940 55396 56019 gene locus_tag LOCUS_37950 55396 56019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 56965 56066 gene locus_tag LOCUS_37960 56965 56066 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_37960 58507 56966 gene locus_tag LOCUS_37970 58507 56966 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_37970 59277 58510 gene locus_tag LOCUS_37980 59277 58510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 59558 59277 gene locus_tag LOCUS_37990 59558 59277 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_37990 60275 59565 gene locus_tag LOCUS_38000 60275 59565 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_38000 60600 60289 gene locus_tag LOCUS_38010 60600 60289 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_38010 60962 60648 gene locus_tag LOCUS_38020 60962 60648 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932709.1 protein_id gnl|my_center|LOCUS_38020 61347 60955 gene locus_tag LOCUS_38030 61347 60955 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_38030 62732 61344 gene locus_tag LOCUS_38040 gene atpD 62732 61344 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_38040 63173 64282 gene locus_tag LOCUS_38050 63173 64282 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_38050 64408 65979 gene locus_tag LOCUS_38060 64408 65979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38060 65972 68368 gene locus_tag LOCUS_38070 65972 68368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38070 69681 68755 gene locus_tag LOCUS_38080 69681 68755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 70092 69730 gene locus_tag LOCUS_38090 70092 69730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 71962 70277 gene locus_tag LOCUS_38100 gene ettA 71962 70277 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_38100 72577 73818 gene locus_tag LOCUS_38110 72577 73818 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_38110 75020 73815 gene locus_tag LOCUS_38120 gene ahbD 75020 73815 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_38120 75422 77026 gene locus_tag LOCUS_38130 gene cimA 75422 77026 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_38130 77023 79791 gene locus_tag LOCUS_38140 77023 79791 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082363.1 protein_id gnl|my_center|LOCUS_38140 79796 81226 gene locus_tag LOCUS_38150 79796 81226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 81361 81723 gene locus_tag LOCUS_38160 81361 81723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 81772 82698 gene locus_tag LOCUS_38170 81772 82698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 82942 83205 gene locus_tag LOCUS_38180 82942 83205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 83469 84392 gene locus_tag LOCUS_38190 gene speB 83469 84392 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_38190 85658 84732 gene locus_tag LOCUS_38200 85658 84732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 86069 85707 gene locus_tag LOCUS_38210 86069 85707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 88018 86264 gene locus_tag LOCUS_38220 88018 86264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 89193 88102 gene locus_tag LOCUS_38230 89193 88102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 89953 89231 gene locus_tag LOCUS_38240 89953 89231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 90765 89995 gene locus_tag LOCUS_38250 90765 89995 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_38250 92593 90848 gene locus_tag LOCUS_38260 92593 90848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 93149 92628 gene locus_tag LOCUS_38270 93149 92628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 93758 93513 gene locus_tag LOCUS_38280 93758 93513 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942005.1 protein_id gnl|my_center|LOCUS_38280 94223 93804 gene locus_tag LOCUS_38290 94223 93804 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_38290 94786 94265 gene locus_tag LOCUS_38300 94786 94265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38300 95208 94801 gene locus_tag LOCUS_38310 95208 94801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38310 95631 95212 gene locus_tag LOCUS_38320 95631 95212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 96542 95652 gene locus_tag LOCUS_38330 96542 95652 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_38330 97327 96689 gene locus_tag LOCUS_38340 97327 96689 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_38340 98630 97341 gene locus_tag LOCUS_38350 gene lysA 98630 97341 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_38350 100018 98636 gene locus_tag LOCUS_38360 gene argH 100018 98636 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_38360 100644 100309 gene locus_tag LOCUS_38370 100644 100309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 101243 100920 gene locus_tag LOCUS_38380 101243 100920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 101945 101244 gene locus_tag LOCUS_38390 101945 101244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 102717 102187 gene locus_tag LOCUS_38400 gene pgpA 102717 102187 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 protein_id gnl|my_center|LOCUS_38400 103986 103081 gene locus_tag LOCUS_38410 gene murQ 103986 103081 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477459.1 protein_id gnl|my_center|LOCUS_38410 104598 106430 gene locus_tag LOCUS_38420 gene uvrC 104598 106430 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_38420 106674 107915 gene locus_tag LOCUS_38430 106674 107915 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_38430 107922 109187 gene locus_tag LOCUS_38440 107922 109187 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_38440 109420 110568 gene locus_tag LOCUS_38450 109420 110568 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_38450 110568 111230 gene locus_tag LOCUS_38460 110568 111230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262011.1 protein_id gnl|my_center|LOCUS_38460 112254 112670 gene locus_tag LOCUS_38470 112254 112670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 112802 113197 gene locus_tag LOCUS_38480 112802 113197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence07 836 390 gene locus_tag LOCUS_38490 836 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1065 829 gene locus_tag LOCUS_38500 1065 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 1429 1160 gene locus_tag LOCUS_38510 1429 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1702 1505 gene locus_tag LOCUS_38520 1702 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1872 1690 gene locus_tag LOCUS_38530 1872 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2258 1953 gene locus_tag LOCUS_38540 2258 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 2476 2255 gene locus_tag LOCUS_38550 2476 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 3220 2954 gene locus_tag LOCUS_38560 3220 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 3476 3282 gene locus_tag LOCUS_38570 3476 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4743 4468 gene locus_tag LOCUS_38580 4743 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 5033 4725 gene locus_tag LOCUS_38590 5033 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 5150 5476 gene locus_tag LOCUS_38600 5150 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 9165 8350 gene locus_tag LOCUS_38610 9165 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 10510 9323 gene locus_tag LOCUS_38620 10510 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 11742 10525 gene locus_tag LOCUS_38630 11742 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 12739 12284 gene locus_tag LOCUS_38640 12739 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38640 12890 12702 gene locus_tag LOCUS_38650 12890 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 14134 13832 gene locus_tag LOCUS_38660 14134 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 14400 14131 gene locus_tag LOCUS_38670 14400 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 15010 14762 gene locus_tag LOCUS_38680 15010 14762 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_38680 17157 16813 gene locus_tag LOCUS_38690 17157 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 18471 19511 gene locus_tag LOCUS_38700 gene lpxD 18471 19511 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_38700 19493 20344 gene locus_tag LOCUS_38710 gene lpxI 19493 20344 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_38710 20764 21222 gene locus_tag LOCUS_38720 20764 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 23111 22047 gene locus_tag LOCUS_38730 23111 22047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_38730 24641 23406 gene locus_tag LOCUS_38740 24641 23406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_38740 25630 24638 gene locus_tag LOCUS_38750 25630 24638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_38750 26564 25635 gene locus_tag LOCUS_38760 26564 25635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_38760 27568 26570 gene locus_tag LOCUS_38770 27568 26570 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_38770 28507 28310 gene locus_tag LOCUS_38780 28507 28310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 29303 29100 gene locus_tag LOCUS_38790 29303 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 29952 29770 gene locus_tag LOCUS_38800 29952 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 30473 29949 gene locus_tag LOCUS_38810 30473 29949 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_38810 32277 31006 gene locus_tag LOCUS_38820 32277 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 33070 32387 gene locus_tag LOCUS_38830 33070 32387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 34514 33171 gene locus_tag LOCUS_38840 34514 33171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 35535 34507 gene locus_tag LOCUS_38850 35535 34507 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_38850 36979 35528 gene locus_tag LOCUS_38860 36979 35528 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_38860 39424 37022 gene locus_tag LOCUS_38870 39424 37022 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_38870 40076 39831 gene locus_tag LOCUS_38880 40076 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 42024 40630 gene locus_tag LOCUS_38890 42024 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 42538 42320 gene locus_tag LOCUS_38900 42538 42320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 42651 43496 gene locus_tag LOCUS_38910 42651 43496 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_38910 44263 43535 gene locus_tag LOCUS_38920 gene pssA 44263 43535 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_38920 44958 45644 gene locus_tag LOCUS_38930 44958 45644 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714845.1 protein_id gnl|my_center|LOCUS_38930 45748 46401 gene locus_tag LOCUS_38940 45748 46401 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_38940 46566 47369 gene locus_tag LOCUS_38950 gene lipA 46566 47369 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_38950 47578 48408 gene locus_tag LOCUS_38960 gene thiD 47578 48408 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867389.1 protein_id gnl|my_center|LOCUS_38960 48831 49466 gene locus_tag LOCUS_38970 48831 49466 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_38970 49686 50621 gene locus_tag LOCUS_38980 gene lpxK 49686 50621 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_38980 50636 50806 gene locus_tag LOCUS_38990 50636 50806 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_38990 50978 51949 gene locus_tag LOCUS_39000 50978 51949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_39000 51942 52586 gene locus_tag LOCUS_39010 51942 52586 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_39010 52992 52723 gene locus_tag LOCUS_39020 52992 52723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 53203 52994 gene locus_tag LOCUS_39030 53203 52994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 54138 53449 gene locus_tag LOCUS_39040 54138 53449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 55200 54208 gene locus_tag LOCUS_39050 55200 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 55475 55711 gene locus_tag LOCUS_39060 55475 55711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 56284 55979 gene locus_tag LOCUS_39070 56284 55979 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_39070 56575 56294 gene locus_tag LOCUS_39080 56575 56294 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_39080 57513 56692 gene locus_tag LOCUS_39090 57513 56692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 58212 58045 gene locus_tag LOCUS_39100 58212 58045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 59171 58590 gene locus_tag LOCUS_39110 59171 58590 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_39110 59901 59200 gene locus_tag LOCUS_39120 59901 59200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39120 60262 59825 gene locus_tag LOCUS_39130 60262 59825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39130 60951 60592 gene locus_tag LOCUS_39140 60951 60592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 62031 61585 gene locus_tag LOCUS_39150 62031 61585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 62505 62320 gene locus_tag LOCUS_39160 62505 62320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 64331 62826 gene locus_tag LOCUS_39170 64331 62826 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532536.1 protein_id gnl|my_center|LOCUS_39170 65888 64413 gene locus_tag LOCUS_39180 65888 64413 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883612.1 protein_id gnl|my_center|LOCUS_39180 66581 66075 gene locus_tag LOCUS_39190 66581 66075 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_39190 67743 66706 gene locus_tag LOCUS_39200 67743 66706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 68322 67912 gene locus_tag LOCUS_39210 68322 67912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 68766 68344 gene locus_tag LOCUS_39220 68766 68344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 69191 69586 gene locus_tag LOCUS_39230 69191 69586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 69653 70987 gene locus_tag LOCUS_39240 69653 70987 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_39240 70981 71661 gene locus_tag LOCUS_39250 70981 71661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 71645 72049 gene locus_tag LOCUS_39260 71645 72049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 72261 72067 gene locus_tag LOCUS_39270 72261 72067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 73538 74254 gene locus_tag LOCUS_39280 73538 74254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 75393 74251 gene locus_tag LOCUS_39290 gene proB 75393 74251 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_39290 76108 75620 gene locus_tag LOCUS_39300 76108 75620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39300 76608 76066 gene locus_tag LOCUS_39310 76608 76066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39310 78564 79436 gene locus_tag LOCUS_39320 gene panC 78564 79436 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_39320 79499 79756 gene locus_tag LOCUS_39330 79499 79756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 79737 80867 gene locus_tag LOCUS_39340 79737 80867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 81595 80897 gene locus_tag LOCUS_39350 81595 80897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 81796 84438 gene locus_tag LOCUS_39360 81796 84438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 84732 84956 gene locus_tag LOCUS_39370 84732 84956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 86799 85132 gene locus_tag LOCUS_39380 86799 85132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_39380 87482 86883 gene locus_tag LOCUS_39390 87482 86883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 88608 87535 gene locus_tag LOCUS_39400 gene arsB 88608 87535 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence08 1077 178 gene locus_tag LOCUS_39410 1077 178 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257993.1 protein_id gnl|my_center|LOCUS_39410 2225 1071 gene locus_tag LOCUS_39420 2225 1071 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_39420 3141 2215 gene locus_tag LOCUS_39430 gene chbG 3141 2215 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815723.1 protein_id gnl|my_center|LOCUS_39430 4093 3803 gene locus_tag LOCUS_39440 4093 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 4930 4109 gene locus_tag LOCUS_39450 4930 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 5327 5136 gene locus_tag LOCUS_39460 5327 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 8096 7299 gene locus_tag LOCUS_39470 8096 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 8855 8577 gene locus_tag LOCUS_39480 8855 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 9521 9258 gene locus_tag LOCUS_39490 9521 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 9836 9528 gene locus_tag LOCUS_39500 9836 9528 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_39500 10328 11497 gene locus_tag LOCUS_39510 10328 11497 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_39510 11683 11492 gene locus_tag LOCUS_39520 11683 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 >Feature sequence09 2985 1795 gene locus_tag LOCUS_39530 2985 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 4840 3164 gene locus_tag LOCUS_39540 4840 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 5606 5202 gene locus_tag LOCUS_39550 5606 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 7321 5618 gene locus_tag LOCUS_39560 7321 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 8122 7334 gene locus_tag LOCUS_39570 8122 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105153.1 protein_id gnl|my_center|LOCUS_39570 9567 8395 gene locus_tag LOCUS_39580 gene arsB 9567 8395 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_39580 10986 9574 gene locus_tag LOCUS_39590 10986 9574 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948601.1 protein_id gnl|my_center|LOCUS_39590 >Feature sequence10 <1 627 gene locus_tag LOCUS_39600 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein 628 1443 gene locus_tag LOCUS_39610 628 1443 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_39610 1450 4314 gene locus_tag LOCUS_39620 1450 4314 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_39620 4662 5324 gene locus_tag LOCUS_39630 4662 5324 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_39630 6738 5668 gene locus_tag LOCUS_39640 gene mqnC 6738 5668 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_39640 7650 6856 gene locus_tag LOCUS_39650 7650 6856 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_39650 7802 8554 gene locus_tag LOCUS_39660 7802 8554 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 protein_id gnl|my_center|LOCUS_39660 8668 9639 gene locus_tag LOCUS_39670 8668 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 9832 10596 gene locus_tag LOCUS_39680 9832 10596 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 protein_id gnl|my_center|LOCUS_39680 >Feature sequence11 <1 507 gene locus_tag LOCUS_39690 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839192.1:transcription termination factor NusA 738 861 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtccccgagcgaagtcgag 1677 868 gene locus_tag LOCUS_39700 gene kdsA 1677 868 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931782.1 protein_id gnl|my_center|LOCUS_39700 3281 1677 gene locus_tag LOCUS_39710 gene metG 3281 1677 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_39710 4113 3244 gene locus_tag LOCUS_39720 4113 3244 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_39720 4502 4981 gene locus_tag LOCUS_39730 4502 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence12 38 685 gene locus_tag LOCUS_39740 38 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 1212 2192 gene locus_tag LOCUS_39750 1212 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 >Feature sequence13 <1 864 gene locus_tag LOCUS_39760 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005941495.1:IS110 family transposase