>Feature sequence001 3085 3161 gene locus_tag LOCUS_t00010 3085 3161 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4390 3263 gene locus_tag LOCUS_00010 4390 3263 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_00010 4695 4390 gene locus_tag LOCUS_00020 4695 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7080 5008 gene locus_tag LOCUS_00030 7080 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8141 7077 gene locus_tag LOCUS_00040 8141 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9736 8144 gene locus_tag LOCUS_00050 9736 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10227 9739 gene locus_tag LOCUS_00060 10227 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10934 10233 gene locus_tag LOCUS_00070 10934 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11163 10924 gene locus_tag LOCUS_00080 11163 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11498 11160 gene locus_tag LOCUS_00090 11498 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11644 12312 gene locus_tag LOCUS_00100 11644 12312 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_00100 15356 12348 gene locus_tag LOCUS_00110 15356 12348 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_00110 18010 15434 gene locus_tag LOCUS_00120 18010 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19005 18013 gene locus_tag LOCUS_00130 19005 18013 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_00130 21025 19139 gene locus_tag LOCUS_00140 21025 19139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21516 21337 gene locus_tag LOCUS_00150 21516 21337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22082 21513 gene locus_tag LOCUS_00160 22082 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22281 22123 gene locus_tag LOCUS_00170 22281 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23192 22278 gene locus_tag LOCUS_00180 23192 22278 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_00180 23526 23179 gene locus_tag LOCUS_00190 23526 23179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25436 23523 gene locus_tag LOCUS_00200 25436 23523 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_00200 33981 25831 gene locus_tag LOCUS_00210 33981 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 34856 34290 gene locus_tag LOCUS_00220 34856 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 37582 36716 gene locus_tag LOCUS_00230 37582 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 38845 37583 gene locus_tag LOCUS_00240 38845 37583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 39486 38848 gene locus_tag LOCUS_00250 39486 38848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 41334 39520 gene locus_tag LOCUS_00260 41334 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 44681 41331 gene locus_tag LOCUS_00270 44681 41331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 45211 44678 gene locus_tag LOCUS_00280 45211 44678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 48258 45208 gene locus_tag LOCUS_00290 48258 45208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 48699 48271 gene locus_tag LOCUS_00300 48699 48271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 49332 48712 gene locus_tag LOCUS_00310 49332 48712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 49912 49412 gene locus_tag LOCUS_00320 49912 49412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 51563 49929 gene locus_tag LOCUS_00330 51563 49929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 52238 51567 gene locus_tag LOCUS_00340 52238 51567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 52459 52235 gene locus_tag LOCUS_00350 52459 52235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 >Feature sequence002 569 189 gene locus_tag LOCUS_00360 569 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 1830 595 gene locus_tag LOCUS_00370 1830 595 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_00370 2263 1832 gene locus_tag LOCUS_00380 2263 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2401 2499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3697 2909 gene locus_tag LOCUS_00390 3697 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4377 3832 gene locus_tag LOCUS_00400 4377 3832 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350817.1 protein_id gnl|my_center|LOCUS_00400 5508 4480 gene locus_tag LOCUS_00410 5508 4480 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_00410 6452 5562 gene locus_tag LOCUS_00420 6452 5562 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_00420 6961 6452 gene locus_tag LOCUS_00430 6961 6452 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888217.1 protein_id gnl|my_center|LOCUS_00430 7136 8278 gene locus_tag LOCUS_00440 7136 8278 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_00440 11044 8357 gene locus_tag LOCUS_00450 11044 8357 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_00450 11731 11543 gene locus_tag LOCUS_00460 11731 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 11811 12908 gene locus_tag LOCUS_00470 gene ablA 11811 12908 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_00470 12912 13916 gene locus_tag LOCUS_00480 12912 13916 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_00480 13926 14945 gene locus_tag LOCUS_00490 13926 14945 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_00490 15122 15619 gene locus_tag LOCUS_00500 15122 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 15783 16544 gene locus_tag LOCUS_00510 15783 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 16603 17202 gene locus_tag LOCUS_00520 16603 17202 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_00520 17204 18667 gene locus_tag LOCUS_00530 gene sufB 17204 18667 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_00530 18681 19433 gene locus_tag LOCUS_00540 gene sufC 18681 19433 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_00540 19437 20759 gene locus_tag LOCUS_00550 gene sufD 19437 20759 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_00550 20756 21994 gene locus_tag LOCUS_00560 20756 21994 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00560 21994 22443 gene locus_tag LOCUS_00570 21994 22443 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00570 23037 24797 gene locus_tag LOCUS_00580 23037 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 25960 24842 gene locus_tag LOCUS_00590 25960 24842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_00590 27073 25964 gene locus_tag LOCUS_00600 27073 25964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_00600 28001 27075 gene locus_tag LOCUS_00610 28001 27075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_00610 28924 27998 gene locus_tag LOCUS_00620 28924 27998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_00620 29903 28911 gene locus_tag LOCUS_00630 29903 28911 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_00630 31225 29900 gene locus_tag LOCUS_00640 31225 29900 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_00640 31271 31364 gene locus_tag LOCUS_t00020 31271 31364 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32644 31409 gene locus_tag LOCUS_00650 32644 31409 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_00650 32949 33821 gene locus_tag LOCUS_00660 32949 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 33964 34977 gene locus_tag LOCUS_00670 33964 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 35446 35027 gene locus_tag LOCUS_00680 gene mscL 35446 35027 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_00680 38240 35607 gene locus_tag LOCUS_00690 gene mutS 38240 35607 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_00690 38727 38233 gene locus_tag LOCUS_00700 38727 38233 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence003 3043 422 gene locus_tag LOCUS_00710 3043 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4278 3040 gene locus_tag LOCUS_00720 4278 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4851 5264 gene locus_tag LOCUS_00730 4851 5264 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_00730 5290 6960 gene locus_tag LOCUS_00740 gene dnaX 5290 6960 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_00740 7290 7610 gene locus_tag LOCUS_00750 7290 7610 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292337.1 protein_id gnl|my_center|LOCUS_00750 7617 8213 gene locus_tag LOCUS_00760 gene recR 7617 8213 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_00760 9095 8313 gene locus_tag LOCUS_00770 gene budA 9095 8313 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244457.1 protein_id gnl|my_center|LOCUS_00770 9330 9426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10378 9461 gene locus_tag LOCUS_00780 10378 9461 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_00780 10837 10430 gene locus_tag LOCUS_00790 10837 10430 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_00790 12137 11007 gene locus_tag LOCUS_00800 12137 11007 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_00800 13174 12170 gene locus_tag LOCUS_00810 gene mltG 13174 12170 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_00810 13614 13171 gene locus_tag LOCUS_00820 gene ruvX 13614 13171 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_00820 15696 13621 gene locus_tag LOCUS_00830 15696 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 16517 15693 gene locus_tag LOCUS_00840 gene bioC 16517 15693 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_00840 17314 16523 gene locus_tag LOCUS_00850 gene bioH 17314 16523 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_00850 17942 17508 gene locus_tag LOCUS_00860 17942 17508 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_00860 18601 17942 gene locus_tag LOCUS_00870 18601 17942 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_00870 19617 18850 gene locus_tag LOCUS_00880 19617 18850 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942714.1 protein_id gnl|my_center|LOCUS_00880 19747 20529 gene locus_tag LOCUS_00890 gene mazG 19747 20529 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_00890 20522 20926 gene locus_tag LOCUS_00900 gene ybgC 20522 20926 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 protein_id gnl|my_center|LOCUS_00900 20928 22286 gene locus_tag LOCUS_00910 20928 22286 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_00910 22531 23871 gene locus_tag LOCUS_00920 22531 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_00920 25548 24103 gene locus_tag LOCUS_00930 25548 24103 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_00930 25637 26623 gene locus_tag LOCUS_00940 25637 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 26769 27944 gene locus_tag LOCUS_00950 26769 27944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27970 28581 gene locus_tag LOCUS_00960 27970 28581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 28767 31112 gene locus_tag LOCUS_00970 28767 31112 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_00970 31141 31665 gene locus_tag LOCUS_00980 31141 31665 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_00980 31757 32821 gene locus_tag LOCUS_00990 31757 32821 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_00990 32830 33618 gene locus_tag LOCUS_01000 32830 33618 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_01000 34634 33615 gene locus_tag LOCUS_01010 34634 33615 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_01010 34826 35461 gene locus_tag LOCUS_01020 34826 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_01020 35619 36614 gene locus_tag LOCUS_01030 35619 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence004 1402 260 gene locus_tag LOCUS_01040 1402 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6097 1469 gene locus_tag LOCUS_01050 6097 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9154 7109 gene locus_tag LOCUS_01060 9154 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9275 9496 gene locus_tag LOCUS_01070 9275 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11671 10277 gene locus_tag LOCUS_01080 11671 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13030 13323 gene locus_tag LOCUS_01090 13030 13323 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 protein_id gnl|my_center|LOCUS_01090 13320 13526 gene locus_tag LOCUS_01100 13320 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 16942 13523 gene locus_tag LOCUS_01110 16942 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 19038 16939 gene locus_tag LOCUS_01120 19038 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 20110 19049 gene locus_tag LOCUS_01130 20110 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 21600 21049 gene locus_tag LOCUS_01140 21600 21049 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459363.1 protein_id gnl|my_center|LOCUS_01140 24556 21758 gene locus_tag LOCUS_01150 24556 21758 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_01150 27070 24851 gene locus_tag LOCUS_01160 27070 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 27876 27070 gene locus_tag LOCUS_01170 27876 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 29524 28436 gene locus_tag LOCUS_01180 29524 28436 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_01180 31088 29514 gene locus_tag LOCUS_01190 31088 29514 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_01190 33370 31463 gene locus_tag LOCUS_01200 33370 31463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence005 77 1273 gene locus_tag LOCUS_01210 77 1273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880778.1 protein_id gnl|my_center|LOCUS_01210 1300 1761 gene locus_tag LOCUS_01220 1300 1761 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_01220 1820 2059 gene locus_tag LOCUS_01230 1820 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2071 2478 gene locus_tag LOCUS_01240 2071 2478 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_01240 2869 2558 gene locus_tag LOCUS_01250 2869 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4108 2966 gene locus_tag LOCUS_01260 4108 2966 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_01260 4306 5151 gene locus_tag LOCUS_01270 4306 5151 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_01270 5167 5448 gene locus_tag LOCUS_01280 5167 5448 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_01280 5466 5753 gene locus_tag LOCUS_01290 5466 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5897 6826 gene locus_tag LOCUS_01300 5897 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7308 7057 gene locus_tag LOCUS_01310 7308 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 8426 7305 gene locus_tag LOCUS_01320 8426 7305 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_01320 8719 8507 gene locus_tag LOCUS_01330 8719 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10462 8972 gene locus_tag LOCUS_01340 10462 8972 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546548.1 protein_id gnl|my_center|LOCUS_01340 10672 11550 gene locus_tag LOCUS_01350 10672 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 11663 12724 gene locus_tag LOCUS_01360 11663 12724 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101899139.1 protein_id gnl|my_center|LOCUS_01360 12829 13872 gene locus_tag LOCUS_01370 gene ispG 12829 13872 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_01370 13919 14782 gene locus_tag LOCUS_01380 13919 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 15034 14750 gene locus_tag LOCUS_01390 15034 14750 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_01390 15327 15049 gene locus_tag LOCUS_01400 15327 15049 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_01400 15503 16792 gene locus_tag LOCUS_01410 gene purD 15503 16792 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_01410 16897 18312 gene locus_tag LOCUS_01420 16897 18312 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_01420 18340 19233 gene locus_tag LOCUS_01430 18340 19233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_01430 19230 20054 gene locus_tag LOCUS_01440 19230 20054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_01440 20878 20288 gene locus_tag LOCUS_01450 20878 20288 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391659.1 protein_id gnl|my_center|LOCUS_01450 22029 20857 gene locus_tag LOCUS_01460 22029 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 22105 23565 gene locus_tag LOCUS_01470 22105 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 23604 25961 gene locus_tag LOCUS_01480 23604 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 26046 27383 gene locus_tag LOCUS_01490 26046 27383 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257405.1 protein_id gnl|my_center|LOCUS_01490 27395 28228 gene locus_tag LOCUS_01500 27395 28228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 28232 28954 gene locus_tag LOCUS_01510 28232 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 30357 29242 gene locus_tag LOCUS_01520 gene alr 30357 29242 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01520 30568 30377 gene locus_tag LOCUS_01530 30568 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 30699 30565 gene locus_tag LOCUS_01540 30699 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence006 430 1767 gene locus_tag LOCUS_01550 430 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3898 1817 gene locus_tag LOCUS_01560 3898 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4247 5017 gene locus_tag LOCUS_01570 4247 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5891 5682 gene locus_tag LOCUS_01580 5891 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6011 6517 gene locus_tag LOCUS_01590 6011 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7025 6522 gene locus_tag LOCUS_01600 7025 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7285 7013 gene locus_tag LOCUS_01610 7285 7013 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_01610 7680 7973 gene locus_tag LOCUS_01620 gene groES 7680 7973 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056041.1 protein_id gnl|my_center|LOCUS_01620 8021 9664 gene locus_tag LOCUS_01630 gene groL 8021 9664 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_01630 10371 10051 gene locus_tag LOCUS_01640 10371 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 10621 10358 gene locus_tag LOCUS_01650 10621 10358 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 protein_id gnl|my_center|LOCUS_01650 10827 12038 gene locus_tag LOCUS_01660 10827 12038 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921463.1 protein_id gnl|my_center|LOCUS_01660 12038 12691 gene locus_tag LOCUS_01670 12038 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 13163 14353 gene locus_tag LOCUS_01680 gene trpB 13163 14353 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 protein_id gnl|my_center|LOCUS_01680 14356 15156 gene locus_tag LOCUS_01690 gene trpA 14356 15156 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_01690 15519 16232 gene locus_tag LOCUS_01700 15519 16232 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_01700 16496 16242 gene locus_tag LOCUS_01710 16496 16242 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_01710 16746 16489 gene locus_tag LOCUS_01720 gene yefM 16746 16489 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_01720 20092 17156 gene locus_tag LOCUS_01730 20092 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 20223 20319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21716 21132 gene locus_tag LOCUS_01740 gene gmhA 21716 21132 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_01740 21959 22318 gene locus_tag LOCUS_01750 21959 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 23971 22331 gene locus_tag LOCUS_01760 23971 22331 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_01760 24739 24296 gene locus_tag LOCUS_01770 24739 24296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 26625 24736 gene locus_tag LOCUS_01780 26625 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 26902 28029 gene locus_tag LOCUS_01790 26902 28029 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_01790 29117 28221 gene locus_tag LOCUS_01800 29117 28221 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391304.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence007 1278 319 gene locus_tag LOCUS_01810 1278 319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533422.1 protein_id gnl|my_center|LOCUS_01810 1872 2618 gene locus_tag LOCUS_01820 1872 2618 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_01820 3445 2633 gene locus_tag LOCUS_01830 3445 2633 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_01830 3721 3449 gene locus_tag LOCUS_01840 3721 3449 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_01840 3990 3718 gene locus_tag LOCUS_01850 3990 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3943 4248 gene locus_tag LOCUS_01860 3943 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4792 4235 gene locus_tag LOCUS_01870 4792 4235 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_01870 5960 4902 gene locus_tag LOCUS_01880 5960 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7297 5957 gene locus_tag LOCUS_01890 7297 5957 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868840.1 protein_id gnl|my_center|LOCUS_01890 7415 7654 gene locus_tag LOCUS_01900 7415 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9003 7546 gene locus_tag LOCUS_01910 9003 7546 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 protein_id gnl|my_center|LOCUS_01910 9333 9019 gene locus_tag LOCUS_01920 9333 9019 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_01920 9631 9338 gene locus_tag LOCUS_01930 gene pduA 9631 9338 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_01930 10291 9656 gene locus_tag LOCUS_01940 10291 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_01940 11153 10338 gene locus_tag LOCUS_01950 11153 10338 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_01950 12085 11468 gene locus_tag LOCUS_01960 12085 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 12692 12099 gene locus_tag LOCUS_01970 12692 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 14202 12925 gene locus_tag LOCUS_01980 gene serS 14202 12925 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_01980 14993 14208 gene locus_tag LOCUS_01990 14993 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 17500 14990 gene locus_tag LOCUS_02000 gene gyrA 17500 14990 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_02000 19445 17997 gene locus_tag LOCUS_02010 19445 17997 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_02010 20176 19961 gene locus_tag LOCUS_02020 20176 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 20058 20516 gene locus_tag LOCUS_02030 20058 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 20616 21038 gene locus_tag LOCUS_02040 20616 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 21373 22863 gene locus_tag LOCUS_02050 21373 22863 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_02050 24033 23110 gene locus_tag LOCUS_02060 gene waaF 24033 23110 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_02060 25067 24090 gene locus_tag LOCUS_02070 25067 24090 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_02070 25698 25072 gene locus_tag LOCUS_02080 gene hisH 25698 25072 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_02080 26301 25711 gene locus_tag LOCUS_02090 gene hisB 26301 25711 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528350.1 protein_id gnl|my_center|LOCUS_02090 27181 26444 gene locus_tag LOCUS_02100 27181 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence008 825 196 gene locus_tag LOCUS_02110 825 196 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_02110 724 1092 gene locus_tag LOCUS_02120 724 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1232 1483 gene locus_tag LOCUS_02130 1232 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1522 2817 gene locus_tag LOCUS_02140 gene gltA 1522 2817 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_02140 3119 3700 gene locus_tag LOCUS_02150 3119 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_02150 4085 5572 gene locus_tag LOCUS_02160 4085 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 5565 6392 gene locus_tag LOCUS_02170 5565 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6678 7661 gene locus_tag LOCUS_02180 6678 7661 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_02180 7661 8476 gene locus_tag LOCUS_02190 gene lpxI 7661 8476 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_02190 8509 9981 gene locus_tag LOCUS_02200 8509 9981 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_02200 10267 9989 gene locus_tag LOCUS_02210 10267 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 12132 10369 gene locus_tag LOCUS_02220 12132 10369 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_02220 12913 13164 gene locus_tag LOCUS_02230 12913 13164 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_02230 13169 13528 gene locus_tag LOCUS_02240 13169 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13669 14301 gene locus_tag LOCUS_02250 13669 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14316 15488 gene locus_tag LOCUS_02260 14316 15488 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_02260 15485 16078 gene locus_tag LOCUS_02270 15485 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 16266 17171 gene locus_tag LOCUS_02280 16266 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 17327 17950 gene locus_tag LOCUS_02290 17327 17950 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_02290 18046 19449 gene locus_tag LOCUS_02300 18046 19449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 19476 19847 gene locus_tag LOCUS_02310 19476 19847 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026148953.1 protein_id gnl|my_center|LOCUS_02310 20765 19914 gene locus_tag LOCUS_02320 20765 19914 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_02320 21700 20777 gene locus_tag LOCUS_02330 gene hemC 21700 20777 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_02330 22147 21764 gene locus_tag LOCUS_02340 22147 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22493 22134 gene locus_tag LOCUS_02350 22493 22134 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_02350 22801 22493 gene locus_tag LOCUS_02360 22801 22493 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_02360 24066 22798 gene locus_tag LOCUS_02370 gene hemA 24066 22798 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_02370 24848 24063 gene locus_tag LOCUS_02380 gene ccsB 24848 24063 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_02380 25264 24845 gene locus_tag LOCUS_02390 25264 24845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 25151 25450 gene locus_tag LOCUS_02400 25151 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 26390 25935 gene locus_tag LOCUS_02410 gene nrdR 26390 25935 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_02410 27668 26394 gene locus_tag LOCUS_02420 27668 26394 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_02420 28147 27674 gene locus_tag LOCUS_02430 gene rpiB 28147 27674 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence009 829 551 gene locus_tag LOCUS_02440 829 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 1242 1943 gene locus_tag LOCUS_02450 1242 1943 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_02450 1940 3109 gene locus_tag LOCUS_02460 gene lpxB 1940 3109 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_02460 5943 3178 gene locus_tag LOCUS_02470 5943 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6688 6185 gene locus_tag LOCUS_02480 gene mog 6688 6185 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_02480 7918 6707 gene locus_tag LOCUS_02490 7918 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9908 7920 gene locus_tag LOCUS_02500 9908 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10425 9925 gene locus_tag LOCUS_02510 10425 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 11683 10448 gene locus_tag LOCUS_02520 11683 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12083 11721 gene locus_tag LOCUS_02530 12083 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13141 12080 gene locus_tag LOCUS_02540 13141 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 13949 14401 gene locus_tag LOCUS_02550 13949 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 14965 15915 gene locus_tag LOCUS_02560 14965 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16405 18954 gene locus_tag LOCUS_02570 16405 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18964 20106 gene locus_tag LOCUS_02580 18964 20106 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545659.1 protein_id gnl|my_center|LOCUS_02580 20103 20411 gene locus_tag LOCUS_02590 20103 20411 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_02590 20398 20742 gene locus_tag LOCUS_02600 20398 20742 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_02600 20990 22336 gene locus_tag LOCUS_02610 20990 22336 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_02610 22503 23693 gene locus_tag LOCUS_02620 22503 23693 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_02620 24067 24444 gene locus_tag LOCUS_02630 24067 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 26543 24624 gene locus_tag LOCUS_02640 26543 24624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence010 366 2081 gene locus_tag LOCUS_02650 gene sdhA 366 2081 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545258.1 protein_id gnl|my_center|LOCUS_02650 2130 3086 gene locus_tag LOCUS_02660 2130 3086 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_02660 3083 3952 gene locus_tag LOCUS_02670 3083 3952 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_02670 4164 4592 gene locus_tag LOCUS_02680 4164 4592 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943617.1 protein_id gnl|my_center|LOCUS_02680 6565 4853 gene locus_tag LOCUS_02690 6565 4853 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_02690 6930 8615 gene locus_tag LOCUS_02700 6930 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 8840 9964 gene locus_tag LOCUS_02710 8840 9964 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_02710 9758 9854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10037 12337 gene locus_tag LOCUS_02720 10037 12337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12821 13006 gene locus_tag LOCUS_02730 12821 13006 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_02730 13018 13230 gene locus_tag LOCUS_02740 13018 13230 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_02740 13410 13733 gene locus_tag LOCUS_02750 13410 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 13847 14953 gene locus_tag LOCUS_02760 gene gnfL 13847 14953 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_02760 14983 15077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16581 15214 gene locus_tag LOCUS_02770 gene selA 16581 15214 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187099.1 protein_id gnl|my_center|LOCUS_02770 18373 16631 gene locus_tag LOCUS_02780 18373 16631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_02780 19632 18439 gene locus_tag LOCUS_02790 19632 18439 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02790 20414 19683 gene locus_tag LOCUS_02800 20414 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 21611 20421 gene locus_tag LOCUS_02810 21611 20421 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_02810 23524 21869 gene locus_tag LOCUS_02820 23524 21869 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_02820 23809 23540 gene locus_tag LOCUS_02830 23809 23540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 24350 23799 gene locus_tag LOCUS_02840 24350 23799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 26112 24436 gene locus_tag LOCUS_02850 gene ilvD 26112 24436 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence011 <1 1859 gene locus_tag LOCUS_02860 <1 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein 2162 3223 gene locus_tag LOCUS_02870 2162 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3240 3806 gene locus_tag LOCUS_02880 3240 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4390 3926 gene locus_tag LOCUS_02890 4390 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6836 4455 gene locus_tag LOCUS_02900 6836 4455 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_02900 7332 7405 gene locus_tag LOCUS_t00030 7332 7405 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9726 7957 gene locus_tag LOCUS_02910 9726 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10122 9805 gene locus_tag LOCUS_02920 10122 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10744 10127 gene locus_tag LOCUS_02930 10744 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10944 10741 gene locus_tag LOCUS_02940 10944 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11101 12075 gene locus_tag LOCUS_02950 11101 12075 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403637.1 protein_id gnl|my_center|LOCUS_02950 12101 12280 gene locus_tag LOCUS_02960 12101 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12638 12357 gene locus_tag LOCUS_02970 12638 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 14104 13328 gene locus_tag LOCUS_02980 14104 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14433 15477 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcccctcgtttctggggcgtggtttgcgac 16049 15744 gene locus_tag LOCUS_02990 16049 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 17349 16267 gene locus_tag LOCUS_03000 gene cas1 17349 16267 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388909.1 protein_id gnl|my_center|LOCUS_03000 18700 17369 gene locus_tag LOCUS_03010 18700 17369 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229155.1 protein_id gnl|my_center|LOCUS_03010 21115 18716 gene locus_tag LOCUS_03020 21115 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 21511 21125 gene locus_tag LOCUS_03030 21511 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 22395 21508 gene locus_tag LOCUS_03040 gene cmr4 22395 21508 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_03040 23437 22388 gene locus_tag LOCUS_03050 23437 22388 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_03050 25473 23437 gene locus_tag LOCUS_03060 25473 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25612 25830 gene locus_tag LOCUS_03070 25612 25830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence012 <1 1280 gene locus_tag LOCUS_03080 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943204.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 1286 2086 gene locus_tag LOCUS_03090 1286 2086 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_03090 2184 3275 gene locus_tag LOCUS_03100 2184 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 3512 3601 gene locus_tag LOCUS_t00040 3512 3601 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3666 4478 gene locus_tag LOCUS_03110 3666 4478 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_03110 4808 5305 gene locus_tag LOCUS_03120 4808 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5305 5907 gene locus_tag LOCUS_03130 5305 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5907 7013 gene locus_tag LOCUS_03140 5907 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 7092 7898 gene locus_tag LOCUS_03150 7092 7898 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529675.1 protein_id gnl|my_center|LOCUS_03150 7898 9490 gene locus_tag LOCUS_03160 7898 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9570 10850 gene locus_tag LOCUS_03170 9570 10850 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_03170 10847 12313 gene locus_tag LOCUS_03180 10847 12313 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263308.1 protein_id gnl|my_center|LOCUS_03180 12537 15653 gene locus_tag LOCUS_03190 12537 15653 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_03190 16011 16343 gene locus_tag LOCUS_03200 16011 16343 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_03200 16874 18256 gene locus_tag LOCUS_03210 gene cobB 16874 18256 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_03210 18300 18461 gene locus_tag LOCUS_03220 18300 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 18697 19698 gene locus_tag LOCUS_03230 gene galE 18697 19698 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_03230 20003 20332 gene locus_tag LOCUS_03240 20003 20332 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_03240 20322 20657 gene locus_tag LOCUS_03250 20322 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 20693 20962 gene locus_tag LOCUS_03260 20693 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20963 21709 gene locus_tag LOCUS_03270 20963 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 21714 22118 gene locus_tag LOCUS_03280 21714 22118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 22305 23270 gene locus_tag LOCUS_03290 22305 23270 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_03290 23334 23636 gene locus_tag LOCUS_03300 23334 23636 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_03300 23623 23985 gene locus_tag LOCUS_03310 23623 23985 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888442.1 protein_id gnl|my_center|LOCUS_03310 23991 24800 gene locus_tag LOCUS_03320 gene lgt 23991 24800 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_03320 24763 25707 gene locus_tag LOCUS_03330 24763 25707 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence013 39 254 gene locus_tag LOCUS_03340 39 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1145 411 gene locus_tag LOCUS_03350 1145 411 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_03350 1444 2775 gene locus_tag LOCUS_03360 gene xanA2 1444 2775 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_03360 3037 3255 gene locus_tag LOCUS_03370 3037 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3476 3754 gene locus_tag LOCUS_03380 3476 3754 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_03380 3751 4980 gene locus_tag LOCUS_03390 3751 4980 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_03390 5003 5959 gene locus_tag LOCUS_03400 5003 5959 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_03400 5956 7137 gene locus_tag LOCUS_03410 5956 7137 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_03410 7141 7947 gene locus_tag LOCUS_03420 7141 7947 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_03420 8085 10853 gene locus_tag LOCUS_03430 8085 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10958 11143 gene locus_tag LOCUS_03440 10958 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 11134 11210 gene locus_tag LOCUS_t00050 11134 11210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11726 11244 gene locus_tag LOCUS_03450 11726 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 12969 11710 gene locus_tag LOCUS_03460 12969 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 13838 12969 gene locus_tag LOCUS_03470 13838 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 14437 13874 gene locus_tag LOCUS_03480 14437 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 14825 14418 gene locus_tag LOCUS_03490 14825 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 15334 14822 gene locus_tag LOCUS_03500 gene exeH 15334 14822 CDS product GspH family T2SS minor pseudopilin variant ExeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704543.1 protein_id gnl|my_center|LOCUS_03500 15768 15319 gene locus_tag LOCUS_03510 gene gspG 15768 15319 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_03510 16976 15765 gene locus_tag LOCUS_03520 gene exeF 16976 15765 CDS product GspF family T2SS innner membrane protein variant ExeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_03520 18509 16986 gene locus_tag LOCUS_03530 gene gspE 18509 16986 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_03530 20551 18506 gene locus_tag LOCUS_03540 gene xcpQ 20551 18506 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_03540 21126 20548 gene locus_tag LOCUS_03550 21126 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 21857 21123 gene locus_tag LOCUS_03560 21857 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence014 1375 191 gene locus_tag LOCUS_03570 1375 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3165 1393 gene locus_tag LOCUS_03580 3165 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3753 3472 gene locus_tag LOCUS_03590 3753 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4799 4089 gene locus_tag LOCUS_03600 gene rph 4799 4089 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_03600 5615 4812 gene locus_tag LOCUS_03610 gene murI 5615 4812 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_03610 6604 5798 gene locus_tag LOCUS_03620 6604 5798 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_03620 8994 6601 gene locus_tag LOCUS_03630 gene gyrB 8994 6601 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 protein_id gnl|my_center|LOCUS_03630 10535 9186 gene locus_tag LOCUS_03640 gene dnaA 10535 9186 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_03640 10662 11459 gene locus_tag LOCUS_03650 gene thiD 10662 11459 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_03650 12811 11702 gene locus_tag LOCUS_03660 12811 11702 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_03660 13959 12808 gene locus_tag LOCUS_03670 13959 12808 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_03670 14751 13960 gene locus_tag LOCUS_03680 14751 13960 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_03680 15515 14751 gene locus_tag LOCUS_03690 15515 14751 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_03690 16094 15537 gene locus_tag LOCUS_03700 gene frr 16094 15537 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_03700 16842 16096 gene locus_tag LOCUS_03710 gene pyrH 16842 16096 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_03710 17725 16847 gene locus_tag LOCUS_03720 gene tsf 17725 16847 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_03720 18661 17828 gene locus_tag LOCUS_03730 gene rpsB 18661 17828 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_03730 19417 19109 gene locus_tag LOCUS_03740 19417 19109 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_03740 19388 19591 gene locus_tag LOCUS_03750 19388 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 19736 20008 gene locus_tag LOCUS_03760 19736 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 20005 20325 gene locus_tag LOCUS_03770 20005 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 21427 20342 gene locus_tag LOCUS_03780 21427 20342 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_03780 23050 21713 gene locus_tag LOCUS_03790 23050 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 24582 23047 gene locus_tag LOCUS_03800 24582 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence015 <1 3161 gene locus_tag LOCUS_03810 <1 3161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:PAS domain S-box protein 4118 3231 gene locus_tag LOCUS_03820 4118 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5550 4342 gene locus_tag LOCUS_03830 gene argJ 5550 4342 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_03830 6572 5556 gene locus_tag LOCUS_03840 gene argC 6572 5556 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_03840 7067 6666 gene locus_tag LOCUS_03850 7067 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7519 7067 gene locus_tag LOCUS_03860 gene rplM 7519 7067 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_03860 7785 8204 gene locus_tag LOCUS_03870 7785 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8258 9661 gene locus_tag LOCUS_03880 8258 9661 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_03880 9866 11395 gene locus_tag LOCUS_03890 9866 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 11520 12527 gene locus_tag LOCUS_03900 gene gap 11520 12527 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_03900 12595 13779 gene locus_tag LOCUS_03910 gene pgk 12595 13779 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_03910 13828 14112 gene locus_tag LOCUS_03920 13828 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 14099 14362 gene locus_tag LOCUS_03930 14099 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 14712 15479 gene locus_tag LOCUS_03940 gene tpiA 14712 15479 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_03940 15564 16019 gene locus_tag LOCUS_03950 15564 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 16404 18098 gene locus_tag LOCUS_03960 16404 18098 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_03960 18641 18108 gene locus_tag LOCUS_03970 18641 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 19486 18638 gene locus_tag LOCUS_03980 gene mreC 19486 18638 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_03980 20599 19577 gene locus_tag LOCUS_03990 20599 19577 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_03990 21429 21217 gene locus_tag LOCUS_04000 21429 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 22813 21497 gene locus_tag LOCUS_04010 22813 21497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 22952 24205 gene locus_tag LOCUS_04020 gene ampG 22952 24205 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223277.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence016 477 2456 gene locus_tag LOCUS_04030 477 2456 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_04030 2453 4981 gene locus_tag LOCUS_04040 2453 4981 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_04040 5088 5447 gene locus_tag LOCUS_04050 5088 5447 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_04050 5444 5992 gene locus_tag LOCUS_04060 5444 5992 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_04060 5989 6528 gene locus_tag LOCUS_04070 5989 6528 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_04070 6536 7747 gene locus_tag LOCUS_04080 gene nuoD 6536 7747 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_04080 7744 8835 gene locus_tag LOCUS_04090 gene nuoH 7744 8835 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_04090 8845 9420 gene locus_tag LOCUS_04100 8845 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 9436 9933 gene locus_tag LOCUS_04110 9436 9933 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_04110 9938 10216 gene locus_tag LOCUS_04120 9938 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 10251 12206 gene locus_tag LOCUS_04130 gene nuoL 10251 12206 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_04130 12208 13788 gene locus_tag LOCUS_04140 12208 13788 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_04140 13801 15252 gene locus_tag LOCUS_04150 13801 15252 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_04150 15416 15676 gene locus_tag LOCUS_04160 15416 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15751 16290 gene locus_tag LOCUS_04170 15751 16290 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_04170 16853 16377 gene locus_tag LOCUS_04180 16853 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 17223 17975 gene locus_tag LOCUS_04190 17223 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_04190 18617 17997 gene locus_tag LOCUS_04200 18617 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20502 19255 gene locus_tag LOCUS_04210 20502 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 20813 20989 gene locus_tag LOCUS_04220 20813 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 21187 21369 gene locus_tag LOCUS_04230 21187 21369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 21687 22355 gene locus_tag LOCUS_04240 21687 22355 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_04240 22402 22971 gene locus_tag LOCUS_04250 22402 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 22971 23672 gene locus_tag LOCUS_04260 gene nfi 22971 23672 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence017 <1 654 gene locus_tag LOCUS_04270 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258445.1:sensor domain-containing diguanylate cyclase 658 1308 gene locus_tag LOCUS_04280 gene plsY 658 1308 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_04280 1461 1537 gene locus_tag LOCUS_t00060 1461 1537 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1864 3294 gene locus_tag LOCUS_04290 1864 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3671 3291 gene locus_tag LOCUS_04300 3671 3291 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_04300 4317 3676 gene locus_tag LOCUS_04310 gene thiE 4317 3676 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_04310 4538 4314 gene locus_tag LOCUS_04320 4538 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4735 4538 gene locus_tag LOCUS_04330 gene thiS 4735 4538 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_04330 6131 4980 gene locus_tag LOCUS_04340 gene thiH 6131 4980 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_04340 6921 6142 gene locus_tag LOCUS_04350 6921 6142 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_04350 7043 8257 gene locus_tag LOCUS_04360 7043 8257 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_04360 8259 8501 gene locus_tag LOCUS_04370 8259 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8786 9451 gene locus_tag LOCUS_04380 8786 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 9846 11291 gene locus_tag LOCUS_04390 gene nhaB 9846 11291 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816442.1 protein_id gnl|my_center|LOCUS_04390 12548 11340 gene locus_tag LOCUS_04400 12548 11340 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_04400 12800 13636 gene locus_tag LOCUS_04410 gene mpgP 12800 13636 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_04410 14806 13703 gene locus_tag LOCUS_04420 14806 13703 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_04420 15876 14803 gene locus_tag LOCUS_04430 15876 14803 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_04430 17862 16156 gene locus_tag LOCUS_04440 gene recN 17862 16156 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_04440 18927 17866 gene locus_tag LOCUS_04450 18927 17866 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_04450 19789 18914 gene locus_tag LOCUS_04460 19789 18914 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_04460 20045 21367 gene locus_tag LOCUS_04470 20045 21367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 21790 21491 gene locus_tag LOCUS_04480 21790 21491 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_04480 22072 21797 gene locus_tag LOCUS_04490 22072 21797 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_04490 22337 22261 gene locus_tag LOCUS_t00070 22337 22261 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23214 22459 gene locus_tag LOCUS_04500 23214 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence018 361 2202 gene locus_tag LOCUS_04510 361 2202 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_04510 2210 4192 gene locus_tag LOCUS_04520 2210 4192 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271940.1 protein_id gnl|my_center|LOCUS_04520 5446 4418 gene locus_tag LOCUS_04530 5446 4418 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_04530 7062 5689 gene locus_tag LOCUS_04540 7062 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9190 7112 gene locus_tag LOCUS_04550 9190 7112 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919291.1 protein_id gnl|my_center|LOCUS_04550 9616 10194 gene locus_tag LOCUS_04560 9616 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10328 11995 gene locus_tag LOCUS_04570 10328 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11999 13342 gene locus_tag LOCUS_04580 11999 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 16966 13343 gene locus_tag LOCUS_04590 16966 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 17877 16963 gene locus_tag LOCUS_04600 17877 16963 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420320.1 protein_id gnl|my_center|LOCUS_04600 18899 17874 gene locus_tag LOCUS_04610 18899 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 20511 19975 gene locus_tag LOCUS_04620 20511 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 21999 20668 gene locus_tag LOCUS_04630 gene thrC 21999 20668 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_04630 22209 22973 gene locus_tag LOCUS_04640 22209 22973 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence019 751 164 gene locus_tag LOCUS_04650 751 164 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_04650 3943 1040 gene locus_tag LOCUS_04660 3943 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4656 5039 gene locus_tag LOCUS_04670 4656 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5887 7458 gene locus_tag LOCUS_04680 5887 7458 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881284.1 protein_id gnl|my_center|LOCUS_04680 7709 8401 gene locus_tag LOCUS_04690 7709 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8513 8704 gene locus_tag LOCUS_04700 8513 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 12145 8729 gene locus_tag LOCUS_04710 12145 8729 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057320.1 protein_id gnl|my_center|LOCUS_04710 12724 12146 gene locus_tag LOCUS_04720 12724 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14811 12901 gene locus_tag LOCUS_04730 14811 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 16089 14824 gene locus_tag LOCUS_04740 16089 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 16278 16105 gene locus_tag LOCUS_04750 16278 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_04750 17809 16769 gene locus_tag LOCUS_04760 17809 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18231 17806 gene locus_tag LOCUS_04770 18231 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 18786 18304 gene locus_tag LOCUS_04780 18786 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19224 18874 gene locus_tag LOCUS_04790 19224 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20144 19359 gene locus_tag LOCUS_04800 20144 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21182 20325 gene locus_tag LOCUS_04810 21182 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22324 21635 gene locus_tag LOCUS_04820 22324 21635 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663315.1 protein_id gnl|my_center|LOCUS_04820 23389 22454 gene locus_tag LOCUS_04830 23389 22454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence020 1503 769 gene locus_tag LOCUS_04840 1503 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1910 1500 gene locus_tag LOCUS_04850 1910 1500 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_04850 2545 1913 gene locus_tag LOCUS_04860 2545 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3713 2550 gene locus_tag LOCUS_04870 3713 2550 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_04870 4896 3937 gene locus_tag LOCUS_04880 4896 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6262 5411 gene locus_tag LOCUS_04890 6262 5411 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_04890 6754 6853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6943 7473 gene locus_tag LOCUS_04900 6943 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8482 9303 gene locus_tag LOCUS_04910 8482 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9079 9137 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10088 9288 gene locus_tag LOCUS_04920 10088 9288 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_04920 10280 10639 gene locus_tag LOCUS_04930 10280 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 12141 12370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13020 13208 gene locus_tag LOCUS_04940 13020 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 13064 13070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13144 13323 gene locus_tag LOCUS_04950 13144 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13371 13775 gene locus_tag LOCUS_04960 13371 13775 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_04960 13841 14236 gene locus_tag LOCUS_04970 13841 14236 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_04970 15135 14278 gene locus_tag LOCUS_04980 15135 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15814 15149 gene locus_tag LOCUS_04990 15814 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 16303 18129 gene locus_tag LOCUS_05000 16303 18129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 18253 20481 gene locus_tag LOCUS_05010 18253 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 20622 22964 gene locus_tag LOCUS_05020 20622 22964 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence021 1446 169 gene locus_tag LOCUS_05030 1446 169 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_05030 2016 2588 gene locus_tag LOCUS_05040 2016 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3313 2798 gene locus_tag LOCUS_05050 3313 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3937 3317 gene locus_tag LOCUS_05060 3937 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4916 3972 gene locus_tag LOCUS_05070 4916 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5735 4935 gene locus_tag LOCUS_05080 5735 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6797 5772 gene locus_tag LOCUS_05090 6797 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8258 7029 gene locus_tag LOCUS_05100 8258 7029 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_05100 8901 8233 gene locus_tag LOCUS_05110 8901 8233 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_05110 10907 8925 gene locus_tag LOCUS_05120 gene feoB 10907 8925 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_05120 11873 10926 gene locus_tag LOCUS_05130 11873 10926 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_05130 12121 11870 gene locus_tag LOCUS_05140 12121 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12921 12127 gene locus_tag LOCUS_05150 12921 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13604 12933 gene locus_tag LOCUS_05160 13604 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14384 13623 gene locus_tag LOCUS_05170 14384 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16270 14384 gene locus_tag LOCUS_05180 16270 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17306 16365 gene locus_tag LOCUS_05190 17306 16365 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023294.1 protein_id gnl|my_center|LOCUS_05190 17552 17349 gene locus_tag LOCUS_05200 17552 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 17825 17586 gene locus_tag LOCUS_05210 17825 17586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19112 17910 gene locus_tag LOCUS_05220 19112 17910 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_05220 20461 19136 gene locus_tag LOCUS_05230 20461 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 21225 20458 gene locus_tag LOCUS_05240 21225 20458 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_05240 <22884 21228 gene locus_tag LOCUS_05250 <22884 21228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259285.1:Do family serine endopeptidase >Feature sequence022 993 454 gene locus_tag LOCUS_05260 993 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2099 1014 gene locus_tag LOCUS_05270 2099 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2575 2859 gene locus_tag LOCUS_05280 2575 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5306 3120 gene locus_tag LOCUS_05290 5306 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5849 6583 gene locus_tag LOCUS_05300 gene tolQ 5849 6583 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_05300 6646 7035 gene locus_tag LOCUS_05310 gene tolR 6646 7035 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_05310 7016 7960 gene locus_tag LOCUS_05320 7016 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7970 9310 gene locus_tag LOCUS_05330 gene tolB 7970 9310 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_05330 9467 10087 gene locus_tag LOCUS_05340 gene pal 9467 10087 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_05340 10181 11155 gene locus_tag LOCUS_05350 10181 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11188 13098 gene locus_tag LOCUS_05360 11188 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 13683 14567 gene locus_tag LOCUS_05370 13683 14567 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_05370 14564 16399 gene locus_tag LOCUS_05380 14564 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 16424 17755 gene locus_tag LOCUS_05390 16424 17755 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272782.1 protein_id gnl|my_center|LOCUS_05390 18293 17994 gene locus_tag LOCUS_05400 18293 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19689 18643 gene locus_tag LOCUS_05410 19689 18643 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_05410 21048 19858 gene locus_tag LOCUS_05420 21048 19858 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695838.1 protein_id gnl|my_center|LOCUS_05420 22328 21045 gene locus_tag LOCUS_05430 22328 21045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence023 <1 1071 gene locus_tag LOCUS_05440 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861227.1:cell wall-binding protein Cwp20 1073 2083 gene locus_tag LOCUS_05450 1073 2083 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_05450 2268 3791 gene locus_tag LOCUS_05460 2268 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3788 4600 gene locus_tag LOCUS_05470 3788 4600 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130802.1 protein_id gnl|my_center|LOCUS_05470 4618 8895 gene locus_tag LOCUS_05480 4618 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8976 10103 gene locus_tag LOCUS_05490 8976 10103 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_05490 10104 10706 gene locus_tag LOCUS_05500 10104 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 10703 11677 gene locus_tag LOCUS_05510 10703 11677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972048.1 protein_id gnl|my_center|LOCUS_05510 11674 15582 gene locus_tag LOCUS_05520 11674 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 16857 15817 gene locus_tag LOCUS_05530 gene rlmN 16857 15817 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_05530 17100 17345 gene locus_tag LOCUS_05540 17100 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 17332 18747 gene locus_tag LOCUS_05550 17332 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 20022 21725 gene locus_tag LOCUS_05560 20022 21725 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_05560 21882 22208 gene locus_tag LOCUS_05570 21882 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence024 328 1530 gene locus_tag LOCUS_05580 328 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1897 3081 gene locus_tag LOCUS_05590 1897 3081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_05590 3085 3777 gene locus_tag LOCUS_05600 3085 3777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_05600 3774 5003 gene locus_tag LOCUS_05610 3774 5003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_05610 5085 6986 gene locus_tag LOCUS_05620 5085 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6983 8764 gene locus_tag LOCUS_05630 6983 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8946 8785 gene locus_tag LOCUS_05640 8946 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 9722 9063 gene locus_tag LOCUS_05650 9722 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 10166 9771 gene locus_tag LOCUS_05660 10166 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12956 10242 gene locus_tag LOCUS_05670 12956 10242 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_05670 14088 13063 gene locus_tag LOCUS_05680 14088 13063 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257614.1 protein_id gnl|my_center|LOCUS_05680 16209 14110 gene locus_tag LOCUS_05690 16209 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 18027 16546 gene locus_tag LOCUS_05700 gene gcvPB 18027 16546 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_05700 19395 18046 gene locus_tag LOCUS_05710 gene gcvPA 19395 18046 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_05710 19785 19399 gene locus_tag LOCUS_05720 gene gcvH 19785 19399 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_05720 20927 19782 gene locus_tag LOCUS_05730 gene gcvT 20927 19782 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_05730 21396 20983 gene locus_tag LOCUS_05740 21396 20983 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence025 906 1841 gene locus_tag LOCUS_05750 906 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2118 1867 gene locus_tag LOCUS_05760 2118 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2266 2514 gene locus_tag LOCUS_05770 2266 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3264 2647 gene locus_tag LOCUS_05780 3264 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3994 3557 gene locus_tag LOCUS_05790 3994 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4099 4195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4995 4708 gene locus_tag LOCUS_05800 gene gatC 4995 4708 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702422.1 protein_id gnl|my_center|LOCUS_05800 7484 5190 gene locus_tag LOCUS_05810 7484 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7638 8453 gene locus_tag LOCUS_05820 7638 8453 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_05820 8482 9555 gene locus_tag LOCUS_05830 8482 9555 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_05830 10234 9809 gene locus_tag LOCUS_05840 10234 9809 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_05840 11307 10231 gene locus_tag LOCUS_05850 gene hisC 11307 10231 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545615.1 protein_id gnl|my_center|LOCUS_05850 12619 11327 gene locus_tag LOCUS_05860 gene hisD 12619 11327 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546313.1 protein_id gnl|my_center|LOCUS_05860 14751 12616 gene locus_tag LOCUS_05870 14751 12616 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583261.1 protein_id gnl|my_center|LOCUS_05870 15783 14818 gene locus_tag LOCUS_05880 15783 14818 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_05880 16896 15802 gene locus_tag LOCUS_05890 16896 15802 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_05890 17034 17792 gene locus_tag LOCUS_05900 17034 17792 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_05900 17782 18189 gene locus_tag LOCUS_05910 17782 18189 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_05910 18144 18932 gene locus_tag LOCUS_05920 18144 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 19745 18936 gene locus_tag LOCUS_05930 gene folP 19745 18936 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930173.1 protein_id gnl|my_center|LOCUS_05930 22031 19776 gene locus_tag LOCUS_05940 gene infB 22031 19776 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence026 571 1764 gene locus_tag LOCUS_05950 571 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1792 2049 gene locus_tag LOCUS_05960 1792 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2705 3316 gene locus_tag LOCUS_05970 2705 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3309 3707 gene locus_tag LOCUS_05980 3309 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3811 4941 gene locus_tag LOCUS_05990 3811 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_05990 4946 5365 gene locus_tag LOCUS_06000 4946 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5393 6322 gene locus_tag LOCUS_06010 5393 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 protein_id gnl|my_center|LOCUS_06010 6325 6615 gene locus_tag LOCUS_06020 6325 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6691 7023 gene locus_tag LOCUS_06030 6691 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7020 7505 gene locus_tag LOCUS_06040 7020 7505 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_06040 7502 7909 gene locus_tag LOCUS_06050 7502 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7912 8433 gene locus_tag LOCUS_06060 7912 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8426 8869 gene locus_tag LOCUS_06070 8426 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8881 9621 gene locus_tag LOCUS_06080 8881 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 9631 9933 gene locus_tag LOCUS_06090 9631 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10039 12990 gene locus_tag LOCUS_06100 10039 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12987 13379 gene locus_tag LOCUS_06110 12987 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13389 14447 gene locus_tag LOCUS_06120 13389 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14440 15315 gene locus_tag LOCUS_06130 14440 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 15312 16673 gene locus_tag LOCUS_06140 15312 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 16718 17947 gene locus_tag LOCUS_06150 16718 17947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 17947 18171 gene locus_tag LOCUS_06160 17947 18171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 18181 18840 gene locus_tag LOCUS_06170 18181 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 19905 20864 gene locus_tag LOCUS_06180 19905 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 20864 21388 gene locus_tag LOCUS_06190 20864 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 21439 21681 gene locus_tag LOCUS_06200 21439 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 21678 21893 gene locus_tag LOCUS_06210 21678 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence027 772 389 gene locus_tag LOCUS_06220 772 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 690 950 gene locus_tag LOCUS_06230 690 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1793 1068 gene locus_tag LOCUS_06240 1793 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3952 2048 gene locus_tag LOCUS_06250 gene selB 3952 2048 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816415.1 protein_id gnl|my_center|LOCUS_06250 5784 3976 gene locus_tag LOCUS_06260 5784 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7136 5781 gene locus_tag LOCUS_06270 gene der 7136 5781 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_06270 7228 8214 gene locus_tag LOCUS_06280 7228 8214 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_06280 8508 9431 gene locus_tag LOCUS_06290 8508 9431 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_06290 9428 10366 gene locus_tag LOCUS_06300 9428 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10363 11346 gene locus_tag LOCUS_06310 10363 11346 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_06310 11343 12386 gene locus_tag LOCUS_06320 11343 12386 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_06320 13651 12272 gene locus_tag LOCUS_06330 13651 12272 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393790.1 protein_id gnl|my_center|LOCUS_06330 14077 13724 gene locus_tag LOCUS_06340 14077 13724 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_06340 14448 14074 gene locus_tag LOCUS_06350 gene crcB 14448 14074 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_06350 15193 14456 gene locus_tag LOCUS_06360 15193 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 17019 15511 gene locus_tag LOCUS_06370 17019 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 17728 18075 gene locus_tag LOCUS_06380 17728 18075 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_06380 18435 19637 gene locus_tag LOCUS_06390 18435 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 19648 21405 gene locus_tag LOCUS_06400 19648 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence028 2185 158 gene locus_tag LOCUS_06410 2185 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4039 2213 gene locus_tag LOCUS_06420 gene glmS 4039 2213 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_06420 5273 4074 gene locus_tag LOCUS_06430 5273 4074 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_06430 5758 7041 gene locus_tag LOCUS_06440 5758 7041 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_06440 7061 7762 gene locus_tag LOCUS_06450 gene nadD 7061 7762 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_06450 7837 8121 gene locus_tag LOCUS_06460 gene rsfS 7837 8121 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_06460 8149 8511 gene locus_tag LOCUS_06470 8149 8511 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_06470 8521 9741 gene locus_tag LOCUS_06480 8521 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9799 9984 gene locus_tag LOCUS_06490 9799 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10006 10236 gene locus_tag LOCUS_06500 10006 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10229 10471 gene locus_tag LOCUS_06510 10229 10471 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_06510 10561 10866 gene locus_tag LOCUS_06520 10561 10866 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_06520 10888 11967 gene locus_tag LOCUS_06530 10888 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_06530 14251 12014 gene locus_tag LOCUS_06540 14251 12014 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_06540 14618 15358 gene locus_tag LOCUS_06550 14618 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 15420 15752 gene locus_tag LOCUS_06560 15420 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 15873 17339 gene locus_tag LOCUS_06570 15873 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 17637 17341 gene locus_tag LOCUS_06580 gene mazF 17637 17341 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887062.1 protein_id gnl|my_center|LOCUS_06580 17921 17679 gene locus_tag LOCUS_06590 17921 17679 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_06590 18724 17987 gene locus_tag LOCUS_06600 18724 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 19048 20214 gene locus_tag LOCUS_06610 19048 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 20211 20873 gene locus_tag LOCUS_06620 20211 20873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence029 <1 962 gene locus_tag LOCUS_06630 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583380.1:AmmeMemoRadiSam system radical SAM enzyme 1444 989 gene locus_tag LOCUS_06640 1444 989 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191888.1 protein_id gnl|my_center|LOCUS_06640 1523 2407 gene locus_tag LOCUS_06650 gene ilvE 1523 2407 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_06650 2517 3722 gene locus_tag LOCUS_06660 2517 3722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_06660 3816 4475 gene locus_tag LOCUS_06670 3816 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4451 5956 gene locus_tag LOCUS_06680 4451 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4577 4620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5497 5532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5991 6329 gene locus_tag LOCUS_06690 5991 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 6343 6840 gene locus_tag LOCUS_06700 6343 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06700 7348 7665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8097 8172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10888 10016 gene locus_tag LOCUS_06710 10888 10016 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_06710 11216 12394 gene locus_tag LOCUS_06720 11216 12394 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 protein_id gnl|my_center|LOCUS_06720 12593 13027 gene locus_tag LOCUS_06730 12593 13027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13427 13233 gene locus_tag LOCUS_06740 13427 13233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 13478 13846 gene locus_tag LOCUS_06750 gene hmeE 13478 13846 CDS product Hdr-like menaquinol oxidoreductase cytochrome c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064247.1 protein_id gnl|my_center|LOCUS_06750 13843 14583 gene locus_tag LOCUS_06760 13843 14583 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_06760 14587 15777 gene locus_tag LOCUS_06770 gene hmeB 14587 15777 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_06770 17050 15842 gene locus_tag LOCUS_06780 17050 15842 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_06780 17899 17075 gene locus_tag LOCUS_06790 17899 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 17980 18978 gene locus_tag LOCUS_06800 17980 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 18982 19611 gene locus_tag LOCUS_06810 18982 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence030 286 134 gene locus_tag LOCUS_06820 286 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 525 2138 gene locus_tag LOCUS_06830 525 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3889 2492 gene locus_tag LOCUS_06840 3889 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4064 4588 gene locus_tag LOCUS_06850 gene hpt 4064 4588 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_06850 6981 4555 gene locus_tag LOCUS_06860 6981 4555 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_06860 7444 9069 gene locus_tag LOCUS_06870 7444 9069 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_06870 9072 9641 gene locus_tag LOCUS_06880 gene pnuC 9072 9641 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_06880 9605 10627 gene locus_tag LOCUS_06890 9605 10627 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_06890 12011 10599 gene locus_tag LOCUS_06900 12011 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12604 12014 gene locus_tag LOCUS_06910 12604 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14400 12601 gene locus_tag LOCUS_06920 14400 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15400 14402 gene locus_tag LOCUS_06930 15400 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16983 15397 gene locus_tag LOCUS_06940 16983 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18804 17005 gene locus_tag LOCUS_06950 18804 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19034 20026 gene locus_tag LOCUS_06960 19034 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence031 2017 158 gene locus_tag LOCUS_06970 2017 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2184 2274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3389 3304 gene locus_tag LOCUS_t00080 3389 3304 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3570 3644 gene locus_tag LOCUS_t00090 3570 3644 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3672 4628 gene locus_tag LOCUS_06980 3672 4628 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_06980 4671 5324 gene locus_tag LOCUS_06990 4671 5324 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_06990 5355 5885 gene locus_tag LOCUS_07000 gene pth 5355 5885 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_07000 6097 6957 gene locus_tag LOCUS_07010 6097 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6978 7166 gene locus_tag LOCUS_07020 6978 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7084 7554 gene locus_tag LOCUS_07030 7084 7554 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_07030 7682 8974 gene locus_tag LOCUS_07040 7682 8974 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_07040 8990 9934 gene locus_tag LOCUS_07050 8990 9934 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_07050 9953 10654 gene locus_tag LOCUS_07060 gene radC 9953 10654 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_07060 10658 12124 gene locus_tag LOCUS_07070 gene rfaE1 10658 12124 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_07070 12492 13463 gene locus_tag LOCUS_07080 12492 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_07080 13480 14688 gene locus_tag LOCUS_07090 13480 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14688 15458 gene locus_tag LOCUS_07100 14688 15458 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_07100 15480 16781 gene locus_tag LOCUS_07110 gene purB 15480 16781 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_07110 16788 17516 gene locus_tag LOCUS_07120 16788 17516 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_07120 17518 17772 gene locus_tag LOCUS_07130 gene purS 17518 17772 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_07130 17778 18245 gene locus_tag LOCUS_07140 17778 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 18250 18945 gene locus_tag LOCUS_07150 gene purQ 18250 18945 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_07150 19021 19452 gene locus_tag LOCUS_07160 19021 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence032 197 1111 gene locus_tag LOCUS_07170 197 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1108 3369 gene locus_tag LOCUS_07180 gene gspD 1108 3369 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_07180 3374 4960 gene locus_tag LOCUS_07190 gene gspE 3374 4960 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_07190 4967 6184 gene locus_tag LOCUS_07200 gene gspF 4967 6184 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_07200 6339 6767 gene locus_tag LOCUS_07210 gene xcpT 6339 6767 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_07210 6764 7321 gene locus_tag LOCUS_07220 6764 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7299 7676 gene locus_tag LOCUS_07230 7299 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7673 8299 gene locus_tag LOCUS_07240 7673 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8296 9234 gene locus_tag LOCUS_07250 gene gspK 8296 9234 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038516.1 protein_id gnl|my_center|LOCUS_07250 9245 10732 gene locus_tag LOCUS_07260 9245 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 10744 11286 gene locus_tag LOCUS_07270 10744 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 11286 12224 gene locus_tag LOCUS_07280 11286 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 12982 12221 gene locus_tag LOCUS_07290 12982 12221 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268856.1 protein_id gnl|my_center|LOCUS_07290 13150 14196 gene locus_tag LOCUS_07300 13150 14196 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_07300 14193 15125 gene locus_tag LOCUS_07310 14193 15125 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_07310 15118 15894 gene locus_tag LOCUS_07320 15118 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 15903 16772 gene locus_tag LOCUS_07330 gene mtnP 15903 16772 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_07330 16794 18068 gene locus_tag LOCUS_07340 16794 18068 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence033 <1 1110 gene locus_tag LOCUS_07350 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932547.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 1116 3329 gene locus_tag LOCUS_07360 1116 3329 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_07360 3348 4517 gene locus_tag LOCUS_07370 gene qmoC 3348 4517 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_07370 4542 5753 gene locus_tag LOCUS_07380 gene sat 4542 5753 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_07380 5868 5964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5966 7057 gene locus_tag LOCUS_07390 5966 7057 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_07390 7620 7012 gene locus_tag LOCUS_07400 7620 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8471 7698 gene locus_tag LOCUS_07410 8471 7698 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_07410 8508 8771 gene locus_tag LOCUS_07420 8508 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9359 8781 gene locus_tag LOCUS_07430 9359 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 10260 9460 gene locus_tag LOCUS_07440 gene lpxA 10260 9460 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_07440 10696 10265 gene locus_tag LOCUS_07450 gene fabZ 10696 10265 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_07450 11709 10702 gene locus_tag LOCUS_07460 gene lpxD 11709 10702 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_07460 12284 11709 gene locus_tag LOCUS_07470 12284 11709 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939643.1 protein_id gnl|my_center|LOCUS_07470 13810 12290 gene locus_tag LOCUS_07480 13810 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14149 14248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17187 14755 gene locus_tag LOCUS_07490 17187 14755 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_07490 18009 17296 gene locus_tag LOCUS_07500 18009 17296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_07500 18608 18018 gene locus_tag LOCUS_07510 18608 18018 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797975.1 protein_id gnl|my_center|LOCUS_07510 <19159 18605 gene locus_tag LOCUS_07520 <19159 18605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence034 2180 1758 gene locus_tag LOCUS_07530 2180 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2914 2177 gene locus_tag LOCUS_07540 2914 2177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_07540 3174 4754 gene locus_tag LOCUS_07550 3174 4754 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_07550 7369 5237 gene locus_tag LOCUS_07560 7369 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7545 8009 gene locus_tag LOCUS_07570 gene fabZ 7545 8009 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_07570 8014 8823 gene locus_tag LOCUS_07580 8014 8823 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_07580 10489 9134 gene locus_tag LOCUS_07590 10489 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10944 11837 gene locus_tag LOCUS_07600 gene fhcD 10944 11837 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879696.1 protein_id gnl|my_center|LOCUS_07600 14469 11821 gene locus_tag LOCUS_07610 14469 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 16385 14508 gene locus_tag LOCUS_07620 16385 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18484 16382 gene locus_tag LOCUS_07630 18484 16382 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence035 359 1561 gene locus_tag LOCUS_07640 359 1561 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240716.1 protein_id gnl|my_center|LOCUS_07640 1563 2087 gene locus_tag LOCUS_07650 1563 2087 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_07650 2187 3314 gene locus_tag LOCUS_07660 2187 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3882 6272 gene locus_tag LOCUS_07670 3882 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7171 12171 gene locus_tag LOCUS_07680 7171 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 12834 12403 gene locus_tag LOCUS_07690 12834 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 13224 13150 gene locus_tag LOCUS_t00100 13224 13150 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14935 13478 gene locus_tag LOCUS_07700 14935 13478 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188709.1 protein_id gnl|my_center|LOCUS_07700 15654 17387 gene locus_tag LOCUS_07710 15654 17387 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_07710 18459 17371 gene locus_tag LOCUS_07720 gene purM 18459 17371 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946657.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence036 222 1661 gene locus_tag LOCUS_07730 gene gnfM 222 1661 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_07730 1830 4754 gene locus_tag LOCUS_07740 gene glnE 1830 4754 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_07740 4751 5860 gene locus_tag LOCUS_07750 gene dprA 4751 5860 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_07750 5879 8140 gene locus_tag LOCUS_07760 gene topA 5879 8140 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_07760 8482 10191 gene locus_tag LOCUS_07770 8482 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 10572 11150 gene locus_tag LOCUS_07780 10572 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence037 577 158 gene locus_tag LOCUS_07790 gene rplQ 577 158 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943458.1 protein_id gnl|my_center|LOCUS_07790 1618 602 gene locus_tag LOCUS_07800 1618 602 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_07800 2276 1650 gene locus_tag LOCUS_07810 gene rpsD 2276 1650 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_07810 2711 2307 gene locus_tag LOCUS_07820 gene rpsK 2711 2307 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_07820 3133 2750 gene locus_tag LOCUS_07830 gene rpsM 3133 2750 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_07830 3383 3204 gene locus_tag LOCUS_07840 3383 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4137 3364 gene locus_tag LOCUS_07850 gene map 4137 3364 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_07850 4781 4134 gene locus_tag LOCUS_07860 4781 4134 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_07860 6123 4804 gene locus_tag LOCUS_07870 gene secY 6123 4804 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_07870 6569 6120 gene locus_tag LOCUS_07880 gene rplO 6569 6120 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_07880 7107 6556 gene locus_tag LOCUS_07890 gene rpsE 7107 6556 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_07890 7466 7104 gene locus_tag LOCUS_07900 gene rplR 7466 7104 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_07900 8038 7499 gene locus_tag LOCUS_07910 gene rplF 8038 7499 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_07910 8456 8061 gene locus_tag LOCUS_07920 gene rpsH 8456 8061 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_07920 8659 8474 gene locus_tag LOCUS_07930 8659 8474 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_07930 9234 8683 gene locus_tag LOCUS_07940 gene rplE 9234 8683 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_07940 9608 9234 gene locus_tag LOCUS_07950 gene rplX 9608 9234 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_07950 9976 9608 gene locus_tag LOCUS_07960 gene rplN 9976 9608 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_07960 10259 9990 gene locus_tag LOCUS_07970 gene rpsQ 10259 9990 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869920.1 protein_id gnl|my_center|LOCUS_07970 10465 10256 gene locus_tag LOCUS_07980 gene rpmC 10465 10256 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_07980 10887 10462 gene locus_tag LOCUS_07990 gene rplP 10887 10462 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_07990 11672 10893 gene locus_tag LOCUS_08000 gene rpsC 11672 10893 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_08000 12166 11699 gene locus_tag LOCUS_08010 12166 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 12959 12456 gene locus_tag LOCUS_08020 12959 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 13518 12964 gene locus_tag LOCUS_08030 13518 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 14304 16856 gene locus_tag LOCUS_08040 14304 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 16964 18253 gene locus_tag LOCUS_08050 16964 18253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130104.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence038 150 1211 gene locus_tag LOCUS_08060 gene gmd 150 1211 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_08060 1227 2213 gene locus_tag LOCUS_08070 1227 2213 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_08070 2861 3217 gene locus_tag LOCUS_08080 2861 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3223 3468 gene locus_tag LOCUS_08090 3223 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3449 3820 gene locus_tag LOCUS_08100 3449 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7490 4005 gene locus_tag LOCUS_08110 gene dnaE 7490 4005 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_08110 7974 7663 gene locus_tag LOCUS_08120 7974 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9996 8467 gene locus_tag LOCUS_08130 9996 8467 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08130 10557 11156 gene locus_tag LOCUS_08140 10557 11156 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_08140 11147 11743 gene locus_tag LOCUS_08150 gene coaE 11147 11743 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_08150 11973 13670 gene locus_tag LOCUS_08160 11973 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 13750 15366 gene locus_tag LOCUS_08170 13750 15366 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_08170 16426 15674 gene locus_tag LOCUS_08180 gene pgeF 16426 15674 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_08180 18200 16419 gene locus_tag LOCUS_08190 18200 16419 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence039 617 1150 gene locus_tag LOCUS_08200 617 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1457 1107 gene locus_tag LOCUS_08210 1457 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1677 1928 gene locus_tag LOCUS_08220 1677 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2159 3694 gene locus_tag LOCUS_08230 2159 3694 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08230 3756 4886 gene locus_tag LOCUS_08240 3756 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4883 5638 gene locus_tag LOCUS_08250 4883 5638 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256806.1 protein_id gnl|my_center|LOCUS_08250 6635 5667 gene locus_tag LOCUS_08260 6635 5667 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229534.1 protein_id gnl|my_center|LOCUS_08260 7413 6637 gene locus_tag LOCUS_08270 7413 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 8660 7410 gene locus_tag LOCUS_08280 8660 7410 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_08280 9711 8662 gene locus_tag LOCUS_08290 9711 8662 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_08290 10859 9708 gene locus_tag LOCUS_08300 10859 9708 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_08300 11350 10862 gene locus_tag LOCUS_08310 11350 10862 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_08310 12363 11347 gene locus_tag LOCUS_08320 12363 11347 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_08320 12660 13550 gene locus_tag LOCUS_08330 gene cysD 12660 13550 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389944.1 protein_id gnl|my_center|LOCUS_08330 13550 15433 gene locus_tag LOCUS_08340 gene cysN 13550 15433 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_08340 15524 16669 gene locus_tag LOCUS_08350 gene wecB 15524 16669 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211986.1 protein_id gnl|my_center|LOCUS_08350 16656 17597 gene locus_tag LOCUS_08360 16656 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence040 <1 644 gene locus_tag LOCUS_08370 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258008.1:cytochrome c oxidase subunit I 916 2337 gene locus_tag LOCUS_08380 gene ccoN 916 2337 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_08380 2353 3042 gene locus_tag LOCUS_08390 gene ccoO 2353 3042 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_08390 3035 3235 gene locus_tag LOCUS_08400 3035 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3237 4106 gene locus_tag LOCUS_08410 gene ccoP 3237 4106 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 protein_id gnl|my_center|LOCUS_08410 4195 5700 gene locus_tag LOCUS_08420 gene ccoG 4195 5700 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 protein_id gnl|my_center|LOCUS_08420 5732 6265 gene locus_tag LOCUS_08430 5732 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 6364 8742 gene locus_tag LOCUS_08440 6364 8742 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072346.1 protein_id gnl|my_center|LOCUS_08440 8754 8987 gene locus_tag LOCUS_08450 8754 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 9631 8984 gene locus_tag LOCUS_08460 9631 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10173 11087 gene locus_tag LOCUS_08470 10173 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13248 11230 gene locus_tag LOCUS_08480 13248 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13917 13279 gene locus_tag LOCUS_08490 13917 13279 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_08490 14750 15034 gene locus_tag LOCUS_08500 14750 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 15031 16689 gene locus_tag LOCUS_08510 gene argS 15031 16689 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_08510 16699 17457 gene locus_tag LOCUS_08520 16699 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence041 <1 1227 gene locus_tag LOCUS_08530 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938556.1:outer membrane protein transport protein 1458 3167 gene locus_tag LOCUS_08540 1458 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4440 3490 gene locus_tag LOCUS_08550 4440 3490 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_08550 4878 5267 gene locus_tag LOCUS_08560 4878 5267 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_08560 5274 6785 gene locus_tag LOCUS_08570 gene trpE 5274 6785 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_08570 6998 7306 gene locus_tag LOCUS_08580 6998 7306 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_08580 7323 7658 gene locus_tag LOCUS_08590 7323 7658 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_08590 7655 8035 gene locus_tag LOCUS_08600 7655 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8213 9139 gene locus_tag LOCUS_08610 8213 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 9546 10610 gene locus_tag LOCUS_08620 gene hrcA 9546 10610 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_08620 10624 11340 gene locus_tag LOCUS_08630 10624 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 13108 11600 gene locus_tag LOCUS_08640 13108 11600 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_08640 13270 13367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13613 13798 gene locus_tag LOCUS_08650 13613 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14187 15263 gene locus_tag LOCUS_08660 14187 15263 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816851.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence042 2255 408 gene locus_tag LOCUS_08670 2255 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2597 4531 gene locus_tag LOCUS_08680 2597 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5915 4521 gene locus_tag LOCUS_08690 5915 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7027 5912 gene locus_tag LOCUS_08700 7027 5912 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_08700 7252 7572 gene locus_tag LOCUS_08710 7252 7572 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_08710 7565 7951 gene locus_tag LOCUS_08720 7565 7951 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_08720 9096 7948 gene locus_tag LOCUS_08730 9096 7948 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_08730 10152 9100 gene locus_tag LOCUS_08740 10152 9100 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_08740 10632 11810 gene locus_tag LOCUS_08750 10632 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 11829 12269 gene locus_tag LOCUS_08760 11829 12269 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316407.1 protein_id gnl|my_center|LOCUS_08760 12572 14188 gene locus_tag LOCUS_08770 12572 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14691 15155 gene locus_tag LOCUS_08780 14691 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 15157 15834 gene locus_tag LOCUS_08790 15157 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15831 16379 gene locus_tag LOCUS_08800 15831 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence043 290 1771 gene locus_tag LOCUS_08810 290 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2039 2359 gene locus_tag LOCUS_08820 2039 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2437 3000 gene locus_tag LOCUS_08830 2437 3000 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_08830 2997 3431 gene locus_tag LOCUS_08840 2997 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3424 3924 gene locus_tag LOCUS_08850 3424 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6302 4014 gene locus_tag LOCUS_08860 6302 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8679 6418 gene locus_tag LOCUS_08870 8679 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10238 8739 gene locus_tag LOCUS_08880 gene kaiC 10238 8739 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_08880 10534 10235 gene locus_tag LOCUS_08890 gene kaiB 10534 10235 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_08890 11934 10678 gene locus_tag LOCUS_08900 11934 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 12437 12652 gene locus_tag LOCUS_08910 12437 12652 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_08910 13856 12639 gene locus_tag LOCUS_08920 13856 12639 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_08920 14271 14017 gene locus_tag LOCUS_08930 14271 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 15383 14166 gene locus_tag LOCUS_08940 gene tyrS 15383 14166 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938252.1 protein_id gnl|my_center|LOCUS_08940 14306 14404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16134 16562 gene locus_tag LOCUS_08950 16134 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence044 1290 199 gene locus_tag LOCUS_08960 gene lptF 1290 199 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_08960 4041 1393 gene locus_tag LOCUS_08970 4041 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6620 4215 gene locus_tag LOCUS_08980 6620 4215 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_08980 7279 6629 gene locus_tag LOCUS_08990 7279 6629 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_08990 7779 7375 gene locus_tag LOCUS_09000 7779 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 8809 7865 gene locus_tag LOCUS_09010 8809 7865 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808659.1 protein_id gnl|my_center|LOCUS_09010 11156 8898 gene locus_tag LOCUS_09020 gene rnr 11156 8898 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_09020 11801 11175 gene locus_tag LOCUS_09030 11801 11175 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_09030 11878 12603 gene locus_tag LOCUS_09040 11878 12603 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_09040 12676 13311 gene locus_tag LOCUS_09050 gene thpR 12676 13311 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_09050 13880 13308 gene locus_tag LOCUS_09060 13880 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 15916 14066 gene locus_tag LOCUS_09070 15916 14066 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_09070 16163 17461 gene locus_tag LOCUS_09080 gene thiC 16163 17461 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence045 3241 1430 gene locus_tag LOCUS_09090 gene ptsP 3241 1430 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_09090 3507 3238 gene locus_tag LOCUS_09100 3507 3238 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_09100 3932 3504 gene locus_tag LOCUS_09110 3932 3504 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_09110 4439 3972 gene locus_tag LOCUS_09120 4439 3972 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_09120 4793 4464 gene locus_tag LOCUS_09130 gene hpf 4793 4464 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 protein_id gnl|my_center|LOCUS_09130 6301 4820 gene locus_tag LOCUS_09140 gene rpoN 6301 4820 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_09140 7140 6406 gene locus_tag LOCUS_09150 gene lptB 7140 6406 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 protein_id gnl|my_center|LOCUS_09150 7787 7143 gene locus_tag LOCUS_09160 7787 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8332 7784 gene locus_tag LOCUS_09170 8332 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9986 9126 gene locus_tag LOCUS_09180 9986 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10587 10114 gene locus_tag LOCUS_09190 10587 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12237 10600 gene locus_tag LOCUS_09200 12237 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 12313 12900 gene locus_tag LOCUS_09210 12313 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 12975 13931 gene locus_tag LOCUS_09220 12975 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13942 15615 gene locus_tag LOCUS_09230 13942 15615 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_09230 16055 15648 gene locus_tag LOCUS_09240 16055 15648 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_09240 16276 16052 gene locus_tag LOCUS_09250 16276 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence046 469 735 gene locus_tag LOCUS_09260 gene rpsT 469 735 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060261.1 protein_id gnl|my_center|LOCUS_09260 1892 789 gene locus_tag LOCUS_09270 1892 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2642 1914 gene locus_tag LOCUS_09280 2642 1914 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_09280 4019 3072 gene locus_tag LOCUS_09290 gene queA 4019 3072 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_09290 4254 4895 gene locus_tag LOCUS_09300 4254 4895 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_09300 5053 6114 gene locus_tag LOCUS_09310 5053 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6111 6404 gene locus_tag LOCUS_09320 6111 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6418 7509 gene locus_tag LOCUS_09330 6418 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 8520 7831 gene locus_tag LOCUS_09340 8520 7831 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_09340 9586 8528 gene locus_tag LOCUS_09350 9586 8528 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_09350 10302 9583 gene locus_tag LOCUS_09360 10302 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11056 10319 gene locus_tag LOCUS_09370 11056 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 12227 11169 gene locus_tag LOCUS_09380 12227 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 14437 12224 gene locus_tag LOCUS_09390 14437 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 16071 14590 gene locus_tag LOCUS_09400 16071 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence047 1913 852 gene locus_tag LOCUS_09410 1913 852 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_09410 2598 1939 gene locus_tag LOCUS_09420 2598 1939 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_09420 3242 3877 gene locus_tag LOCUS_09430 3242 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3971 4456 gene locus_tag LOCUS_09440 3971 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4496 6487 gene locus_tag LOCUS_09450 gene ccsA 4496 6487 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_09450 6533 7003 gene locus_tag LOCUS_09460 6533 7003 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582438.1 protein_id gnl|my_center|LOCUS_09460 7254 8078 gene locus_tag LOCUS_09470 7254 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8091 8993 gene locus_tag LOCUS_09480 8091 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 9922 12219 gene locus_tag LOCUS_09490 9922 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12456 12941 gene locus_tag LOCUS_09500 12456 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13156 14940 gene locus_tag LOCUS_09510 13156 14940 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_09510 14937 15686 gene locus_tag LOCUS_09520 14937 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence048 453 238 gene locus_tag LOCUS_09530 453 238 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_09530 1610 807 gene locus_tag LOCUS_09540 gene whiG 1610 807 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_09540 1931 1701 gene locus_tag LOCUS_09550 1931 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2932 2063 gene locus_tag LOCUS_09560 2932 2063 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545992.1 protein_id gnl|my_center|LOCUS_09560 4233 2980 gene locus_tag LOCUS_09570 gene flhF 4233 2980 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_09570 6324 4249 gene locus_tag LOCUS_09580 gene flhA 6324 4249 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_09580 7518 6451 gene locus_tag LOCUS_09590 gene flhB 7518 6451 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_09590 7669 7511 gene locus_tag LOCUS_09600 7669 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8478 7696 gene locus_tag LOCUS_09610 gene fliR 8478 7696 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_09610 8757 8485 gene locus_tag LOCUS_09620 gene fliQ 8757 8485 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941093.1 protein_id gnl|my_center|LOCUS_09620 9541 8774 gene locus_tag LOCUS_09630 gene fliP 9541 8774 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081361032.1 protein_id gnl|my_center|LOCUS_09630 10949 9546 gene locus_tag LOCUS_09640 10949 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 11226 11486 gene locus_tag LOCUS_09650 11226 11486 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_09650 11476 11700 gene locus_tag LOCUS_09660 11476 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_09660 12187 11711 gene locus_tag LOCUS_09670 12187 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 13221 12202 gene locus_tag LOCUS_09680 gene fliM 13221 12202 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_09680 13767 13258 gene locus_tag LOCUS_09690 13767 13258 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_09690 14884 14372 gene locus_tag LOCUS_09700 14884 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 15452 14901 gene locus_tag LOCUS_09710 15452 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence049 227 613 gene locus_tag LOCUS_09720 227 613 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_09720 1384 632 gene locus_tag LOCUS_09730 1384 632 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_09730 3294 1504 gene locus_tag LOCUS_09740 3294 1504 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942999.1 protein_id gnl|my_center|LOCUS_09740 7577 3375 gene locus_tag LOCUS_09750 gene rpoC 7577 3375 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_09750 11679 7627 gene locus_tag LOCUS_09760 gene rpoB 11679 7627 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_09760 12212 11838 gene locus_tag LOCUS_09770 gene rplL 12212 11838 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546672.1 protein_id gnl|my_center|LOCUS_09770 12807 12271 gene locus_tag LOCUS_09780 gene rplJ 12807 12271 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_09780 13540 12827 gene locus_tag LOCUS_09790 gene rplA 13540 12827 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_09790 13993 13571 gene locus_tag LOCUS_09800 gene rplK 13993 13571 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403291.1 protein_id gnl|my_center|LOCUS_09800 14584 14024 gene locus_tag LOCUS_09810 gene nusG 14584 14024 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_09810 14798 14592 gene locus_tag LOCUS_09820 14798 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 14906 14830 gene locus_tag LOCUS_t00110 14906 14830 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15095 14946 gene locus_tag LOCUS_09830 gene rpmG 15095 14946 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_09830 <15932 15099 gene locus_tag LOCUS_09840 <15932 15099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu >Feature sequence050 <1 665 gene locus_tag LOCUS_09850 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807789.1:EFR1 family ferrodoxin 1803 721 gene locus_tag LOCUS_09860 1803 721 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 3416 1812 gene locus_tag LOCUS_09870 gene pckA 3416 1812 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_09870 4800 3718 gene locus_tag LOCUS_09880 4800 3718 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704357.1 protein_id gnl|my_center|LOCUS_09880 5806 4982 gene locus_tag LOCUS_09890 5806 4982 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_09890 8074 5879 gene locus_tag LOCUS_09900 8074 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 10173 8092 gene locus_tag LOCUS_09910 gene glgX 10173 8092 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_09910 10768 10199 gene locus_tag LOCUS_09920 10768 10199 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528771.1 protein_id gnl|my_center|LOCUS_09920 11575 10796 gene locus_tag LOCUS_09930 gene hpaI 11575 10796 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_09930 12898 11666 gene locus_tag LOCUS_09940 12898 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 13766 12939 gene locus_tag LOCUS_09950 13766 12939 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_09950 15749 14052 gene locus_tag LOCUS_09960 gene soxB 15749 14052 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881174.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence051 570 187 gene locus_tag LOCUS_09970 570 187 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 protein_id gnl|my_center|LOCUS_09970 878 567 gene locus_tag LOCUS_09980 878 567 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_09980 1764 895 gene locus_tag LOCUS_09990 1764 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2231 1905 gene locus_tag LOCUS_10000 2231 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2590 2210 gene locus_tag LOCUS_10010 2590 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3014 2709 gene locus_tag LOCUS_10020 3014 2709 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_10020 3864 3031 gene locus_tag LOCUS_10030 gene dapF 3864 3031 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_10030 5137 3875 gene locus_tag LOCUS_10040 gene lysA 5137 3875 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_10040 5978 5646 gene locus_tag LOCUS_10050 5978 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 6016 6636 gene locus_tag LOCUS_10060 6016 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6818 7333 gene locus_tag LOCUS_10070 6818 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7340 8197 gene locus_tag LOCUS_10080 gene motA 7340 8197 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_10080 8199 9161 gene locus_tag LOCUS_10090 8199 9161 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_10090 11199 9670 gene locus_tag LOCUS_10100 11199 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11648 11199 gene locus_tag LOCUS_10110 11648 11199 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_10110 13543 11645 gene locus_tag LOCUS_10120 13543 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 14511 13567 gene locus_tag LOCUS_10130 14511 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 15660 14701 gene locus_tag LOCUS_10140 15660 14701 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence052 423 656 gene locus_tag LOCUS_10150 423 656 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_10150 682 1158 gene locus_tag LOCUS_10160 682 1158 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_10160 1994 1308 gene locus_tag LOCUS_10170 gene queC 1994 1308 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_10170 2985 2221 gene locus_tag LOCUS_10180 2985 2221 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_10180 5690 3027 gene locus_tag LOCUS_10190 gene alaS 5690 3027 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_10190 7766 5700 gene locus_tag LOCUS_10200 7766 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9911 8208 gene locus_tag LOCUS_10210 9911 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10199 10390 gene locus_tag LOCUS_10220 10199 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 10446 11672 gene locus_tag LOCUS_10230 gene serA 10446 11672 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626385.1 protein_id gnl|my_center|LOCUS_10230 12189 11791 gene locus_tag LOCUS_10240 gene cheY 12189 11791 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 protein_id gnl|my_center|LOCUS_10240 12436 14091 gene locus_tag LOCUS_10250 12436 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14105 15601 gene locus_tag LOCUS_10260 gene gltA 14105 15601 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence053 803 156 gene locus_tag LOCUS_10270 803 156 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_10270 1195 2070 gene locus_tag LOCUS_10280 1195 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2291 2734 gene locus_tag LOCUS_10290 2291 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2739 3728 gene locus_tag LOCUS_10300 2739 3728 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941966.1 protein_id gnl|my_center|LOCUS_10300 3778 4893 gene locus_tag LOCUS_10310 gene ruvB 3778 4893 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_10310 5282 6025 gene locus_tag LOCUS_10320 5282 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6086 6913 gene locus_tag LOCUS_10330 6086 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8665 7358 gene locus_tag LOCUS_10340 8665 7358 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_10340 9677 8829 gene locus_tag LOCUS_10350 9677 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10403 10176 gene locus_tag LOCUS_10360 10403 10176 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971060.1 protein_id gnl|my_center|LOCUS_10360 11684 10599 gene locus_tag LOCUS_10370 gene prfA 11684 10599 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_10370 11981 11754 gene locus_tag LOCUS_10380 gene rpmE 11981 11754 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_10380 13392 12052 gene locus_tag LOCUS_10390 gene rho 13392 12052 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_10390 13396 13656 gene locus_tag LOCUS_10400 13396 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 13737 14240 gene locus_tag LOCUS_10410 13737 14240 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505223.1 protein_id gnl|my_center|LOCUS_10410 14379 15050 gene locus_tag LOCUS_10420 gene crp 14379 15050 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063269.1 protein_id gnl|my_center|LOCUS_10420 15052 15585 gene locus_tag LOCUS_10430 15052 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence054 1567 1859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2009 3214 gene locus_tag LOCUS_10440 2009 3214 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_10440 3552 3358 gene locus_tag LOCUS_10450 3552 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3565 4227 gene locus_tag LOCUS_10460 3565 4227 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_10460 4224 5501 gene locus_tag LOCUS_10470 4224 5501 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_10470 5498 6496 gene locus_tag LOCUS_10480 5498 6496 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_10480 7370 6480 gene locus_tag LOCUS_10490 gene panC 7370 6480 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_10490 9241 7556 gene locus_tag LOCUS_10500 9241 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10175 9231 gene locus_tag LOCUS_10510 10175 9231 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_10510 11332 10337 gene locus_tag LOCUS_10520 gene selD 11332 10337 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_10520 12166 13419 gene locus_tag LOCUS_10530 12166 13419 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_10530 13760 14038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14069 14563 gene locus_tag LOCUS_10540 14069 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 14780 15607 gene locus_tag LOCUS_10550 gene panB 14780 15607 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence055 1740 298 gene locus_tag LOCUS_10560 1740 298 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_10560 2955 1888 gene locus_tag LOCUS_10570 2955 1888 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_10570 3277 3005 gene locus_tag LOCUS_10580 3277 3005 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_10580 3537 3265 gene locus_tag LOCUS_10590 3537 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4598 3612 gene locus_tag LOCUS_10600 4598 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5689 4610 gene locus_tag LOCUS_10610 5689 4610 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_10610 7111 5945 gene locus_tag LOCUS_10620 7111 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8416 7133 gene locus_tag LOCUS_10630 8416 7133 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939254.1 protein_id gnl|my_center|LOCUS_10630 10749 8839 gene locus_tag LOCUS_10640 gene dnaK 10749 8839 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_10640 10984 11202 gene locus_tag LOCUS_10650 10984 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11199 11621 gene locus_tag LOCUS_10660 11199 11621 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_10660 11777 12682 gene locus_tag LOCUS_10670 11777 12682 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_10670 13043 12726 gene locus_tag LOCUS_10680 gene sugE 13043 12726 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_10680 13782 13465 gene locus_tag LOCUS_10690 13782 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 14169 15326 gene locus_tag LOCUS_10700 14169 15326 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence056 1139 690 gene locus_tag LOCUS_10710 1139 690 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_10710 1390 1136 gene locus_tag LOCUS_10720 gene csrA 1390 1136 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_10720 2988 1459 gene locus_tag LOCUS_10730 gene flgL 2988 1459 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937826.1 protein_id gnl|my_center|LOCUS_10730 4729 3032 gene locus_tag LOCUS_10740 gene flgK 4729 3032 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545686.1 protein_id gnl|my_center|LOCUS_10740 5260 4751 gene locus_tag LOCUS_10750 5260 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5737 5303 gene locus_tag LOCUS_10760 5737 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6983 5802 gene locus_tag LOCUS_10770 6983 5802 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_10770 7683 7003 gene locus_tag LOCUS_10780 7683 7003 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937821.1 protein_id gnl|my_center|LOCUS_10780 8417 7701 gene locus_tag LOCUS_10790 8417 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9237 8449 gene locus_tag LOCUS_10800 gene flgG 9237 8449 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_10800 10081 9269 gene locus_tag LOCUS_10810 gene flgF 10081 9269 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_10810 10260 10448 gene locus_tag LOCUS_10820 10260 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10501 10755 gene locus_tag LOCUS_10830 10501 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 11287 11087 gene locus_tag LOCUS_10840 11287 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11419 12096 gene locus_tag LOCUS_10850 11419 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12101 12388 gene locus_tag LOCUS_10860 12101 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 12385 13440 gene locus_tag LOCUS_10870 12385 13440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_10870 13457 14848 gene locus_tag LOCUS_10880 13457 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence057 699 1199 gene locus_tag LOCUS_10890 699 1199 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_10890 1866 1315 gene locus_tag LOCUS_10900 1866 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2963 1872 gene locus_tag LOCUS_10910 gene speY 2963 1872 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_10910 3121 3360 gene locus_tag LOCUS_10920 3121 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3357 3848 gene locus_tag LOCUS_10930 3357 3848 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_10930 3856 4590 gene locus_tag LOCUS_10940 3856 4590 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_10940 4959 4600 gene locus_tag LOCUS_10950 4959 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6142 5648 gene locus_tag LOCUS_10960 6142 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 6391 6780 gene locus_tag LOCUS_10970 6391 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 6770 8932 gene locus_tag LOCUS_10980 6770 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 8971 9891 gene locus_tag LOCUS_10990 8971 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 10315 9944 gene locus_tag LOCUS_11000 10315 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 11015 10482 gene locus_tag LOCUS_11010 11015 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11430 11074 gene locus_tag LOCUS_11020 11430 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11628 13301 gene locus_tag LOCUS_11030 gene ettA 11628 13301 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_11030 13311 15104 gene locus_tag LOCUS_11040 13311 15104 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023116.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence058 527 114 gene locus_tag LOCUS_11050 527 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1784 882 gene locus_tag LOCUS_11060 gene argB 1784 882 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_11060 2189 1788 gene locus_tag LOCUS_11070 2189 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3155 2208 gene locus_tag LOCUS_11080 gene xerC 3155 2208 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_11080 3651 7352 gene locus_tag LOCUS_11090 3651 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8583 7411 gene locus_tag LOCUS_11100 8583 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 9116 8574 gene locus_tag LOCUS_11110 9116 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 9822 9118 gene locus_tag LOCUS_11120 9822 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 10735 9812 gene locus_tag LOCUS_11130 10735 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 11287 10901 gene locus_tag LOCUS_11140 11287 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 11780 14605 gene locus_tag LOCUS_11150 11780 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence059 511 164 gene locus_tag LOCUS_11160 511 164 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973178.1 protein_id gnl|my_center|LOCUS_11160 2261 564 gene locus_tag LOCUS_11170 2261 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2457 3512 gene locus_tag LOCUS_11180 2457 3512 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_11180 3499 6012 gene locus_tag LOCUS_11190 3499 6012 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_11190 5549 5594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5969 6406 gene locus_tag LOCUS_11200 gene ybeY 5969 6406 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_11200 7141 6797 gene locus_tag LOCUS_11210 7141 6797 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022116.1 protein_id gnl|my_center|LOCUS_11210 7442 7128 gene locus_tag LOCUS_11220 7442 7128 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_11220 9109 7532 gene locus_tag LOCUS_11230 9109 7532 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_11230 9521 10231 gene locus_tag LOCUS_11240 9521 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 11528 10821 gene locus_tag LOCUS_11250 11528 10821 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_11250 11687 13021 gene locus_tag LOCUS_11260 gene ffh 11687 13021 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_11260 13054 13296 gene locus_tag LOCUS_11270 gene rpsP 13054 13296 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895310.1 protein_id gnl|my_center|LOCUS_11270 13378 13608 gene locus_tag LOCUS_11280 13378 13608 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_11280 13605 14189 gene locus_tag LOCUS_11290 gene rimM 13605 14189 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence060 1043 21 gene locus_tag LOCUS_11300 1043 21 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972929.1 protein_id gnl|my_center|LOCUS_11300 3384 1063 gene locus_tag LOCUS_11310 gene bcsB 3384 1063 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 protein_id gnl|my_center|LOCUS_11310 2966 2990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3545 3402 gene locus_tag LOCUS_11320 3545 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5815 3545 gene locus_tag LOCUS_11330 gene bcsA 5815 3545 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880909.1 protein_id gnl|my_center|LOCUS_11330 6731 5850 gene locus_tag LOCUS_11340 6731 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7211 7954 gene locus_tag LOCUS_11350 7211 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 8080 9240 gene locus_tag LOCUS_11360 8080 9240 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_11360 9245 10411 gene locus_tag LOCUS_11370 9245 10411 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179100.1 protein_id gnl|my_center|LOCUS_11370 10763 12286 gene locus_tag LOCUS_11380 10763 12286 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_11380 12283 13161 gene locus_tag LOCUS_11390 gene accD 12283 13161 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_11390 13214 14515 gene locus_tag LOCUS_11400 13214 14515 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229640.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence061 <1 1377 gene locus_tag LOCUS_11410 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941904.1:ATP-binding protein 1384 2799 gene locus_tag LOCUS_11420 1384 2799 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546569.1 protein_id gnl|my_center|LOCUS_11420 3589 4035 gene locus_tag LOCUS_11430 3589 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4411 4097 gene locus_tag LOCUS_11440 4411 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6553 4526 gene locus_tag LOCUS_11450 6553 4526 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545400.1 protein_id gnl|my_center|LOCUS_11450 6815 6558 gene locus_tag LOCUS_11460 6815 6558 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_11460 7170 8501 gene locus_tag LOCUS_11470 7170 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8090 8186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8444 9253 gene locus_tag LOCUS_11480 8444 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9253 9954 gene locus_tag LOCUS_11490 9253 9954 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_11490 10570 9965 gene locus_tag LOCUS_11500 10570 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10628 10726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11141 11992 gene locus_tag LOCUS_11510 11141 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 12730 12005 gene locus_tag LOCUS_11520 12730 12005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967051.1 protein_id gnl|my_center|LOCUS_11520 13566 12727 gene locus_tag LOCUS_11530 13566 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 14407 13583 gene locus_tag LOCUS_11540 14407 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence062 979 314 gene locus_tag LOCUS_11550 979 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1812 1030 gene locus_tag LOCUS_11560 1812 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2564 1809 gene locus_tag LOCUS_11570 gene cobM 2564 1809 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_11570 3280 2561 gene locus_tag LOCUS_11580 gene cobI 3280 2561 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_11580 3912 3277 gene locus_tag LOCUS_11590 gene cbiE 3912 3277 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392603.1 protein_id gnl|my_center|LOCUS_11590 5240 4176 gene locus_tag LOCUS_11600 gene cbiD 5240 4176 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869514.1 protein_id gnl|my_center|LOCUS_11600 6102 5224 gene locus_tag LOCUS_11610 6102 5224 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943631.1 protein_id gnl|my_center|LOCUS_11610 6890 6099 gene locus_tag LOCUS_11620 gene cbiQ 6890 6099 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_11620 7149 6868 gene locus_tag LOCUS_11630 7149 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7880 7146 gene locus_tag LOCUS_11640 7880 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11640 8401 7880 gene locus_tag LOCUS_11650 8401 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9092 8388 gene locus_tag LOCUS_11660 9092 8388 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_11660 10488 9085 gene locus_tag LOCUS_11670 10488 9085 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_11670 11518 12123 gene locus_tag LOCUS_11680 11518 12123 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_11680 12111 12656 gene locus_tag LOCUS_11690 gene cobU 12111 12656 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_11690 12643 13707 gene locus_tag LOCUS_11700 gene cobT 12643 13707 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_11700 13704 14438 gene locus_tag LOCUS_11710 gene cobS 13704 14438 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence063 2526 1510 gene locus_tag LOCUS_11720 gene aroF 2526 1510 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_11720 2784 3155 gene locus_tag LOCUS_11730 gene dksA 2784 3155 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_11730 4115 3204 gene locus_tag LOCUS_11740 4115 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4419 5309 gene locus_tag LOCUS_11750 gene xerD 4419 5309 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_11750 5357 5653 gene locus_tag LOCUS_11760 5357 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5650 6162 gene locus_tag LOCUS_11770 5650 6162 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_11770 6159 7463 gene locus_tag LOCUS_11780 gene rlmD 6159 7463 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_11780 7545 8339 gene locus_tag LOCUS_11790 7545 8339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_11790 8352 9152 gene locus_tag LOCUS_11800 8352 9152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_11800 9195 10694 gene locus_tag LOCUS_11810 9195 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10747 12057 gene locus_tag LOCUS_11820 10747 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12073 13269 gene locus_tag LOCUS_11830 12073 13269 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941116.1 protein_id gnl|my_center|LOCUS_11830 13266 14405 gene locus_tag LOCUS_11840 13266 14405 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143735.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence064 9 1415 gene locus_tag LOCUS_11850 9 1415 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_11850 1679 1921 gene locus_tag LOCUS_11860 1679 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2212 1943 gene locus_tag LOCUS_11870 2212 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3172 2255 gene locus_tag LOCUS_11880 3172 2255 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_11880 3973 3176 gene locus_tag LOCUS_11890 3973 3176 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_11890 5400 3970 gene locus_tag LOCUS_11900 5400 3970 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_11900 6552 5812 gene locus_tag LOCUS_11910 6552 5812 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_11910 7496 9289 gene locus_tag LOCUS_11920 gene lepA 7496 9289 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_11920 9311 9928 gene locus_tag LOCUS_11930 gene lepB 9311 9928 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_11930 10213 11490 gene locus_tag LOCUS_11940 10213 11490 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_11940 11499 11963 gene locus_tag LOCUS_11950 11499 11963 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_11950 12070 14406 gene locus_tag LOCUS_11960 12070 14406 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence065 3049 782 gene locus_tag LOCUS_11970 3049 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3255 4781 gene locus_tag LOCUS_11980 gene rng 3255 4781 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11980 4875 7436 gene locus_tag LOCUS_11990 4875 7436 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_11990 7514 8572 gene locus_tag LOCUS_12000 7514 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 8569 10878 gene locus_tag LOCUS_12010 8569 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10973 12940 gene locus_tag LOCUS_12020 10973 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 12996 13169 gene locus_tag LOCUS_12030 12996 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 13221 14078 gene locus_tag LOCUS_12040 gene ispE 13221 14078 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_12040 14412 14197 gene locus_tag LOCUS_12050 14412 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence066 1160 468 gene locus_tag LOCUS_12060 gene ccsA 1160 468 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_12060 2029 1331 gene locus_tag LOCUS_12070 2029 1331 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_12070 2998 2264 gene locus_tag LOCUS_12080 2998 2264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_12080 3187 3861 gene locus_tag LOCUS_12090 3187 3861 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_12090 3873 5966 gene locus_tag LOCUS_12100 3873 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5960 8476 gene locus_tag LOCUS_12110 5960 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8716 9429 gene locus_tag LOCUS_12120 gene mtgA 8716 9429 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_12120 9602 10141 gene locus_tag LOCUS_12130 9602 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 11753 10185 gene locus_tag LOCUS_12140 11753 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 12747 11884 gene locus_tag LOCUS_12150 12747 11884 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_12150 13735 12755 gene locus_tag LOCUS_12160 gene hflK 13735 12755 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence067 868 110 gene locus_tag LOCUS_12170 868 110 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_12170 1089 1304 gene locus_tag LOCUS_12180 1089 1304 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_12180 1311 1667 gene locus_tag LOCUS_12190 1311 1667 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_12190 1664 2134 gene locus_tag LOCUS_12200 1664 2134 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_12200 2280 2354 gene locus_tag LOCUS_t00120 2280 2354 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2394 3626 gene locus_tag LOCUS_12210 2394 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3942 3646 gene locus_tag LOCUS_12220 3942 3646 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_12220 6434 6015 gene locus_tag LOCUS_12230 gene cdd 6434 6015 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_12230 6875 6489 gene locus_tag LOCUS_12240 6875 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7614 6865 gene locus_tag LOCUS_12250 7614 6865 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941739.1 protein_id gnl|my_center|LOCUS_12250 7915 7739 gene locus_tag LOCUS_12260 7915 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8076 8246 gene locus_tag LOCUS_12270 8076 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8654 9766 gene locus_tag LOCUS_12280 8654 9766 CDS product arabinose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706056.1 protein_id gnl|my_center|LOCUS_12280 9763 11139 gene locus_tag LOCUS_12290 9763 11139 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148136891.1 protein_id gnl|my_center|LOCUS_12290 11378 11151 gene locus_tag LOCUS_12300 11378 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 11743 11396 gene locus_tag LOCUS_12310 gene trxA 11743 11396 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_12310 12217 12912 gene locus_tag LOCUS_12320 12217 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence068 371 964 gene locus_tag LOCUS_12330 371 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 976 2175 gene locus_tag LOCUS_12340 976 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2178 2753 gene locus_tag LOCUS_12350 2178 2753 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938122.1 protein_id gnl|my_center|LOCUS_12350 2779 3357 gene locus_tag LOCUS_12360 2779 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3466 3474 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3850 4830 gene locus_tag LOCUS_12370 gene pstS 3850 4830 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_12370 4872 7193 gene locus_tag LOCUS_12380 4872 7193 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_12380 7190 8806 gene locus_tag LOCUS_12390 gene pstA 7190 8806 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_12390 8803 9708 gene locus_tag LOCUS_12400 gene pstB 8803 9708 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_12400 9741 10421 gene locus_tag LOCUS_12410 gene phoU 9741 10421 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_12410 10822 11598 gene locus_tag LOCUS_12420 10822 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 12560 11904 gene locus_tag LOCUS_12430 12560 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 12575 12995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 64 762 gene locus_tag LOCUS_12440 64 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 755 1684 gene locus_tag LOCUS_12450 755 1684 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_12450 1674 2537 gene locus_tag LOCUS_12460 1674 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2530 3759 gene locus_tag LOCUS_12470 gene ftsA 2530 3759 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_12470 3823 5058 gene locus_tag LOCUS_12480 gene ftsZ 3823 5058 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_12480 5077 5742 gene locus_tag LOCUS_12490 5077 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5739 7034 gene locus_tag LOCUS_12500 5739 7034 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_12500 7684 7031 gene locus_tag LOCUS_12510 7684 7031 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544953.1 protein_id gnl|my_center|LOCUS_12510 8778 7672 gene locus_tag LOCUS_12520 gene ribD 8778 7672 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_12520 9758 8823 gene locus_tag LOCUS_12530 9758 8823 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_12530 10252 9782 gene locus_tag LOCUS_12540 10252 9782 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886246.1 protein_id gnl|my_center|LOCUS_12540 13490 10716 gene locus_tag LOCUS_12550 gene ppdK 13490 10716 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence070 990 232 gene locus_tag LOCUS_12560 990 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1013 6028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7974 6763 gene locus_tag LOCUS_12570 7974 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8911 7967 gene locus_tag LOCUS_12580 8911 7967 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_12580 10861 8963 gene locus_tag LOCUS_12590 gene asnB 10861 8963 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_12590 11644 10868 gene locus_tag LOCUS_12600 11644 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence071 983 783 gene locus_tag LOCUS_12610 983 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1686 1132 gene locus_tag LOCUS_12620 1686 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3925 2441 gene locus_tag LOCUS_12630 gene guaB 3925 2441 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_12630 4470 4054 gene locus_tag LOCUS_12640 gene nikR 4470 4054 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_12640 4949 5551 gene locus_tag LOCUS_12650 4949 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6150 5506 gene locus_tag LOCUS_12660 gene ysxC 6150 5506 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_12660 7454 6147 gene locus_tag LOCUS_12670 7454 6147 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_12670 9524 7491 gene locus_tag LOCUS_12680 9524 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 9785 10723 gene locus_tag LOCUS_12690 gene moaA 9785 10723 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875820.1 protein_id gnl|my_center|LOCUS_12690 10852 11856 gene locus_tag LOCUS_12700 10852 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 11860 12459 gene locus_tag LOCUS_12710 11860 12459 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 protein_id gnl|my_center|LOCUS_12710 12983 12477 gene locus_tag LOCUS_12720 12983 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence072 <1 558 gene locus_tag LOCUS_12730 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391988.1:molybdopterin-dependent oxidoreductase 639 1274 gene locus_tag LOCUS_12740 639 1274 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461328.1 protein_id gnl|my_center|LOCUS_12740 1271 2446 gene locus_tag LOCUS_12750 1271 2446 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392896.1 protein_id gnl|my_center|LOCUS_12750 2439 3041 gene locus_tag LOCUS_12760 2439 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3545 3090 gene locus_tag LOCUS_12770 3545 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4225 3836 gene locus_tag LOCUS_12780 4225 3836 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_12780 4457 4906 gene locus_tag LOCUS_12790 gene queF 4457 4906 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263288.1 protein_id gnl|my_center|LOCUS_12790 4903 5868 gene locus_tag LOCUS_12800 4903 5868 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_12800 5937 6263 gene locus_tag LOCUS_12810 gene trxA 5937 6263 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883224.1 protein_id gnl|my_center|LOCUS_12810 6956 6324 gene locus_tag LOCUS_12820 6956 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 7941 6958 gene locus_tag LOCUS_12830 7941 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 11020 8090 gene locus_tag LOCUS_12840 11020 8090 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_12840 11815 12417 gene locus_tag LOCUS_12850 11815 12417 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943628.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence073 361 870 gene locus_tag LOCUS_12860 361 870 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_12860 978 2987 gene locus_tag LOCUS_12870 978 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4127 3459 gene locus_tag LOCUS_12880 4127 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4516 4124 gene locus_tag LOCUS_12890 4516 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4829 6754 gene locus_tag LOCUS_12900 4829 6754 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144073.1 protein_id gnl|my_center|LOCUS_12900 6797 7726 gene locus_tag LOCUS_12910 gene mdh 6797 7726 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_12910 7932 10355 gene locus_tag LOCUS_12920 7932 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10535 10684 gene locus_tag LOCUS_12930 10535 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10703 11455 gene locus_tag LOCUS_12940 10703 11455 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870402.1 protein_id gnl|my_center|LOCUS_12940 11461 11727 gene locus_tag LOCUS_12950 11461 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12894 11743 gene locus_tag LOCUS_12960 12894 11743 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence074 1225 1037 gene locus_tag LOCUS_12970 1225 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1372 1241 gene locus_tag LOCUS_12980 1372 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3306 1378 gene locus_tag LOCUS_12990 3306 1378 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_12990 1401 1498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5692 3308 gene locus_tag LOCUS_13000 5692 3308 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_13000 5828 6595 gene locus_tag LOCUS_13010 5828 6595 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_13010 6700 6616 gene locus_tag LOCUS_t00130 6700 6616 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8333 7008 gene locus_tag LOCUS_13020 8333 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8506 8730 gene locus_tag LOCUS_13030 8506 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9658 8768 gene locus_tag LOCUS_13040 9658 8768 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_13040 9944 9663 gene locus_tag LOCUS_13050 9944 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 11407 9956 gene locus_tag LOCUS_13060 gene xseA 11407 9956 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 protein_id gnl|my_center|LOCUS_13060 12267 11410 gene locus_tag LOCUS_13070 gene folD 12267 11410 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13070 12579 12655 gene locus_tag LOCUS_t00140 12579 12655 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 <1 2820 gene locus_tag LOCUS_13080 <1 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460092.1:ASKHA domain-containing protein 2817 3848 gene locus_tag LOCUS_13090 gene gnfL 2817 3848 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_13090 4374 3853 gene locus_tag LOCUS_13100 4374 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5273 4371 gene locus_tag LOCUS_13110 5273 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6037 5273 gene locus_tag LOCUS_13120 6037 5273 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_13120 6477 6034 gene locus_tag LOCUS_13130 6477 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7241 6474 gene locus_tag LOCUS_13140 7241 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7993 7262 gene locus_tag LOCUS_13150 7993 7262 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_13150 8838 7996 gene locus_tag LOCUS_13160 8838 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 9452 8853 gene locus_tag LOCUS_13170 9452 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9890 11071 gene locus_tag LOCUS_13180 9890 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11075 12754 gene locus_tag LOCUS_13190 11075 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence076 145 1086 gene locus_tag LOCUS_13200 145 1086 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_13200 1086 2381 gene locus_tag LOCUS_13210 gene rimO 1086 2381 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_13210 2378 2701 gene locus_tag LOCUS_13220 2378 2701 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_13220 3544 2717 gene locus_tag LOCUS_13230 3544 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4733 3759 gene locus_tag LOCUS_13240 4733 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5523 4735 gene locus_tag LOCUS_13250 5523 4735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_13250 8426 5697 gene locus_tag LOCUS_13260 8426 5697 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_13260 9360 8491 gene locus_tag LOCUS_13270 gene metF 9360 8491 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_13270 9589 10719 gene locus_tag LOCUS_13280 9589 10719 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_13280 10773 11309 gene locus_tag LOCUS_13290 10773 11309 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_13290 11382 12158 gene locus_tag LOCUS_13300 11382 12158 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence077 <1 1250 gene locus_tag LOCUS_13310 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546455.1:argininosuccinate lyase 1514 3679 gene locus_tag LOCUS_13320 1514 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4749 3685 gene locus_tag LOCUS_13330 4749 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5757 4837 gene locus_tag LOCUS_13340 5757 4837 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_13340 5883 6164 gene locus_tag LOCUS_13350 5883 6164 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_13350 6168 6587 gene locus_tag LOCUS_13360 gene rbfA 6168 6587 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_13360 7733 6864 gene locus_tag LOCUS_13370 7733 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8101 9852 gene locus_tag LOCUS_13380 8101 9852 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_13380 9854 10231 gene locus_tag LOCUS_13390 9854 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 10225 10608 gene locus_tag LOCUS_13400 10225 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 <12838 10924 gene locus_tag LOCUS_13410 <12838 10924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265883.1:ATP-binding protein >Feature sequence078 676 2994 gene locus_tag LOCUS_13420 676 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3093 3839 gene locus_tag LOCUS_13430 3093 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5228 3858 gene locus_tag LOCUS_13440 5228 3858 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_13440 6521 5244 gene locus_tag LOCUS_13450 6521 5244 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_13450 7815 6541 gene locus_tag LOCUS_13460 7815 6541 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_13460 9398 7812 gene locus_tag LOCUS_13470 gene serA 9398 7812 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_13470 10617 9472 gene locus_tag LOCUS_13480 10617 9472 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_13480 11277 10759 gene locus_tag LOCUS_13490 11277 10759 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084261.1 protein_id gnl|my_center|LOCUS_13490 12168 11290 gene locus_tag LOCUS_13500 12168 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence079 352 1611 gene locus_tag LOCUS_13510 352 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1568 2647 gene locus_tag LOCUS_13520 1568 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2644 4059 gene locus_tag LOCUS_13530 2644 4059 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_13530 4276 5004 gene locus_tag LOCUS_13540 4276 5004 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_13540 5004 5981 gene locus_tag LOCUS_13550 gene miaA 5004 5981 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_13550 5935 8157 gene locus_tag LOCUS_13560 5935 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8514 8173 gene locus_tag LOCUS_13570 8514 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8537 10120 gene locus_tag LOCUS_13580 8537 10120 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_13580 10134 11525 gene locus_tag LOCUS_13590 10134 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 11522 12457 gene locus_tag LOCUS_13600 11522 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence080 1160 93 gene locus_tag LOCUS_13610 gene mqnC 1160 93 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_13610 2434 1157 gene locus_tag LOCUS_13620 2434 1157 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_13620 3714 2431 gene locus_tag LOCUS_13630 3714 2431 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_13630 5203 3731 gene locus_tag LOCUS_13640 5203 3731 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_13640 6732 5200 gene locus_tag LOCUS_13650 6732 5200 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_13650 7023 6841 gene locus_tag LOCUS_13660 7023 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7287 7595 gene locus_tag LOCUS_13670 7287 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7602 7904 gene locus_tag LOCUS_13680 7602 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13680 8051 10276 gene locus_tag LOCUS_13690 gene priA 8051 10276 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_13690 10421 10837 gene locus_tag LOCUS_13700 gene rpsL 10421 10837 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_13700 10858 11328 gene locus_tag LOCUS_13710 gene rpsG 10858 11328 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence081 134 1879 gene locus_tag LOCUS_13720 134 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1960 3318 gene locus_tag LOCUS_13730 1960 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3347 3580 gene locus_tag LOCUS_13740 3347 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3933 5327 gene locus_tag LOCUS_13750 3933 5327 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_13750 5632 6570 gene locus_tag LOCUS_13760 5632 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6567 7475 gene locus_tag LOCUS_13770 6567 7475 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_13770 8909 7827 gene locus_tag LOCUS_13780 8909 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 9443 8964 gene locus_tag LOCUS_13790 9443 8964 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_13790 10029 9508 gene locus_tag LOCUS_13800 gene rplI 10029 9508 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_13800 10993 10049 gene locus_tag LOCUS_13810 10993 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11247 10999 gene locus_tag LOCUS_13820 gene rpsR 11247 10999 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941327.1 protein_id gnl|my_center|LOCUS_13820 11712 11296 gene locus_tag LOCUS_13830 gene ssb 11712 11296 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_13830 12073 11696 gene locus_tag LOCUS_13840 12073 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence082 154 333 gene locus_tag LOCUS_13850 154 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1068 568 gene locus_tag LOCUS_13860 1068 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1379 2920 gene locus_tag LOCUS_13870 1379 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3964 2909 gene locus_tag LOCUS_13880 3964 2909 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_13880 4119 3970 gene locus_tag LOCUS_13890 4119 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6878 4116 gene locus_tag LOCUS_13900 6878 4116 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704393.1 protein_id gnl|my_center|LOCUS_13900 6957 7054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9819 8572 gene locus_tag LOCUS_13910 9819 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 11745 9871 gene locus_tag LOCUS_13920 11745 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 11684 11944 gene locus_tag LOCUS_13930 11684 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 12005 12319 gene locus_tag LOCUS_13940 12005 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence083 411 890 gene locus_tag LOCUS_13950 411 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 946 1377 gene locus_tag LOCUS_13960 946 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1429 5037 gene locus_tag LOCUS_13970 1429 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5284 8301 gene locus_tag LOCUS_13980 5284 8301 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_13980 8397 9077 gene locus_tag LOCUS_13990 8397 9077 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_13990 9217 11841 gene locus_tag LOCUS_14000 9217 11841 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036268.1 protein_id gnl|my_center|LOCUS_14000 12117 12042 gene locus_tag LOCUS_t00150 12117 12042 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 2036 1536 gene locus_tag LOCUS_14010 2036 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3280 2033 gene locus_tag LOCUS_14020 3280 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4224 3277 gene locus_tag LOCUS_14030 gene gspK 4224 3277 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_14030 4766 4239 gene locus_tag LOCUS_14040 4766 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5208 4816 gene locus_tag LOCUS_14050 gene xcpV 5208 4816 CDS product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 protein_id gnl|my_center|LOCUS_14050 5723 5208 gene locus_tag LOCUS_14060 5723 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6168 5725 gene locus_tag LOCUS_14070 gene gspG 6168 5725 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_14070 7438 6221 gene locus_tag LOCUS_14080 gene gspF 7438 6221 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_14080 8969 7440 gene locus_tag LOCUS_14090 gene gspE 8969 7440 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_14090 11455 8966 gene locus_tag LOCUS_14100 gene gspD 11455 8966 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213605796.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence085 <1 1818 gene locus_tag LOCUS_14110 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391800.1:excinuclease ABC subunit UvrC 2342 1956 gene locus_tag LOCUS_14120 2342 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3372 2347 gene locus_tag LOCUS_14130 3372 2347 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_14130 4357 3413 gene locus_tag LOCUS_14140 4357 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6448 4445 gene locus_tag LOCUS_14150 gene cheAY2 6448 4445 CDS product chemotaxis histidine kinase/response regulator CheAY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342347.1 protein_id gnl|my_center|LOCUS_14150 6861 6448 gene locus_tag LOCUS_14160 6861 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7247 6885 gene locus_tag LOCUS_14170 7247 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7260 7358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7380 7619 gene locus_tag LOCUS_14180 7380 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8475 7966 gene locus_tag LOCUS_14190 8475 7966 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_14190 8930 8502 gene locus_tag LOCUS_14200 8930 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11843 9003 gene locus_tag LOCUS_14210 11843 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence086 295 453 gene locus_tag LOCUS_14220 295 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 437 1387 gene locus_tag LOCUS_14230 437 1387 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_14230 1384 2637 gene locus_tag LOCUS_14240 1384 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2813 3202 gene locus_tag LOCUS_14250 2813 3202 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_14250 3171 3587 gene locus_tag LOCUS_14260 3171 3587 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_14260 3717 4241 gene locus_tag LOCUS_14270 3717 4241 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_14270 4484 4717 gene locus_tag LOCUS_14280 4484 4717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_14280 4740 5837 gene locus_tag LOCUS_14290 gene pilM 4740 5837 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_14290 5834 6478 gene locus_tag LOCUS_14300 5834 6478 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_14300 6570 7316 gene locus_tag LOCUS_14310 6570 7316 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_14310 7375 8298 gene locus_tag LOCUS_14320 7375 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 9003 9099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9153 10685 gene locus_tag LOCUS_14330 9153 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10701 11138 gene locus_tag LOCUS_14340 10701 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence087 649 254 gene locus_tag LOCUS_14350 649 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 813 646 gene locus_tag LOCUS_14360 813 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1291 836 gene locus_tag LOCUS_14370 1291 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1727 1296 gene locus_tag LOCUS_14380 1727 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2789 1803 gene locus_tag LOCUS_14390 2789 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3478 2831 gene locus_tag LOCUS_14400 3478 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4422 3511 gene locus_tag LOCUS_14410 4422 3511 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 protein_id gnl|my_center|LOCUS_14410 5661 4570 gene locus_tag LOCUS_14420 5661 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 7197 5695 gene locus_tag LOCUS_14430 7197 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7828 7130 gene locus_tag LOCUS_14440 7828 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8421 7828 gene locus_tag LOCUS_14450 8421 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8747 8421 gene locus_tag LOCUS_14460 8747 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8938 8759 gene locus_tag LOCUS_14470 8938 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8989 9231 gene locus_tag LOCUS_14480 8989 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 9466 9714 gene locus_tag LOCUS_14490 9466 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10231 11211 gene locus_tag LOCUS_14500 10231 11211 CDS product HupU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089682.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence088 <1 636 gene locus_tag LOCUS_14510 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085551.1:cytochrome-c oxidase, cbb3-type subunit III 1300 2061 gene locus_tag LOCUS_14520 1300 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2105 2491 gene locus_tag LOCUS_14530 2105 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2488 2844 gene locus_tag LOCUS_14540 2488 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3146 5014 gene locus_tag LOCUS_14550 gene ftsH 3146 5014 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_14550 5231 6031 gene locus_tag LOCUS_14560 5231 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 6077 6829 gene locus_tag LOCUS_14570 gene surE 6077 6829 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_14570 6833 8098 gene locus_tag LOCUS_14580 gene aroA 6833 8098 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_14580 8177 8455 gene locus_tag LOCUS_14590 8177 8455 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_14590 8471 8755 gene locus_tag LOCUS_14600 8471 8755 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_14600 11696 8763 gene locus_tag LOCUS_14610 11696 8763 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_14610 11596 11889 gene locus_tag LOCUS_14620 11596 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence089 1937 636 gene locus_tag LOCUS_14630 gene nirJ1 1937 636 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_14630 2321 2668 gene locus_tag LOCUS_14640 2321 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2665 3069 gene locus_tag LOCUS_14650 2665 3069 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_14650 3209 3901 gene locus_tag LOCUS_14660 3209 3901 CDS product methyltransferase cognate corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020203.1 protein_id gnl|my_center|LOCUS_14660 3894 4952 gene locus_tag LOCUS_14670 3894 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4945 5520 gene locus_tag LOCUS_14680 4945 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5517 7088 gene locus_tag LOCUS_14690 5517 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7223 7552 gene locus_tag LOCUS_14700 7223 7552 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140979.1 protein_id gnl|my_center|LOCUS_14700 7549 7926 gene locus_tag LOCUS_14710 7549 7926 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_14710 8009 9127 gene locus_tag LOCUS_14720 8009 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9334 10407 gene locus_tag LOCUS_14730 9334 10407 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_14730 10412 11461 gene locus_tag LOCUS_14740 gene waaF 10412 11461 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence090 1826 240 gene locus_tag LOCUS_14750 1826 240 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_14750 3282 1828 gene locus_tag LOCUS_14760 3282 1828 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_14760 3993 3325 gene locus_tag LOCUS_14770 3993 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_14770 4947 4003 gene locus_tag LOCUS_14780 4947 4003 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_14780 4064 4133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7002 4963 gene locus_tag LOCUS_14790 gene hyfB 7002 4963 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_14790 7622 7549 gene locus_tag LOCUS_t00160 7622 7549 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8201 7656 gene locus_tag LOCUS_14800 8201 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9483 8731 gene locus_tag LOCUS_14810 9483 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 10190 9492 gene locus_tag LOCUS_14820 10190 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 11561 10665 gene locus_tag LOCUS_14830 gene cyoE 11561 10665 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880042.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence091 401 1219 gene locus_tag LOCUS_14840 401 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1216 1473 gene locus_tag LOCUS_14850 1216 1473 CDS product Franean1_4349 family RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943216.1 protein_id gnl|my_center|LOCUS_14850 1538 2179 gene locus_tag LOCUS_14860 1538 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2211 2831 gene locus_tag LOCUS_14870 2211 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2869 4362 gene locus_tag LOCUS_14880 2869 4362 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546548.1 protein_id gnl|my_center|LOCUS_14880 4346 5599 gene locus_tag LOCUS_14890 4346 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 5952 6791 gene locus_tag LOCUS_14900 5952 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 6901 7236 gene locus_tag LOCUS_14910 6901 7236 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_14910 8292 7264 gene locus_tag LOCUS_14920 8292 7264 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_14920 9756 8302 gene locus_tag LOCUS_14930 9756 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 9915 10562 gene locus_tag LOCUS_14940 9915 10562 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 protein_id gnl|my_center|LOCUS_14940 10590 11594 gene locus_tag LOCUS_14950 gene amrS 10590 11594 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583380.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence092 <1 3426 gene locus_tag LOCUS_14960 <1 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein 3498 4460 gene locus_tag LOCUS_14970 3498 4460 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003054729.1 protein_id gnl|my_center|LOCUS_14970 4895 4533 gene locus_tag LOCUS_tm00010 4895 4533 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5850 4981 gene locus_tag LOCUS_14980 5850 4981 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546155.1 protein_id gnl|my_center|LOCUS_14980 7150 5975 gene locus_tag LOCUS_14990 7150 5975 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_14990 7274 8968 gene locus_tag LOCUS_15000 gene ilvB 7274 8968 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_15000 8975 9466 gene locus_tag LOCUS_15010 gene ilvN 8975 9466 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_15010 9521 10525 gene locus_tag LOCUS_15020 gene ilvC 9521 10525 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_15020 10535 11182 gene locus_tag LOCUS_15030 10535 11182 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327813.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence093 1098 139 gene locus_tag LOCUS_15040 1098 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2227 1142 gene locus_tag LOCUS_15050 2227 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4720 2243 gene locus_tag LOCUS_15060 gene lon 4720 2243 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 protein_id gnl|my_center|LOCUS_15060 6085 4835 gene locus_tag LOCUS_15070 gene clpX 6085 4835 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_15070 6807 6139 gene locus_tag LOCUS_15080 gene clpP 6807 6139 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_15080 8093 6795 gene locus_tag LOCUS_15090 gene tig 8093 6795 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_15090 8242 8160 gene locus_tag LOCUS_t00170 8242 8160 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8785 8883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8915 9319 gene locus_tag LOCUS_15100 8915 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 9361 9924 gene locus_tag LOCUS_15110 9361 9924 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_15110 10982 9960 gene locus_tag LOCUS_15120 gene htpX 10982 9960 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence094 168 1718 gene locus_tag LOCUS_15130 168 1718 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_15130 1851 2783 gene locus_tag LOCUS_15140 1851 2783 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937955.1 protein_id gnl|my_center|LOCUS_15140 2826 3800 gene locus_tag LOCUS_15150 gene dusB 2826 3800 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_15150 4205 3861 gene locus_tag LOCUS_15160 4205 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5430 4642 gene locus_tag LOCUS_15170 5430 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5812 6237 gene locus_tag LOCUS_15180 gene flgB 5812 6237 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_15180 6254 6556 gene locus_tag LOCUS_15190 gene fliE 6254 6556 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937621.1 protein_id gnl|my_center|LOCUS_15190 6894 10928 gene locus_tag LOCUS_15200 6894 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence095 897 292 gene locus_tag LOCUS_15210 gene lexA 897 292 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_15210 1635 1312 gene locus_tag LOCUS_15220 1635 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2240 1878 gene locus_tag LOCUS_15230 2240 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2762 2295 gene locus_tag LOCUS_15240 2762 2295 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_15240 5653 3011 gene locus_tag LOCUS_15250 5653 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3018 3115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6216 5719 gene locus_tag LOCUS_15260 6216 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 6707 6321 gene locus_tag LOCUS_15270 6707 6321 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_15270 6958 6704 gene locus_tag LOCUS_15280 6958 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7047 7232 gene locus_tag LOCUS_15290 7047 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8428 7208 gene locus_tag LOCUS_15300 gene rlmI 8428 7208 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_15300 9167 8421 gene locus_tag LOCUS_15310 9167 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9740 10468 gene locus_tag LOCUS_15320 9740 10468 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence096 225 1721 gene locus_tag LOCUS_15330 225 1721 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_15330 1725 2066 gene locus_tag LOCUS_15340 gene hypA 1725 2066 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_15340 2063 2728 gene locus_tag LOCUS_15350 2063 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2712 5003 gene locus_tag LOCUS_15360 gene hypF 2712 5003 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_15360 5023 5802 gene locus_tag LOCUS_15370 5023 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5845 6075 gene locus_tag LOCUS_15380 5845 6075 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_15380 6072 7178 gene locus_tag LOCUS_15390 gene hypD 6072 7178 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_15390 7171 8184 gene locus_tag LOCUS_15400 gene hypE 7171 8184 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_15400 8827 8546 gene locus_tag LOCUS_15410 gene rpsS 8827 8546 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_15410 9667 8843 gene locus_tag LOCUS_15420 gene rplB 9667 8843 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_15420 9981 9688 gene locus_tag LOCUS_15430 9981 9688 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_15430 10607 9978 gene locus_tag LOCUS_15440 gene rplD 10607 9978 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence097 766 230 gene locus_tag LOCUS_15450 766 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1131 1532 gene locus_tag LOCUS_15460 1131 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1546 2007 gene locus_tag LOCUS_15470 1546 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3103 2021 gene locus_tag LOCUS_15480 3103 2021 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938160.1 protein_id gnl|my_center|LOCUS_15480 3258 5285 gene locus_tag LOCUS_15490 3258 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6228 5410 gene locus_tag LOCUS_15500 gene proC 6228 5410 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_15500 6933 6244 gene locus_tag LOCUS_15510 6933 6244 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_15510 7279 7052 gene locus_tag LOCUS_15520 7279 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 8434 7790 gene locus_tag LOCUS_15530 8434 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9437 8394 gene locus_tag LOCUS_15540 9437 8394 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_15540 9792 9867 gene locus_tag LOCUS_t00180 9792 9867 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10134 10565 gene locus_tag LOCUS_15550 10134 10565 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence098 1324 473 gene locus_tag LOCUS_15560 1324 473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_15560 2291 1317 gene locus_tag LOCUS_15570 2291 1317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_15570 2798 5059 gene locus_tag LOCUS_15580 2798 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5249 7360 gene locus_tag LOCUS_15590 5249 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7466 8455 gene locus_tag LOCUS_15600 7466 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8458 9630 gene locus_tag LOCUS_15610 8458 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10011 10334 gene locus_tag LOCUS_15620 10011 10334 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391100.1 protein_id gnl|my_center|LOCUS_15620 10364 10873 gene locus_tag LOCUS_15630 10364 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence099 369 13 gene locus_tag LOCUS_15640 369 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 996 442 gene locus_tag LOCUS_15650 gene pyrE 996 442 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930785.1 protein_id gnl|my_center|LOCUS_15650 1245 2582 gene locus_tag LOCUS_15660 1245 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2588 3259 gene locus_tag LOCUS_15670 2588 3259 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_15670 3267 3584 gene locus_tag LOCUS_15680 3267 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3958 3755 gene locus_tag LOCUS_15690 3958 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4581 3955 gene locus_tag LOCUS_15700 4581 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5046 4738 gene locus_tag LOCUS_15710 5046 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 8292 5080 gene locus_tag LOCUS_15720 8292 5080 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255936.1 protein_id gnl|my_center|LOCUS_15720 9521 8310 gene locus_tag LOCUS_15730 gene nrfD 9521 8310 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255935.1 protein_id gnl|my_center|LOCUS_15730 9959 9534 gene locus_tag LOCUS_15740 9959 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 10675 10600 gene locus_tag LOCUS_t00190 10675 10600 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 <1 726 gene locus_tag LOCUS_15750 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000798631.1:multidrug efflux MFS transporter outer membrane subunit VceC 730 1896 gene locus_tag LOCUS_15760 730 1896 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_15760 1999 2208 gene locus_tag LOCUS_15770 1999 2208 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_15770 2304 2453 gene locus_tag LOCUS_15780 2304 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2574 4049 gene locus_tag LOCUS_15790 2574 4049 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524545.1 protein_id gnl|my_center|LOCUS_15790 4648 5985 gene locus_tag LOCUS_15800 4648 5985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_15800 6128 7003 gene locus_tag LOCUS_15810 6128 7003 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_15810 7000 8019 gene locus_tag LOCUS_15820 7000 8019 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_15820 8016 8738 gene locus_tag LOCUS_15830 8016 8738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_15830 8731 9435 gene locus_tag LOCUS_15840 8731 9435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_15840 9458 10147 gene locus_tag LOCUS_15850 9458 10147 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_15850 <10713 10172 gene locus_tag LOCUS_15860 <10713 10172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294596.1:RtcB family protein >Feature sequence101 1008 415 gene locus_tag LOCUS_15870 1008 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1474 1094 gene locus_tag LOCUS_15880 1474 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2187 1474 gene locus_tag LOCUS_15890 2187 1474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_15890 2897 2184 gene locus_tag LOCUS_15900 2897 2184 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808326.1 protein_id gnl|my_center|LOCUS_15900 3870 2884 gene locus_tag LOCUS_15910 3870 2884 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_15910 4822 3851 gene locus_tag LOCUS_15920 4822 3851 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_15920 7429 4952 gene locus_tag LOCUS_15930 7429 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 <10676 7429 gene locus_tag LOCUS_15940 <10676 7429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965644.1:glycosyltransferase family 2 protein >Feature sequence102 1621 239 gene locus_tag LOCUS_15950 1621 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1620 1808 gene locus_tag LOCUS_15960 1620 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2663 1794 gene locus_tag LOCUS_15970 gene glyQ 2663 1794 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_15970 4121 3018 gene locus_tag LOCUS_15980 4121 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5613 4420 gene locus_tag LOCUS_15990 5613 4420 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_15990 6898 5618 gene locus_tag LOCUS_16000 6898 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7003 7698 gene locus_tag LOCUS_16010 gene tsaB 7003 7698 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_16010 7717 7929 gene locus_tag LOCUS_16020 7717 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 9455 8256 gene locus_tag LOCUS_16030 9455 8256 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence103 368 1582 gene locus_tag LOCUS_16040 368 1582 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_16040 1912 3927 gene locus_tag LOCUS_16050 1912 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4100 3939 gene locus_tag LOCUS_16060 4100 3939 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_16060 4354 4112 gene locus_tag LOCUS_16070 4354 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4811 4377 gene locus_tag LOCUS_16080 4811 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6848 4842 gene locus_tag LOCUS_16090 6848 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 7007 7447 gene locus_tag LOCUS_16100 7007 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 7444 7893 gene locus_tag LOCUS_16110 7444 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7890 8486 gene locus_tag LOCUS_16120 7890 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 8483 9886 gene locus_tag LOCUS_16130 8483 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence104 541 2958 gene locus_tag LOCUS_16140 541 2958 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_16140 3003 4874 gene locus_tag LOCUS_16150 gene mutL 3003 4874 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_16150 5280 4888 gene locus_tag LOCUS_16160 5280 4888 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_16160 7715 5331 gene locus_tag LOCUS_16170 7715 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 9093 7732 gene locus_tag LOCUS_16180 9093 7732 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_16180 9690 9376 gene locus_tag LOCUS_16190 9690 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence105 43 3312 gene locus_tag LOCUS_16200 43 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3309 6890 gene locus_tag LOCUS_16210 3309 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7965 6958 gene locus_tag LOCUS_16220 7965 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8763 7987 gene locus_tag LOCUS_16230 8763 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 9538 8810 gene locus_tag LOCUS_16240 9538 8810 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_16240 10179 9454 gene locus_tag LOCUS_16250 10179 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence106 2782 590 gene locus_tag LOCUS_16260 gene glgB 2782 590 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_16260 2976 3305 gene locus_tag LOCUS_16270 2976 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3317 3541 gene locus_tag LOCUS_16280 3317 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3799 4116 gene locus_tag LOCUS_16290 3799 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4113 5987 gene locus_tag LOCUS_16300 4113 5987 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_16300 6009 6221 gene locus_tag LOCUS_16310 6009 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6218 6799 gene locus_tag LOCUS_16320 6218 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6789 7802 gene locus_tag LOCUS_16330 6789 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 7805 8149 gene locus_tag LOCUS_16340 7805 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8146 9894 gene locus_tag LOCUS_16350 8146 9894 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_16350 9913 10215 gene locus_tag LOCUS_16360 9913 10215 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence107 376 1980 gene locus_tag LOCUS_16370 gene fliD 376 1980 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938162.1 protein_id gnl|my_center|LOCUS_16370 2011 2448 gene locus_tag LOCUS_16380 2011 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2540 4531 gene locus_tag LOCUS_16390 gene uvrB 2540 4531 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_16390 4860 6524 gene locus_tag LOCUS_16400 4860 6524 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254166.1 protein_id gnl|my_center|LOCUS_16400 6877 7470 gene locus_tag LOCUS_16410 6877 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8692 7544 gene locus_tag LOCUS_16420 8692 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 9714 8623 gene locus_tag LOCUS_16430 gene waaC 9714 8623 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence108 631 221 gene locus_tag LOCUS_16440 631 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 1936 1028 gene locus_tag LOCUS_16450 1936 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2247 2464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3875 5152 gene locus_tag LOCUS_16460 gene leuC 3875 5152 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198993.1 protein_id gnl|my_center|LOCUS_16460 5210 5665 gene locus_tag LOCUS_16470 gene leuD 5210 5665 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_16470 6182 6423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7973 9190 gene locus_tag LOCUS_16480 7973 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence109 401 949 gene locus_tag LOCUS_16490 401 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 950 1120 gene locus_tag LOCUS_16500 950 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1673 1431 gene locus_tag LOCUS_16510 1673 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1579 2178 gene locus_tag LOCUS_16520 1579 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3603 2206 gene locus_tag LOCUS_16530 3603 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4119 3724 gene locus_tag LOCUS_16540 4119 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4787 4116 gene locus_tag LOCUS_16550 4787 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5414 4791 gene locus_tag LOCUS_16560 gene gmk 5414 4791 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_16560 6289 5411 gene locus_tag LOCUS_16570 6289 5411 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_16570 6702 6301 gene locus_tag LOCUS_16580 6702 6301 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964577.1 protein_id gnl|my_center|LOCUS_16580 9419 6705 gene locus_tag LOCUS_16590 gene secA 9419 6705 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_16590 <10272 9763 gene locus_tag LOCUS_16600 <10272 9763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940692.1:DnaJ C-terminal domain-containing protein >Feature sequence110 167 2170 gene locus_tag LOCUS_16610 167 2170 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_16610 2679 3731 gene locus_tag LOCUS_16620 2679 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4038 8330 gene locus_tag LOCUS_16630 4038 8330 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_16630 8355 8603 gene locus_tag LOCUS_16640 8355 8603 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_16640 8729 8968 gene locus_tag LOCUS_16650 8729 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 9293 9733 gene locus_tag LOCUS_16660 9293 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9730 10011 gene locus_tag LOCUS_16670 9730 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence111 1532 327 gene locus_tag LOCUS_16680 1532 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1829 1605 gene locus_tag LOCUS_16690 1829 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2767 1790 gene locus_tag LOCUS_16700 2767 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4924 2795 gene locus_tag LOCUS_16710 4924 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6489 4924 gene locus_tag LOCUS_16720 6489 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7084 6479 gene locus_tag LOCUS_16730 7084 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 7314 7030 gene locus_tag LOCUS_16740 7314 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7788 7330 gene locus_tag LOCUS_16750 7788 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7967 7785 gene locus_tag LOCUS_16760 7967 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 8526 7954 gene locus_tag LOCUS_16770 8526 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8990 8517 gene locus_tag LOCUS_16780 8990 8517 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_16780 9333 8971 gene locus_tag LOCUS_16790 9333 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence112 1275 88 gene locus_tag LOCUS_16800 1275 88 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925054.1 protein_id gnl|my_center|LOCUS_16800 1479 5576 gene locus_tag LOCUS_16810 1479 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5831 7969 gene locus_tag LOCUS_16820 5831 7969 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048283.1 protein_id gnl|my_center|LOCUS_16820 8148 8978 gene locus_tag LOCUS_16830 8148 8978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_16830 8981 9283 gene locus_tag LOCUS_16840 8981 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9268 9687 gene locus_tag LOCUS_16850 9268 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence113 118 420 gene locus_tag LOCUS_16860 118 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 393 1163 gene locus_tag LOCUS_16870 393 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1160 1567 gene locus_tag LOCUS_16880 1160 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1567 2178 gene locus_tag LOCUS_16890 1567 2178 CDS product septation protein IspZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208348.1 protein_id gnl|my_center|LOCUS_16890 2517 2155 gene locus_tag LOCUS_16900 2517 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2623 3063 gene locus_tag LOCUS_16910 2623 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4688 3282 gene locus_tag LOCUS_16920 4688 3282 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_16920 4970 6556 gene locus_tag LOCUS_16930 4970 6556 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925926.1 protein_id gnl|my_center|LOCUS_16930 6553 7158 gene locus_tag LOCUS_16940 gene lolA 6553 7158 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958062.1 protein_id gnl|my_center|LOCUS_16940 7155 9878 gene locus_tag LOCUS_16950 7155 9878 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence114 1173 457 gene locus_tag LOCUS_16960 1173 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1415 2350 gene locus_tag LOCUS_16970 1415 2350 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 protein_id gnl|my_center|LOCUS_16970 3473 2472 gene locus_tag LOCUS_16980 3473 2472 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_16980 3778 4374 gene locus_tag LOCUS_16990 3778 4374 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_16990 4585 6642 gene locus_tag LOCUS_17000 4585 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6661 7386 gene locus_tag LOCUS_17010 6661 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7376 8884 gene locus_tag LOCUS_17020 gene nrfD 7376 8884 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_17020 8888 9421 gene locus_tag LOCUS_17030 8888 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9421 9912 gene locus_tag LOCUS_17040 9421 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence115 203 961 gene locus_tag LOCUS_17050 203 961 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_17050 990 1754 gene locus_tag LOCUS_17060 990 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2218 2682 gene locus_tag LOCUS_17070 2218 2682 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_17070 3135 3686 gene locus_tag LOCUS_17080 3135 3686 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_17080 3782 3964 gene locus_tag LOCUS_17090 gene rpmF 3782 3964 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008362864.1 protein_id gnl|my_center|LOCUS_17090 4044 5198 gene locus_tag LOCUS_17100 gene plsX 4044 5198 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_17100 5199 6188 gene locus_tag LOCUS_17110 5199 6188 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_17110 6209 7369 gene locus_tag LOCUS_17120 6209 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7366 7563 gene locus_tag LOCUS_17130 7366 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 7705 8433 gene locus_tag LOCUS_17140 7705 8433 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_17140 8584 9042 gene locus_tag LOCUS_17150 8584 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 9154 9723 gene locus_tag LOCUS_17160 9154 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence116 280 1218 gene locus_tag LOCUS_17170 280 1218 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_17170 1218 2156 gene locus_tag LOCUS_17180 1218 2156 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_17180 2166 4028 gene locus_tag LOCUS_17190 2166 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4028 5530 gene locus_tag LOCUS_17200 4028 5530 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17200 5527 6447 gene locus_tag LOCUS_17210 5527 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 6606 7466 gene locus_tag LOCUS_17220 6606 7466 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_17220 7409 8611 gene locus_tag LOCUS_17230 7409 8611 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931321.1 protein_id gnl|my_center|LOCUS_17230 8628 9794 gene locus_tag LOCUS_17240 8628 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence117 1452 76 gene locus_tag LOCUS_17250 1452 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2248 1799 gene locus_tag LOCUS_17260 2248 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2840 2367 gene locus_tag LOCUS_17270 2840 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3350 7885 gene locus_tag LOCUS_17280 gene gltB 3350 7885 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227769.1 protein_id gnl|my_center|LOCUS_17280 7887 9356 gene locus_tag LOCUS_17290 7887 9356 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence118 1523 258 gene locus_tag LOCUS_17300 1523 258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_17300 1806 2120 gene locus_tag LOCUS_17310 1806 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2425 2006 gene locus_tag LOCUS_17320 2425 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3111 4181 gene locus_tag LOCUS_17330 3111 4181 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938567.1 protein_id gnl|my_center|LOCUS_17330 4482 4985 gene locus_tag LOCUS_17340 4482 4985 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879943.1 protein_id gnl|my_center|LOCUS_17340 5459 5124 gene locus_tag LOCUS_17350 5459 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5506 5604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5963 5637 gene locus_tag LOCUS_17360 5963 5637 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_17360 6417 6031 gene locus_tag LOCUS_17370 6417 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7122 6472 gene locus_tag LOCUS_17380 7122 6472 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435983.1 protein_id gnl|my_center|LOCUS_17380 7978 7148 gene locus_tag LOCUS_17390 7978 7148 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392302.1 protein_id gnl|my_center|LOCUS_17390 9236 8010 gene locus_tag LOCUS_17400 9236 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence119 <1 1050 gene locus_tag LOCUS_17410 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein 1394 2608 gene locus_tag LOCUS_17420 1394 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2807 4108 gene locus_tag LOCUS_17430 2807 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4105 4416 gene locus_tag LOCUS_17440 4105 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4420 4737 gene locus_tag LOCUS_17450 4420 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4734 5126 gene locus_tag LOCUS_17460 4734 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5787 5191 gene locus_tag LOCUS_17470 gene ruvA 5787 5191 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_17470 6299 5784 gene locus_tag LOCUS_17480 gene ruvC 6299 5784 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_17480 7032 6280 gene locus_tag LOCUS_17490 7032 6280 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_17490 8029 7109 gene locus_tag LOCUS_17500 gene argF 8029 7109 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_17500 9213 8026 gene locus_tag LOCUS_17510 9213 8026 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546465.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence120 445 2685 gene locus_tag LOCUS_17520 gene cas3 445 2685 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_17520 2714 3487 gene locus_tag LOCUS_17530 gene cas5c 2714 3487 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_17530 3484 5199 gene locus_tag LOCUS_17540 gene cas8c 3484 5199 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_17540 5202 6086 gene locus_tag LOCUS_17550 gene cas7c 5202 6086 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_17550 6088 6327 gene locus_tag LOCUS_17560 6088 6327 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_17560 6324 6698 gene locus_tag LOCUS_17570 6324 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 6695 7327 gene locus_tag LOCUS_17580 gene cas4 6695 7327 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_17580 7330 8361 gene locus_tag LOCUS_17590 gene cas1c 7330 8361 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_17590 8365 8658 gene locus_tag LOCUS_17600 gene cas2 8365 8658 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence121 233 1612 gene locus_tag LOCUS_17610 233 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1879 2358 gene locus_tag LOCUS_17620 1879 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3360 2374 gene locus_tag LOCUS_17630 3360 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3672 6455 gene locus_tag LOCUS_17640 3672 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6469 9387 gene locus_tag LOCUS_17650 6469 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence122 <1 660 gene locus_tag LOCUS_17660 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:type IV pilus secretin PilQ 762 1952 gene locus_tag LOCUS_17670 762 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3025 1931 gene locus_tag LOCUS_17680 3025 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3501 3094 gene locus_tag LOCUS_17690 3501 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4134 3520 gene locus_tag LOCUS_17700 4134 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4497 4183 gene locus_tag LOCUS_17710 4497 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5004 4690 gene locus_tag LOCUS_17720 5004 4690 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_17720 5357 5127 gene locus_tag LOCUS_17730 5357 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5825 5493 gene locus_tag LOCUS_17740 5825 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6115 5822 gene locus_tag LOCUS_17750 6115 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7012 6260 gene locus_tag LOCUS_17760 7012 6260 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_17760 8906 6972 gene locus_tag LOCUS_17770 gene dxs 8906 6972 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence123 267 7 gene locus_tag LOCUS_17780 267 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 828 1166 gene locus_tag LOCUS_17790 828 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1748 1179 gene locus_tag LOCUS_17800 1748 1179 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_17800 2210 1896 gene locus_tag LOCUS_17810 2210 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2609 3769 gene locus_tag LOCUS_17820 2609 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3946 4749 gene locus_tag LOCUS_17830 3946 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5204 7111 gene locus_tag LOCUS_17840 gene typA 5204 7111 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_17840 7173 7781 gene locus_tag LOCUS_17850 gene cysC 7173 7781 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_17850 8000 9403 gene locus_tag LOCUS_17860 8000 9403 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence124 25 639 gene locus_tag LOCUS_17870 25 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 885 5793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6086 6259 gene locus_tag LOCUS_17880 6086 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6909 6607 gene locus_tag LOCUS_17890 6909 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 7186 7566 gene locus_tag LOCUS_17900 7186 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 7669 8958 gene locus_tag LOCUS_17910 gene eno 7669 8958 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_17910 8990 9328 gene locus_tag LOCUS_17920 8990 9328 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546062.1 protein_id gnl|my_center|LOCUS_17920 9451 9527 gene locus_tag LOCUS_t00200 9451 9527 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 548 129 gene locus_tag LOCUS_17930 548 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1236 574 gene locus_tag LOCUS_17940 1236 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1195 1401 gene locus_tag LOCUS_17950 1195 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1735 2697 gene locus_tag LOCUS_17960 1735 2697 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_17960 2784 3338 gene locus_tag LOCUS_17970 gene pgsA 2784 3338 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_17970 3386 3946 gene locus_tag LOCUS_17980 3386 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4840 5007 gene locus_tag LOCUS_17990 4840 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5020 5547 gene locus_tag LOCUS_18000 5020 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5564 7072 gene locus_tag LOCUS_18010 5564 7072 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_18010 7094 7225 gene locus_tag LOCUS_18020 7094 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 7286 8104 gene locus_tag LOCUS_18030 7286 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence126 350 1081 gene locus_tag LOCUS_18040 gene cysZ 350 1081 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_18040 1083 2039 gene locus_tag LOCUS_18050 1083 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2062 2922 gene locus_tag LOCUS_18060 2062 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2922 3599 gene locus_tag LOCUS_18070 2922 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5067 3583 gene locus_tag LOCUS_18080 5067 3583 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_18080 6208 5087 gene locus_tag LOCUS_18090 gene rho 6208 5087 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_18090 9216 6643 gene locus_tag LOCUS_18100 9216 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence127 1729 1803 gene locus_tag LOCUS_t00210 1729 1803 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1881 2495 gene locus_tag LOCUS_18110 gene infC 1881 2495 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_18110 2499 2693 gene locus_tag LOCUS_18120 gene rpmI 2499 2693 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_18120 2729 3100 gene locus_tag LOCUS_18130 gene rplT 2729 3100 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_18130 3177 4211 gene locus_tag LOCUS_18140 gene pheS 3177 4211 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_18140 4214 6607 gene locus_tag LOCUS_18150 gene pheT 4214 6607 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_18150 6862 6787 gene locus_tag LOCUS_t00220 6862 6787 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8857 6968 gene locus_tag LOCUS_18160 8857 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <9476 8854 gene locus_tag LOCUS_18170 <9476 8854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966347.1:glycosyltransferase >Feature sequence128 933 220 gene locus_tag LOCUS_18180 933 220 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 protein_id gnl|my_center|LOCUS_18180 1902 1006 gene locus_tag LOCUS_18190 1902 1006 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_18190 2152 3624 gene locus_tag LOCUS_18200 2152 3624 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_18200 3968 3642 gene locus_tag LOCUS_18210 3968 3642 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_18210 4423 4013 gene locus_tag LOCUS_18220 4423 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4878 4528 gene locus_tag LOCUS_18230 4878 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4994 5419 gene locus_tag LOCUS_18240 4994 5419 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_18240 5562 6044 gene locus_tag LOCUS_18250 5562 6044 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198641.1 protein_id gnl|my_center|LOCUS_18250 6076 6432 gene locus_tag LOCUS_18260 6076 6432 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_18260 6413 6895 gene locus_tag LOCUS_18270 6413 6895 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_18270 7115 7405 gene locus_tag LOCUS_18280 7115 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 7416 7598 gene locus_tag LOCUS_18290 7416 7598 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937335.1 protein_id gnl|my_center|LOCUS_18290 8075 7668 gene locus_tag LOCUS_18300 8075 7668 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_18300 8990 8103 gene locus_tag LOCUS_18310 8990 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence129 225 1589 gene locus_tag LOCUS_18320 225 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1736 2674 gene locus_tag LOCUS_18330 1736 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5716 2882 gene locus_tag LOCUS_18340 5716 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_18340 7067 5652 gene locus_tag LOCUS_18350 7067 5652 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_18350 9096 7138 gene locus_tag LOCUS_18360 9096 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence130 2761 242 gene locus_tag LOCUS_18370 2761 242 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_18370 3869 2754 gene locus_tag LOCUS_18380 gene rodA 3869 2754 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_18380 5707 3866 gene locus_tag LOCUS_18390 gene mrdA 5707 3866 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_18390 7113 5743 gene locus_tag LOCUS_18400 7113 5743 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_18400 7272 7574 gene locus_tag LOCUS_18410 7272 7574 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_18410 9026 7809 gene locus_tag LOCUS_18420 9026 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence131 770 336 gene locus_tag LOCUS_18430 gene dut 770 336 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454700.1 protein_id gnl|my_center|LOCUS_18430 1100 1438 gene locus_tag LOCUS_18440 1100 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2471 1506 gene locus_tag LOCUS_18450 2471 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2833 3492 gene locus_tag LOCUS_18460 2833 3492 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_18460 4937 3963 gene locus_tag LOCUS_18470 4937 3963 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_18470 5173 5439 gene locus_tag LOCUS_18480 5173 5439 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_18480 5534 6898 gene locus_tag LOCUS_18490 5534 6898 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_18490 7262 6972 gene locus_tag LOCUS_18500 7262 6972 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_18500 7362 8501 gene locus_tag LOCUS_18510 7362 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 8502 8663 gene locus_tag LOCUS_18520 8502 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence132 236 1198 gene locus_tag LOCUS_18530 236 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1456 1241 gene locus_tag LOCUS_18540 1456 1241 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089387.1 protein_id gnl|my_center|LOCUS_18540 1858 1472 gene locus_tag LOCUS_18550 1858 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2258 1914 gene locus_tag LOCUS_18560 2258 1914 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_18560 2982 2266 gene locus_tag LOCUS_18570 2982 2266 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_18570 3864 2992 gene locus_tag LOCUS_18580 3864 2992 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_18580 3964 5619 gene locus_tag LOCUS_18590 3964 5619 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_18590 5744 5553 gene locus_tag LOCUS_18600 5744 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6176 6748 gene locus_tag LOCUS_18610 6176 6748 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_18610 6954 7358 gene locus_tag LOCUS_18620 6954 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7383 7946 gene locus_tag LOCUS_18630 7383 7946 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_18630 7934 8236 gene locus_tag LOCUS_18640 7934 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8243 8911 gene locus_tag LOCUS_18650 8243 8911 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence133 1153 971 gene locus_tag LOCUS_18660 1153 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4228 1268 gene locus_tag LOCUS_18670 4228 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4953 4309 gene locus_tag LOCUS_18680 4953 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5613 4954 gene locus_tag LOCUS_18690 5613 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5903 5679 gene locus_tag LOCUS_18700 5903 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6795 6034 gene locus_tag LOCUS_18710 6795 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8767 6803 gene locus_tag LOCUS_18720 8767 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence134 438 827 gene locus_tag LOCUS_18730 438 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1149 820 gene locus_tag LOCUS_18740 1149 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1538 1191 gene locus_tag LOCUS_18750 1538 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2225 1560 gene locus_tag LOCUS_18760 2225 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3594 2236 gene locus_tag LOCUS_18770 3594 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5188 3620 gene locus_tag LOCUS_18780 5188 3620 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_18780 5967 5188 gene locus_tag LOCUS_18790 5967 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 6908 5964 gene locus_tag LOCUS_18800 6908 5964 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_18800 8495 7401 gene locus_tag LOCUS_18810 8495 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence135 224 730 gene locus_tag LOCUS_18820 gene recX 224 730 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908057.1 protein_id gnl|my_center|LOCUS_18820 727 1494 gene locus_tag LOCUS_18830 727 1494 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_18830 1931 2968 gene locus_tag LOCUS_18840 1931 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2980 3876 gene locus_tag LOCUS_18850 2980 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5434 4064 gene locus_tag LOCUS_18860 5434 4064 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 protein_id gnl|my_center|LOCUS_18860 7370 5424 gene locus_tag LOCUS_18870 7370 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 7824 8003 gene locus_tag LOCUS_18880 7824 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8066 8632 gene locus_tag LOCUS_18890 8066 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence136 417 2213 gene locus_tag LOCUS_18900 417 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2556 3839 gene locus_tag LOCUS_18910 gene dsrA 2556 3839 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_18910 3843 4940 gene locus_tag LOCUS_18920 gene dsrB 3843 4940 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_18920 4954 6771 gene locus_tag LOCUS_18930 4954 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7088 7807 gene locus_tag LOCUS_18940 gene dsrM 7088 7807 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence137 473 937 gene locus_tag LOCUS_18950 473 937 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880117.1 protein_id gnl|my_center|LOCUS_18950 952 2082 gene locus_tag LOCUS_18960 gene nusA 952 2082 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_18960 3041 2124 gene locus_tag LOCUS_18970 3041 2124 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_18970 3999 3760 gene locus_tag LOCUS_18980 3999 3760 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_18980 4899 4054 gene locus_tag LOCUS_18990 4899 4054 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_18990 5368 4931 gene locus_tag LOCUS_19000 5368 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940218.1 protein_id gnl|my_center|LOCUS_19000 6303 5365 gene locus_tag LOCUS_19010 6303 5365 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546489.1 protein_id gnl|my_center|LOCUS_19010 6788 6480 gene locus_tag LOCUS_19020 6788 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 8331 7069 gene locus_tag LOCUS_19030 gene rmuC 8331 7069 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_19030 8645 8857 gene locus_tag LOCUS_19040 8645 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence138 139 1149 gene locus_tag LOCUS_19050 139 1149 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_19050 1146 1979 gene locus_tag LOCUS_19060 1146 1979 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521524.1 protein_id gnl|my_center|LOCUS_19060 2717 2815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3258 5474 gene locus_tag LOCUS_19070 gene purL 3258 5474 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_19070 5494 5709 gene locus_tag LOCUS_19080 5494 5709 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_19080 6612 6220 gene locus_tag LOCUS_19090 6612 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 6803 6714 gene locus_tag LOCUS_t00230 6803 6714 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7873 6926 gene locus_tag LOCUS_19100 gene fmt 7873 6926 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_19100 8420 7878 gene locus_tag LOCUS_19110 gene def 8420 7878 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_19110 8634 8804 gene locus_tag LOCUS_19120 8634 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence139 481 1365 gene locus_tag LOCUS_19130 481 1365 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_19130 1403 2302 gene locus_tag LOCUS_19140 1403 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2678 2535 gene locus_tag LOCUS_19150 2678 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2821 4341 gene locus_tag LOCUS_19160 2821 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4525 4621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5767 4745 gene locus_tag LOCUS_19170 5767 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6439 6089 gene locus_tag LOCUS_19180 6439 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7236 6547 gene locus_tag LOCUS_19190 7236 6547 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881358.1 protein_id gnl|my_center|LOCUS_19190 7825 7253 gene locus_tag LOCUS_19200 7825 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 7959 8096 gene locus_tag LOCUS_19210 7959 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 <8841 8239 gene locus_tag LOCUS_19220 <8841 8239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_142085990.1:DEAD/DEAH box helicase >Feature sequence140 773 976 gene locus_tag LOCUS_19230 773 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 976 2046 gene locus_tag LOCUS_19240 976 2046 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_19240 2051 2947 gene locus_tag LOCUS_19250 2051 2947 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_19250 2928 4607 gene locus_tag LOCUS_19260 2928 4607 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_19260 5092 6081 gene locus_tag LOCUS_19270 5092 6081 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331126.1 protein_id gnl|my_center|LOCUS_19270 7064 6204 gene locus_tag LOCUS_19280 gene motA 7064 6204 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_19280 6999 7229 gene locus_tag LOCUS_19290 6999 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7523 7861 gene locus_tag LOCUS_19300 7523 7861 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_19300 8657 8298 gene locus_tag LOCUS_19310 gene spoIIAA 8657 8298 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence141 2559 1522 gene locus_tag LOCUS_19320 2559 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3937 2567 gene locus_tag LOCUS_19330 3937 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4646 3915 gene locus_tag LOCUS_19340 4646 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 5297 4665 gene locus_tag LOCUS_19350 5297 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 5819 5322 gene locus_tag LOCUS_19360 5819 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 7732 5930 gene locus_tag LOCUS_19370 7732 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8178 7756 gene locus_tag LOCUS_19380 8178 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence142 230 1000 gene locus_tag LOCUS_19390 230 1000 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_19390 1251 1559 gene locus_tag LOCUS_19400 gene rplU 1251 1559 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 protein_id gnl|my_center|LOCUS_19400 1585 1854 gene locus_tag LOCUS_19410 gene rpmA 1585 1854 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771977.1 protein_id gnl|my_center|LOCUS_19410 1925 2986 gene locus_tag LOCUS_19420 gene obgE 1925 2986 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_19420 3477 3154 gene locus_tag LOCUS_19430 3477 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 6725 3564 gene locus_tag LOCUS_19440 6725 3564 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_19440 7784 6729 gene locus_tag LOCUS_19450 7784 6729 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_19450 <8651 7774 gene locus_tag LOCUS_19460 <8651 7774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943302.1:efflux RND transporter permease subunit >Feature sequence143 419 1348 gene locus_tag LOCUS_19470 419 1348 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_19470 1367 1741 gene locus_tag LOCUS_19480 1367 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1751 2302 gene locus_tag LOCUS_19490 gene rsmD 1751 2302 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_19490 2720 3406 gene locus_tag LOCUS_19500 2720 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3424 3948 gene locus_tag LOCUS_19510 3424 3948 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_19510 4276 4085 gene locus_tag LOCUS_19520 4276 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4954 4568 gene locus_tag LOCUS_19530 4954 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7393 5213 gene locus_tag LOCUS_19540 7393 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 <8622 7503 gene locus_tag LOCUS_19550 <8622 7503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021984.1:chemotaxis protein CheB >Feature sequence144 567 2297 gene locus_tag LOCUS_19560 gene kdpA 567 2297 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550718.1 protein_id gnl|my_center|LOCUS_19560 2310 4379 gene locus_tag LOCUS_19570 gene kdpB 2310 4379 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_19570 4390 4983 gene locus_tag LOCUS_19580 gene kdpC 4390 4983 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186443.1 protein_id gnl|my_center|LOCUS_19580 4970 7687 gene locus_tag LOCUS_19590 4970 7687 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_19590 7689 8387 gene locus_tag LOCUS_19600 gene kdpE 7689 8387 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence145 16 294 gene locus_tag LOCUS_19610 16 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 346 1626 gene locus_tag LOCUS_19620 346 1626 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_19620 1626 2747 gene locus_tag LOCUS_19630 gene carA 1626 2747 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_19630 2744 3391 gene locus_tag LOCUS_19640 2744 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3488 3706 gene locus_tag LOCUS_19650 3488 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3718 4629 gene locus_tag LOCUS_19660 3718 4629 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_19660 4630 4905 gene locus_tag LOCUS_19670 4630 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5075 4890 gene locus_tag LOCUS_19680 5075 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5239 8463 gene locus_tag LOCUS_19690 gene carB 5239 8463 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence146 2785 2528 gene locus_tag LOCUS_19700 2785 2528 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 protein_id gnl|my_center|LOCUS_19700 3017 2739 gene locus_tag LOCUS_19710 3017 2739 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_19710 4534 3059 gene locus_tag LOCUS_19720 4534 3059 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_19720 5619 4639 gene locus_tag LOCUS_19730 5619 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6161 6337 gene locus_tag LOCUS_19740 6161 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6423 7733 gene locus_tag LOCUS_19750 gene pfp 6423 7733 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546508.1 protein_id gnl|my_center|LOCUS_19750 7761 7988 gene locus_tag LOCUS_19760 7761 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence147 1579 1271 gene locus_tag LOCUS_19770 1579 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2530 1592 gene locus_tag LOCUS_19780 gene rsmH 2530 1592 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_19780 3051 2623 gene locus_tag LOCUS_19790 gene mraZ 3051 2623 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_19790 3530 3454 gene locus_tag LOCUS_t00240 3530 3454 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5311 3572 gene locus_tag LOCUS_19800 gene rpoD 5311 3572 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_19800 7132 5360 gene locus_tag LOCUS_19810 gene dnaG 7132 5360 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_19810 7589 7143 gene locus_tag LOCUS_19820 7589 7143 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_19820 8146 7706 gene locus_tag LOCUS_19830 8146 7706 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391058.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence148 647 917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2258 1368 gene locus_tag LOCUS_19840 2258 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2856 2218 gene locus_tag LOCUS_19850 2856 2218 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_19850 6302 2856 gene locus_tag LOCUS_19860 6302 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3442 3451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4485 4667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6867 6526 gene locus_tag LOCUS_19870 gene rplS 6867 6526 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_19870 7471 6884 gene locus_tag LOCUS_19880 7471 6884 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_19880 8210 7452 gene locus_tag LOCUS_19890 gene trmD 8210 7452 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence149 472 2460 gene locus_tag LOCUS_19900 472 2460 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_19900 4440 2608 gene locus_tag LOCUS_19910 4440 2608 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_19910 5648 4443 gene locus_tag LOCUS_19920 5648 4443 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_19920 6243 7025 gene locus_tag LOCUS_19930 6243 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7042 7779 gene locus_tag LOCUS_19940 7042 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941606.1 protein_id gnl|my_center|LOCUS_19940 7820 8269 gene locus_tag LOCUS_19950 gene rnhA 7820 8269 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence150 <1 552 gene locus_tag LOCUS_19960 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein 549 2045 gene locus_tag LOCUS_19970 549 2045 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_19970 2048 3436 gene locus_tag LOCUS_19980 2048 3436 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_19980 3440 4525 gene locus_tag LOCUS_19990 gene mraY 3440 4525 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_19990 4522 5895 gene locus_tag LOCUS_20000 gene murD 4522 5895 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_20000 5886 7007 gene locus_tag LOCUS_20010 gene ftsW 5886 7007 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_20010 7004 8080 gene locus_tag LOCUS_20020 gene murG 7004 8080 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence151 789 505 gene locus_tag LOCUS_20030 789 505 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 protein_id gnl|my_center|LOCUS_20030 1036 779 gene locus_tag LOCUS_20040 1036 779 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939316.1 protein_id gnl|my_center|LOCUS_20040 1176 2129 gene locus_tag LOCUS_20050 1176 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1980 2072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2289 2537 gene locus_tag LOCUS_20060 2289 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5490 2869 gene locus_tag LOCUS_20070 5490 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5634 6524 gene locus_tag LOCUS_20080 gene prmC 5634 6524 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_20080 6788 8056 gene locus_tag LOCUS_20090 gene murA 6788 8056 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence152 1887 685 gene locus_tag LOCUS_20100 1887 685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_20100 3077 1884 gene locus_tag LOCUS_20110 3077 1884 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868787.1 protein_id gnl|my_center|LOCUS_20110 3682 3074 gene locus_tag LOCUS_20120 gene slmA 3682 3074 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_20120 4158 3733 gene locus_tag LOCUS_20130 4158 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5427 4510 gene locus_tag LOCUS_20140 5427 4510 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_20140 5644 6078 gene locus_tag LOCUS_20150 gene aprB 5644 6078 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_20150 6099 8021 gene locus_tag LOCUS_20160 gene aprA 6099 8021 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence153 177 851 gene locus_tag LOCUS_20170 177 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1124 1930 gene locus_tag LOCUS_20180 1124 1930 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_20180 3168 1999 gene locus_tag LOCUS_20190 gene larC 3168 1999 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_20190 3941 3165 gene locus_tag LOCUS_20200 gene larB 3941 3165 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_20200 4970 3954 gene locus_tag LOCUS_20210 4970 3954 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545485.1 protein_id gnl|my_center|LOCUS_20210 5250 6134 gene locus_tag LOCUS_20220 5250 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6445 6206 gene locus_tag LOCUS_20230 6445 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6651 7673 gene locus_tag LOCUS_20240 gene dnaN 6651 7673 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_20240 7684 8094 gene locus_tag LOCUS_20250 7684 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence154 345 97 gene locus_tag LOCUS_20260 345 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 613 314 gene locus_tag LOCUS_20270 613 314 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_20270 1070 816 gene locus_tag LOCUS_20280 1070 816 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_20280 1272 1078 gene locus_tag LOCUS_20290 1272 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1427 2368 gene locus_tag LOCUS_20300 1427 2368 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_20300 2438 2938 gene locus_tag LOCUS_20310 gene tpx 2438 2938 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_20310 3986 3309 gene locus_tag LOCUS_20320 3986 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4084 4725 gene locus_tag LOCUS_20330 4084 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6570 5011 gene locus_tag LOCUS_20340 6570 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_20340 7253 6567 gene locus_tag LOCUS_20350 gene bshB1 7253 6567 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_20350 8041 7205 gene locus_tag LOCUS_20360 8041 7205 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence155 <1 1521 gene locus_tag LOCUS_20370 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000284473.1:threonine--tRNA ligase 1593 2090 gene locus_tag LOCUS_20380 1593 2090 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_20380 2373 4148 gene locus_tag LOCUS_20390 gene aspS 2373 4148 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_20390 4145 5557 gene locus_tag LOCUS_20400 gene gltX 4145 5557 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_20400 5554 6273 gene locus_tag LOCUS_20410 gene thyX 5554 6273 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_20410 7317 6316 gene locus_tag LOCUS_20420 7317 6316 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_20420 <8176 7314 gene locus_tag LOCUS_20430 <8176 7314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878561.1:ATP-grasp domain-containing protein >Feature sequence156 686 201 gene locus_tag LOCUS_20440 686 201 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_20440 1120 854 gene locus_tag LOCUS_20450 1120 854 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_20450 1316 1104 gene locus_tag LOCUS_20460 1316 1104 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_20460 3231 1438 gene locus_tag LOCUS_20470 3231 1438 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_20470 3589 4440 gene locus_tag LOCUS_20480 gene mtnP 3589 4440 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_20480 4457 5734 gene locus_tag LOCUS_20490 gene hemL 4457 5734 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_20490 7905 5818 gene locus_tag LOCUS_20500 7905 5818 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence157 52 1497 gene locus_tag LOCUS_20510 52 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1672 1769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1783 2166 gene locus_tag LOCUS_20520 1783 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3509 2160 gene locus_tag LOCUS_20530 gene tilS 3509 2160 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_20530 3965 3534 gene locus_tag LOCUS_20540 3965 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3968 4066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5139 5570 gene locus_tag LOCUS_20550 5139 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5580 8078 gene locus_tag LOCUS_20560 gene lon 5580 8078 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence158 226 726 gene locus_tag LOCUS_20570 226 726 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459789.1 protein_id gnl|my_center|LOCUS_20570 872 1117 gene locus_tag LOCUS_20580 872 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1114 1539 gene locus_tag LOCUS_20590 1114 1539 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_20590 1602 1850 gene locus_tag LOCUS_20600 1602 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1834 2163 gene locus_tag LOCUS_20610 1834 2163 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097626.1 protein_id gnl|my_center|LOCUS_20610 2375 3199 gene locus_tag LOCUS_20620 gene kdsA 2375 3199 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_20620 3760 3221 gene locus_tag LOCUS_20630 3760 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5509 3851 gene locus_tag LOCUS_20640 5509 3851 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084348.1 protein_id gnl|my_center|LOCUS_20640 5968 5705 gene locus_tag LOCUS_20650 5968 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6300 7373 gene locus_tag LOCUS_20660 gene leuB 6300 7373 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence159 56 1507 gene locus_tag LOCUS_20670 56 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2234 1830 gene locus_tag LOCUS_20680 2234 1830 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947010.1 protein_id gnl|my_center|LOCUS_20680 2388 2315 gene locus_tag LOCUS_t00250 2388 2315 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4187 2415 gene locus_tag LOCUS_20690 4187 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5315 4305 gene locus_tag LOCUS_20700 5315 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6776 5895 gene locus_tag LOCUS_20710 6776 5895 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_20710 7632 6976 gene locus_tag LOCUS_20720 gene hisG 7632 6976 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_20720 7754 7846 gene locus_tag LOCUS_t00260 7754 7846 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 347 1207 gene locus_tag LOCUS_20730 347 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1222 2109 gene locus_tag LOCUS_20740 1222 2109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_20740 2138 2830 gene locus_tag LOCUS_20750 2138 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2832 3173 gene locus_tag LOCUS_20760 2832 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4455 3229 gene locus_tag LOCUS_20770 4455 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6032 4677 gene locus_tag LOCUS_20780 gene zraR 6032 4677 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_20780 7597 6029 gene locus_tag LOCUS_20790 7597 6029 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence161 53 256 gene locus_tag LOCUS_20800 53 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 463 666 gene locus_tag LOCUS_20810 463 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2771 705 gene locus_tag LOCUS_20820 2771 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3831 2986 gene locus_tag LOCUS_20830 3831 2986 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541595.1 protein_id gnl|my_center|LOCUS_20830 5023 3833 gene locus_tag LOCUS_20840 5023 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 6253 5180 gene locus_tag LOCUS_20850 6253 5180 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158653702.1 protein_id gnl|my_center|LOCUS_20850 7398 6271 gene locus_tag LOCUS_20860 7398 6271 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence162 602 1744 gene locus_tag LOCUS_20870 602 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2641 1751 gene locus_tag LOCUS_20880 2641 1751 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_20880 3190 2687 gene locus_tag LOCUS_20890 gene purE 3190 2687 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_20890 4582 3191 gene locus_tag LOCUS_20900 4582 3191 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_20900 6245 5151 gene locus_tag LOCUS_20910 6245 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6860 6480 gene locus_tag LOCUS_20920 6860 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 7260 7760 gene locus_tag LOCUS_20930 7260 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence163 3519 1864 gene locus_tag LOCUS_20940 3519 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5025 3772 gene locus_tag LOCUS_20950 5025 3772 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_20950 5820 5047 gene locus_tag LOCUS_20960 5820 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 7388 5835 gene locus_tag LOCUS_20970 7388 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence164 516 316 gene locus_tag LOCUS_20980 516 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 714 2282 gene locus_tag LOCUS_20990 gene rny 714 2282 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_20990 2301 3083 gene locus_tag LOCUS_21000 2301 3083 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_21000 3139 6384 gene locus_tag LOCUS_21010 3139 6384 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_21010 6819 6475 gene locus_tag LOCUS_21020 6819 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7045 7632 gene locus_tag LOCUS_21030 7045 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence165 304 1311 gene locus_tag LOCUS_21040 gene moaA 304 1311 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_21040 1344 1595 gene locus_tag LOCUS_21050 1344 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1597 2013 gene locus_tag LOCUS_21060 1597 2013 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_21060 2038 2637 gene locus_tag LOCUS_21070 2038 2637 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_21070 2967 3197 gene locus_tag LOCUS_21080 2967 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3199 3570 gene locus_tag LOCUS_21090 3199 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3841 6510 gene locus_tag LOCUS_21100 3841 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6527 7378 gene locus_tag LOCUS_21110 6527 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence166 229 1971 gene locus_tag LOCUS_21120 229 1971 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_21120 1968 2840 gene locus_tag LOCUS_21130 1968 2840 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_21130 3367 4947 gene locus_tag LOCUS_21140 3367 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4916 5119 gene locus_tag LOCUS_21150 4916 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 6619 5213 gene locus_tag LOCUS_21160 6619 5213 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943217.1 protein_id gnl|my_center|LOCUS_21160 7545 7111 gene locus_tag LOCUS_21170 7545 7111 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence167 1384 350 gene locus_tag LOCUS_21180 1384 350 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_21180 4641 1384 gene locus_tag LOCUS_21190 4641 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21190 5106 4654 gene locus_tag LOCUS_21200 5106 4654 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_21200 6871 5096 gene locus_tag LOCUS_21210 6871 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence168 1262 216 gene locus_tag LOCUS_21220 gene thiL 1262 216 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_21220 1491 1309 gene locus_tag LOCUS_21230 1491 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2153 1575 gene locus_tag LOCUS_21240 2153 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_21240 2375 2160 gene locus_tag LOCUS_21250 2375 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2564 2827 gene locus_tag LOCUS_21260 2564 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2776 3144 gene locus_tag LOCUS_21270 2776 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 3696 3157 gene locus_tag LOCUS_21280 3696 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 3827 4117 gene locus_tag LOCUS_21290 3827 4117 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_21290 4246 4872 gene locus_tag LOCUS_21300 4246 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 5475 5813 gene locus_tag LOCUS_21310 5475 5813 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_21310 5906 7318 gene locus_tag LOCUS_21320 gene glnA 5906 7318 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence169 422 1573 gene locus_tag LOCUS_21330 422 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 1833 3251 gene locus_tag LOCUS_21340 1833 3251 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_21340 3412 4539 gene locus_tag LOCUS_21350 3412 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4549 5028 gene locus_tag LOCUS_21360 4549 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5368 7011 gene locus_tag LOCUS_21370 5368 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence170 2099 690 gene locus_tag LOCUS_21380 2099 690 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_21380 2953 2102 gene locus_tag LOCUS_21390 2953 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3013 3112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3211 3435 gene locus_tag LOCUS_21400 3211 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3942 3691 gene locus_tag LOCUS_21410 3942 3691 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_21410 5240 4002 gene locus_tag LOCUS_21420 5240 4002 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_21420 5622 5377 gene locus_tag LOCUS_21430 5622 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6039 5824 gene locus_tag LOCUS_21440 6039 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7187 6195 gene locus_tag LOCUS_21450 7187 6195 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence171 579 740 gene locus_tag LOCUS_21460 579 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 762 1184 gene locus_tag LOCUS_21470 762 1184 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_21470 1649 1185 gene locus_tag LOCUS_21480 1649 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2155 1682 gene locus_tag LOCUS_21490 gene greA 2155 1682 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_21490 2318 2662 gene locus_tag LOCUS_21500 2318 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3015 2656 gene locus_tag LOCUS_21510 3015 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 3020 3117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5615 3561 gene locus_tag LOCUS_21520 gene ligA 5615 3561 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_21520 5875 5639 gene locus_tag LOCUS_21530 5875 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6163 7302 gene locus_tag LOCUS_21540 6163 7302 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence172 954 322 gene locus_tag LOCUS_21550 954 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1394 951 gene locus_tag LOCUS_21560 1394 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2720 1404 gene locus_tag LOCUS_21570 2720 1404 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_21570 3520 2726 gene locus_tag LOCUS_21580 3520 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4535 3513 gene locus_tag LOCUS_21590 gene fliG 4535 3513 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_21590 6163 4571 gene locus_tag LOCUS_21600 gene fliF 6163 4571 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_21600 6632 6201 gene locus_tag LOCUS_21610 gene flgC 6632 6201 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_21610 7055 6645 gene locus_tag LOCUS_21620 gene flgB 7055 6645 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence173 74 403 gene locus_tag LOCUS_21630 74 403 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_21630 387 800 gene locus_tag LOCUS_21640 387 800 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_21640 838 1563 gene locus_tag LOCUS_21650 gene ubiE 838 1563 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_21650 1580 4207 gene locus_tag LOCUS_21660 gene glnD 1580 4207 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_21660 4213 5607 gene locus_tag LOCUS_21670 4213 5607 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_21670 6263 5631 gene locus_tag LOCUS_21680 6263 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence174 <1 773 gene locus_tag LOCUS_21690 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083774559.1:bacteriohemerythrin 946 872 gene locus_tag LOCUS_t00270 946 872 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1451 1029 gene locus_tag LOCUS_21700 1451 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1961 1563 gene locus_tag LOCUS_21710 1961 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2871 2116 gene locus_tag LOCUS_21720 2871 2116 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_21720 3847 3296 gene locus_tag LOCUS_21730 gene folE 3847 3296 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_21730 4204 3914 gene locus_tag LOCUS_21740 gene ihfA 4204 3914 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419121.1 protein_id gnl|my_center|LOCUS_21740 4951 4367 gene locus_tag LOCUS_21750 4951 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5186 5659 gene locus_tag LOCUS_21760 gene ispF 5186 5659 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_21760 5656 7095 gene locus_tag LOCUS_21770 gene gltX 5656 7095 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence175 <1 2025 gene locus_tag LOCUS_21780 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210266672.1:DEAD/DEAH box helicase note possible pseudo, frameshifted 2076 2357 gene locus_tag LOCUS_21790 2076 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21790 2938 2540 gene locus_tag LOCUS_21800 2938 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3239 3054 gene locus_tag LOCUS_21810 3239 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5902 3536 gene locus_tag LOCUS_21820 5902 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6456 6253 gene locus_tag LOCUS_21830 6456 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 7140 6580 gene locus_tag LOCUS_21840 7140 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence176 118 348 gene locus_tag LOCUS_21850 118 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 587 243 gene locus_tag LOCUS_21860 587 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 627 1835 gene locus_tag LOCUS_21870 gene amrB 627 1835 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_21870 1903 2658 gene locus_tag LOCUS_21880 1903 2658 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938201.1 protein_id gnl|my_center|LOCUS_21880 3083 2697 gene locus_tag LOCUS_21890 gene cheY 3083 2697 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_21890 3440 3222 gene locus_tag LOCUS_21900 3440 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3528 6200 gene locus_tag LOCUS_21910 gene polA 3528 6200 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_21910 6332 6207 gene locus_tag LOCUS_21920 6332 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 6499 6377 gene locus_tag LOCUS_21930 6499 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence177 1140 955 gene locus_tag LOCUS_21940 1140 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1686 1360 gene locus_tag LOCUS_21950 1686 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2287 1883 gene locus_tag LOCUS_21960 2287 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2616 2284 gene locus_tag LOCUS_21970 2616 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2847 3080 gene locus_tag LOCUS_21980 2847 3080 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_21980 3084 3506 gene locus_tag LOCUS_21990 3084 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3490 4152 gene locus_tag LOCUS_22000 gene atpB 3490 4152 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_22000 4207 4575 gene locus_tag LOCUS_22010 4207 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5030 5236 gene locus_tag LOCUS_22020 5030 5236 CDS product TraY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390943.1 protein_id gnl|my_center|LOCUS_22020 6452 5301 gene locus_tag LOCUS_22030 6452 5301 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_22030 6797 6468 gene locus_tag LOCUS_22040 6797 6468 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence178 1365 1943 gene locus_tag LOCUS_22050 1365 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2000 2809 gene locus_tag LOCUS_22060 2000 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2809 3609 gene locus_tag LOCUS_22070 2809 3609 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_22070 4179 3985 gene locus_tag LOCUS_22080 4179 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4489 4334 gene locus_tag LOCUS_22090 4489 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 5876 4755 gene locus_tag LOCUS_22100 5876 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 6197 6775 gene locus_tag LOCUS_22110 6197 6775 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768434.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence179 822 109 gene locus_tag LOCUS_22120 822 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1780 1013 gene locus_tag LOCUS_22130 gene fabI 1780 1013 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 protein_id gnl|my_center|LOCUS_22130 2369 1812 gene locus_tag LOCUS_22140 2369 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2826 2488 gene locus_tag LOCUS_22150 2826 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3086 2841 gene locus_tag LOCUS_22160 3086 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3200 3397 gene locus_tag LOCUS_22170 3200 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 4585 3740 gene locus_tag LOCUS_22180 4585 3740 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_22180 5386 4592 gene locus_tag LOCUS_22190 5386 4592 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_22190 6471 5386 gene locus_tag LOCUS_22200 gene mnmA 6471 5386 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence180 796 218 gene locus_tag LOCUS_22210 796 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2309 819 gene locus_tag LOCUS_22220 2309 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3196 2294 gene locus_tag LOCUS_22230 gene sppA 3196 2294 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_22230 5059 3248 gene locus_tag LOCUS_22240 5059 3248 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_22240 5841 5086 gene locus_tag LOCUS_22250 gene cmk 5841 5086 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_22250 6688 5822 gene locus_tag LOCUS_22260 6688 5822 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence181 1036 428 gene locus_tag LOCUS_22270 1036 428 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_22270 1900 1319 gene locus_tag LOCUS_22280 1900 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2472 1897 gene locus_tag LOCUS_22290 2472 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3695 2997 gene locus_tag LOCUS_22300 3695 2997 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065627.1 protein_id gnl|my_center|LOCUS_22300 4149 3697 gene locus_tag LOCUS_22310 4149 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4457 6559 gene locus_tag LOCUS_22320 4457 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence182 187 1170 gene locus_tag LOCUS_22330 187 1170 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_22330 1171 1950 gene locus_tag LOCUS_22340 1171 1950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 protein_id gnl|my_center|LOCUS_22340 1955 3325 gene locus_tag LOCUS_22350 1955 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3325 5115 gene locus_tag LOCUS_22360 3325 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5119 5691 gene locus_tag LOCUS_22370 5119 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence183 183 2267 gene locus_tag LOCUS_22380 183 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2635 4899 gene locus_tag LOCUS_22390 2635 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4781 4880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4896 6071 gene locus_tag LOCUS_22400 4896 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 6068 6718 gene locus_tag LOCUS_22410 6068 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence184 390 1655 gene locus_tag LOCUS_22420 390 1655 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_22420 2134 2400 gene locus_tag LOCUS_22430 2134 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2451 4547 gene locus_tag LOCUS_22440 2451 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4544 5032 gene locus_tag LOCUS_22450 4544 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5045 5380 gene locus_tag LOCUS_22460 5045 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5377 5568 gene locus_tag LOCUS_22470 5377 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5570 5965 gene locus_tag LOCUS_22480 5570 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5952 6455 gene locus_tag LOCUS_22490 5952 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence185 1264 470 gene locus_tag LOCUS_22500 1264 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2304 1261 gene locus_tag LOCUS_22510 2304 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3247 2543 gene locus_tag LOCUS_22520 3247 2543 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808326.1 protein_id gnl|my_center|LOCUS_22520 4237 3266 gene locus_tag LOCUS_22530 4237 3266 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence186 588 2126 gene locus_tag LOCUS_22540 588 2126 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_22540 2101 2793 gene locus_tag LOCUS_22550 2101 2793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_22550 2790 3551 gene locus_tag LOCUS_22560 2790 3551 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_22560 3564 4301 gene locus_tag LOCUS_22570 3564 4301 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084858.1 protein_id gnl|my_center|LOCUS_22570 4311 5288 gene locus_tag LOCUS_22580 4311 5288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661932.1 protein_id gnl|my_center|LOCUS_22580 5300 6037 gene locus_tag LOCUS_22590 5300 6037 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence187 1409 276 gene locus_tag LOCUS_22600 1409 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2944 1427 gene locus_tag LOCUS_22610 2944 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3521 3748 gene locus_tag LOCUS_22620 3521 3748 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_22620 3750 4850 gene locus_tag LOCUS_22630 3750 4850 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 protein_id gnl|my_center|LOCUS_22630 4875 4973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <6665 5378 gene locus_tag LOCUS_22640 <6665 5378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence188 993 496 gene locus_tag LOCUS_22650 993 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1939 1178 gene locus_tag LOCUS_22660 1939 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1977 2492 gene locus_tag LOCUS_22670 1977 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3228 2767 gene locus_tag LOCUS_22680 3228 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3962 4420 gene locus_tag LOCUS_22690 3962 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4417 4905 gene locus_tag LOCUS_22700 4417 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4937 5392 gene locus_tag LOCUS_22710 gene soxY 4937 5392 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_22710 5418 5747 gene locus_tag LOCUS_22720 gene soxZ 5418 5747 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_22720 5761 6534 gene locus_tag LOCUS_22730 gene soxA 5761 6534 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881176.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence189 195 386 gene locus_tag LOCUS_22740 195 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 376 882 gene locus_tag LOCUS_22750 376 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1148 969 gene locus_tag LOCUS_22760 1148 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1403 2443 gene locus_tag LOCUS_22770 gene recA 1403 2443 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_22770 2624 4177 gene locus_tag LOCUS_22780 2624 4177 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_22780 4212 5600 gene locus_tag LOCUS_22790 4212 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 5177 5274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5607 6518 gene locus_tag LOCUS_22800 5607 6518 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence190 506 868 gene locus_tag LOCUS_22810 506 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1342 2499 gene locus_tag LOCUS_22820 1342 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2477 3085 gene locus_tag LOCUS_22830 2477 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3323 3511 gene locus_tag LOCUS_22840 gene rpsU 3323 3511 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941574.1 protein_id gnl|my_center|LOCUS_22840 3528 4730 gene locus_tag LOCUS_22850 3528 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5109 5477 gene locus_tag LOCUS_22860 5109 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5487 6080 gene locus_tag LOCUS_22870 5487 6080 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523925.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence191 174 1526 gene locus_tag LOCUS_22880 174 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1701 2822 gene locus_tag LOCUS_22890 1701 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2909 3670 gene locus_tag LOCUS_22900 2909 3670 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763472.1 protein_id gnl|my_center|LOCUS_22900 3909 4006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4079 5023 gene locus_tag LOCUS_22910 4079 5023 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266284.1 protein_id gnl|my_center|LOCUS_22910 5162 5452 gene locus_tag LOCUS_22920 5162 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940657.1 protein_id gnl|my_center|LOCUS_22920 5532 5729 gene locus_tag LOCUS_22930 5532 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5758 6087 gene locus_tag LOCUS_22940 5758 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence192 684 1478 gene locus_tag LOCUS_22950 684 1478 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_22950 1468 2328 gene locus_tag LOCUS_22960 1468 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2312 3070 gene locus_tag LOCUS_22970 2312 3070 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544927.1 protein_id gnl|my_center|LOCUS_22970 3076 4140 gene locus_tag LOCUS_22980 3076 4140 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_22980 4109 4642 gene locus_tag LOCUS_22990 4109 4642 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_22990 5014 5571 gene locus_tag LOCUS_23000 5014 5571 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545293.1 protein_id gnl|my_center|LOCUS_23000 5568 6464 gene locus_tag LOCUS_23010 5568 6464 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence193 665 180 gene locus_tag LOCUS_23020 665 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 837 667 gene locus_tag LOCUS_23030 837 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1651 965 gene locus_tag LOCUS_23040 1651 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2597 1728 gene locus_tag LOCUS_23050 gene galU 2597 1728 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_23050 <6485 2768 gene locus_tag LOCUS_23060 <6485 2768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein >Feature sequence194 <1 1048 gene locus_tag LOCUS_23070 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104308.1:molybdenum ABC transporter ATP-binding protein 2455 1064 gene locus_tag LOCUS_23080 2455 1064 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_23080 4349 2511 gene locus_tag LOCUS_23090 4349 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5263 4346 gene locus_tag LOCUS_23100 gene phnD 5263 4346 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence195 318 896 gene locus_tag LOCUS_23110 318 896 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_23110 2299 1109 gene locus_tag LOCUS_23120 2299 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3285 2296 gene locus_tag LOCUS_23130 3285 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 5051 3282 gene locus_tag LOCUS_23140 gene msbA 5051 3282 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_23140 6097 5051 gene locus_tag LOCUS_23150 6097 5051 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence196 2084 1362 gene locus_tag LOCUS_23160 2084 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3561 2173 gene locus_tag LOCUS_23170 3561 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4508 3558 gene locus_tag LOCUS_23180 4508 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence197 720 43 gene locus_tag LOCUS_23190 720 43 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_23190 918 1322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3525 2050 gene locus_tag LOCUS_23200 3525 2050 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_23200 4514 3540 gene locus_tag LOCUS_23210 4514 3540 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_23210 5357 4530 gene locus_tag LOCUS_23220 5357 4530 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_23220 6021 5581 gene locus_tag LOCUS_23230 6021 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence198 159 866 gene locus_tag LOCUS_23240 159 866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_23240 929 2065 gene locus_tag LOCUS_23250 929 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3120 2215 gene locus_tag LOCUS_23260 3120 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3496 4368 gene locus_tag LOCUS_23270 3496 4368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_23270 4621 4512 gene locus_tag LOCUS_r00010 4621 4512 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence199 457 89 gene locus_tag LOCUS_23280 457 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 752 576 gene locus_tag LOCUS_23290 752 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 947 1600 gene locus_tag LOCUS_23300 gene tmk 947 1600 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_23300 1604 2608 gene locus_tag LOCUS_23310 gene holB 1604 2608 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_23310 2798 3958 gene locus_tag LOCUS_23320 2798 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3975 4418 gene locus_tag LOCUS_23330 3975 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 4470 4967 gene locus_tag LOCUS_23340 4470 4967 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_23340 4983 5462 gene locus_tag LOCUS_23350 4983 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence200 1384 350 gene locus_tag LOCUS_23360 1384 350 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_23360 5182 1406 gene locus_tag LOCUS_23370 5182 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23370 >Feature sequence201 1504 227 gene locus_tag LOCUS_23380 gene ahcY 1504 227 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_23380 2695 1523 gene locus_tag LOCUS_23390 gene metK 2695 1523 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23390 2976 3074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3283 4257 gene locus_tag LOCUS_23400 gene hemB 3283 4257 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_23400 4448 4762 gene locus_tag LOCUS_23410 4448 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23410 5093 5620 gene locus_tag LOCUS_23420 5093 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence202 236 571 gene locus_tag LOCUS_23430 236 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 635 1597 gene locus_tag LOCUS_23440 635 1597 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_23440 1594 1878 gene locus_tag LOCUS_23450 1594 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1894 2133 gene locus_tag LOCUS_23460 1894 2133 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423249.1 protein_id gnl|my_center|LOCUS_23460 2138 2632 gene locus_tag LOCUS_23470 2138 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2629 3087 gene locus_tag LOCUS_23480 gene iscR 2629 3087 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 protein_id gnl|my_center|LOCUS_23480 5408 3222 gene locus_tag LOCUS_23490 5408 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence203 308 2173 gene locus_tag LOCUS_23500 gene mnmG 308 2173 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_23500 2154 2774 gene locus_tag LOCUS_23510 gene rsmG 2154 2774 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_23510 3194 4075 gene locus_tag LOCUS_23520 3194 4075 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_23520 4103 4933 gene locus_tag LOCUS_23530 4103 4933 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_23530 5065 5496 gene locus_tag LOCUS_23540 5065 5496 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence204 <1 2081 gene locus_tag LOCUS_23550 <1 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G 2103 3014 gene locus_tag LOCUS_23560 2103 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3026 3403 gene locus_tag LOCUS_23570 3026 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4695 3484 gene locus_tag LOCUS_23580 4695 3484 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_23580 5515 5075 gene locus_tag LOCUS_23590 5515 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence205 138 1181 gene locus_tag LOCUS_23600 gene pseG 138 1181 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_23600 1378 1668 gene locus_tag LOCUS_23610 1378 1668 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_23610 4508 1824 gene locus_tag LOCUS_23620 4508 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 5343 4666 gene locus_tag LOCUS_23630 gene rsmI 5343 4666 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588618.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence206 2717 102 gene locus_tag LOCUS_23640 2717 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3511 2708 gene locus_tag LOCUS_23650 3511 2708 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_23650 4301 3504 gene locus_tag LOCUS_23660 4301 3504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_23660 4765 4298 gene locus_tag LOCUS_23670 4765 4298 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_23670 5089 4862 gene locus_tag LOCUS_23680 5089 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5310 5624 gene locus_tag LOCUS_23690 5310 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence207 1846 278 gene locus_tag LOCUS_23700 1846 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3051 1852 gene locus_tag LOCUS_23710 3051 1852 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_23710 3696 3076 gene locus_tag LOCUS_23720 3696 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3912 5309 gene locus_tag LOCUS_23730 gene atoC 3912 5309 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence208 2113 212 gene locus_tag LOCUS_23740 2113 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3216 2104 gene locus_tag LOCUS_23750 gene ald 3216 2104 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_23750 4188 3253 gene locus_tag LOCUS_23760 4188 3253 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_23760 5372 4305 gene locus_tag LOCUS_23770 gene corA 5372 4305 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence209 2147 1929 gene locus_tag LOCUS_23780 2147 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 3214 2354 gene locus_tag LOCUS_23790 3214 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3704 3312 gene locus_tag LOCUS_23800 3704 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4021 3701 gene locus_tag LOCUS_23810 4021 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5202 4018 gene locus_tag LOCUS_23820 5202 4018 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence210 931 83 gene locus_tag LOCUS_23830 gene larE 931 83 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_23830 3336 928 gene locus_tag LOCUS_23840 3336 928 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_23840 4094 3333 gene locus_tag LOCUS_23850 4094 3333 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_23850 5302 4094 gene locus_tag LOCUS_23860 gene coaBC 5302 4094 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence211 256 32 gene locus_tag LOCUS_23870 256 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1247 309 gene locus_tag LOCUS_23880 1247 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1582 2310 gene locus_tag LOCUS_23890 1582 2310 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373626.1 protein_id gnl|my_center|LOCUS_23890 4052 2364 gene locus_tag LOCUS_23900 4052 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 <5511 4058 gene locus_tag LOCUS_23910 <5511 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048068.1:MBOAT family protein >Feature sequence212 <1 1450 gene locus_tag LOCUS_23920 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926968.1:ATP-binding protein 1479 2348 gene locus_tag LOCUS_23930 gene lipA 1479 2348 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_23930 2436 2636 gene locus_tag LOCUS_23940 2436 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3098 3487 gene locus_tag LOCUS_23950 3098 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3731 5335 gene locus_tag LOCUS_23960 3731 5335 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence213 2278 221 gene locus_tag LOCUS_23970 gene metG 2278 221 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262543.1 protein_id gnl|my_center|LOCUS_23970 2460 3632 gene locus_tag LOCUS_23980 2460 3632 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_23980 3655 4110 gene locus_tag LOCUS_23990 3655 4110 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_23990 4117 4818 gene locus_tag LOCUS_24000 4117 4818 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_24000 4833 5321 gene locus_tag LOCUS_24010 4833 5321 CDS product cytochrome b subunit of the bc complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942627.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence214 285 1127 gene locus_tag LOCUS_24020 285 1127 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143353.1 protein_id gnl|my_center|LOCUS_24020 1124 2194 gene locus_tag LOCUS_24030 1124 2194 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143352.1 protein_id gnl|my_center|LOCUS_24030 2234 2455 gene locus_tag LOCUS_24040 2234 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2482 4188 gene locus_tag LOCUS_24050 2482 4188 CDS product electron-transfer flavoprotein:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143351.1 protein_id gnl|my_center|LOCUS_24050 4371 5183 gene locus_tag LOCUS_24060 4371 5183 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082107.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence215 500 291 gene locus_tag LOCUS_24070 500 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1875 601 gene locus_tag LOCUS_24080 1875 601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_24080 2294 1962 gene locus_tag LOCUS_24090 2294 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2791 2312 gene locus_tag LOCUS_24100 2791 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4682 3153 gene locus_tag LOCUS_24110 4682 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence216 1959 70 gene locus_tag LOCUS_24120 1959 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2817 2113 gene locus_tag LOCUS_24130 2817 2113 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878216.1 protein_id gnl|my_center|LOCUS_24130 3497 2994 gene locus_tag LOCUS_24140 3497 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5060 3780 gene locus_tag LOCUS_24150 5060 3780 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941878.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence217 891 70 gene locus_tag LOCUS_24160 891 70 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_24160 2321 1224 gene locus_tag LOCUS_24170 2321 1224 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647785.1 protein_id gnl|my_center|LOCUS_24170 3455 2886 gene locus_tag LOCUS_24180 gene efp 3455 2886 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence218 1183 161 gene locus_tag LOCUS_24190 1183 161 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_24190 1369 1202 gene locus_tag LOCUS_24200 1369 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2112 1381 gene locus_tag LOCUS_24210 gene sreB 2112 1381 CDS product sulfur reductase subunit SreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880781.1 protein_id gnl|my_center|LOCUS_24210 4084 2117 gene locus_tag LOCUS_24220 4084 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24220 4131 4400 gene locus_tag LOCUS_24230 4131 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4557 4985 gene locus_tag LOCUS_24240 4557 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence219 140 1132 gene locus_tag LOCUS_24250 140 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1224 2060 gene locus_tag LOCUS_24260 1224 2060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_24260 2222 3502 gene locus_tag LOCUS_24270 2222 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5040 3703 gene locus_tag LOCUS_24280 5040 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence220 <1 750 gene locus_tag LOCUS_24290 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089681.1:nickel-dependent hydrogenase large subunit 775 3501 gene locus_tag LOCUS_24300 775 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3562 3939 gene locus_tag LOCUS_24310 3562 3939 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_24310 4006 5079 gene locus_tag LOCUS_24320 4006 5079 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence221 275 1150 gene locus_tag LOCUS_24330 gene fabD 275 1150 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_24330 1151 1897 gene locus_tag LOCUS_24340 gene fabG 1151 1897 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_24340 1994 2245 gene locus_tag LOCUS_24350 gene acpP 1994 2245 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_24350 2323 3567 gene locus_tag LOCUS_24360 gene fabF 2323 3567 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_24360 3604 4377 gene locus_tag LOCUS_24370 gene rncS 3604 4377 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_24370 4377 5021 gene locus_tag LOCUS_24380 gene queE 4377 5021 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence222 458 1459 gene locus_tag LOCUS_24390 458 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1473 3440 gene locus_tag LOCUS_24400 gene asnB 1473 3440 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_24400 3437 4705 gene locus_tag LOCUS_24410 3437 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence223 164 700 gene locus_tag LOCUS_24420 gene atpH 164 700 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_24420 729 2237 gene locus_tag LOCUS_24430 gene atpA 729 2237 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_24430 2262 3122 gene locus_tag LOCUS_24440 gene atpG 2262 3122 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_24440 3170 4585 gene locus_tag LOCUS_24450 gene atpD 3170 4585 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_24450 4592 5026 gene locus_tag LOCUS_24460 4592 5026 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence224 304 999 gene locus_tag LOCUS_24470 304 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1003 1911 gene locus_tag LOCUS_24480 1003 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1941 3152 gene locus_tag LOCUS_24490 gene nrfD 1941 3152 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_24490 3611 3210 gene locus_tag LOCUS_24500 gene mog 3611 3210 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_24500 3689 3874 gene locus_tag LOCUS_24510 3689 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4459 3887 gene locus_tag LOCUS_24520 4459 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4935 4645 gene locus_tag LOCUS_24530 4935 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence225 2125 1145 gene locus_tag LOCUS_24540 gene prfB 2125 1145 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24540 3187 2282 gene locus_tag LOCUS_24550 3187 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4153 4542 gene locus_tag LOCUS_24560 4153 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 5085 4702 gene locus_tag LOCUS_24570 5085 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence226 877 107 gene locus_tag LOCUS_24580 877 107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_24580 1797 877 gene locus_tag LOCUS_24590 1797 877 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_24590 2014 1805 gene locus_tag LOCUS_24600 2014 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2769 2119 gene locus_tag LOCUS_24610 gene fsa 2769 2119 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_24610 3757 2903 gene locus_tag LOCUS_24620 3757 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 3902 3738 gene locus_tag LOCUS_24630 3902 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4049 4612 gene locus_tag LOCUS_24640 gene amrA 4049 4612 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence227 1487 291 gene locus_tag LOCUS_24650 1487 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3106 2252 gene locus_tag LOCUS_24660 3106 2252 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965753.1 protein_id gnl|my_center|LOCUS_24660 4818 3094 gene locus_tag LOCUS_24670 4818 3094 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence228 1109 216 gene locus_tag LOCUS_24680 1109 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2946 1450 gene locus_tag LOCUS_24690 gene nhaB 2946 1450 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_24690 <4997 3134 gene locus_tag LOCUS_24700 <4997 3134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942688.1:valine--tRNA ligase >Feature sequence229 24 509 gene locus_tag LOCUS_24710 24 509 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_24710 499 2511 gene locus_tag LOCUS_24720 499 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2998 4077 gene locus_tag LOCUS_24730 2998 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4454 4122 gene locus_tag LOCUS_24740 4454 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4789 4451 gene locus_tag LOCUS_24750 4789 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence230 916 554 gene locus_tag LOCUS_24760 916 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1785 913 gene locus_tag LOCUS_24770 1785 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2964 1798 gene locus_tag LOCUS_24780 2964 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3538 3065 gene locus_tag LOCUS_24790 3538 3065 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083047.1 protein_id gnl|my_center|LOCUS_24790 4920 4099 gene locus_tag LOCUS_24800 4920 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence231 201 2693 gene locus_tag LOCUS_24810 gene leuS 201 2693 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_24810 4795 3143 gene locus_tag LOCUS_24820 4795 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence232 1974 1204 gene locus_tag LOCUS_24830 1974 1204 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_24830 3431 2358 gene locus_tag LOCUS_24840 3431 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4115 3441 gene locus_tag LOCUS_24850 4115 3441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence233 <1 926 gene locus_tag LOCUS_24860 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 1555 968 gene locus_tag LOCUS_24870 1555 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2385 1552 gene locus_tag LOCUS_24880 2385 1552 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_24880 3080 2442 gene locus_tag LOCUS_24890 3080 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3986 3249 gene locus_tag LOCUS_24900 3986 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence234 1276 134 gene locus_tag LOCUS_24910 gene proB 1276 134 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_24910 2286 1273 gene locus_tag LOCUS_24920 gene trpD 2286 1273 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_24920 2353 2962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3122 3310 gene locus_tag LOCUS_24930 3122 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3561 4739 gene locus_tag LOCUS_24940 3561 4739 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence235 >Feature sequence236 4545 3694 gene locus_tag LOCUS_24950 4545 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence237 1326 1790 gene locus_tag LOCUS_24960 1326 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2021 2377 gene locus_tag LOCUS_24970 2021 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2435 2668 gene locus_tag LOCUS_24980 2435 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2686 3096 gene locus_tag LOCUS_24990 2686 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 4327 3086 gene locus_tag LOCUS_25000 4327 3086 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence238 4027 2753 gene locus_tag LOCUS_25010 4027 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence239 3589 617 gene locus_tag LOCUS_25020 3589 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 4660 3593 gene locus_tag LOCUS_25030 gene aroC 4660 3593 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence240 1240 35 gene locus_tag LOCUS_25040 1240 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2000 1614 gene locus_tag LOCUS_25050 2000 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3002 2379 gene locus_tag LOCUS_25060 3002 2379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_25060 3574 3296 gene locus_tag LOCUS_25070 3574 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 4508 3597 gene locus_tag LOCUS_25080 4508 3597 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_25080 4630 4505 gene locus_tag LOCUS_25090 4630 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence241 183 1121 gene locus_tag LOCUS_25100 gene trxB 183 1121 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_25100 1210 3213 gene locus_tag LOCUS_25110 1210 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3225 3902 gene locus_tag LOCUS_25120 3225 3902 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_25120 4713 4141 gene locus_tag LOCUS_25130 4713 4141 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence242 1594 158 gene locus_tag LOCUS_25140 gene gnfM 1594 158 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_25140 1827 1708 gene locus_tag LOCUS_25150 1827 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2619 4604 gene locus_tag LOCUS_25160 2619 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence243 4 1914 gene locus_tag LOCUS_25170 4 1914 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_25170 1911 3119 gene locus_tag LOCUS_25180 1911 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2105 2202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3120 4007 gene locus_tag LOCUS_25190 gene rfbA 3120 4007 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_25190 3986 4555 gene locus_tag LOCUS_25200 gene rfbC 3986 4555 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence244 1592 264 gene locus_tag LOCUS_25210 1592 264 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_25210 2039 2455 gene locus_tag LOCUS_25220 2039 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2662 3102 gene locus_tag LOCUS_25230 2662 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3131 3535 gene locus_tag LOCUS_25240 3131 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence245 260 853 gene locus_tag LOCUS_25250 260 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1567 866 gene locus_tag LOCUS_25260 1567 866 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_25260 1851 1564 gene locus_tag LOCUS_25270 1851 1564 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_25270 2404 1871 gene locus_tag LOCUS_25280 2404 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940841.1 protein_id gnl|my_center|LOCUS_25280 2795 2944 gene locus_tag LOCUS_25290 2795 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence246 339 722 gene locus_tag LOCUS_25300 339 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 726 1838 gene locus_tag LOCUS_25310 726 1838 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_25310 1878 2030 gene locus_tag LOCUS_25320 1878 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2027 3220 gene locus_tag LOCUS_25330 gene alaC 2027 3220 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_25330 3224 4537 gene locus_tag LOCUS_25340 3224 4537 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence247 401 2452 gene locus_tag LOCUS_25350 401 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2462 2962 gene locus_tag LOCUS_25360 2462 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3126 3260 gene locus_tag LOCUS_25370 3126 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3680 3949 gene locus_tag LOCUS_25380 3680 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3957 4370 gene locus_tag LOCUS_25390 3957 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence248 357 2738 gene locus_tag LOCUS_25400 357 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2793 2892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence249 595 218 gene locus_tag LOCUS_25410 595 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 552 809 gene locus_tag LOCUS_25420 552 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1495 824 gene locus_tag LOCUS_25430 1495 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2241 1492 gene locus_tag LOCUS_25440 2241 1492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_25440 2419 2228 gene locus_tag LOCUS_25450 2419 2228 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_25450 2592 2978 gene locus_tag LOCUS_25460 2592 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2992 4242 gene locus_tag LOCUS_25470 2992 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence250 <1 1643 gene locus_tag LOCUS_25480 <1 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137931707.1:isoprenylcysteine carboxylmethyltransferase family protein 1656 2333 gene locus_tag LOCUS_25490 1656 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3995 2796 gene locus_tag LOCUS_25500 3995 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence251 294 1040 gene locus_tag LOCUS_25510 294 1040 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830661.1 protein_id gnl|my_center|LOCUS_25510 1057 1833 gene locus_tag LOCUS_25520 1057 1833 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 protein_id gnl|my_center|LOCUS_25520 2076 4316 gene locus_tag LOCUS_25530 2076 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence252 869 48 gene locus_tag LOCUS_25540 869 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1714 881 gene locus_tag LOCUS_25550 1714 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1804 2616 gene locus_tag LOCUS_25560 1804 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2613 3062 gene locus_tag LOCUS_25570 gene aroQ 2613 3062 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_25570 3197 4297 gene locus_tag LOCUS_25580 3197 4297 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence253 838 317 gene locus_tag LOCUS_25590 838 317 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_25590 1240 2016 gene locus_tag LOCUS_25600 1240 2016 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_25600 2085 4061 gene locus_tag LOCUS_25610 gene acs 2085 4061 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence254 252 2240 gene locus_tag LOCUS_25620 252 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 4079 2301 gene locus_tag LOCUS_25630 4079 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence255 240 1682 gene locus_tag LOCUS_25640 gene gatB 240 1682 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_25640 1669 2568 gene locus_tag LOCUS_25650 gene rsgA 1669 2568 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_25650 2575 4053 gene locus_tag LOCUS_25660 2575 4053 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence256 242 1267 gene locus_tag LOCUS_25670 242 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1267 2427 gene locus_tag LOCUS_25680 1267 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2705 2448 gene locus_tag LOCUS_25690 2705 2448 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_25690 2906 4042 gene locus_tag LOCUS_25700 2906 4042 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence257 176 1204 gene locus_tag LOCUS_25710 gene bioB 176 1204 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_25710 1201 2361 gene locus_tag LOCUS_25720 gene bioF 1201 2361 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_25720 2388 3311 gene locus_tag LOCUS_25730 2388 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3716 3411 gene locus_tag LOCUS_25740 3716 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 4010 3828 gene locus_tag LOCUS_25750 4010 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence258 3465 3974 gene locus_tag LOCUS_25760 3465 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence259 1254 1030 gene locus_tag LOCUS_25770 1254 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2718 1699 gene locus_tag LOCUS_25780 2718 1699 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence260 <1 1860 gene locus_tag LOCUS_25790 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941537.1:AsmA-like C-terminal domain-containing protein 1860 2498 gene locus_tag LOCUS_25800 1860 2498 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_25800 2458 3348 gene locus_tag LOCUS_25810 2458 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3515 4057 gene locus_tag LOCUS_25820 3515 4057 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence261 1543 170 gene locus_tag LOCUS_25830 gene radA 1543 170 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_25830 1746 2066 gene locus_tag LOCUS_25840 1746 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2221 3315 gene locus_tag LOCUS_25850 2221 3315 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_25850 3824 3411 gene locus_tag LOCUS_25860 gene ndk 3824 3411 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence262 1431 118 gene locus_tag LOCUS_25870 1431 118 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_25870 3574 1352 gene locus_tag LOCUS_25880 gene pnp 3574 1352 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence263 875 2518 gene locus_tag LOCUS_25890 875 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3398 2592 gene locus_tag LOCUS_25900 3398 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence264 207 1181 gene locus_tag LOCUS_25910 207 1181 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072600.1 protein_id gnl|my_center|LOCUS_25910 1178 1378 gene locus_tag LOCUS_25920 1178 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1378 1752 gene locus_tag LOCUS_25930 1378 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1749 1922 gene locus_tag LOCUS_25940 1749 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1903 2268 gene locus_tag LOCUS_25950 1903 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2265 2393 gene locus_tag LOCUS_25960 2265 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2390 2815 gene locus_tag LOCUS_25970 2390 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2812 3138 gene locus_tag LOCUS_25980 2812 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3135 3413 gene locus_tag LOCUS_25990 3135 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence265 1488 472 gene locus_tag LOCUS_26000 1488 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1886 1485 gene locus_tag LOCUS_26010 1886 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1906 2250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence266 89 517 gene locus_tag LOCUS_26020 89 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 514 1533 gene locus_tag LOCUS_26030 514 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 953 994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1530 2081 gene locus_tag LOCUS_26040 1530 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26040 2082 3878 gene locus_tag LOCUS_26050 2082 3878 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26050 3158 3256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence267 211 3903 gene locus_tag LOCUS_26060 211 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence268 1585 110 gene locus_tag LOCUS_26070 1585 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1798 2976 gene locus_tag LOCUS_26080 gene sucC 1798 2976 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_26080 2992 3858 gene locus_tag LOCUS_26090 gene sucD 2992 3858 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence269 2286 532 gene locus_tag LOCUS_26100 gene oadA 2286 532 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_26100 3142 2339 gene locus_tag LOCUS_26110 gene dapB 3142 2339 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_26110 <3918 3139 gene locus_tag LOCUS_26120 <3918 3139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545135.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence270 144 506 gene locus_tag LOCUS_26130 144 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2346 517 gene locus_tag LOCUS_26140 2346 517 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_26140 2842 2636 gene locus_tag LOCUS_26150 2842 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 <3876 2894 gene locus_tag LOCUS_26160 <3876 2894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114478.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence271 734 537 gene locus_tag LOCUS_26170 734 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1767 775 gene locus_tag LOCUS_26180 1767 775 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_26180 2852 1776 gene locus_tag LOCUS_26190 2852 1776 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_26190 3746 2871 gene locus_tag LOCUS_26200 3746 2871 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence272 590 183 gene locus_tag LOCUS_26210 590 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1059 1136 gene locus_tag LOCUS_t00280 1059 1136 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2683 1160 gene locus_tag LOCUS_26220 2683 1160 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_26220 3676 2687 gene locus_tag LOCUS_26230 3676 2687 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence273 438 2321 gene locus_tag LOCUS_26240 438 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2348 3706 gene locus_tag LOCUS_26250 2348 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence274 237 1643 gene locus_tag LOCUS_26260 237 1643 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_26260 1863 3473 gene locus_tag LOCUS_26270 gene nirS 1863 3473 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence275 1274 30 gene locus_tag LOCUS_26280 1274 30 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811716.1 protein_id gnl|my_center|LOCUS_26280 1439 3580 gene locus_tag LOCUS_26290 1439 3580 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938885.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence276 278 1945 gene locus_tag LOCUS_26300 278 1945 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791909.1 protein_id gnl|my_center|LOCUS_26300 2423 1962 gene locus_tag LOCUS_26310 2423 1962 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_26310 2961 2506 gene locus_tag LOCUS_26320 2961 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3325 3161 gene locus_tag LOCUS_26330 3325 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3549 3337 gene locus_tag LOCUS_26340 3549 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence277 2769 373 gene locus_tag LOCUS_26350 2769 373 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_26350 3211 2756 gene locus_tag LOCUS_26360 3211 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3536 3204 gene locus_tag LOCUS_26370 3536 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence278 237 2264 gene locus_tag LOCUS_26380 237 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2461 3045 gene locus_tag LOCUS_26390 2461 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3051 3650 gene locus_tag LOCUS_26400 3051 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence279 1713 433 gene locus_tag LOCUS_26410 1713 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3406 1724 gene locus_tag LOCUS_26420 3406 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence280 248 1411 gene locus_tag LOCUS_26430 248 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1414 3483 gene locus_tag LOCUS_26440 1414 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence281 552 172 gene locus_tag LOCUS_26450 552 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2510 975 gene locus_tag LOCUS_26460 gene bcsG 2510 975 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530604.1 protein_id gnl|my_center|LOCUS_26460 3369 2554 gene locus_tag LOCUS_26470 3369 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence282 263 925 gene locus_tag LOCUS_26480 263 925 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_26480 928 1218 gene locus_tag LOCUS_26490 928 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1215 1952 gene locus_tag LOCUS_26500 gene cbiQ 1215 1952 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_26500 1953 2657 gene locus_tag LOCUS_26510 1953 2657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728469.1 protein_id gnl|my_center|LOCUS_26510 <3598 2826 gene locus_tag LOCUS_26520 <3598 2826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922276.1:formylmethanofuran dehydrogenase subunit A >Feature sequence283 <1 1401 gene locus_tag LOCUS_26530 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389505.1:excinuclease ABC subunit UvrA 1412 1675 gene locus_tag LOCUS_26540 1412 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1689 1928 gene locus_tag LOCUS_26550 1689 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2915 3118 gene locus_tag LOCUS_26560 2915 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3115 3321 gene locus_tag LOCUS_26570 3115 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence284 1835 177 gene locus_tag LOCUS_26580 1835 177 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_26580 2987 1851 gene locus_tag LOCUS_26590 2987 1851 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_26590 3577 3086 gene locus_tag LOCUS_26600 3577 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence285 16 318 gene locus_tag LOCUS_26610 16 318 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_26610 543 746 gene locus_tag LOCUS_26620 543 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 739 1101 gene locus_tag LOCUS_26630 739 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1175 1336 gene locus_tag LOCUS_26640 1175 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1338 1757 gene locus_tag LOCUS_26650 1338 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 2762 3052 gene locus_tag LOCUS_26660 2762 3052 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_26660 3248 3415 gene locus_tag LOCUS_26670 3248 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence286 21 929 gene locus_tag LOCUS_26680 21 929 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_26680 3290 942 gene locus_tag LOCUS_26690 3290 942 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_26690 3450 3274 gene locus_tag LOCUS_26700 3450 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence287 2088 1012 gene locus_tag LOCUS_26710 2088 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_26710 3087 2092 gene locus_tag LOCUS_26720 3087 2092 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_26720 <3563 3015 gene locus_tag LOCUS_26730 <3563 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943066.1:peptidylprolyl isomerase >Feature sequence288 2047 581 gene locus_tag LOCUS_26740 2047 581 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_26740 3036 2044 gene locus_tag LOCUS_26750 3036 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3445 3137 gene locus_tag LOCUS_26760 3445 3137 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255960.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence289 1 978 gene locus_tag LOCUS_26770 1 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1101 1176 gene locus_tag LOCUS_t00290 1101 1176 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2176 1184 gene locus_tag LOCUS_26780 2176 1184 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_26780 3513 2374 gene locus_tag LOCUS_26790 3513 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence290 766 407 gene locus_tag LOCUS_26800 766 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1425 763 gene locus_tag LOCUS_26810 1425 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2924 1422 gene locus_tag LOCUS_26820 2924 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence291 <3542 544 gene locus_tag LOCUS_26830 <3542 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102960.1:DEAD/DEAH box helicase family protein >Feature sequence292 152 664 gene locus_tag LOCUS_26840 152 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 <3532 674 gene locus_tag LOCUS_26850 <3532 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence293 545 3382 gene locus_tag LOCUS_26860 gene smc 545 3382 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence294 1915 281 gene locus_tag LOCUS_26870 gene cimA 1915 281 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_26870 3165 1912 gene locus_tag LOCUS_26880 3165 1912 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence295 508 1830 gene locus_tag LOCUS_26890 508 1830 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence296 911 1747 gene locus_tag LOCUS_26900 911 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1747 2817 gene locus_tag LOCUS_26910 1747 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence297 1632 190 gene locus_tag LOCUS_26920 gene dacB 1632 190 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189150.1 protein_id gnl|my_center|LOCUS_26920 2164 1619 gene locus_tag LOCUS_26930 2164 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3157 2189 gene locus_tag LOCUS_26940 3157 2189 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence298 1069 413 gene locus_tag LOCUS_26950 1069 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1070 1711 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2906 2631 gene locus_tag LOCUS_26960 2906 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3266 3096 gene locus_tag LOCUS_26970 3266 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence299 333 58 gene locus_tag LOCUS_26980 333 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2353 656 gene locus_tag LOCUS_26990 2353 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2495 2343 gene locus_tag LOCUS_27000 2495 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2919 2506 gene locus_tag LOCUS_27010 2919 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3290 2916 gene locus_tag LOCUS_27020 3290 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence300 281 3127 gene locus_tag LOCUS_27030 281 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence301 1722 916 gene locus_tag LOCUS_27040 1722 916 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 protein_id gnl|my_center|LOCUS_27040 2175 1753 gene locus_tag LOCUS_27050 2175 1753 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391610.1 protein_id gnl|my_center|LOCUS_27050 2817 2299 gene locus_tag LOCUS_27060 2817 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence302 3 458 gene locus_tag LOCUS_27070 3 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1293 568 gene locus_tag LOCUS_27080 1293 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1906 1295 gene locus_tag LOCUS_27090 1906 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2479 1958 gene locus_tag LOCUS_27100 2479 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence303 <1 514 gene locus_tag LOCUS_27110 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930460.1:glycosyltransferase 529 1620 gene locus_tag LOCUS_27120 529 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1617 2201 gene locus_tag LOCUS_27130 1617 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2198 3067 gene locus_tag LOCUS_27140 2198 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence304 188 1345 gene locus_tag LOCUS_27150 188 1345 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_27150 1332 1793 gene locus_tag LOCUS_27160 1332 1793 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_27160 1807 2646 gene locus_tag LOCUS_27170 1807 2646 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence305 <1 1261 gene locus_tag LOCUS_27180 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113244.1:dihydro-heme d1 dehydrogenase 1274 2452 gene locus_tag LOCUS_27190 gene nirJ1 1274 2452 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence306 225 551 gene locus_tag LOCUS_27200 225 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 599 1060 gene locus_tag LOCUS_27210 599 1060 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_27210 1705 1193 gene locus_tag LOCUS_27220 1705 1193 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_27220 3037 1727 gene locus_tag LOCUS_27230 gene miaB 3037 1727 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence307 454 1272 gene locus_tag LOCUS_27240 454 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence308 2327 777 gene locus_tag LOCUS_27250 gene secD 2327 777 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_27250 2682 2320 gene locus_tag LOCUS_27260 gene yajC 2682 2320 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_27260 3039 2758 gene locus_tag LOCUS_27270 3039 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence309 1620 2849 gene locus_tag LOCUS_27280 1620 2849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence310 1005 226 gene locus_tag LOCUS_27290 1005 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1448 1191 gene locus_tag LOCUS_27300 1448 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2020 2613 gene locus_tag LOCUS_27310 gene pyrR 2020 2613 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence311 23 505 gene locus_tag LOCUS_27320 23 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 618 1526 gene locus_tag LOCUS_27330 618 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1526 2533 gene locus_tag LOCUS_27340 1526 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2520 3065 gene locus_tag LOCUS_27350 2520 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence312 278 598 gene locus_tag LOCUS_27360 278 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 623 1669 gene locus_tag LOCUS_27370 623 1669 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879736.1 protein_id gnl|my_center|LOCUS_27370 1685 1921 gene locus_tag LOCUS_27380 1685 1921 CDS product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879737.1 protein_id gnl|my_center|LOCUS_27380 2084 3007 gene locus_tag LOCUS_27390 gene arsB 2084 3007 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence313 1907 1020 gene locus_tag LOCUS_27400 1907 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 <3021 1894 gene locus_tag LOCUS_27410 <3021 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268280.1:sensor histidine kinase >Feature sequence314 <1 2121 gene locus_tag LOCUS_27420 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941477.1:sigma-54 dependent transcriptional regulator 2118 2756 gene locus_tag LOCUS_27430 gene purN 2118 2756 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence315 686 264 gene locus_tag LOCUS_27440 gene nusB 686 264 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_27440 1154 690 gene locus_tag LOCUS_27450 gene ribH 1154 690 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_27450 2412 1174 gene locus_tag LOCUS_27460 2412 1174 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_27460 2513 2758 gene locus_tag LOCUS_27470 2513 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence316 172 666 gene locus_tag LOCUS_27480 gene coaD 172 666 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_27480 679 1392 gene locus_tag LOCUS_27490 679 1392 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877403.1 protein_id gnl|my_center|LOCUS_27490 1405 2598 gene locus_tag LOCUS_27500 1405 2598 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_27500 2619 2753 gene locus_tag LOCUS_27510 2619 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27510 >Feature sequence317 628 53 gene locus_tag LOCUS_27520 628 53 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 protein_id gnl|my_center|LOCUS_27520 2740 689 gene locus_tag LOCUS_27530 2740 689 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence318 533 201 gene locus_tag LOCUS_27540 533 201 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_27540 1298 906 gene locus_tag LOCUS_27550 1298 906 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_27550 1774 1313 gene locus_tag LOCUS_27560 1774 1313 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296996.1 protein_id gnl|my_center|LOCUS_27560 2025 1777 gene locus_tag LOCUS_27570 2025 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2615 2022 gene locus_tag LOCUS_27580 gene sigW 2615 2022 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence319 2332 95 gene locus_tag LOCUS_27590 2332 95 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116585.1 protein_id gnl|my_center|LOCUS_27590 2569 2354 gene locus_tag LOCUS_27600 2569 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence320 1191 2501 gene locus_tag LOCUS_27610 1191 2501 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence321 1019 303 gene locus_tag LOCUS_27620 1019 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1353 1931 gene locus_tag LOCUS_27630 1353 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2237 2046 gene locus_tag LOCUS_27640 2237 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2338 2583 gene locus_tag LOCUS_27650 2338 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence322 1800 514 gene locus_tag LOCUS_27660 1800 514 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926985.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence323 <1 1463 gene locus_tag LOCUS_27670 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000090679.1:DUF935 domain-containing protein >Feature sequence324 1969 848 gene locus_tag LOCUS_27680 1969 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2276 2082 gene locus_tag LOCUS_27690 gene rpmB 2276 2082 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938507.1 protein_id gnl|my_center|LOCUS_27690 2405 2590 gene locus_tag LOCUS_27700 2405 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence325 <1 1055 gene locus_tag LOCUS_27710 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462401.1:DmsE family decaheme c-type cytochrome 1052 2359 gene locus_tag LOCUS_27720 1052 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence326 2077 512 gene locus_tag LOCUS_27730 2077 512 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_27730 <2582 2074 gene locus_tag LOCUS_27740 <2582 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392609.1:precorrin-6A reductase >Feature sequence327 344 823 gene locus_tag LOCUS_27750 344 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2342 873 gene locus_tag LOCUS_27760 2342 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence328 1085 153 gene locus_tag LOCUS_27770 1085 153 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142197.1 protein_id gnl|my_center|LOCUS_27770 1143 2234 gene locus_tag LOCUS_27780 gene ychF 1143 2234 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence329 1389 118 gene locus_tag LOCUS_27790 1389 118 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_27790 <2558 1593 gene locus_tag LOCUS_27800 <2558 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459114.1:HD-GYP domain-containing protein >Feature sequence330 449 138 gene locus_tag LOCUS_27810 449 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2120 465 gene locus_tag LOCUS_27820 2120 465 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921786.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence331 80 4 gene locus_tag LOCUS_t00300 80 4 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 657 448 gene locus_tag LOCUS_27830 657 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 <2524 923 gene locus_tag LOCUS_27840 <2524 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941980.1:ATP-dependent DNA helicase RecG >Feature sequence332 945 1943 gene locus_tag LOCUS_27850 945 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1921 2508 gene locus_tag LOCUS_27860 1921 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence333 680 2410 gene locus_tag LOCUS_27870 680 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence334 <1 1002 gene locus_tag LOCUS_27880 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533549.1:HigA family addiction module antitoxin 1013 1486 gene locus_tag LOCUS_27890 1013 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1722 1489 gene locus_tag LOCUS_27900 1722 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1878 2345 gene locus_tag LOCUS_27910 1878 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence335 <1 1857 gene locus_tag LOCUS_27920 <1 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 1866 2189 gene locus_tag LOCUS_27930 1866 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence336 88 213 gene locus_tag LOCUS_27940 88 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 192 1937 gene locus_tag LOCUS_27950 gene ispH 192 1937 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_27950 1987 2259 gene locus_tag LOCUS_27960 1987 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence337 1155 214 gene locus_tag LOCUS_27970 gene nadA 1155 214 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_27970 2277 1522 gene locus_tag LOCUS_27980 gene rlmB 2277 1522 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence338 293 1894 gene locus_tag LOCUS_27990 293 1894 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence339 149 1657 gene locus_tag LOCUS_28000 149 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1784 1665 gene locus_tag LOCUS_28010 1784 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence340 50 376 gene locus_tag LOCUS_28020 50 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1210 404 gene locus_tag LOCUS_28030 1210 404 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922383.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence341 2168 1395 gene locus_tag LOCUS_28040 2168 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence342 946 131 gene locus_tag LOCUS_28050 946 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1228 947 gene locus_tag LOCUS_28060 1228 947 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_28060 <2306 1251 gene locus_tag LOCUS_28070 <2306 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546459.1:threonine synthase >Feature sequence343 1813 725 gene locus_tag LOCUS_28080 gene mqnE 1813 725 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence344 2119 1682 gene locus_tag LOCUS_28090 2119 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence345 590 96 gene locus_tag LOCUS_28100 590 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 892 978 gene locus_tag LOCUS_t00310 892 978 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1082 2260 gene locus_tag LOCUS_28110 1082 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence346 187 525 gene locus_tag LOCUS_28120 187 525 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_28120 506 925 gene locus_tag LOCUS_28130 506 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 922 1254 gene locus_tag LOCUS_28140 922 1254 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_28140 1335 2219 gene locus_tag LOCUS_28150 1335 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence347 <1 1182 gene locus_tag LOCUS_28160 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933684.1:competence/damage-inducible protein A 1179 1835 gene locus_tag LOCUS_28170 gene rpe 1179 1835 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence348 129 287 gene locus_tag LOCUS_28180 129 287 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_28180 320 2146 gene locus_tag LOCUS_28190 320 2146 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence349 2044 161 gene locus_tag LOCUS_28200 2044 161 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence350 626 2176 gene locus_tag LOCUS_28210 626 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence351 2118 1585 gene locus_tag LOCUS_28220 2118 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence352 1988 135 gene locus_tag LOCUS_28230 1988 135 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence353 >Feature sequence354 588 58 gene locus_tag LOCUS_28240 588 58 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_28240 1846 596 gene locus_tag LOCUS_28250 1846 596 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence355 1919 252 gene locus_tag LOCUS_28260 1919 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence356 1492 1148 gene locus_tag LOCUS_28270 1492 1148 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942071.1 protein_id gnl|my_center|LOCUS_28270 1932 1546 gene locus_tag LOCUS_28280 1932 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence357 607 62 gene locus_tag LOCUS_28290 607 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1950 589 gene locus_tag LOCUS_28300 1950 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence358 59 460 gene locus_tag LOCUS_28310 59 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 460 897 gene locus_tag LOCUS_28320 460 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320