>Feature sequence001 1958 1671 gene locus_tag LOCUS_00010 1958 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2883 2038 gene locus_tag LOCUS_00020 2883 2038 CDS product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 protein_id gnl|my_center|LOCUS_00020 3697 3200 gene locus_tag LOCUS_00030 gene fliW 3697 3200 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_00030 6594 4267 gene locus_tag LOCUS_00040 6594 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7172 6633 gene locus_tag LOCUS_00050 7172 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8396 7197 gene locus_tag LOCUS_00060 8396 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10202 8418 gene locus_tag LOCUS_00070 gene flgK 10202 8418 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_00070 10615 11406 gene locus_tag LOCUS_00080 10615 11406 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_00080 13090 11708 gene locus_tag LOCUS_00090 gene der 13090 11708 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_00090 14482 13217 gene locus_tag LOCUS_00100 14482 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15366 14992 gene locus_tag LOCUS_00110 15366 14992 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_00110 15939 15460 gene locus_tag LOCUS_00120 15939 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16419 16039 gene locus_tag LOCUS_00130 16419 16039 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_00130 17295 16459 gene locus_tag LOCUS_00140 gene cheR 17295 16459 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_00140 18553 17309 gene locus_tag LOCUS_00150 18553 17309 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207872.1 protein_id gnl|my_center|LOCUS_00150 19612 18599 gene locus_tag LOCUS_00160 19612 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19672 19767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20522 20208 gene locus_tag LOCUS_00170 gene hsbA 20522 20208 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_00170 21706 20663 gene locus_tag LOCUS_00180 gene cttP 21706 20663 CDS product trichloroethylene chemotactic transducer CttP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106690.1 protein_id gnl|my_center|LOCUS_00180 22197 21703 gene locus_tag LOCUS_00190 22197 21703 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_00190 25686 22261 gene locus_tag LOCUS_00200 25686 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26128 26544 gene locus_tag LOCUS_00210 26128 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26832 27842 gene locus_tag LOCUS_00220 26832 27842 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_00220 28059 29348 gene locus_tag LOCUS_00230 28059 29348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29604 30284 gene locus_tag LOCUS_00240 gene flgD 29604 30284 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535718.1 protein_id gnl|my_center|LOCUS_00240 30345 32201 gene locus_tag LOCUS_00250 30345 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32386 32889 gene locus_tag LOCUS_00260 32386 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32899 33894 gene locus_tag LOCUS_00270 gene fliM 32899 33894 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_00270 33934 34281 gene locus_tag LOCUS_00280 33934 34281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34278 34682 gene locus_tag LOCUS_00290 34278 34682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 34679 35458 gene locus_tag LOCUS_00300 gene fliP 34679 35458 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_00300 35503 37548 gene locus_tag LOCUS_00310 gene ligA 35503 37548 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957648.1 protein_id gnl|my_center|LOCUS_00310 37744 39018 gene locus_tag LOCUS_00320 37744 39018 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_00320 39031 40464 gene locus_tag LOCUS_00330 gene gndA 39031 40464 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_00330 40536 40790 gene locus_tag LOCUS_00340 40536 40790 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_00340 40787 41119 gene locus_tag LOCUS_00350 40787 41119 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_00350 41329 42771 gene locus_tag LOCUS_00360 41329 42771 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_00360 42846 44063 gene locus_tag LOCUS_00370 42846 44063 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525685.1 protein_id gnl|my_center|LOCUS_00370 44331 44098 gene locus_tag LOCUS_00380 44331 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44925 45416 gene locus_tag LOCUS_00390 44925 45416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45483 46802 gene locus_tag LOCUS_00400 45483 46802 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_00400 46865 47998 gene locus_tag LOCUS_00410 46865 47998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47995 49761 gene locus_tag LOCUS_00420 gene recJ 47995 49761 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_00420 49786 50214 gene locus_tag LOCUS_00430 49786 50214 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_00430 50207 51040 gene locus_tag LOCUS_00440 50207 51040 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_00440 51861 51388 gene locus_tag LOCUS_00450 gene secB 51861 51388 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 protein_id gnl|my_center|LOCUS_00450 53502 51937 gene locus_tag LOCUS_00460 53502 51937 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941190.1 protein_id gnl|my_center|LOCUS_00460 53710 53522 gene locus_tag LOCUS_00470 53710 53522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53948 53673 gene locus_tag LOCUS_00480 gene rpsT 53948 53673 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948336.1 protein_id gnl|my_center|LOCUS_00480 54204 55808 gene locus_tag LOCUS_00490 gene murJ 54204 55808 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367200.1 protein_id gnl|my_center|LOCUS_00490 56252 55830 gene locus_tag LOCUS_00500 56252 55830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56622 56467 gene locus_tag LOCUS_00510 56622 56467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57310 56615 gene locus_tag LOCUS_00520 57310 56615 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_00520 57978 57313 gene locus_tag LOCUS_00530 gene ccmB 57978 57313 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104640.1 protein_id gnl|my_center|LOCUS_00530 58691 57972 gene locus_tag LOCUS_00540 58691 57972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_00540 59910 58738 gene locus_tag LOCUS_00550 59910 58738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60182 61594 gene locus_tag LOCUS_00560 gene hemN 60182 61594 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103794.1 protein_id gnl|my_center|LOCUS_00560 61591 62985 gene locus_tag LOCUS_00570 gene hemG 61591 62985 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_00570 62989 63702 gene locus_tag LOCUS_00580 gene dnaQ 62989 63702 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_00580 64083 63718 gene locus_tag LOCUS_00590 64083 63718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64179 65300 gene locus_tag LOCUS_00600 gene murG 64179 65300 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_00600 65532 65344 gene locus_tag LOCUS_00610 65532 65344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65886 66389 gene locus_tag LOCUS_00620 65886 66389 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865419.1 protein_id gnl|my_center|LOCUS_00620 66409 69036 gene locus_tag LOCUS_00630 gene alaS 66409 69036 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971929.1 protein_id gnl|my_center|LOCUS_00630 69033 69320 gene locus_tag LOCUS_00640 69033 69320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_00640 69327 70271 gene locus_tag LOCUS_00650 69327 70271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70280 71191 gene locus_tag LOCUS_00660 70280 71191 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_00660 >Feature sequence002 2450 300 gene locus_tag LOCUS_00670 gene rlmKL 2450 300 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_00670 2801 2505 gene locus_tag LOCUS_00680 2801 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4211 5626 gene locus_tag LOCUS_00690 4211 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5623 6981 gene locus_tag LOCUS_00700 5623 6981 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_00700 6956 9211 gene locus_tag LOCUS_00710 6956 9211 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_00710 9462 10013 gene locus_tag LOCUS_00720 9462 10013 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_00720 10042 10491 gene locus_tag LOCUS_00730 10042 10491 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_00730 10498 11718 gene locus_tag LOCUS_00740 10498 11718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_00740 11979 12257 gene locus_tag LOCUS_00750 11979 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 12464 13759 gene locus_tag LOCUS_00760 gene gltA 12464 13759 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_00760 14016 14381 gene locus_tag LOCUS_00770 14016 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 14516 14773 gene locus_tag LOCUS_00780 14516 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 14778 15662 gene locus_tag LOCUS_00790 14778 15662 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_00790 15679 17553 gene locus_tag LOCUS_00800 gene dxs 15679 17553 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_00800 17550 18236 gene locus_tag LOCUS_00810 17550 18236 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_00810 18342 19253 gene locus_tag LOCUS_00820 18342 19253 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 protein_id gnl|my_center|LOCUS_00820 19506 20909 gene locus_tag LOCUS_00830 gene leuC 19506 20909 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_00830 20978 21646 gene locus_tag LOCUS_00840 20978 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 21677 22348 gene locus_tag LOCUS_00850 gene leuD 21677 22348 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_00850 22396 23490 gene locus_tag LOCUS_00860 gene leuB 22396 23490 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_00860 23487 24503 gene locus_tag LOCUS_00870 23487 24503 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721972.1 protein_id gnl|my_center|LOCUS_00870 24542 26947 gene locus_tag LOCUS_00880 24542 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 26947 27849 gene locus_tag LOCUS_00890 26947 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28826 27894 gene locus_tag LOCUS_00900 28826 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 29163 29840 gene locus_tag LOCUS_00910 29163 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 32080 29984 gene locus_tag LOCUS_00920 32080 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 33695 32202 gene locus_tag LOCUS_00930 33695 32202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 34437 33769 gene locus_tag LOCUS_00940 34437 33769 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_00940 34990 34586 gene locus_tag LOCUS_00950 34990 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 35386 35311 gene locus_tag LOCUS_t00010 35386 35311 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 35856 35464 gene locus_tag LOCUS_00960 35856 35464 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 protein_id gnl|my_center|LOCUS_00960 37062 35926 gene locus_tag LOCUS_00970 37062 35926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 39151 37121 gene locus_tag LOCUS_00980 39151 37121 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 protein_id gnl|my_center|LOCUS_00980 39337 40035 gene locus_tag LOCUS_00990 39337 40035 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_00990 40274 40486 gene locus_tag LOCUS_01000 gene cspE 40274 40486 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 protein_id gnl|my_center|LOCUS_01000 40579 41727 gene locus_tag LOCUS_01010 40579 41727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 41759 42850 gene locus_tag LOCUS_01020 gene thiO 41759 42850 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333314.1 protein_id gnl|my_center|LOCUS_01020 42847 43965 gene locus_tag LOCUS_01030 gene mnmA 42847 43965 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_01030 44021 44464 gene locus_tag LOCUS_01040 44021 44464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 44567 45469 gene locus_tag LOCUS_01050 44567 45469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 46896 45517 gene locus_tag LOCUS_01060 46896 45517 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_01060 48309 46900 gene locus_tag LOCUS_01070 48309 46900 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_01070 49268 48306 gene locus_tag LOCUS_01080 49268 48306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 49920 49261 gene locus_tag LOCUS_01090 gene tmk 49920 49261 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 protein_id gnl|my_center|LOCUS_01090 50933 49932 gene locus_tag LOCUS_01100 gene mltG 50933 49932 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 protein_id gnl|my_center|LOCUS_01100 52171 50930 gene locus_tag LOCUS_01110 gene fabF 52171 50930 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_01110 52498 52265 gene locus_tag LOCUS_01120 52498 52265 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203723.1 protein_id gnl|my_center|LOCUS_01120 53315 52581 gene locus_tag LOCUS_01130 gene fabG 53315 52581 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388175.1 protein_id gnl|my_center|LOCUS_01130 54304 53315 gene locus_tag LOCUS_01140 gene fabD 54304 53315 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337657.1 protein_id gnl|my_center|LOCUS_01140 55048 54503 gene locus_tag LOCUS_01150 55048 54503 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_01150 55312 55238 gene locus_tag LOCUS_t00020 55312 55238 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 55568 55492 gene locus_tag LOCUS_t00030 55568 55492 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 55652 55578 gene locus_tag LOCUS_t00040 55652 55578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58422 56524 gene locus_tag LOCUS_01160 gene uvrC 58422 56524 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_01160 59206 58427 gene locus_tag LOCUS_01170 gene lgt 59206 58427 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_01170 60068 59211 gene locus_tag LOCUS_01180 60068 59211 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_01180 60920 60135 gene locus_tag LOCUS_01190 60920 60135 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_01190 61289 63307 gene locus_tag LOCUS_01200 61289 63307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 64454 63420 gene locus_tag LOCUS_01210 64454 63420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 64848 64444 gene locus_tag LOCUS_01220 gene msrB 64848 64444 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_01220 66243 64864 gene locus_tag LOCUS_01230 gene thiC 66243 64864 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_01230 66401 67456 gene locus_tag LOCUS_01240 66401 67456 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_01240 67590 68696 gene locus_tag LOCUS_01250 67590 68696 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925054.1 protein_id gnl|my_center|LOCUS_01250 68747 69835 gene locus_tag LOCUS_01260 68747 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 70407 69907 gene locus_tag LOCUS_01270 70407 69907 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence003 370 654 gene locus_tag LOCUS_01280 370 654 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_01280 803 1291 gene locus_tag LOCUS_01290 803 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 1320 2114 gene locus_tag LOCUS_01300 1320 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2129 3184 gene locus_tag LOCUS_01310 2129 3184 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_01310 3181 3591 gene locus_tag LOCUS_01320 3181 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3588 4175 gene locus_tag LOCUS_01330 3588 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 5697 4138 gene locus_tag LOCUS_01340 gene rny 5697 4138 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_01340 6459 5833 gene locus_tag LOCUS_01350 6459 5833 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262563.1 protein_id gnl|my_center|LOCUS_01350 6959 6636 gene locus_tag LOCUS_01360 6959 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7261 6974 gene locus_tag LOCUS_01370 7261 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 8791 7361 gene locus_tag LOCUS_01380 8791 7361 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_01380 13496 8784 gene locus_tag LOCUS_01390 13496 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 11624 11721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13696 13794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14649 13840 gene locus_tag LOCUS_01400 14649 13840 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_01400 15512 14655 gene locus_tag LOCUS_01410 15512 14655 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974051.1 protein_id gnl|my_center|LOCUS_01410 16484 15531 gene locus_tag LOCUS_01420 16484 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 16850 17851 gene locus_tag LOCUS_01430 16850 17851 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_01430 18007 19035 gene locus_tag LOCUS_01440 gene cobT 18007 19035 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038174.1 protein_id gnl|my_center|LOCUS_01440 19080 20648 gene locus_tag LOCUS_01450 19080 20648 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_01450 20802 21647 gene locus_tag LOCUS_01460 20802 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 21696 24851 gene locus_tag LOCUS_01470 21696 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 24848 25975 gene locus_tag LOCUS_01480 24848 25975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 26035 29424 gene locus_tag LOCUS_01490 gene mscK 26035 29424 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 protein_id gnl|my_center|LOCUS_01490 29421 30056 gene locus_tag LOCUS_01500 29421 30056 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143029.1 protein_id gnl|my_center|LOCUS_01500 30038 30673 gene locus_tag LOCUS_01510 gene thiE 30038 30673 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_01510 30865 31203 gene locus_tag LOCUS_01520 30865 31203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 31204 31569 gene locus_tag LOCUS_01530 31204 31569 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_01530 31602 33710 gene locus_tag LOCUS_01540 31602 33710 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_01540 33769 36495 gene locus_tag LOCUS_01550 33769 36495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 36721 37329 gene locus_tag LOCUS_01560 gene ppiA 36721 37329 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_01560 37344 38669 gene locus_tag LOCUS_01570 37344 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 39151 38813 gene locus_tag LOCUS_01580 39151 38813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 40437 40084 gene locus_tag LOCUS_01590 40437 40084 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_01590 41517 40489 gene locus_tag LOCUS_01600 41517 40489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 41648 42004 gene locus_tag LOCUS_01610 41648 42004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 44122 42005 gene locus_tag LOCUS_01620 44122 42005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 45769 44249 gene locus_tag LOCUS_01630 45769 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 46239 47495 gene locus_tag LOCUS_01640 gene coaBC 46239 47495 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_01640 47513 47974 gene locus_tag LOCUS_01650 47513 47974 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_01650 47987 48703 gene locus_tag LOCUS_01660 gene thiF 47987 48703 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_01660 48718 49647 gene locus_tag LOCUS_01670 gene cysK 48718 49647 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067744.1 protein_id gnl|my_center|LOCUS_01670 49647 50624 gene locus_tag LOCUS_01680 49647 50624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 50846 51274 gene locus_tag LOCUS_01690 50846 51274 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_01690 51342 51770 gene locus_tag LOCUS_01700 51342 51770 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_01700 51880 52311 gene locus_tag LOCUS_01710 51880 52311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 52360 54330 gene locus_tag LOCUS_01720 52360 54330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 54376 55851 gene locus_tag LOCUS_01730 54376 55851 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_01730 56791 55859 gene locus_tag LOCUS_01740 56791 55859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 58520 56802 gene locus_tag LOCUS_01750 gene recQ 58520 56802 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence004 1419 115 gene locus_tag LOCUS_01760 1419 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2237 1800 gene locus_tag LOCUS_01770 2237 1800 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_01770 3455 2406 gene locus_tag LOCUS_01780 3455 2406 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_01780 4310 3459 gene locus_tag LOCUS_01790 gene cysW 4310 3459 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_01790 5156 4314 gene locus_tag LOCUS_01800 gene cysT 5156 4314 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_01800 6179 5160 gene locus_tag LOCUS_01810 6179 5160 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_01810 6706 6224 gene locus_tag LOCUS_01820 6706 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 8105 6726 gene locus_tag LOCUS_01830 8105 6726 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792552.1 protein_id gnl|my_center|LOCUS_01830 10933 8111 gene locus_tag LOCUS_01840 10933 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 11886 10930 gene locus_tag LOCUS_01850 11886 10930 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924797.1 protein_id gnl|my_center|LOCUS_01850 12121 13074 gene locus_tag LOCUS_01860 gene prmB 12121 13074 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 protein_id gnl|my_center|LOCUS_01860 13939 13163 gene locus_tag LOCUS_01870 13939 13163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 14784 14095 gene locus_tag LOCUS_01880 14784 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 16049 14778 gene locus_tag LOCUS_01890 16049 14778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_01890 16498 16986 gene locus_tag LOCUS_01900 gene rimP 16498 16986 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_01900 17017 18582 gene locus_tag LOCUS_01910 gene nusA 17017 18582 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_01910 18671 19153 gene locus_tag LOCUS_01920 18671 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 19289 22369 gene locus_tag LOCUS_01930 gene infB 19289 22369 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_01930 22366 22650 gene locus_tag LOCUS_01940 22366 22650 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220950.1 protein_id gnl|my_center|LOCUS_01940 22650 23027 gene locus_tag LOCUS_01950 gene rbfA 22650 23027 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776442.1 protein_id gnl|my_center|LOCUS_01950 23040 23972 gene locus_tag LOCUS_01960 gene truB 23040 23972 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_01960 24023 24292 gene locus_tag LOCUS_01970 gene rpsO 24023 24292 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385566.1 protein_id gnl|my_center|LOCUS_01970 24348 26432 gene locus_tag LOCUS_01980 gene pnp 24348 26432 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398735.1 protein_id gnl|my_center|LOCUS_01980 26547 28478 gene locus_tag LOCUS_01990 26547 28478 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_01990 30480 28567 gene locus_tag LOCUS_02000 30480 28567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 30720 30884 gene locus_tag LOCUS_02010 30720 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 32286 30844 gene locus_tag LOCUS_02020 gene gltX 32286 30844 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695640.1 protein_id gnl|my_center|LOCUS_02020 32494 33498 gene locus_tag LOCUS_02030 32494 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 33495 35315 gene locus_tag LOCUS_02040 gene aspS 33495 35315 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_02040 35491 37449 gene locus_tag LOCUS_02050 35491 37449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 37479 37628 gene locus_tag LOCUS_02060 37479 37628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 37629 37790 gene locus_tag LOCUS_02070 37629 37790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 37883 39418 gene locus_tag LOCUS_02080 37883 39418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 39415 40221 gene locus_tag LOCUS_02090 39415 40221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 41271 40201 gene locus_tag LOCUS_02100 gene flhB 41271 40201 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_02100 42077 41280 gene locus_tag LOCUS_02110 gene fliR 42077 41280 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_02110 42368 42099 gene locus_tag LOCUS_02120 gene fliQ 42368 42099 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_02120 43671 42529 gene locus_tag LOCUS_02130 43671 42529 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_02130 43774 44364 gene locus_tag LOCUS_02140 43774 44364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 45280 44402 gene locus_tag LOCUS_02150 45280 44402 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_02150 46501 45371 gene locus_tag LOCUS_02160 46501 45371 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_02160 46730 47578 gene locus_tag LOCUS_02170 gene gluQRS 46730 47578 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_02170 48493 47627 gene locus_tag LOCUS_02180 48493 47627 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_02180 49056 48640 gene locus_tag LOCUS_02190 49056 48640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 50277 50047 gene locus_tag LOCUS_02200 50277 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 51282 50800 gene locus_tag LOCUS_02210 51282 50800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 52289 53470 gene locus_tag LOCUS_02220 52289 53470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 55224 54256 gene locus_tag LOCUS_02230 55224 54256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 55523 56581 gene locus_tag LOCUS_02240 55523 56581 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444370.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence005 678 2144 gene locus_tag LOCUS_02250 678 2144 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02250 2218 2985 gene locus_tag LOCUS_02260 2218 2985 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229160.1 protein_id gnl|my_center|LOCUS_02260 3131 3478 gene locus_tag LOCUS_02270 gene hspQ 3131 3478 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975546.1 protein_id gnl|my_center|LOCUS_02270 3533 4732 gene locus_tag LOCUS_02280 3533 4732 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_02280 4774 5442 gene locus_tag LOCUS_02290 4774 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5477 6880 gene locus_tag LOCUS_02300 5477 6880 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_02300 6886 8046 gene locus_tag LOCUS_02310 6886 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 8149 8478 gene locus_tag LOCUS_02320 8149 8478 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_02320 8468 8782 gene locus_tag LOCUS_02330 8468 8782 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211007.1 protein_id gnl|my_center|LOCUS_02330 10421 8868 gene locus_tag LOCUS_02340 10421 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 10852 10418 gene locus_tag LOCUS_02350 10852 10418 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_02350 11962 10865 gene locus_tag LOCUS_02360 gene nadA 11962 10865 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_02360 12028 13182 gene locus_tag LOCUS_02370 gene queG 12028 13182 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_02370 13642 13992 gene locus_tag LOCUS_02380 13642 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14007 14840 gene locus_tag LOCUS_02390 14007 14840 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_02390 14916 18350 gene locus_tag LOCUS_02400 14916 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 19110 18364 gene locus_tag LOCUS_02410 gene rnc 19110 18364 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420714.1 protein_id gnl|my_center|LOCUS_02410 19438 19094 gene locus_tag LOCUS_02420 19438 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 20439 19501 gene locus_tag LOCUS_02430 20439 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 22270 20450 gene locus_tag LOCUS_02440 gene lepA 22270 20450 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_02440 22790 22335 gene locus_tag LOCUS_02450 22790 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 24487 22940 gene locus_tag LOCUS_02460 24487 22940 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_02460 25046 24654 gene locus_tag LOCUS_02470 25046 24654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 25086 25184 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28353 25321 gene locus_tag LOCUS_02480 28353 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 29599 28460 gene locus_tag LOCUS_02490 29599 28460 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_02490 30267 29605 gene locus_tag LOCUS_02500 gene elbB 30267 29605 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174227.1 protein_id gnl|my_center|LOCUS_02500 30463 30293 gene locus_tag LOCUS_02510 30463 30293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 32336 30681 gene locus_tag LOCUS_02520 gene groL 32336 30681 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975442.1 protein_id gnl|my_center|LOCUS_02520 32696 32403 gene locus_tag LOCUS_02530 32696 32403 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090264.1 protein_id gnl|my_center|LOCUS_02530 34013 32874 gene locus_tag LOCUS_02540 gene hflX 34013 32874 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_02540 33903 34148 gene locus_tag LOCUS_02550 33903 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 34395 34162 gene locus_tag LOCUS_02560 gene hfq 34395 34162 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_02560 35536 34619 gene locus_tag LOCUS_02570 35536 34619 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_02570 35756 36718 gene locus_tag LOCUS_02580 35756 36718 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389548.1 protein_id gnl|my_center|LOCUS_02580 37009 37365 gene locus_tag LOCUS_02590 37009 37365 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_02590 37370 37888 gene locus_tag LOCUS_02600 37370 37888 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_02600 37885 38436 gene locus_tag LOCUS_02610 37885 38436 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919820.1 protein_id gnl|my_center|LOCUS_02610 38524 39705 gene locus_tag LOCUS_02620 38524 39705 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930035.1 protein_id gnl|my_center|LOCUS_02620 39710 40213 gene locus_tag LOCUS_02630 gene nuoE 39710 40213 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597486.1 protein_id gnl|my_center|LOCUS_02630 40210 41490 gene locus_tag LOCUS_02640 gene nuoF 40210 41490 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_02640 41507 43909 gene locus_tag LOCUS_02650 gene nuoG 41507 43909 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_02650 43981 45021 gene locus_tag LOCUS_02660 gene nuoH 43981 45021 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886375.1 protein_id gnl|my_center|LOCUS_02660 45024 45518 gene locus_tag LOCUS_02670 gene nuoI 45024 45518 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886374.1 protein_id gnl|my_center|LOCUS_02670 45531 46121 gene locus_tag LOCUS_02680 45531 46121 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531099.1 protein_id gnl|my_center|LOCUS_02680 46127 46429 gene locus_tag LOCUS_02690 gene nuoK 46127 46429 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502389.1 protein_id gnl|my_center|LOCUS_02690 46466 48382 gene locus_tag LOCUS_02700 gene nuoL 46466 48382 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531855.1 protein_id gnl|my_center|LOCUS_02700 48402 49877 gene locus_tag LOCUS_02710 48402 49877 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_02710 49958 51403 gene locus_tag LOCUS_02720 gene nuoN 49958 51403 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_02720 51461 52627 gene locus_tag LOCUS_02730 51461 52627 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_02730 52706 53524 gene locus_tag LOCUS_02740 gene fabI 52706 53524 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_02740 53651 54742 gene locus_tag LOCUS_02750 gene aroC 53651 54742 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_02750 54810 55304 gene locus_tag LOCUS_02760 54810 55304 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942508.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence006 3582 2164 gene locus_tag LOCUS_02770 3582 2164 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_02770 4391 3726 gene locus_tag LOCUS_02780 4391 3726 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_02780 4650 4958 gene locus_tag LOCUS_02790 4650 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5031 6245 gene locus_tag LOCUS_02800 5031 6245 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_02800 6586 6341 gene locus_tag LOCUS_02810 6586 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9382 7097 gene locus_tag LOCUS_02820 9382 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9477 11456 gene locus_tag LOCUS_02830 9477 11456 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269255.1 protein_id gnl|my_center|LOCUS_02830 12876 11638 gene locus_tag LOCUS_02840 12876 11638 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_02840 13885 13043 gene locus_tag LOCUS_02850 13885 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 14598 13885 gene locus_tag LOCUS_02860 gene thiE 14598 13885 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_02860 14975 14595 gene locus_tag LOCUS_02870 14975 14595 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261316.1 protein_id gnl|my_center|LOCUS_02870 15973 14972 gene locus_tag LOCUS_02880 15973 14972 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_02880 16840 15989 gene locus_tag LOCUS_02890 16840 15989 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_02890 18419 16980 gene locus_tag LOCUS_02900 18419 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 18575 19105 gene locus_tag LOCUS_02910 18575 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 19354 19983 gene locus_tag LOCUS_02920 19354 19983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_02920 20026 20562 gene locus_tag LOCUS_02930 gene cobO 20026 20562 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083457.1 protein_id gnl|my_center|LOCUS_02930 20627 21388 gene locus_tag LOCUS_02940 gene phoB 20627 21388 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_02940 21731 21483 gene locus_tag LOCUS_02950 21731 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 22172 24577 gene locus_tag LOCUS_02960 22172 24577 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_02960 24818 24612 gene locus_tag LOCUS_02970 24818 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 26430 24967 gene locus_tag LOCUS_02980 26430 24967 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_02980 27970 26492 gene locus_tag LOCUS_02990 gene glgA 27970 26492 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_02990 30422 28068 gene locus_tag LOCUS_03000 gene glgB 30422 28068 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_03000 32119 30698 gene locus_tag LOCUS_03010 gene lpdA 32119 30698 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_03010 33473 32151 gene locus_tag LOCUS_03020 33473 32151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 36198 33523 gene locus_tag LOCUS_03030 gene aceE 36198 33523 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_03030 37881 36292 gene locus_tag LOCUS_03040 gene lnt 37881 36292 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_03040 38344 37874 gene locus_tag LOCUS_03050 gene ybeY 38344 37874 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391519.1 protein_id gnl|my_center|LOCUS_03050 40625 38292 gene locus_tag LOCUS_03060 40625 38292 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_03060 41633 40629 gene locus_tag LOCUS_03070 41633 40629 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_03070 43063 41771 gene locus_tag LOCUS_03080 gene miaB 43063 41771 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 protein_id gnl|my_center|LOCUS_03080 43602 43120 gene locus_tag LOCUS_03090 gene coaD 43602 43120 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830072.1 protein_id gnl|my_center|LOCUS_03090 44199 43609 gene locus_tag LOCUS_03100 gene rsmD 44199 43609 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241227.1 protein_id gnl|my_center|LOCUS_03100 44923 44228 gene locus_tag LOCUS_03110 44923 44228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 45157 45774 gene locus_tag LOCUS_03120 45157 45774 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_03120 46589 45819 gene locus_tag LOCUS_03130 46589 45819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 46919 46629 gene locus_tag LOCUS_03140 46919 46629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 47175 47089 gene locus_tag LOCUS_t00050 47175 47089 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48785 47349 gene locus_tag LOCUS_03150 48785 47349 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 protein_id gnl|my_center|LOCUS_03150 48996 49433 gene locus_tag LOCUS_03160 48996 49433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 49461 49982 gene locus_tag LOCUS_03170 49461 49982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 50788 51636 gene locus_tag LOCUS_03180 50788 51636 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_03180 51746 52591 gene locus_tag LOCUS_03190 51746 52591 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_03190 52706 53557 gene locus_tag LOCUS_03200 52706 53557 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_03200 53672 54517 gene locus_tag LOCUS_03210 53672 54517 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_03210 54626 55459 gene locus_tag LOCUS_03220 54626 55459 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987022.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence007 197 388 gene locus_tag LOCUS_03230 197 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 724 1041 gene locus_tag LOCUS_03240 gene rplU 724 1041 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_03240 1135 1386 gene locus_tag LOCUS_03250 gene rpmA 1135 1386 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918207.1 protein_id gnl|my_center|LOCUS_03250 1528 2676 gene locus_tag LOCUS_03260 gene obgE 1528 2676 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 protein_id gnl|my_center|LOCUS_03260 2660 3844 gene locus_tag LOCUS_03270 gene proB 2660 3844 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_03270 3881 5143 gene locus_tag LOCUS_03280 3881 5143 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810251.1 protein_id gnl|my_center|LOCUS_03280 5140 5805 gene locus_tag LOCUS_03290 gene nadD 5140 5805 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_03290 5853 6239 gene locus_tag LOCUS_03300 gene rsfS 5853 6239 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555337.1 protein_id gnl|my_center|LOCUS_03300 6240 6716 gene locus_tag LOCUS_03310 gene rlmH 6240 6716 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383438.1 protein_id gnl|my_center|LOCUS_03310 7127 6750 gene locus_tag LOCUS_03320 7127 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8263 7223 gene locus_tag LOCUS_03330 8263 7223 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_03330 8517 9092 gene locus_tag LOCUS_03340 8517 9092 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155857.1 protein_id gnl|my_center|LOCUS_03340 9206 10585 gene locus_tag LOCUS_03350 9206 10585 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_03350 11527 11051 gene locus_tag LOCUS_03360 11527 11051 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_03360 12121 11561 gene locus_tag LOCUS_03370 12121 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13264 12323 gene locus_tag LOCUS_03380 gene miaA 13264 12323 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_03380 13423 14592 gene locus_tag LOCUS_03390 13423 14592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_03390 14592 15332 gene locus_tag LOCUS_03400 14592 15332 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_03400 15613 15383 gene locus_tag LOCUS_03410 15613 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 16726 15632 gene locus_tag LOCUS_03420 16726 15632 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768894.1 protein_id gnl|my_center|LOCUS_03420 18070 16814 gene locus_tag LOCUS_03430 gene lysA 18070 16814 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_03430 18784 18389 gene locus_tag LOCUS_03440 18784 18389 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930690.1 protein_id gnl|my_center|LOCUS_03440 19018 19377 gene locus_tag LOCUS_03450 19018 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 19378 19974 gene locus_tag LOCUS_03460 19378 19974 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_03460 20066 20884 gene locus_tag LOCUS_03470 20066 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 22338 20932 gene locus_tag LOCUS_03480 gene argH 22338 20932 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_03480 23552 22335 gene locus_tag LOCUS_03490 23552 22335 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_03490 24612 23659 gene locus_tag LOCUS_03500 gene argF 24612 23659 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_03500 25786 24614 gene locus_tag LOCUS_03510 25786 24614 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_03510 26424 25954 gene locus_tag LOCUS_03520 26424 25954 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_03520 26666 26439 gene locus_tag LOCUS_03530 gene tusA 26666 26439 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_03530 26975 27610 gene locus_tag LOCUS_03540 26975 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 28242 27685 gene locus_tag LOCUS_03550 28242 27685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 29799 28435 gene locus_tag LOCUS_03560 29799 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 30359 32017 gene locus_tag LOCUS_03570 30359 32017 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085850.1 protein_id gnl|my_center|LOCUS_03570 32042 33013 gene locus_tag LOCUS_03580 32042 33013 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229534.1 protein_id gnl|my_center|LOCUS_03580 34307 33018 gene locus_tag LOCUS_03590 34307 33018 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_03590 35102 34344 gene locus_tag LOCUS_03600 35102 34344 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_03600 36213 35107 gene locus_tag LOCUS_03610 36213 35107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 37537 36269 gene locus_tag LOCUS_03620 37537 36269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 39712 37643 gene locus_tag LOCUS_03630 39712 37643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 40858 39917 gene locus_tag LOCUS_03640 40858 39917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 44268 41068 gene locus_tag LOCUS_03650 44268 41068 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_03650 44723 46000 gene locus_tag LOCUS_03660 44723 46000 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_03660 46615 46067 gene locus_tag LOCUS_03670 46615 46067 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_03670 46872 46612 gene locus_tag LOCUS_03680 46872 46612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 47124 47197 gene locus_tag LOCUS_t00060 47124 47197 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49711 47267 gene locus_tag LOCUS_03690 gene gyrB 49711 47267 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_03690 50833 49715 gene locus_tag LOCUS_03700 gene recF 50833 49715 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_03700 51971 50850 gene locus_tag LOCUS_03710 gene dnaN 51971 50850 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_03710 53390 51999 gene locus_tag LOCUS_03720 gene dnaA 53390 51999 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_03720 54484 53519 gene locus_tag LOCUS_03730 gene fmt 54484 53519 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_03730 54993 54481 gene locus_tag LOCUS_03740 gene def 54993 54481 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_03740 55517 55092 gene locus_tag LOCUS_03750 55517 55092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence008 307 576 gene locus_tag LOCUS_03760 307 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1438 1214 gene locus_tag LOCUS_03770 1438 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1680 1450 gene locus_tag LOCUS_03780 1680 1450 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_03780 1726 1917 gene locus_tag LOCUS_03790 1726 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2435 2229 gene locus_tag LOCUS_03800 2435 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2701 3048 gene locus_tag LOCUS_03810 2701 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3011 3244 gene locus_tag LOCUS_03820 3011 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5189 3354 gene locus_tag LOCUS_03830 5189 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5742 5197 gene locus_tag LOCUS_03840 5742 5197 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957880.1 protein_id gnl|my_center|LOCUS_03840 5947 7647 gene locus_tag LOCUS_03850 5947 7647 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_03850 8424 7831 gene locus_tag LOCUS_03860 8424 7831 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_03860 10572 8968 gene locus_tag LOCUS_03870 gene fumA 10572 8968 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_03870 11269 10679 gene locus_tag LOCUS_03880 11269 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11771 11433 gene locus_tag LOCUS_03890 11771 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 12787 12149 gene locus_tag LOCUS_03900 12787 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12689 13060 gene locus_tag LOCUS_03910 12689 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13572 13033 gene locus_tag LOCUS_03920 13572 13033 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_03920 13921 15909 gene locus_tag LOCUS_03930 13921 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 19237 15929 gene locus_tag LOCUS_03940 19237 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 19383 19646 gene locus_tag LOCUS_03950 19383 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 19671 19847 gene locus_tag LOCUS_03960 19671 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 20289 20525 gene locus_tag LOCUS_03970 20289 20525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 23427 21076 gene locus_tag LOCUS_03980 23427 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 23619 23897 gene locus_tag LOCUS_03990 23619 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 24457 23933 gene locus_tag LOCUS_04000 24457 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 24550 24882 gene locus_tag LOCUS_04010 24550 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 26134 24956 gene locus_tag LOCUS_04020 26134 24956 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 protein_id gnl|my_center|LOCUS_04020 28197 26131 gene locus_tag LOCUS_04030 gene uvrB 28197 26131 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_04030 28460 28993 gene locus_tag LOCUS_04040 28460 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 29083 30333 gene locus_tag LOCUS_04050 29083 30333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 30538 31131 gene locus_tag LOCUS_04060 30538 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 31655 33466 gene locus_tag LOCUS_04070 gene kdpA 31655 33466 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550718.1 protein_id gnl|my_center|LOCUS_04070 33480 35543 gene locus_tag LOCUS_04080 gene kdpB 33480 35543 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_04080 35555 36136 gene locus_tag LOCUS_04090 gene kdpC 35555 36136 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_04090 36133 38826 gene locus_tag LOCUS_04100 36133 38826 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_04100 38819 39517 gene locus_tag LOCUS_04110 gene kdpE 38819 39517 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_04110 39597 40649 gene locus_tag LOCUS_04120 39597 40649 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_04120 41007 40732 gene locus_tag LOCUS_04130 41007 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 41277 43289 gene locus_tag LOCUS_04140 gene speA 41277 43289 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_04140 43408 44874 gene locus_tag LOCUS_04150 43408 44874 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_04150 44886 48173 gene locus_tag LOCUS_04160 44886 48173 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 protein_id gnl|my_center|LOCUS_04160 48166 49722 gene locus_tag LOCUS_04170 48166 49722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 49738 51273 gene locus_tag LOCUS_04180 49738 51273 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_04180 51270 52775 gene locus_tag LOCUS_04190 51270 52775 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_04190 53293 52934 gene locus_tag LOCUS_04200 53293 52934 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence009 200 532 gene locus_tag LOCUS_04210 200 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 789 607 gene locus_tag LOCUS_04220 789 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2415 829 gene locus_tag LOCUS_04230 2415 829 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_04230 2785 2504 gene locus_tag LOCUS_04240 2785 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2841 3626 gene locus_tag LOCUS_04250 2841 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3781 4401 gene locus_tag LOCUS_04260 3781 4401 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_04260 4434 5651 gene locus_tag LOCUS_04270 gene sat 4434 5651 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_04270 5711 6142 gene locus_tag LOCUS_04280 gene aprB 5711 6142 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_04280 6211 8178 gene locus_tag LOCUS_04290 gene aprA 6211 8178 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_04290 8251 9144 gene locus_tag LOCUS_04300 8251 9144 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_04300 9201 9644 gene locus_tag LOCUS_04310 9201 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9950 10201 gene locus_tag LOCUS_04320 9950 10201 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390130.1 protein_id gnl|my_center|LOCUS_04320 10198 10503 gene locus_tag LOCUS_04330 10198 10503 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440152.1 protein_id gnl|my_center|LOCUS_04330 10888 10583 gene locus_tag LOCUS_04340 10888 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11444 10974 gene locus_tag LOCUS_04350 11444 10974 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095231.1 protein_id gnl|my_center|LOCUS_04350 12616 11453 gene locus_tag LOCUS_04360 12616 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 13619 12627 gene locus_tag LOCUS_04370 13619 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 14528 13728 gene locus_tag LOCUS_04380 14528 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 14822 15592 gene locus_tag LOCUS_04390 14822 15592 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_04390 15605 16474 gene locus_tag LOCUS_04400 15605 16474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_04400 16519 16968 gene locus_tag LOCUS_04410 gene mlaD 16519 16968 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_04410 17108 17731 gene locus_tag LOCUS_04420 17108 17731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_04420 18165 17833 gene locus_tag LOCUS_04430 gene soxZ 18165 17833 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_04430 18699 18223 gene locus_tag LOCUS_04440 18699 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19530 18910 gene locus_tag LOCUS_04450 19530 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 21106 19802 gene locus_tag LOCUS_04460 21106 19802 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_04460 21759 21130 gene locus_tag LOCUS_04470 21759 21130 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083419.1 protein_id gnl|my_center|LOCUS_04470 22432 21851 gene locus_tag LOCUS_04480 22432 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 23332 23024 gene locus_tag LOCUS_04490 23332 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 23481 23557 gene locus_tag LOCUS_t00070 23481 23557 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23567 23661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24800 26602 gene locus_tag LOCUS_04500 24800 26602 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_04500 26630 28726 gene locus_tag LOCUS_04510 26630 28726 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_04510 28980 30593 gene locus_tag LOCUS_04520 28980 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 31891 30668 gene locus_tag LOCUS_04530 31891 30668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 32008 33192 gene locus_tag LOCUS_04540 32008 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 32101 32198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33189 34193 gene locus_tag LOCUS_04550 33189 34193 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_04550 34504 34202 gene locus_tag LOCUS_04560 34504 34202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 35712 34510 gene locus_tag LOCUS_04570 35712 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 36291 35767 gene locus_tag LOCUS_04580 36291 35767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 37064 36294 gene locus_tag LOCUS_04590 37064 36294 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_04590 38026 37082 gene locus_tag LOCUS_04600 38026 37082 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_04600 39305 38100 gene locus_tag LOCUS_04610 gene flhF 39305 38100 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392312.1 protein_id gnl|my_center|LOCUS_04610 41429 39345 gene locus_tag LOCUS_04620 gene flhA 41429 39345 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_04620 41634 41837 gene locus_tag LOCUS_04630 41634 41837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 42032 43546 gene locus_tag LOCUS_04640 gene amrB 42032 43546 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_04640 43543 44847 gene locus_tag LOCUS_04650 43543 44847 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_04650 44853 45467 gene locus_tag LOCUS_04660 44853 45467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 48107 45489 gene locus_tag LOCUS_04670 48107 45489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 48853 48188 gene locus_tag LOCUS_04680 48853 48188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 51018 48853 gene locus_tag LOCUS_04690 51018 48853 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109314215.1 protein_id gnl|my_center|LOCUS_04690 51602 51075 gene locus_tag LOCUS_04700 51602 51075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence010 113 1885 gene locus_tag LOCUS_04710 113 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1968 3170 gene locus_tag LOCUS_04720 1968 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3392 3183 gene locus_tag LOCUS_04730 3392 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4641 3304 gene locus_tag LOCUS_04740 4641 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4827 7547 gene locus_tag LOCUS_04750 4827 7547 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_04750 7534 10902 gene locus_tag LOCUS_04760 7534 10902 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_04760 11851 10913 gene locus_tag LOCUS_04770 11851 10913 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316772.1 protein_id gnl|my_center|LOCUS_04770 12937 11870 gene locus_tag LOCUS_04780 12937 11870 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_04780 14745 12946 gene locus_tag LOCUS_04790 14745 12946 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_04790 15479 14823 gene locus_tag LOCUS_04800 15479 14823 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_04800 17502 15505 gene locus_tag LOCUS_04810 gene feoB 17502 15505 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_04810 18335 17616 gene locus_tag LOCUS_04820 18335 17616 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_04820 18752 18441 gene locus_tag LOCUS_04830 18752 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 19194 19961 gene locus_tag LOCUS_04840 19194 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20085 21287 gene locus_tag LOCUS_04850 20085 21287 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_04850 21674 21378 gene locus_tag LOCUS_04860 21674 21378 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_04860 21864 22100 gene locus_tag LOCUS_04870 21864 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 22792 22151 gene locus_tag LOCUS_04880 22792 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 22728 22898 gene locus_tag LOCUS_04890 22728 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 23677 22886 gene locus_tag LOCUS_04900 23677 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 24078 23719 gene locus_tag LOCUS_04910 24078 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24788 24123 gene locus_tag LOCUS_04920 24788 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 26565 24865 gene locus_tag LOCUS_04930 26565 24865 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_04930 26983 27927 gene locus_tag LOCUS_04940 26983 27927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 27917 28582 gene locus_tag LOCUS_04950 27917 28582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 28569 30734 gene locus_tag LOCUS_04960 28569 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 31015 31491 gene locus_tag LOCUS_04970 31015 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 31488 31691 gene locus_tag LOCUS_04980 31488 31691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 31681 31833 gene locus_tag LOCUS_04990 31681 31833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 32049 33338 gene locus_tag LOCUS_05000 32049 33338 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_05000 33335 34006 gene locus_tag LOCUS_05010 33335 34006 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_05010 35478 35041 gene locus_tag LOCUS_05020 35478 35041 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_05020 36602 35649 gene locus_tag LOCUS_05030 36602 35649 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_05030 37629 36670 gene locus_tag LOCUS_05040 37629 36670 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_05040 38497 37664 gene locus_tag LOCUS_05050 38497 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 40332 38494 gene locus_tag LOCUS_05060 40332 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 43784 40329 gene locus_tag LOCUS_05070 43784 40329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 44842 43781 gene locus_tag LOCUS_05080 44842 43781 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_05080 45818 44835 gene locus_tag LOCUS_05090 45818 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 46804 45815 gene locus_tag LOCUS_05100 46804 45815 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_05100 47802 46819 gene locus_tag LOCUS_05110 47802 46819 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_05110 48610 49854 gene locus_tag LOCUS_05120 48610 49854 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_05120 50027 49803 gene locus_tag LOCUS_05130 50027 49803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 50454 50684 gene locus_tag LOCUS_05140 50454 50684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 50728 50958 gene locus_tag LOCUS_05150 50728 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 51184 51108 gene locus_tag LOCUS_t00080 51184 51108 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 564 280 gene locus_tag LOCUS_05160 564 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1429 791 gene locus_tag LOCUS_05170 1429 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2015 1383 gene locus_tag LOCUS_05180 2015 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2341 2015 gene locus_tag LOCUS_05190 2341 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2748 2338 gene locus_tag LOCUS_05200 2748 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5550 3208 gene locus_tag LOCUS_05210 5550 3208 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_05210 5947 6183 gene locus_tag LOCUS_05220 5947 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6769 6215 gene locus_tag LOCUS_05230 6769 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7792 6782 gene locus_tag LOCUS_05240 7792 6782 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940417.1 protein_id gnl|my_center|LOCUS_05240 8907 7855 gene locus_tag LOCUS_05250 gene tsaD 8907 7855 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160825.1 protein_id gnl|my_center|LOCUS_05250 9085 10023 gene locus_tag LOCUS_05260 gene hemC 9085 10023 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_05260 10016 10825 gene locus_tag LOCUS_05270 10016 10825 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141649149.1 protein_id gnl|my_center|LOCUS_05270 10973 11281 gene locus_tag LOCUS_05280 10973 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11324 12058 gene locus_tag LOCUS_05290 gene bfmR 11324 12058 CDS product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 protein_id gnl|my_center|LOCUS_05290 12082 12579 gene locus_tag LOCUS_05300 12082 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13011 12574 gene locus_tag LOCUS_05310 gene dtd 13011 12574 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560978.1 protein_id gnl|my_center|LOCUS_05310 13144 16488 gene locus_tag LOCUS_05320 13144 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16717 18780 gene locus_tag LOCUS_05330 16717 18780 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_05330 18795 22898 gene locus_tag LOCUS_05340 18795 22898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 22895 23935 gene locus_tag LOCUS_05350 22895 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 24070 24816 gene locus_tag LOCUS_05360 24070 24816 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_05360 25400 24981 gene locus_tag LOCUS_05370 25400 24981 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_05370 26874 25480 gene locus_tag LOCUS_05380 gene atpD 26874 25480 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_05380 27822 26953 gene locus_tag LOCUS_05390 gene atpG 27822 26953 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_05390 29437 27896 gene locus_tag LOCUS_05400 gene atpA 29437 27896 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_05400 30134 29598 gene locus_tag LOCUS_05410 30134 29598 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 protein_id gnl|my_center|LOCUS_05410 30604 30134 gene locus_tag LOCUS_05420 30604 30134 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815350.1 protein_id gnl|my_center|LOCUS_05420 30916 30644 gene locus_tag LOCUS_05430 gene atpE 30916 30644 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_05430 31768 30959 gene locus_tag LOCUS_05440 gene atpB 31768 30959 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 protein_id gnl|my_center|LOCUS_05440 32004 31774 gene locus_tag LOCUS_05450 32004 31774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 32739 32341 gene locus_tag LOCUS_05460 32739 32341 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_05460 34394 32736 gene locus_tag LOCUS_05470 34394 32736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05470 34784 35911 gene locus_tag LOCUS_05480 34784 35911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 34947 35042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35908 36420 gene locus_tag LOCUS_05490 gene purE 35908 36420 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_05490 36823 36458 gene locus_tag LOCUS_05500 36823 36458 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_05500 37688 36903 gene locus_tag LOCUS_05510 gene trpA 37688 36903 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_05510 38977 37751 gene locus_tag LOCUS_05520 gene trpB 38977 37751 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037673.1 protein_id gnl|my_center|LOCUS_05520 39078 40403 gene locus_tag LOCUS_05530 39078 40403 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_05530 40459 41670 gene locus_tag LOCUS_05540 40459 41670 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_05540 41667 42806 gene locus_tag LOCUS_05550 41667 42806 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_05550 42917 43423 gene locus_tag LOCUS_05560 42917 43423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 43566 43775 gene locus_tag LOCUS_05570 43566 43775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 43960 43790 gene locus_tag LOCUS_05580 43960 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 44093 44692 gene locus_tag LOCUS_05590 44093 44692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 44689 46389 gene locus_tag LOCUS_05600 44689 46389 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532602.1 protein_id gnl|my_center|LOCUS_05600 46432 46803 gene locus_tag LOCUS_05610 gene folX 46432 46803 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068457.1 protein_id gnl|my_center|LOCUS_05610 46782 47351 gene locus_tag LOCUS_05620 gene folK 46782 47351 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_05620 47483 48376 gene locus_tag LOCUS_05630 gene dapA 47483 48376 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_05630 48432 48929 gene locus_tag LOCUS_05640 48432 48929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 49090 49557 gene locus_tag LOCUS_05650 49090 49557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence012 194 937 gene locus_tag LOCUS_05660 194 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 955 1695 gene locus_tag LOCUS_05670 955 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2901 1813 gene locus_tag LOCUS_05680 gene lptG 2901 1813 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537773.1 protein_id gnl|my_center|LOCUS_05680 4054 2906 gene locus_tag LOCUS_05690 gene lptF 4054 2906 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_05690 4156 5685 gene locus_tag LOCUS_05700 4156 5685 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_05700 5686 6174 gene locus_tag LOCUS_05710 5686 6174 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974965.1 protein_id gnl|my_center|LOCUS_05710 6246 8933 gene locus_tag LOCUS_05720 6246 8933 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_05720 9535 8945 gene locus_tag LOCUS_05730 9535 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 10240 10689 gene locus_tag LOCUS_05740 10240 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 11003 13036 gene locus_tag LOCUS_05750 11003 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14074 13100 gene locus_tag LOCUS_05760 14074 13100 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_05760 14810 14253 gene locus_tag LOCUS_05770 14810 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 15944 14865 gene locus_tag LOCUS_05780 15944 14865 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_05780 18607 15941 gene locus_tag LOCUS_05790 18607 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 20670 18883 gene locus_tag LOCUS_05800 20670 18883 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_05800 23235 21118 gene locus_tag LOCUS_05810 23235 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 24679 23531 gene locus_tag LOCUS_05820 24679 23531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 24730 25515 gene locus_tag LOCUS_05830 24730 25515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 25701 26189 gene locus_tag LOCUS_05840 25701 26189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 26485 26898 gene locus_tag LOCUS_05850 26485 26898 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_05850 26898 27221 gene locus_tag LOCUS_05860 26898 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 27226 27660 gene locus_tag LOCUS_05870 27226 27660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 28828 27734 gene locus_tag LOCUS_05880 gene aroB 28828 27734 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_05880 31272 28825 gene locus_tag LOCUS_05890 gene pilQ 31272 28825 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_05890 31751 31278 gene locus_tag LOCUS_05900 31751 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 32361 31756 gene locus_tag LOCUS_05910 32361 31756 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_05910 33005 32361 gene locus_tag LOCUS_05920 33005 32361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 34136 33006 gene locus_tag LOCUS_05930 gene pilM 34136 33006 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_05930 34422 37073 gene locus_tag LOCUS_05940 34422 37073 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_05940 37135 37896 gene locus_tag LOCUS_05950 37135 37896 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_05950 38024 39058 gene locus_tag LOCUS_05960 38024 39058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 39313 39519 gene locus_tag LOCUS_05970 39313 39519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 39936 40382 gene locus_tag LOCUS_05980 39936 40382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 40518 40868 gene locus_tag LOCUS_05990 40518 40868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 41774 40962 gene locus_tag LOCUS_06000 gene phoU 41774 40962 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_06000 42565 41783 gene locus_tag LOCUS_06010 gene pstB 42565 41783 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_06010 43444 42599 gene locus_tag LOCUS_06020 gene pstA 43444 42599 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_06020 44465 43455 gene locus_tag LOCUS_06030 gene pstC 44465 43455 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 protein_id gnl|my_center|LOCUS_06030 45566 44511 gene locus_tag LOCUS_06040 gene pstS 45566 44511 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867129.1 protein_id gnl|my_center|LOCUS_06040 46115 45612 gene locus_tag LOCUS_06050 46115 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 47321 46410 gene locus_tag LOCUS_06060 gene miaA 47321 46410 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_06060 48173 47352 gene locus_tag LOCUS_06070 48173 47352 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_06070 48411 48641 gene locus_tag LOCUS_06080 48411 48641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 48631 48978 gene locus_tag LOCUS_06090 48631 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence013 423 1409 gene locus_tag LOCUS_06100 423 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1568 4483 gene locus_tag LOCUS_06110 1568 4483 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_06110 4554 5750 gene locus_tag LOCUS_06120 gene odhB 4554 5750 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388969.1 protein_id gnl|my_center|LOCUS_06120 5774 7183 gene locus_tag LOCUS_06130 gene lpdA 5774 7183 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_06130 7662 7330 gene locus_tag LOCUS_06140 7662 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8757 7735 gene locus_tag LOCUS_06150 8757 7735 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516121.1 protein_id gnl|my_center|LOCUS_06150 9404 8778 gene locus_tag LOCUS_06160 gene rpsD 9404 8778 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_06160 9836 9444 gene locus_tag LOCUS_06170 gene rpsK 9836 9444 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_06170 10309 9941 gene locus_tag LOCUS_06180 gene rpsM 10309 9941 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_06180 11844 10510 gene locus_tag LOCUS_06190 gene secY 11844 10510 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_06190 12316 11858 gene locus_tag LOCUS_06200 gene rplO 12316 11858 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_06200 12512 12330 gene locus_tag LOCUS_06210 gene rpmD 12512 12330 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_06210 13071 12544 gene locus_tag LOCUS_06220 gene rpsE 13071 12544 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006333394.1 protein_id gnl|my_center|LOCUS_06220 13513 13148 gene locus_tag LOCUS_06230 gene rplR 13513 13148 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 protein_id gnl|my_center|LOCUS_06230 14069 13536 gene locus_tag LOCUS_06240 gene rplF 14069 13536 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_06240 14488 14093 gene locus_tag LOCUS_06250 gene rpsH 14488 14093 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 protein_id gnl|my_center|LOCUS_06250 15271 14768 gene locus_tag LOCUS_06260 gene rplE 15271 14768 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_06260 15674 15348 gene locus_tag LOCUS_06270 gene rplX 15674 15348 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596219.1 protein_id gnl|my_center|LOCUS_06270 16085 15717 gene locus_tag LOCUS_06280 gene rplN 16085 15717 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_06280 16321 16082 gene locus_tag LOCUS_06290 gene rpsQ 16321 16082 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313974.1 protein_id gnl|my_center|LOCUS_06290 16530 16324 gene locus_tag LOCUS_06300 gene rpmC 16530 16324 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_06300 16949 16530 gene locus_tag LOCUS_06310 gene rplP 16949 16530 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008549252.1 protein_id gnl|my_center|LOCUS_06310 17668 17033 gene locus_tag LOCUS_06320 gene rpsC 17668 17033 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_06320 18074 17739 gene locus_tag LOCUS_06330 gene rplV 18074 17739 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387269.1 protein_id gnl|my_center|LOCUS_06330 19258 18434 gene locus_tag LOCUS_06340 gene rplB 19258 18434 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_06340 19596 19297 gene locus_tag LOCUS_06350 19596 19297 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_06350 20213 19593 gene locus_tag LOCUS_06360 gene rplD 20213 19593 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_06360 20875 20240 gene locus_tag LOCUS_06370 gene rplC 20875 20240 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_06370 21256 20948 gene locus_tag LOCUS_06380 gene rpsJ 21256 20948 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_06380 22507 21317 gene locus_tag LOCUS_06390 gene tuf 22507 21317 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390500.1 protein_id gnl|my_center|LOCUS_06390 24683 22518 gene locus_tag LOCUS_06400 gene fusA 24683 22518 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_06400 25147 24677 gene locus_tag LOCUS_06410 gene rpsG 25147 24677 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_06410 25605 25234 gene locus_tag LOCUS_06420 gene rpsL 25605 25234 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_06420 29990 25758 gene locus_tag LOCUS_06430 gene rpoC 29990 25758 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_06430 34129 30044 gene locus_tag LOCUS_06440 gene rpoB 34129 30044 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_06440 34705 34319 gene locus_tag LOCUS_06450 gene rplL 34705 34319 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_06450 35300 34779 gene locus_tag LOCUS_06460 gene rplJ 35300 34779 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_06460 36254 35565 gene locus_tag LOCUS_06470 gene rplA 36254 35565 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390508.1 protein_id gnl|my_center|LOCUS_06470 36697 36269 gene locus_tag LOCUS_06480 gene rplK 36697 36269 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 protein_id gnl|my_center|LOCUS_06480 37330 36800 gene locus_tag LOCUS_06490 gene nusG 37330 36800 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_06490 37618 37427 gene locus_tag LOCUS_06500 37618 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 37935 37860 gene locus_tag LOCUS_t00090 37935 37860 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 38136 37981 gene locus_tag LOCUS_06510 gene rpmG 38136 37981 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_06510 39438 38248 gene locus_tag LOCUS_06520 gene tuf 39438 38248 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390500.1 protein_id gnl|my_center|LOCUS_06520 39588 39513 gene locus_tag LOCUS_t00100 39588 39513 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39749 39676 gene locus_tag LOCUS_t00110 39749 39676 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39858 39774 gene locus_tag LOCUS_t00120 39858 39774 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 40482 39901 gene locus_tag LOCUS_06530 40482 39901 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_06530 40706 41308 gene locus_tag LOCUS_06540 40706 41308 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_06540 41347 41736 gene locus_tag LOCUS_06550 41347 41736 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_06550 43359 41824 gene locus_tag LOCUS_06560 43359 41824 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_06560 43615 43364 gene locus_tag LOCUS_06570 43615 43364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 44543 43710 gene locus_tag LOCUS_06580 44543 43710 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_06580 45619 44612 gene locus_tag LOCUS_06590 45619 44612 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 protein_id gnl|my_center|LOCUS_06590 46310 45690 gene locus_tag LOCUS_06600 46310 45690 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073576.1 protein_id gnl|my_center|LOCUS_06600 46338 47309 gene locus_tag LOCUS_06610 46338 47309 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968913.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence014 191 2188 gene locus_tag LOCUS_06620 gene uvrD 191 2188 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_06620 2249 3010 gene locus_tag LOCUS_06630 2249 3010 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_06630 4573 3035 gene locus_tag LOCUS_06640 4573 3035 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_06640 5150 4773 gene locus_tag LOCUS_06650 5150 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5575 6216 gene locus_tag LOCUS_06660 5575 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7888 6320 gene locus_tag LOCUS_06670 gene guaA 7888 6320 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_06670 9423 7963 gene locus_tag LOCUS_06680 gene guaB 9423 7963 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_06680 10106 9420 gene locus_tag LOCUS_06690 gene rlmE 10106 9420 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_06690 10594 10118 gene locus_tag LOCUS_06700 gene greA 10594 10118 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_06700 13920 10669 gene locus_tag LOCUS_06710 gene carB 13920 10669 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_06710 15109 13934 gene locus_tag LOCUS_06720 gene carA 15109 13934 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_06720 15529 15951 gene locus_tag LOCUS_06730 15529 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 15985 17301 gene locus_tag LOCUS_06740 15985 17301 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_06740 17305 18693 gene locus_tag LOCUS_06750 17305 18693 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_06750 18738 19682 gene locus_tag LOCUS_06760 18738 19682 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989826.1 protein_id gnl|my_center|LOCUS_06760 19757 20689 gene locus_tag LOCUS_06770 gene ispH 19757 20689 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_06770 20702 21508 gene locus_tag LOCUS_06780 20702 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 21505 22245 gene locus_tag LOCUS_06790 gene kdsB 21505 22245 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_06790 22245 22577 gene locus_tag LOCUS_06800 22245 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 24009 22711 gene locus_tag LOCUS_06810 gene hemL 24009 22711 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_06810 24142 24894 gene locus_tag LOCUS_06820 24142 24894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 24908 25825 gene locus_tag LOCUS_06830 24908 25825 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_06830 25880 27880 gene locus_tag LOCUS_06840 25880 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 27915 29507 gene locus_tag LOCUS_06850 27915 29507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 31138 29504 gene locus_tag LOCUS_06860 gene ubiB 31138 29504 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_06860 31852 31145 gene locus_tag LOCUS_06870 31852 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 32599 31856 gene locus_tag LOCUS_06880 gene ubiE 32599 31856 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958603.1 protein_id gnl|my_center|LOCUS_06880 32793 34628 gene locus_tag LOCUS_06890 gene ubiD 32793 34628 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009479.1 protein_id gnl|my_center|LOCUS_06890 34784 35080 gene locus_tag LOCUS_06900 34784 35080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 35284 36225 gene locus_tag LOCUS_06910 35284 36225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815477.1 protein_id gnl|my_center|LOCUS_06910 36523 37446 gene locus_tag LOCUS_06920 36523 37446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_06920 37550 37825 gene locus_tag LOCUS_06930 37550 37825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 38121 37933 gene locus_tag LOCUS_06940 38121 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 39899 38256 gene locus_tag LOCUS_06950 39899 38256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 40894 39890 gene locus_tag LOCUS_06960 40894 39890 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_06960 40987 41379 gene locus_tag LOCUS_06970 40987 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 41401 42306 gene locus_tag LOCUS_06980 41401 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 42455 44332 gene locus_tag LOCUS_06990 42455 44332 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 protein_id gnl|my_center|LOCUS_06990 44638 44384 gene locus_tag LOCUS_07000 44638 44384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence015 201 1208 gene locus_tag LOCUS_07010 gene prfB 201 1208 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 protein_id gnl|my_center|LOCUS_07010 1258 2745 gene locus_tag LOCUS_07020 gene lysS 1258 2745 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_07020 2759 4006 gene locus_tag LOCUS_07030 2759 4006 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_07030 3999 4745 gene locus_tag LOCUS_07040 3999 4745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_07040 4742 5416 gene locus_tag LOCUS_07050 4742 5416 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_07050 5710 7473 gene locus_tag LOCUS_07060 5710 7473 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 protein_id gnl|my_center|LOCUS_07060 7505 7870 gene locus_tag LOCUS_07070 7505 7870 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_07070 7909 8592 gene locus_tag LOCUS_07080 7909 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 8604 9299 gene locus_tag LOCUS_07090 8604 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 9316 12033 gene locus_tag LOCUS_07100 9316 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 12063 13016 gene locus_tag LOCUS_07110 12063 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 13006 14100 gene locus_tag LOCUS_07120 13006 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14126 14527 gene locus_tag LOCUS_07130 14126 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14558 15223 gene locus_tag LOCUS_07140 14558 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 15230 15784 gene locus_tag LOCUS_07150 15230 15784 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_07150 15850 16551 gene locus_tag LOCUS_07160 gene queC 15850 16551 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_07160 16562 17653 gene locus_tag LOCUS_07170 16562 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 17742 18164 gene locus_tag LOCUS_07180 17742 18164 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_07180 18161 18394 gene locus_tag LOCUS_07190 18161 18394 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_07190 21196 18527 gene locus_tag LOCUS_07200 gene ppdK 21196 18527 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_07200 22043 21297 gene locus_tag LOCUS_07210 gene pomA 22043 21297 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_07210 22832 22077 gene locus_tag LOCUS_07220 22832 22077 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937942.1 protein_id gnl|my_center|LOCUS_07220 23259 23714 gene locus_tag LOCUS_07230 23259 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24434 23730 gene locus_tag LOCUS_07240 gene kdpE 24434 23730 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_07240 25911 24445 gene locus_tag LOCUS_07250 25911 24445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 25981 26484 gene locus_tag LOCUS_07260 25981 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 26625 27323 gene locus_tag LOCUS_07270 gene cysE 26625 27323 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_07270 27320 27772 gene locus_tag LOCUS_07280 gene iscR 27320 27772 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_07280 27769 28914 gene locus_tag LOCUS_07290 27769 28914 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_07290 28921 30132 gene locus_tag LOCUS_07300 28921 30132 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_07300 30159 30557 gene locus_tag LOCUS_07310 gene iscU 30159 30557 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_07310 30547 30888 gene locus_tag LOCUS_07320 gene iscA 30547 30888 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702422.1 protein_id gnl|my_center|LOCUS_07320 30941 31546 gene locus_tag LOCUS_07330 gene hscB 30941 31546 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812456.1 protein_id gnl|my_center|LOCUS_07330 31573 33459 gene locus_tag LOCUS_07340 gene hscA 31573 33459 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_07340 33472 33813 gene locus_tag LOCUS_07350 33472 33813 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_07350 33810 34004 gene locus_tag LOCUS_07360 gene iscX 33810 34004 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_07360 34648 34034 gene locus_tag LOCUS_07370 34648 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 34666 34759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35214 36536 gene locus_tag LOCUS_07380 35214 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 37911 36544 gene locus_tag LOCUS_07390 37911 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 38982 37951 gene locus_tag LOCUS_07400 gene legI 38982 37951 CDS product N,N'-diacetyllegionaminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864265.1 protein_id gnl|my_center|LOCUS_07400 39966 39007 gene locus_tag LOCUS_07410 39966 39007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 41801 40011 gene locus_tag LOCUS_07420 41801 40011 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_07420 42390 42154 gene locus_tag LOCUS_07430 42390 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence016 <1 1681 gene locus_tag LOCUS_07440 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529846.1:HlyD family type I secretion periplasmic adaptor subunit 2105 4297 gene locus_tag LOCUS_07450 2105 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4294 8325 gene locus_tag LOCUS_07460 4294 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8335 8757 gene locus_tag LOCUS_07470 8335 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8930 9265 gene locus_tag LOCUS_07480 8930 9265 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 protein_id gnl|my_center|LOCUS_07480 10261 9374 gene locus_tag LOCUS_07490 10261 9374 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_07490 11148 10258 gene locus_tag LOCUS_07500 11148 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11544 11933 gene locus_tag LOCUS_07510 gene yajC 11544 11933 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_07510 11973 13565 gene locus_tag LOCUS_07520 gene secD 11973 13565 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_07520 13612 14550 gene locus_tag LOCUS_07530 gene secF 13612 14550 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262436.1 protein_id gnl|my_center|LOCUS_07530 14547 14936 gene locus_tag LOCUS_07540 14547 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 15022 15390 gene locus_tag LOCUS_07550 15022 15390 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_07550 16494 15400 gene locus_tag LOCUS_07560 gene hemE 16494 15400 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_07560 16601 17596 gene locus_tag LOCUS_07570 16601 17596 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349123.1 protein_id gnl|my_center|LOCUS_07570 18740 17718 gene locus_tag LOCUS_07580 18740 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 19705 18737 gene locus_tag LOCUS_07590 19705 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 21102 19711 gene locus_tag LOCUS_07600 21102 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 22011 21175 gene locus_tag LOCUS_07610 22011 21175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 23737 22025 gene locus_tag LOCUS_07620 23737 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 24970 23816 gene locus_tag LOCUS_07630 24970 23816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 28471 24983 gene locus_tag LOCUS_07640 28471 24983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 29529 28525 gene locus_tag LOCUS_07650 29529 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 30602 29667 gene locus_tag LOCUS_07660 30602 29667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 30729 34535 gene locus_tag LOCUS_07670 30729 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 35300 34545 gene locus_tag LOCUS_07680 35300 34545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 35556 35386 gene locus_tag LOCUS_07690 35556 35386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 35704 37458 gene locus_tag LOCUS_07700 35704 37458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 37583 39367 gene locus_tag LOCUS_07710 37583 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence017 253 1281 gene locus_tag LOCUS_07720 253 1281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_07720 1341 5150 gene locus_tag LOCUS_07730 1341 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5160 7862 gene locus_tag LOCUS_07740 5160 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7859 8272 gene locus_tag LOCUS_07750 7859 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8350 12096 gene locus_tag LOCUS_07760 8350 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12100 14409 gene locus_tag LOCUS_07770 12100 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 14393 15226 gene locus_tag LOCUS_07780 14393 15226 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_07780 15223 15810 gene locus_tag LOCUS_07790 15223 15810 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 protein_id gnl|my_center|LOCUS_07790 15803 18655 gene locus_tag LOCUS_07800 15803 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18652 19548 gene locus_tag LOCUS_07810 18652 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 19903 19556 gene locus_tag LOCUS_07820 19903 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20146 20307 gene locus_tag LOCUS_07830 20146 20307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 20331 21473 gene locus_tag LOCUS_07840 20331 21473 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_07840 21910 21584 gene locus_tag LOCUS_07850 21910 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23162 22059 gene locus_tag LOCUS_07860 23162 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 24103 23162 gene locus_tag LOCUS_07870 24103 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 26012 24225 gene locus_tag LOCUS_07880 26012 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 26638 26042 gene locus_tag LOCUS_07890 26638 26042 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545221.1 protein_id gnl|my_center|LOCUS_07890 27418 26657 gene locus_tag LOCUS_07900 27418 26657 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 protein_id gnl|my_center|LOCUS_07900 28261 27506 gene locus_tag LOCUS_07910 gene pomA 28261 27506 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_07910 29374 28412 gene locus_tag LOCUS_07920 29374 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30949 29588 gene locus_tag LOCUS_07930 30949 29588 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_07930 31393 30953 gene locus_tag LOCUS_07940 31393 30953 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_07940 32123 31407 gene locus_tag LOCUS_07950 gene lipB 32123 31407 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_07950 33002 32130 gene locus_tag LOCUS_07960 gene lipA 33002 32130 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_07960 33265 34299 gene locus_tag LOCUS_07970 33265 34299 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_07970 34301 34987 gene locus_tag LOCUS_07980 34301 34987 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_07980 36112 35021 gene locus_tag LOCUS_07990 36112 35021 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_07990 36400 37218 gene locus_tag LOCUS_08000 36400 37218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 37350 37547 gene locus_tag LOCUS_08010 37350 37547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence018 <1 7327 gene locus_tag LOCUS_08020 <1 7327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 7362 9311 gene locus_tag LOCUS_08030 7362 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9329 10966 gene locus_tag LOCUS_08040 9329 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 10979 12274 gene locus_tag LOCUS_08050 10979 12274 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_08050 13150 12281 gene locus_tag LOCUS_08060 13150 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 15065 13482 gene locus_tag LOCUS_08070 15065 13482 CDS product MCP four helix bundle domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941343.1 protein_id gnl|my_center|LOCUS_08070 15593 16714 gene locus_tag LOCUS_08080 15593 16714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 16811 19873 gene locus_tag LOCUS_08090 16811 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 19908 20966 gene locus_tag LOCUS_08100 19908 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20998 21582 gene locus_tag LOCUS_08110 20998 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_08110 21595 22356 gene locus_tag LOCUS_08120 gene fabI 21595 22356 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195584.1 protein_id gnl|my_center|LOCUS_08120 22362 23741 gene locus_tag LOCUS_08130 22362 23741 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 protein_id gnl|my_center|LOCUS_08130 23986 24243 gene locus_tag LOCUS_08140 23986 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 24287 25096 gene locus_tag LOCUS_08150 24287 25096 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707450.1 protein_id gnl|my_center|LOCUS_08150 25093 27237 gene locus_tag LOCUS_08160 25093 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 28646 27345 gene locus_tag LOCUS_08170 gene eno 28646 27345 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_08170 30151 28652 gene locus_tag LOCUS_08180 gene gcvPB 30151 28652 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_08180 31503 30148 gene locus_tag LOCUS_08190 gene gcvPA 31503 30148 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_08190 31703 32350 gene locus_tag LOCUS_08200 31703 32350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 32438 32644 gene locus_tag LOCUS_08210 32438 32644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 32650 33549 gene locus_tag LOCUS_08220 32650 33549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 35535 33562 gene locus_tag LOCUS_08230 35535 33562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence019 1474 467 gene locus_tag LOCUS_08240 1474 467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_08240 1774 3177 gene locus_tag LOCUS_08250 gene tolB 1774 3177 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066846.1 protein_id gnl|my_center|LOCUS_08250 3254 3784 gene locus_tag LOCUS_08260 gene pal 3254 3784 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_08260 3808 4863 gene locus_tag LOCUS_08270 3808 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4974 6065 gene locus_tag LOCUS_08280 4974 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6749 7642 gene locus_tag LOCUS_08290 gene rpoH 6749 7642 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_08290 7897 9954 gene locus_tag LOCUS_08300 gene ftsH 7897 9954 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_08300 9951 11174 gene locus_tag LOCUS_08310 9951 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11171 12595 gene locus_tag LOCUS_08320 gene glmM 11171 12595 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_08320 12633 14504 gene locus_tag LOCUS_08330 gene thrS 12633 14504 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_08330 14894 14592 gene locus_tag LOCUS_08340 14894 14592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14781 15146 gene locus_tag LOCUS_08350 14781 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15260 15460 gene locus_tag LOCUS_08360 gene rpmI 15260 15460 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_08360 15542 15913 gene locus_tag LOCUS_08370 gene rplT 15542 15913 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 protein_id gnl|my_center|LOCUS_08370 16121 17170 gene locus_tag LOCUS_08380 gene pheS 16121 17170 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_08380 17174 19549 gene locus_tag LOCUS_08390 gene pheT 17174 19549 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 protein_id gnl|my_center|LOCUS_08390 19696 20886 gene locus_tag LOCUS_08400 19696 20886 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_08400 20973 21419 gene locus_tag LOCUS_08410 20973 21419 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_08410 21455 23026 gene locus_tag LOCUS_08420 21455 23026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 23344 23120 gene locus_tag LOCUS_08430 gene rpmE 23344 23120 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896340.1 protein_id gnl|my_center|LOCUS_08430 24700 23411 gene locus_tag LOCUS_08440 gene rho 24700 23411 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_08440 25823 25110 gene locus_tag LOCUS_08450 gene coaE 25823 25110 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_08450 26634 25855 gene locus_tag LOCUS_08460 26634 25855 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_08460 26922 28259 gene locus_tag LOCUS_08470 gene trmFO 26922 28259 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_08470 28464 30518 gene locus_tag LOCUS_08480 28464 30518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 30587 31399 gene locus_tag LOCUS_08490 gene prmC 30587 31399 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_08490 31527 32345 gene locus_tag LOCUS_08500 31527 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 32528 34513 gene locus_tag LOCUS_08510 32528 34513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence020 794 276 gene locus_tag LOCUS_08520 794 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 981 2705 gene locus_tag LOCUS_08530 981 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2726 3625 gene locus_tag LOCUS_08540 gene speB 2726 3625 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_08540 3720 4574 gene locus_tag LOCUS_08550 3720 4574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_08550 5134 4631 gene locus_tag LOCUS_08560 5134 4631 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_08560 5420 5638 gene locus_tag LOCUS_08570 gene infA 5420 5638 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_08570 5792 6133 gene locus_tag LOCUS_08580 5792 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6213 6968 gene locus_tag LOCUS_08590 6213 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7059 7145 gene locus_tag LOCUS_t00130 7059 7145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11349 7366 gene locus_tag LOCUS_08600 11349 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204821.1 protein_id gnl|my_center|LOCUS_08600 11956 11962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12574 11978 gene locus_tag LOCUS_08610 12574 11978 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_08610 12637 12804 gene locus_tag LOCUS_08620 12637 12804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13307 12777 gene locus_tag LOCUS_08630 13307 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 14975 13611 gene locus_tag LOCUS_08640 gene mtaB 14975 13611 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_08640 15054 16442 gene locus_tag LOCUS_08650 15054 16442 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627718.1 protein_id gnl|my_center|LOCUS_08650 16489 18150 gene locus_tag LOCUS_08660 16489 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18218 19477 gene locus_tag LOCUS_08670 18218 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 20157 21386 gene locus_tag LOCUS_08680 20157 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 21407 22390 gene locus_tag LOCUS_08690 21407 22390 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_08690 22394 23137 gene locus_tag LOCUS_08700 22394 23137 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864434.1 protein_id gnl|my_center|LOCUS_08700 23134 24123 gene locus_tag LOCUS_08710 23134 24123 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_08710 24969 24100 gene locus_tag LOCUS_08720 24969 24100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 25491 25105 gene locus_tag LOCUS_08730 25491 25105 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081018.1 protein_id gnl|my_center|LOCUS_08730 25861 25535 gene locus_tag LOCUS_08740 25861 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 27463 25910 gene locus_tag LOCUS_08750 27463 25910 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_08750 27869 29128 gene locus_tag LOCUS_08760 gene murA 27869 29128 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946583.1 protein_id gnl|my_center|LOCUS_08760 29121 30485 gene locus_tag LOCUS_08770 gene hisD 29121 30485 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537892.1 protein_id gnl|my_center|LOCUS_08770 30482 31078 gene locus_tag LOCUS_08780 gene hisB 30482 31078 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_08780 31075 31710 gene locus_tag LOCUS_08790 gene hisH 31075 31710 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_08790 32257 32353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32510 33286 gene locus_tag LOCUS_08800 gene hisF 32510 33286 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_08800 33295 33687 gene locus_tag LOCUS_08810 gene hisI 33295 33687 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_08810 33710 34060 gene locus_tag LOCUS_08820 33710 34060 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_08820 34057 35253 gene locus_tag LOCUS_08830 34057 35253 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071381.1 protein_id gnl|my_center|LOCUS_08830 35513 35346 gene locus_tag LOCUS_08840 35513 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence021 <1 963 gene locus_tag LOCUS_08850 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257896.1:Fic family protein 963 1115 gene locus_tag LOCUS_08860 963 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1099 1278 gene locus_tag LOCUS_08870 1099 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1275 4484 gene locus_tag LOCUS_08880 1275 4484 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_08880 4509 4718 gene locus_tag LOCUS_08890 4509 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5620 6132 gene locus_tag LOCUS_08900 5620 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6129 6608 gene locus_tag LOCUS_08910 gene tadA 6129 6608 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918120.1 protein_id gnl|my_center|LOCUS_08910 6688 6778 gene locus_tag LOCUS_t00140 6688 6778 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7396 7178 gene locus_tag LOCUS_08920 7396 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7598 9238 gene locus_tag LOCUS_08930 7598 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9258 9581 gene locus_tag LOCUS_08940 9258 9581 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420010.1 protein_id gnl|my_center|LOCUS_08940 9701 10216 gene locus_tag LOCUS_08950 gene recR 9701 10216 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_08950 10387 11751 gene locus_tag LOCUS_08960 10387 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12142 14181 gene locus_tag LOCUS_08970 12142 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 14235 15887 gene locus_tag LOCUS_08980 14235 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15934 17220 gene locus_tag LOCUS_08990 15934 17220 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550333.1 protein_id gnl|my_center|LOCUS_08990 17313 18095 gene locus_tag LOCUS_09000 17313 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18156 18848 gene locus_tag LOCUS_09010 18156 18848 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_09010 19743 18874 gene locus_tag LOCUS_09020 19743 18874 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_09020 23192 20598 gene locus_tag LOCUS_09030 23192 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 25125 23407 gene locus_tag LOCUS_09040 25125 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 27256 25136 gene locus_tag LOCUS_09050 27256 25136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 27660 27340 gene locus_tag LOCUS_09060 27660 27340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 27808 28617 gene locus_tag LOCUS_09070 27808 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 28614 29978 gene locus_tag LOCUS_09080 28614 29978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 29980 32121 gene locus_tag LOCUS_09090 29980 32121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 32355 33518 gene locus_tag LOCUS_09100 32355 33518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 33519 34718 gene locus_tag LOCUS_09110 33519 34718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence022 727 951 gene locus_tag LOCUS_09120 727 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1177 968 gene locus_tag LOCUS_09130 1177 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1431 1183 gene locus_tag LOCUS_09140 1431 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2326 1463 gene locus_tag LOCUS_09150 2326 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3136 2504 gene locus_tag LOCUS_09160 3136 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3489 3133 gene locus_tag LOCUS_09170 3489 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3691 3473 gene locus_tag LOCUS_09180 3691 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4044 3688 gene locus_tag LOCUS_09190 4044 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4453 4025 gene locus_tag LOCUS_09200 4453 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7351 4796 gene locus_tag LOCUS_09210 7351 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8178 7411 gene locus_tag LOCUS_09220 8178 7411 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880576.1 protein_id gnl|my_center|LOCUS_09220 8829 8197 gene locus_tag LOCUS_09230 8829 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10843 8819 gene locus_tag LOCUS_09240 10843 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11165 12157 gene locus_tag LOCUS_09250 11165 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12754 12251 gene locus_tag LOCUS_09260 12754 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12980 12792 gene locus_tag LOCUS_09270 12980 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13450 13022 gene locus_tag LOCUS_09280 13450 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 15062 14028 gene locus_tag LOCUS_09290 15062 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 16080 17759 gene locus_tag LOCUS_09300 16080 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 17753 18301 gene locus_tag LOCUS_09310 17753 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18323 19702 gene locus_tag LOCUS_09320 18323 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 19748 21790 gene locus_tag LOCUS_09330 19748 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 22518 24908 gene locus_tag LOCUS_09340 22518 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 25565 27895 gene locus_tag LOCUS_09350 25565 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 28143 30740 gene locus_tag LOCUS_09360 28143 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 31432 32943 gene locus_tag LOCUS_09370 31432 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence023 57 236 gene locus_tag LOCUS_09380 57 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 535 1326 gene locus_tag LOCUS_09390 535 1326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_09390 1506 2792 gene locus_tag LOCUS_09400 gene glgC 1506 2792 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_09400 3370 2870 gene locus_tag LOCUS_09410 3370 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5730 3556 gene locus_tag LOCUS_09420 5730 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 5665 5925 gene locus_tag LOCUS_09430 5665 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6054 6464 gene locus_tag LOCUS_09440 6054 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6819 6487 gene locus_tag LOCUS_09450 6819 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6956 7564 gene locus_tag LOCUS_09460 6956 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 9830 7584 gene locus_tag LOCUS_09470 9830 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 11272 9827 gene locus_tag LOCUS_09480 gene gatB 11272 9827 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_09480 12737 11280 gene locus_tag LOCUS_09490 gene gatA 12737 11280 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_09490 13052 12765 gene locus_tag LOCUS_09500 gene gatC 13052 12765 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_09500 13198 14016 gene locus_tag LOCUS_09510 gene larE 13198 14016 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_09510 14860 14027 gene locus_tag LOCUS_09520 14860 14027 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_09520 15648 15848 gene locus_tag LOCUS_09530 15648 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 15845 16405 gene locus_tag LOCUS_09540 15845 16405 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349118.1 protein_id gnl|my_center|LOCUS_09540 16547 17236 gene locus_tag LOCUS_09550 16547 17236 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_09550 17548 19128 gene locus_tag LOCUS_09560 17548 19128 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_09560 19131 19736 gene locus_tag LOCUS_09570 19131 19736 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_09570 21142 19865 gene locus_tag LOCUS_09580 21142 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 24265 21215 gene locus_tag LOCUS_09590 24265 21215 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_09590 25347 24262 gene locus_tag LOCUS_09600 25347 24262 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_09600 26772 25357 gene locus_tag LOCUS_09610 26772 25357 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 protein_id gnl|my_center|LOCUS_09610 26905 27456 gene locus_tag LOCUS_09620 26905 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 28321 27404 gene locus_tag LOCUS_09630 28321 27404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 32046 28336 gene locus_tag LOCUS_09640 32046 28336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence024 1719 205 gene locus_tag LOCUS_09650 1719 205 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327689.1 protein_id gnl|my_center|LOCUS_09650 2007 1720 gene locus_tag LOCUS_09660 2007 1720 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_09660 2209 2024 gene locus_tag LOCUS_09670 2209 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3349 2462 gene locus_tag LOCUS_09680 3349 2462 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_09680 3772 3413 gene locus_tag LOCUS_09690 gene arsC 3772 3413 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_09690 3967 5238 gene locus_tag LOCUS_09700 3967 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5544 7088 gene locus_tag LOCUS_09710 5544 7088 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_09710 7104 9065 gene locus_tag LOCUS_09720 7104 9065 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392124.1 protein_id gnl|my_center|LOCUS_09720 9279 9545 gene locus_tag LOCUS_09730 9279 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9980 9633 gene locus_tag LOCUS_09740 9980 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11996 10026 gene locus_tag LOCUS_09750 gene tkt 11996 10026 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_09750 13173 12070 gene locus_tag LOCUS_09760 13173 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 14443 13472 gene locus_tag LOCUS_09770 14443 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 17344 14642 gene locus_tag LOCUS_09780 17344 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 18792 17467 gene locus_tag LOCUS_09790 gene glcF 18792 17467 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_09790 19920 18799 gene locus_tag LOCUS_09800 19920 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 20351 19917 gene locus_tag LOCUS_09810 gene tolR 20351 19917 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_09810 21067 20348 gene locus_tag LOCUS_09820 gene tolQ 21067 20348 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210735.1 protein_id gnl|my_center|LOCUS_09820 21547 21146 gene locus_tag LOCUS_09830 gene ybgC 21547 21146 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_09830 22591 21548 gene locus_tag LOCUS_09840 gene ruvB 22591 21548 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086123.1 protein_id gnl|my_center|LOCUS_09840 23193 22588 gene locus_tag LOCUS_09850 gene ruvA 23193 22588 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_09850 23687 23190 gene locus_tag LOCUS_09860 gene ruvC 23687 23190 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_09860 24447 23698 gene locus_tag LOCUS_09870 24447 23698 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_09870 25424 24576 gene locus_tag LOCUS_09880 25424 24576 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_09880 26426 25440 gene locus_tag LOCUS_09890 gene pdxA 26426 25440 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384456.1 protein_id gnl|my_center|LOCUS_09890 27844 26423 gene locus_tag LOCUS_09900 gene surA 27844 26423 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 protein_id gnl|my_center|LOCUS_09900 30197 27915 gene locus_tag LOCUS_09910 30197 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 31518 30214 gene locus_tag LOCUS_09920 31518 30214 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_09920 32186 32779 gene locus_tag LOCUS_09930 32186 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence025 295 588 gene locus_tag LOCUS_09940 295 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 596 1066 gene locus_tag LOCUS_09950 596 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1123 2286 gene locus_tag LOCUS_09960 1123 2286 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916246.1 protein_id gnl|my_center|LOCUS_09960 2340 4802 gene locus_tag LOCUS_09970 2340 4802 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144972.1 protein_id gnl|my_center|LOCUS_09970 4823 6307 gene locus_tag LOCUS_09980 4823 6307 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976176.1 protein_id gnl|my_center|LOCUS_09980 6402 6581 gene locus_tag LOCUS_09990 6402 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6578 8860 gene locus_tag LOCUS_10000 6578 8860 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169250172.1 protein_id gnl|my_center|LOCUS_10000 10112 8967 gene locus_tag LOCUS_10010 10112 8967 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_10010 11215 10166 gene locus_tag LOCUS_10020 11215 10166 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_10020 12087 11212 gene locus_tag LOCUS_10030 12087 11212 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_10030 12955 12098 gene locus_tag LOCUS_10040 12955 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 14646 13075 gene locus_tag LOCUS_10050 14646 13075 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_10050 16236 14794 gene locus_tag LOCUS_10060 16236 14794 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_10060 16463 17470 gene locus_tag LOCUS_10070 16463 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 17535 19499 gene locus_tag LOCUS_10080 17535 19499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634756.1 protein_id gnl|my_center|LOCUS_10080 19598 21139 gene locus_tag LOCUS_10090 gene cysS 19598 21139 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_10090 21283 22278 gene locus_tag LOCUS_10100 21283 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22358 23977 gene locus_tag LOCUS_10110 22358 23977 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_10110 23984 25024 gene locus_tag LOCUS_10120 23984 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 25359 25144 gene locus_tag LOCUS_10130 25359 25144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 29384 25572 gene locus_tag LOCUS_10140 29384 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 31225 29468 gene locus_tag LOCUS_10150 31225 29468 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence026 1634 399 gene locus_tag LOCUS_10160 1634 399 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_10160 2116 1631 gene locus_tag LOCUS_10170 2116 1631 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_10170 2193 2672 gene locus_tag LOCUS_10180 2193 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3094 4011 gene locus_tag LOCUS_10190 3094 4011 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_10190 4141 5064 gene locus_tag LOCUS_10200 4141 5064 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_10200 7148 5109 gene locus_tag LOCUS_10210 7148 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8849 7233 gene locus_tag LOCUS_10220 8849 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 10070 8940 gene locus_tag LOCUS_10230 10070 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 11303 10602 gene locus_tag LOCUS_10240 11303 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 12580 11672 gene locus_tag LOCUS_10250 12580 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13570 12596 gene locus_tag LOCUS_10260 13570 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 15056 13620 gene locus_tag LOCUS_10270 15056 13620 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_10270 17075 15066 gene locus_tag LOCUS_10280 17075 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 20003 17322 gene locus_tag LOCUS_10290 gene clpB 20003 17322 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_10290 19396 19494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20270 21388 gene locus_tag LOCUS_10300 20270 21388 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099985.1 protein_id gnl|my_center|LOCUS_10300 21413 22336 gene locus_tag LOCUS_10310 21413 22336 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095571.1 protein_id gnl|my_center|LOCUS_10310 22340 23578 gene locus_tag LOCUS_10320 gene livM 22340 23578 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763054.1 protein_id gnl|my_center|LOCUS_10320 23575 24426 gene locus_tag LOCUS_10330 23575 24426 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096031.1 protein_id gnl|my_center|LOCUS_10330 24419 25159 gene locus_tag LOCUS_10340 24419 25159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407872.1 protein_id gnl|my_center|LOCUS_10340 25188 26750 gene locus_tag LOCUS_10350 25188 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 26757 27593 gene locus_tag LOCUS_10360 26757 27593 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_10360 27590 28501 gene locus_tag LOCUS_10370 27590 28501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 28498 30462 gene locus_tag LOCUS_10380 28498 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence027 1974 307 gene locus_tag LOCUS_10390 gene yidC 1974 307 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325034.1 protein_id gnl|my_center|LOCUS_10390 3099 4301 gene locus_tag LOCUS_10400 3099 4301 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10400 4294 5628 gene locus_tag LOCUS_10410 4294 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6372 5719 gene locus_tag LOCUS_10420 6372 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_10420 8514 6391 gene locus_tag LOCUS_10430 8514 6391 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_10430 8899 9507 gene locus_tag LOCUS_10440 8899 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9617 12139 gene locus_tag LOCUS_10450 9617 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 12178 12579 gene locus_tag LOCUS_10460 12178 12579 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_10460 12707 13981 gene locus_tag LOCUS_10470 12707 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 15398 13998 gene locus_tag LOCUS_10480 15398 13998 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_10480 17146 15395 gene locus_tag LOCUS_10490 17146 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 17379 17891 gene locus_tag LOCUS_10500 17379 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 17879 18613 gene locus_tag LOCUS_10510 17879 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 18651 20369 gene locus_tag LOCUS_10520 gene sulP 18651 20369 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_10520 20532 21842 gene locus_tag LOCUS_10530 20532 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 22911 21847 gene locus_tag LOCUS_10540 22911 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 23035 24204 gene locus_tag LOCUS_10550 23035 24204 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_10550 24298 27351 gene locus_tag LOCUS_10560 24298 27351 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_10560 27344 29233 gene locus_tag LOCUS_10570 27344 29233 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_10570 29235 30170 gene locus_tag LOCUS_10580 29235 30170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence028 818 2047 gene locus_tag LOCUS_10590 818 2047 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_10590 2504 2707 gene locus_tag LOCUS_10600 2504 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2780 3601 gene locus_tag LOCUS_10610 2780 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3824 4015 gene locus_tag LOCUS_10620 3824 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 4043 6514 gene locus_tag LOCUS_10630 4043 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6978 6829 gene locus_tag LOCUS_10640 6978 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7275 7039 gene locus_tag LOCUS_10650 7275 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7906 8112 gene locus_tag LOCUS_10660 7906 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 8143 8484 gene locus_tag LOCUS_10670 8143 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 9286 8900 gene locus_tag LOCUS_10680 9286 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9786 9412 gene locus_tag LOCUS_10690 9786 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10973 9948 gene locus_tag LOCUS_10700 10973 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 11107 10973 gene locus_tag LOCUS_10710 11107 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 12522 12283 gene locus_tag LOCUS_10720 12522 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10720 13125 12694 gene locus_tag LOCUS_10730 13125 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13913 13839 gene locus_tag LOCUS_t00150 13913 13839 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16826 14025 gene locus_tag LOCUS_10740 16826 14025 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_10740 18700 16856 gene locus_tag LOCUS_10750 18700 16856 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_10750 19406 18759 gene locus_tag LOCUS_10760 19406 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 19683 21500 gene locus_tag LOCUS_10770 gene dnaG 19683 21500 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844506.1 protein_id gnl|my_center|LOCUS_10770 21551 23545 gene locus_tag LOCUS_10780 gene rpoD 21551 23545 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532953.1 protein_id gnl|my_center|LOCUS_10780 23555 23630 gene locus_tag LOCUS_t00160 23555 23630 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23793 24077 gene locus_tag LOCUS_10790 23793 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 24114 24389 gene locus_tag LOCUS_10800 24114 24389 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_10800 24396 24707 gene locus_tag LOCUS_10810 gene ihfA 24396 24707 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 protein_id gnl|my_center|LOCUS_10810 24700 25287 gene locus_tag LOCUS_10820 24700 25287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 25905 25420 gene locus_tag LOCUS_10830 25905 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 27038 25938 gene locus_tag LOCUS_10840 27038 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 <28752 27043 gene locus_tag LOCUS_10850 <28752 27043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020247.1:DEAD/DEAH box helicase >Feature sequence029 1982 981 gene locus_tag LOCUS_10860 1982 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2047 2143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3488 2514 gene locus_tag LOCUS_10870 3488 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4243 3485 gene locus_tag LOCUS_10880 gene soj 4243 3485 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_10880 4894 4277 gene locus_tag LOCUS_10890 4894 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6757 4928 gene locus_tag LOCUS_10900 gene mnmG 6757 4928 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332781.1 protein_id gnl|my_center|LOCUS_10900 7724 6792 gene locus_tag LOCUS_10910 7724 6792 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_10910 10102 7733 gene locus_tag LOCUS_10920 gene topA 10102 7733 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_10920 11312 10155 gene locus_tag LOCUS_10930 gene dprA 11312 10155 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_10930 11943 11299 gene locus_tag LOCUS_10940 11943 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 12808 12197 gene locus_tag LOCUS_10950 gene plsY 12808 12197 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_10950 13968 12805 gene locus_tag LOCUS_10960 13968 12805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 14106 14669 gene locus_tag LOCUS_10970 gene ssb 14106 14669 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073744.1 protein_id gnl|my_center|LOCUS_10970 15397 14699 gene locus_tag LOCUS_10980 gene purN 15397 14699 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_10980 16424 15390 gene locus_tag LOCUS_10990 gene purM 16424 15390 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209777.1 protein_id gnl|my_center|LOCUS_10990 16589 17692 gene locus_tag LOCUS_11000 16589 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 17827 18228 gene locus_tag LOCUS_11010 17827 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 18292 19002 gene locus_tag LOCUS_11020 gene hda 18292 19002 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694288.1 protein_id gnl|my_center|LOCUS_11020 19054 19770 gene locus_tag LOCUS_11030 gene radC 19054 19770 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 protein_id gnl|my_center|LOCUS_11030 21424 20036 gene locus_tag LOCUS_11040 gene mnmE 21424 20036 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_11040 22159 21443 gene locus_tag LOCUS_11050 gene ubiA 22159 21443 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_11050 22863 22321 gene locus_tag LOCUS_11060 22863 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 23049 23786 gene locus_tag LOCUS_11070 23049 23786 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460869.1 protein_id gnl|my_center|LOCUS_11070 24364 24783 gene locus_tag LOCUS_11080 24364 24783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 24771 25919 gene locus_tag LOCUS_11090 gene mutY 24771 25919 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_11090 25927 26505 gene locus_tag LOCUS_11100 25927 26505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 26520 26846 gene locus_tag LOCUS_11110 26520 26846 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_11110 26960 27688 gene locus_tag LOCUS_11120 26960 27688 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence030 1763 3082 gene locus_tag LOCUS_11130 1763 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4112 3090 gene locus_tag LOCUS_11140 4112 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5359 4550 gene locus_tag LOCUS_11150 5359 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8031 5749 gene locus_tag LOCUS_11160 8031 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9100 8033 gene locus_tag LOCUS_11170 9100 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9242 11416 gene locus_tag LOCUS_11180 9242 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 12061 11432 gene locus_tag LOCUS_11190 gene nth 12061 11432 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_11190 12448 12813 gene locus_tag LOCUS_11200 12448 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 13160 13447 gene locus_tag LOCUS_11210 13160 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 14607 13504 gene locus_tag LOCUS_11220 gene gmd 14607 13504 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_11220 15043 14735 gene locus_tag LOCUS_11230 15043 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 16963 15128 gene locus_tag LOCUS_11240 gene oadA 16963 15128 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711626.1 protein_id gnl|my_center|LOCUS_11240 17924 17037 gene locus_tag LOCUS_11250 gene hisG 17924 17037 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_11250 18630 17941 gene locus_tag LOCUS_11260 18630 17941 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_11260 19157 18627 gene locus_tag LOCUS_11270 gene hpt 19157 18627 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167149.1 protein_id gnl|my_center|LOCUS_11270 19828 19154 gene locus_tag LOCUS_11280 gene metW 19828 19154 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_11280 21021 19825 gene locus_tag LOCUS_11290 21021 19825 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225323.1 protein_id gnl|my_center|LOCUS_11290 21177 26213 gene locus_tag LOCUS_11300 21177 26213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 26350 26682 gene locus_tag LOCUS_11310 26350 26682 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_11310 26669 27064 gene locus_tag LOCUS_11320 26669 27064 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545657.1 protein_id gnl|my_center|LOCUS_11320 27061 27258 gene locus_tag LOCUS_11330 27061 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 27295 27537 gene locus_tag LOCUS_11340 27295 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence031 746 1117 gene locus_tag LOCUS_11350 gene fliS 746 1117 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199081.1 protein_id gnl|my_center|LOCUS_11350 1136 1576 gene locus_tag LOCUS_11360 1136 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1576 1929 gene locus_tag LOCUS_11370 1576 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2184 2393 gene locus_tag LOCUS_11380 2184 2393 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 protein_id gnl|my_center|LOCUS_11380 2858 4873 gene locus_tag LOCUS_11390 2858 4873 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_11390 2882 2980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4912 7458 gene locus_tag LOCUS_11400 4912 7458 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_11400 8218 7487 gene locus_tag LOCUS_11410 gene cysZ 8218 7487 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_11410 8775 8215 gene locus_tag LOCUS_11420 8775 8215 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220370.1 protein_id gnl|my_center|LOCUS_11420 9482 8772 gene locus_tag LOCUS_11430 9482 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10339 9500 gene locus_tag LOCUS_11440 10339 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10675 10466 gene locus_tag LOCUS_11450 10675 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11353 10922 gene locus_tag LOCUS_11460 gene ndk 11353 10922 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_11460 13316 11538 gene locus_tag LOCUS_11470 13316 11538 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_11470 14769 13645 gene locus_tag LOCUS_11480 gene hisC 14769 13645 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857627.1 protein_id gnl|my_center|LOCUS_11480 14942 16591 gene locus_tag LOCUS_11490 14942 16591 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_11490 16588 17364 gene locus_tag LOCUS_11500 16588 17364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 17361 19106 gene locus_tag LOCUS_11510 17361 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 19109 20224 gene locus_tag LOCUS_11520 gene ispG 19109 20224 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_11520 20221 21480 gene locus_tag LOCUS_11530 gene hisS 20221 21480 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_11530 21533 22180 gene locus_tag LOCUS_11540 21533 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 22186 23406 gene locus_tag LOCUS_11550 gene bamB 22186 23406 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261368.1 protein_id gnl|my_center|LOCUS_11550 24509 23445 gene locus_tag LOCUS_11560 gene dapE 24509 23445 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116563.1 protein_id gnl|my_center|LOCUS_11560 25471 24620 gene locus_tag LOCUS_11570 gene dapD 25471 24620 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_11570 26743 25538 gene locus_tag LOCUS_11580 gene dapC 26743 25538 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_11580 <27631 26740 gene locus_tag LOCUS_11590 <27631 26740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705658.1:murein tripeptide amidase MpaA >Feature sequence032 1408 152 gene locus_tag LOCUS_11600 1408 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1626 1405 gene locus_tag LOCUS_11610 1626 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1847 1629 gene locus_tag LOCUS_11620 1847 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2976 1894 gene locus_tag LOCUS_11630 2976 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3435 4460 gene locus_tag LOCUS_11640 3435 4460 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_11640 4579 5814 gene locus_tag LOCUS_11650 4579 5814 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_11650 6118 6441 gene locus_tag LOCUS_11660 6118 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6875 6528 gene locus_tag LOCUS_11670 6875 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6874 7902 gene locus_tag LOCUS_11680 6874 7902 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488462.1 protein_id gnl|my_center|LOCUS_11680 8023 7874 gene locus_tag LOCUS_11690 8023 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 9410 8151 gene locus_tag LOCUS_11700 9410 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 9782 10744 gene locus_tag LOCUS_11710 gene trxB 9782 10744 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_11710 11796 10840 gene locus_tag LOCUS_11720 11796 10840 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_11720 12962 11823 gene locus_tag LOCUS_11730 12962 11823 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_11730 13872 13081 gene locus_tag LOCUS_11740 gene znuB 13872 13081 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 protein_id gnl|my_center|LOCUS_11740 14663 13869 gene locus_tag LOCUS_11750 gene znuC 14663 13869 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996146.1 protein_id gnl|my_center|LOCUS_11750 15186 15602 gene locus_tag LOCUS_11760 15186 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 15663 17045 gene locus_tag LOCUS_11770 15663 17045 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_11770 18013 17123 gene locus_tag LOCUS_11780 18013 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 18940 18113 gene locus_tag LOCUS_11790 18940 18113 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_11790 19162 20169 gene locus_tag LOCUS_11800 gene hemB 19162 20169 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_11800 20148 21233 gene locus_tag LOCUS_11810 20148 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_11810 21226 21459 gene locus_tag LOCUS_11820 21226 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 21456 22565 gene locus_tag LOCUS_11830 21456 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143805.1 protein_id gnl|my_center|LOCUS_11830 22961 23059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23283 23882 gene locus_tag LOCUS_11840 23283 23882 CDS product DUF4337 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083279.1 protein_id gnl|my_center|LOCUS_11840 25685 23898 gene locus_tag LOCUS_11850 25685 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 26521 25847 gene locus_tag LOCUS_11860 26521 25847 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_11860 <27543 26712 gene locus_tag LOCUS_11870 <27543 26712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein >Feature sequence033 480 310 gene locus_tag LOCUS_11880 480 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 739 2013 gene locus_tag LOCUS_11890 gene hemA 739 2013 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_11890 2063 3151 gene locus_tag LOCUS_11900 gene prfA 2063 3151 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066723.1 protein_id gnl|my_center|LOCUS_11900 3440 3637 gene locus_tag LOCUS_11910 3440 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3883 3659 gene locus_tag LOCUS_11920 3883 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4358 4020 gene locus_tag LOCUS_11930 4358 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5468 8296 gene locus_tag LOCUS_11940 5468 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 10157 8520 gene locus_tag LOCUS_11950 gene groL 10157 8520 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088372.1 protein_id gnl|my_center|LOCUS_11950 10512 10219 gene locus_tag LOCUS_11960 gene groES 10512 10219 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533567.1 protein_id gnl|my_center|LOCUS_11960 11236 10640 gene locus_tag LOCUS_11970 11236 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 12297 11254 gene locus_tag LOCUS_11980 12297 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 14144 12294 gene locus_tag LOCUS_11990 14144 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 15744 14206 gene locus_tag LOCUS_12000 15744 14206 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_12000 15883 17223 gene locus_tag LOCUS_12010 gene tolC 15883 17223 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_12010 17232 18353 gene locus_tag LOCUS_12020 17232 18353 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_12020 18353 21619 gene locus_tag LOCUS_12030 18353 21619 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_12030 21625 22179 gene locus_tag LOCUS_12040 21625 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 22194 22760 gene locus_tag LOCUS_12050 22194 22760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22821 23618 gene locus_tag LOCUS_12060 22821 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 25147 23729 gene locus_tag LOCUS_12070 gene fslC 25147 23729 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_12070 26251 25163 gene locus_tag LOCUS_12080 26251 25163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 26523 26248 gene locus_tag LOCUS_12090 26523 26248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 26981 26697 gene locus_tag LOCUS_12100 26981 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence034 429 623 gene locus_tag LOCUS_12110 429 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2033 654 gene locus_tag LOCUS_12120 2033 654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_12120 3200 2160 gene locus_tag LOCUS_12130 3200 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4820 3207 gene locus_tag LOCUS_12140 4820 3207 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_12140 5284 4925 gene locus_tag LOCUS_12150 5284 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5900 5325 gene locus_tag LOCUS_12160 5900 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6522 5950 gene locus_tag LOCUS_12170 6522 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7048 6539 gene locus_tag LOCUS_12180 7048 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8007 7051 gene locus_tag LOCUS_12190 gene nrfD 8007 7051 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932181.1 protein_id gnl|my_center|LOCUS_12190 8617 8018 gene locus_tag LOCUS_12200 8617 8018 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932182.1 protein_id gnl|my_center|LOCUS_12200 11422 8642 gene locus_tag LOCUS_12210 11422 8642 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932183.1 protein_id gnl|my_center|LOCUS_12210 11690 13081 gene locus_tag LOCUS_12220 11690 13081 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_12220 13715 13107 gene locus_tag LOCUS_12230 13715 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14052 13744 gene locus_tag LOCUS_12240 14052 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14720 14073 gene locus_tag LOCUS_12250 gene cysC 14720 14073 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_12250 14940 14731 gene locus_tag LOCUS_12260 14940 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 15540 15049 gene locus_tag LOCUS_12270 gene rnhA 15540 15049 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_12270 15682 16692 gene locus_tag LOCUS_12280 15682 16692 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_12280 16809 17978 gene locus_tag LOCUS_12290 16809 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19164 18100 gene locus_tag LOCUS_12300 19164 18100 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_12300 20370 19168 gene locus_tag LOCUS_12310 20370 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 20950 20594 gene locus_tag LOCUS_12320 20950 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 21587 21126 gene locus_tag LOCUS_12330 21587 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 22397 21651 gene locus_tag LOCUS_12340 gene phbB 22397 21651 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946156.1 protein_id gnl|my_center|LOCUS_12340 23641 22457 gene locus_tag LOCUS_12350 23641 22457 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_12350 <27101 23999 gene locus_tag LOCUS_12360 <27101 23999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207470.1:Ig-like domain-containing protein >Feature sequence035 989 438 gene locus_tag LOCUS_12370 989 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2186 1062 gene locus_tag LOCUS_12380 2186 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5084 2199 gene locus_tag LOCUS_12390 5084 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6007 5081 gene locus_tag LOCUS_12400 gene gldA 6007 5081 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_12400 6936 6124 gene locus_tag LOCUS_12410 6936 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7223 8170 gene locus_tag LOCUS_12420 7223 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8259 8423 gene locus_tag LOCUS_12430 8259 8423 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940442.1 protein_id gnl|my_center|LOCUS_12430 8537 10387 gene locus_tag LOCUS_12440 8537 10387 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_12440 10435 11280 gene locus_tag LOCUS_12450 10435 11280 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946265.1 protein_id gnl|my_center|LOCUS_12450 11847 11374 gene locus_tag LOCUS_12460 11847 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 13240 12911 gene locus_tag LOCUS_12470 13240 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14478 13702 gene locus_tag LOCUS_12480 gene larB 14478 13702 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_12480 15659 14475 gene locus_tag LOCUS_12490 gene larC 15659 14475 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_12490 16139 15717 gene locus_tag LOCUS_12500 16139 15717 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_12500 16366 17343 gene locus_tag LOCUS_12510 16366 17343 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_12510 17340 17921 gene locus_tag LOCUS_12520 17340 17921 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_12520 17908 18498 gene locus_tag LOCUS_12530 17908 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 18486 19166 gene locus_tag LOCUS_12540 18486 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 19168 19923 gene locus_tag LOCUS_12550 gene lptB 19168 19923 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 protein_id gnl|my_center|LOCUS_12550 19938 21458 gene locus_tag LOCUS_12560 19938 21458 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_12560 21471 22367 gene locus_tag LOCUS_12570 gene rapZ 21471 22367 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_12570 22463 23632 gene locus_tag LOCUS_12580 gene metK 22463 23632 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_12580 23692 25008 gene locus_tag LOCUS_12590 gene ahcY 23692 25008 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_12590 25715 25083 gene locus_tag LOCUS_12600 25715 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence036 <1 602 gene locus_tag LOCUS_12610 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042652447.1:IS1595 family transposase 1090 713 gene locus_tag LOCUS_12620 1090 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1692 1183 gene locus_tag LOCUS_12630 1692 1183 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_12630 2223 3977 gene locus_tag LOCUS_12640 2223 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3991 5427 gene locus_tag LOCUS_12650 3991 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5967 5374 gene locus_tag LOCUS_12660 5967 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 9863 6345 gene locus_tag LOCUS_12670 9863 6345 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_12670 11146 9866 gene locus_tag LOCUS_12680 11146 9866 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122868.1 protein_id gnl|my_center|LOCUS_12680 11604 11299 gene locus_tag LOCUS_12690 gene ihfA 11604 11299 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_12690 12513 11836 gene locus_tag LOCUS_12700 12513 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 13155 13985 gene locus_tag LOCUS_12710 13155 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 14034 14384 gene locus_tag LOCUS_12720 14034 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 14389 16173 gene locus_tag LOCUS_12730 14389 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 16275 16721 gene locus_tag LOCUS_12740 16275 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 17313 16918 gene locus_tag LOCUS_12750 17313 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 17632 17300 gene locus_tag LOCUS_12760 17632 17300 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_12760 18516 17629 gene locus_tag LOCUS_12770 18516 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115857.1 protein_id gnl|my_center|LOCUS_12770 18908 18657 gene locus_tag LOCUS_12780 18908 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 19395 19556 gene locus_tag LOCUS_12790 19395 19556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 19553 20971 gene locus_tag LOCUS_12800 gene cbpB 19553 20971 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_12800 21163 22137 gene locus_tag LOCUS_12810 21163 22137 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597449.1 protein_id gnl|my_center|LOCUS_12810 22162 22656 gene locus_tag LOCUS_12820 22162 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 22713 23540 gene locus_tag LOCUS_12830 gene rlmJ 22713 23540 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383564.1 protein_id gnl|my_center|LOCUS_12830 23844 23569 gene locus_tag LOCUS_12840 23844 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 24225 23941 gene locus_tag LOCUS_12850 24225 23941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 25724 24330 gene locus_tag LOCUS_12860 25724 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 25650 26021 gene locus_tag LOCUS_12870 25650 26021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence037 25 318 gene locus_tag LOCUS_12880 25 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2114 936 gene locus_tag LOCUS_12890 2114 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2721 2152 gene locus_tag LOCUS_12900 2721 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3389 2739 gene locus_tag LOCUS_12910 3389 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4468 3431 gene locus_tag LOCUS_12920 4468 3431 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_12920 4731 5303 gene locus_tag LOCUS_12930 4731 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5300 5881 gene locus_tag LOCUS_12940 5300 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6013 7077 gene locus_tag LOCUS_12950 gene recA 6013 7077 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537720.1 protein_id gnl|my_center|LOCUS_12950 7084 9372 gene locus_tag LOCUS_12960 gene parC 7084 9372 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_12960 10281 9454 gene locus_tag LOCUS_12970 10281 9454 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_12970 11510 10299 gene locus_tag LOCUS_12980 11510 10299 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_12980 12083 11556 gene locus_tag LOCUS_12990 gene petA 12083 11556 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_12990 12307 12780 gene locus_tag LOCUS_13000 gene trmL 12307 12780 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_13000 12814 13161 gene locus_tag LOCUS_13010 12814 13161 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_13010 13158 13460 gene locus_tag LOCUS_13020 13158 13460 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_13020 13479 15113 gene locus_tag LOCUS_13030 13479 15113 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_13030 15647 15183 gene locus_tag LOCUS_13040 15647 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974834.1 protein_id gnl|my_center|LOCUS_13040 16787 15804 gene locus_tag LOCUS_13050 16787 15804 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 protein_id gnl|my_center|LOCUS_13050 18140 16878 gene locus_tag LOCUS_13060 18140 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 19455 18133 gene locus_tag LOCUS_13070 19455 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 21128 19485 gene locus_tag LOCUS_13080 21128 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 22565 21186 gene locus_tag LOCUS_13090 22565 21186 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_13090 22737 22483 gene locus_tag LOCUS_13100 22737 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 23882 22773 gene locus_tag LOCUS_13110 gene envC 23882 22773 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 protein_id gnl|my_center|LOCUS_13110 25566 24013 gene locus_tag LOCUS_13120 gene gpmI 25566 24013 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_13120 25874 25963 gene locus_tag LOCUS_t00170 25874 25963 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 1343 579 gene locus_tag LOCUS_13130 1343 579 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881437.1 protein_id gnl|my_center|LOCUS_13130 2763 1816 gene locus_tag LOCUS_13140 2763 1816 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_13140 6480 2776 gene locus_tag LOCUS_13150 6480 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6701 7396 gene locus_tag LOCUS_13160 gene dnr 6701 7396 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_13160 8481 7438 gene locus_tag LOCUS_13170 8481 7438 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919251.1 protein_id gnl|my_center|LOCUS_13170 8747 9073 gene locus_tag LOCUS_13180 8747 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9164 10111 gene locus_tag LOCUS_13190 9164 10111 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931280.1 protein_id gnl|my_center|LOCUS_13190 10399 10154 gene locus_tag LOCUS_13200 10399 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 10768 11106 gene locus_tag LOCUS_13210 10768 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 11328 12893 gene locus_tag LOCUS_13220 11328 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 15192 12964 gene locus_tag LOCUS_13230 gene glgB 15192 12964 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337498.1 protein_id gnl|my_center|LOCUS_13230 15890 15378 gene locus_tag LOCUS_13240 15890 15378 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_13240 16933 16073 gene locus_tag LOCUS_13250 16933 16073 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_13250 17410 16937 gene locus_tag LOCUS_13260 17410 16937 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_13260 18178 17432 gene locus_tag LOCUS_13270 18178 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 18647 18186 gene locus_tag LOCUS_13280 18647 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 19235 18792 gene locus_tag LOCUS_13290 gene rimI 19235 18792 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_13290 19936 19232 gene locus_tag LOCUS_13300 gene tsaB 19936 19232 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_13300 21861 19933 gene locus_tag LOCUS_13310 21861 19933 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128807.1 protein_id gnl|my_center|LOCUS_13310 22760 21927 gene locus_tag LOCUS_13320 22760 21927 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_13320 23095 24339 gene locus_tag LOCUS_13330 23095 24339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_13330 24587 24375 gene locus_tag LOCUS_13340 24587 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 24631 24795 gene locus_tag LOCUS_13350 24631 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 25079 25657 gene locus_tag LOCUS_13360 25079 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence039 506 1069 gene locus_tag LOCUS_13370 506 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1192 2019 gene locus_tag LOCUS_13380 gene rfbA 1192 2019 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_13380 2016 2972 gene locus_tag LOCUS_13390 2016 2972 CDS product WxcM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035858.1 protein_id gnl|my_center|LOCUS_13390 2969 4078 gene locus_tag LOCUS_13400 2969 4078 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_13400 4086 5561 gene locus_tag LOCUS_13410 4086 5561 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 protein_id gnl|my_center|LOCUS_13410 5612 6373 gene locus_tag LOCUS_13420 5612 6373 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_13420 6378 7148 gene locus_tag LOCUS_13430 6378 7148 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_13430 7145 8131 gene locus_tag LOCUS_13440 7145 8131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661932.1 protein_id gnl|my_center|LOCUS_13440 8144 9193 gene locus_tag LOCUS_13450 8144 9193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_13450 9202 9807 gene locus_tag LOCUS_13460 9202 9807 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125472.1 protein_id gnl|my_center|LOCUS_13460 9808 10527 gene locus_tag LOCUS_13470 gene fabG 9808 10527 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929000.1 protein_id gnl|my_center|LOCUS_13470 10520 11590 gene locus_tag LOCUS_13480 gene aroB 10520 11590 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583419.1 protein_id gnl|my_center|LOCUS_13480 11587 12525 gene locus_tag LOCUS_13490 11587 12525 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_13490 12857 13693 gene locus_tag LOCUS_13500 12857 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 13687 15438 gene locus_tag LOCUS_13510 13687 15438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 15428 15685 gene locus_tag LOCUS_13520 15428 15685 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_13520 15675 16121 gene locus_tag LOCUS_13530 15675 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 16118 17743 gene locus_tag LOCUS_13540 16118 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 17927 18286 gene locus_tag LOCUS_13550 17927 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 18297 18863 gene locus_tag LOCUS_13560 18297 18863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 19457 20143 gene locus_tag LOCUS_13570 19457 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 20140 20913 gene locus_tag LOCUS_13580 gene rfbF 20140 20913 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_13580 20914 22017 gene locus_tag LOCUS_13590 gene rfbG 20914 22017 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107729.1 protein_id gnl|my_center|LOCUS_13590 22002 22451 gene locus_tag LOCUS_13600 22002 22451 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303195.1 protein_id gnl|my_center|LOCUS_13600 22537 23667 gene locus_tag LOCUS_13610 22537 23667 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937386.1 protein_id gnl|my_center|LOCUS_13610 23660 24610 gene locus_tag LOCUS_13620 23660 24610 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937387.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence040 1335 247 gene locus_tag LOCUS_13630 1335 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2170 1412 gene locus_tag LOCUS_13640 2170 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2169 3041 gene locus_tag LOCUS_13650 2169 3041 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_13650 3251 3859 gene locus_tag LOCUS_13660 3251 3859 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_13660 3870 5816 gene locus_tag LOCUS_13670 3870 5816 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_13670 6788 5955 gene locus_tag LOCUS_13680 6788 5955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_13680 7094 7273 gene locus_tag LOCUS_13690 7094 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7266 7664 gene locus_tag LOCUS_13700 7266 7664 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_13700 7670 9694 gene locus_tag LOCUS_13710 7670 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10744 12954 gene locus_tag LOCUS_13720 gene sulP 10744 12954 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_13720 13810 12986 gene locus_tag LOCUS_13730 13810 12986 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_13730 16020 13846 gene locus_tag LOCUS_13740 16020 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16651 16154 gene locus_tag LOCUS_13750 16651 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 17498 16692 gene locus_tag LOCUS_13760 17498 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 18691 17621 gene locus_tag LOCUS_13770 18691 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13770 19733 18582 gene locus_tag LOCUS_13780 19733 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 19944 19723 gene locus_tag LOCUS_13790 19944 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 21293 19974 gene locus_tag LOCUS_13800 21293 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 21927 21403 gene locus_tag LOCUS_13810 21927 21403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 22678 22049 gene locus_tag LOCUS_13820 22678 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_13820 22943 24541 gene locus_tag LOCUS_13830 22943 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 24796 25218 gene locus_tag LOCUS_13840 24796 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence041 736 524 gene locus_tag LOCUS_13850 736 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2282 744 gene locus_tag LOCUS_13860 2282 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2341 2562 gene locus_tag LOCUS_13870 2341 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2745 2987 gene locus_tag LOCUS_13880 2745 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3162 3238 gene locus_tag LOCUS_t00180 3162 3238 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3497 3661 gene locus_tag LOCUS_13890 3497 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3669 4001 gene locus_tag LOCUS_13900 3669 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4591 4187 gene locus_tag LOCUS_13910 4591 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6065 4683 gene locus_tag LOCUS_13920 6065 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6262 6987 gene locus_tag LOCUS_13930 6262 6987 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920349.1 protein_id gnl|my_center|LOCUS_13930 7046 10915 gene locus_tag LOCUS_13940 gene purL 7046 10915 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_13940 10991 11767 gene locus_tag LOCUS_13950 10991 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11764 12339 gene locus_tag LOCUS_13960 11764 12339 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113992.1 protein_id gnl|my_center|LOCUS_13960 12382 13392 gene locus_tag LOCUS_13970 12382 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13434 15383 gene locus_tag LOCUS_13980 13434 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 15393 16955 gene locus_tag LOCUS_13990 15393 16955 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_13990 17003 17848 gene locus_tag LOCUS_14000 17003 17848 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_14000 17910 19304 gene locus_tag LOCUS_14010 gene ffh 17910 19304 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_14010 19442 19693 gene locus_tag LOCUS_14020 19442 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 19735 20238 gene locus_tag LOCUS_14030 gene rimM 19735 20238 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_14030 20259 21023 gene locus_tag LOCUS_14040 gene trmD 20259 21023 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_14040 21056 21481 gene locus_tag LOCUS_14050 gene rplS 21056 21481 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_14050 21547 22173 gene locus_tag LOCUS_14060 21547 22173 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_14060 22275 23015 gene locus_tag LOCUS_14070 22275 23015 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_14070 23003 23743 gene locus_tag LOCUS_14080 23003 23743 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 protein_id gnl|my_center|LOCUS_14080 24628 23792 gene locus_tag LOCUS_14090 24628 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 24884 24960 gene locus_tag LOCUS_t00190 24884 24960 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 504 430 gene locus_tag LOCUS_t00200 504 430 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 672 1472 gene locus_tag LOCUS_14100 672 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2750 1479 gene locus_tag LOCUS_14110 2750 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3889 2816 gene locus_tag LOCUS_14120 gene zapE 3889 2816 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_14120 4082 4717 gene locus_tag LOCUS_14130 4082 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4958 4731 gene locus_tag LOCUS_14140 4958 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7566 5830 gene locus_tag LOCUS_14150 gene argS 7566 5830 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967253.1 protein_id gnl|my_center|LOCUS_14150 7673 8842 gene locus_tag LOCUS_14160 gene nrfD 7673 8842 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_14160 9433 8831 gene locus_tag LOCUS_14170 9433 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10142 9426 gene locus_tag LOCUS_14180 gene msrA 10142 9426 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_14180 11149 10229 gene locus_tag LOCUS_14190 gene ppk2 11149 10229 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_14190 11549 11331 gene locus_tag LOCUS_14200 11549 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12506 11655 gene locus_tag LOCUS_14210 12506 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14244 12613 gene locus_tag LOCUS_14220 14244 12613 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_14220 14899 14657 gene locus_tag LOCUS_14230 14899 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17168 15180 gene locus_tag LOCUS_14240 17168 15180 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_14240 17499 17681 gene locus_tag LOCUS_14250 17499 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 17834 19024 gene locus_tag LOCUS_14260 17834 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18997 20337 gene locus_tag LOCUS_14270 18997 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 20347 21138 gene locus_tag LOCUS_14280 20347 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21224 21547 gene locus_tag LOCUS_14290 21224 21547 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_14290 21544 21894 gene locus_tag LOCUS_14300 21544 21894 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_14300 21902 23779 gene locus_tag LOCUS_14310 21902 23779 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_14310 23791 24117 gene locus_tag LOCUS_14320 23791 24117 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_14320 24104 24502 gene locus_tag LOCUS_14330 24104 24502 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_14330 24499 24654 gene locus_tag LOCUS_14340 24499 24654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence043 768 2768 gene locus_tag LOCUS_14350 768 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2787 3542 gene locus_tag LOCUS_14360 2787 3542 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663661.1 protein_id gnl|my_center|LOCUS_14360 3539 4915 gene locus_tag LOCUS_14370 3539 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4912 8280 gene locus_tag LOCUS_14380 4912 8280 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105372141.1 protein_id gnl|my_center|LOCUS_14380 8841 9509 gene locus_tag LOCUS_14390 8841 9509 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258436.1 protein_id gnl|my_center|LOCUS_14390 9509 9775 gene locus_tag LOCUS_14400 9509 9775 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392735.1 protein_id gnl|my_center|LOCUS_14400 9792 10523 gene locus_tag LOCUS_14410 gene cbiQ 9792 10523 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_14410 10520 11359 gene locus_tag LOCUS_14420 10520 11359 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_14420 12630 11365 gene locus_tag LOCUS_14430 12630 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 12823 12921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13113 13787 gene locus_tag LOCUS_14440 gene ftsE 13113 13787 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_14440 13839 15050 gene locus_tag LOCUS_14450 gene ftsX 13839 15050 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081708.1 protein_id gnl|my_center|LOCUS_14450 14865 14962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15118 15519 gene locus_tag LOCUS_14460 gene gcvH 15118 15519 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_14460 16184 15528 gene locus_tag LOCUS_14470 16184 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 16218 19082 gene locus_tag LOCUS_14480 gene uvrA 16218 19082 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_14480 19448 19104 gene locus_tag LOCUS_14490 19448 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 21165 19435 gene locus_tag LOCUS_14500 gene pbpC 21165 19435 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002102274.1 protein_id gnl|my_center|LOCUS_14500 23328 21301 gene locus_tag LOCUS_14510 23328 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence044 981 142 gene locus_tag LOCUS_14520 981 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1142 2467 gene locus_tag LOCUS_14530 gene bioA 1142 2467 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_14530 2578 2662 gene locus_tag LOCUS_t00210 2578 2662 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3843 2707 gene locus_tag LOCUS_14540 3843 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 4594 5439 gene locus_tag LOCUS_14550 4594 5439 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_14550 6879 5521 gene locus_tag LOCUS_14560 6879 5521 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857632.1 protein_id gnl|my_center|LOCUS_14560 8198 6876 gene locus_tag LOCUS_14570 8198 6876 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_14570 8601 8203 gene locus_tag LOCUS_14580 8601 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9101 8598 gene locus_tag LOCUS_14590 gene lspA 9101 8598 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_14590 11947 9098 gene locus_tag LOCUS_14600 gene ileS 11947 9098 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_14600 12908 11970 gene locus_tag LOCUS_14610 gene ribF 12908 11970 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371105.1 protein_id gnl|my_center|LOCUS_14610 13171 15075 gene locus_tag LOCUS_14620 13171 15075 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_14620 15080 15445 gene locus_tag LOCUS_14630 15080 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 15442 16332 gene locus_tag LOCUS_14640 15442 16332 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_14640 16612 16355 gene locus_tag LOCUS_14650 16612 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 19289 16632 gene locus_tag LOCUS_14660 19289 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 20174 19530 gene locus_tag LOCUS_14670 gene pqiC 20174 19530 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 protein_id gnl|my_center|LOCUS_14670 21898 20171 gene locus_tag LOCUS_14680 21898 20171 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_14680 22505 21885 gene locus_tag LOCUS_14690 22505 21885 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_14690 23038 22487 gene locus_tag LOCUS_14700 23038 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 23686 23237 gene locus_tag LOCUS_14710 23686 23237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence045 325 1368 gene locus_tag LOCUS_14720 gene rlmN 325 1368 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688154.1 protein_id gnl|my_center|LOCUS_14720 1365 2540 gene locus_tag LOCUS_14730 1365 2540 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_14730 2527 3483 gene locus_tag LOCUS_14740 2527 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4631 3567 gene locus_tag LOCUS_14750 4631 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5040 4702 gene locus_tag LOCUS_14760 gene glnB 5040 4702 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 protein_id gnl|my_center|LOCUS_14760 6723 5116 gene locus_tag LOCUS_14770 gene cimA 6723 5116 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_14770 7954 6716 gene locus_tag LOCUS_14780 7954 6716 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_14780 8660 8016 gene locus_tag LOCUS_14790 8660 8016 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328209.1 protein_id gnl|my_center|LOCUS_14790 9421 8705 gene locus_tag LOCUS_14800 9421 8705 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_14800 10405 9428 gene locus_tag LOCUS_14810 10405 9428 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_14810 10889 10398 gene locus_tag LOCUS_14820 gene tsaE 10889 10398 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_14820 11350 10892 gene locus_tag LOCUS_14830 11350 10892 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_14830 11441 11818 gene locus_tag LOCUS_14840 11441 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 11864 12751 gene locus_tag LOCUS_14850 11864 12751 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_14850 12748 16701 gene locus_tag LOCUS_14860 12748 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 16819 20988 gene locus_tag LOCUS_14870 16819 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 20985 22118 gene locus_tag LOCUS_14880 20985 22118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_14880 22770 22198 gene locus_tag LOCUS_14890 22770 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence046 522 25 gene locus_tag LOCUS_14900 522 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1679 675 gene locus_tag LOCUS_14910 1679 675 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963662.1 protein_id gnl|my_center|LOCUS_14910 2030 1797 gene locus_tag LOCUS_14920 2030 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3999 2365 gene locus_tag LOCUS_14930 3999 2365 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_14930 4255 6384 gene locus_tag LOCUS_14940 4255 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6524 7540 gene locus_tag LOCUS_14950 6524 7540 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 protein_id gnl|my_center|LOCUS_14950 7596 10346 gene locus_tag LOCUS_14960 7596 10346 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146591721.1 protein_id gnl|my_center|LOCUS_14960 10343 13525 gene locus_tag LOCUS_14970 10343 13525 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970311.1 protein_id gnl|my_center|LOCUS_14970 13662 14138 gene locus_tag LOCUS_14980 13662 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 14152 14739 gene locus_tag LOCUS_14990 14152 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 14759 15568 gene locus_tag LOCUS_15000 14759 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 15922 17163 gene locus_tag LOCUS_15010 gene ftsA 15922 17163 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420913.1 protein_id gnl|my_center|LOCUS_15010 17293 19410 gene locus_tag LOCUS_15020 17293 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 19649 20173 gene locus_tag LOCUS_15030 19649 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 20773 20213 gene locus_tag LOCUS_15040 20773 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 21272 22075 gene locus_tag LOCUS_15050 21272 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392149.1 protein_id gnl|my_center|LOCUS_15050 22423 22608 gene locus_tag LOCUS_15060 22423 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence047 1214 848 gene locus_tag LOCUS_tm00010 1214 848 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1360 1274 gene locus_tag LOCUS_t00220 1360 1274 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1636 1472 gene locus_tag LOCUS_15070 1636 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2392 2877 gene locus_tag LOCUS_15080 2392 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3014 3868 gene locus_tag LOCUS_15090 3014 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4361 3804 gene locus_tag LOCUS_15100 4361 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6134 4362 gene locus_tag LOCUS_15110 6134 4362 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_15110 6874 6149 gene locus_tag LOCUS_15120 6874 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8723 6891 gene locus_tag LOCUS_15130 8723 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9422 8793 gene locus_tag LOCUS_15140 gene gmhA 9422 8793 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_15140 11708 9510 gene locus_tag LOCUS_15150 11708 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 12436 11705 gene locus_tag LOCUS_15160 12436 11705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_15160 13095 13664 gene locus_tag LOCUS_15170 13095 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13711 13881 gene locus_tag LOCUS_15180 13711 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 13901 14131 gene locus_tag LOCUS_15190 13901 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 14584 14261 gene locus_tag LOCUS_15200 14584 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 14919 14605 gene locus_tag LOCUS_15210 14919 14605 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_15210 15388 14930 gene locus_tag LOCUS_15220 15388 14930 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_15220 16697 15378 gene locus_tag LOCUS_15230 gene sufD 16697 15378 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_15230 17449 16694 gene locus_tag LOCUS_15240 gene sufC 17449 16694 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 protein_id gnl|my_center|LOCUS_15240 18891 17446 gene locus_tag LOCUS_15250 gene sufB 18891 17446 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_15250 19415 18978 gene locus_tag LOCUS_15260 19415 18978 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_15260 19679 19467 gene locus_tag LOCUS_15270 19679 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 20203 21897 gene locus_tag LOCUS_15280 20203 21897 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence048 229 1668 gene locus_tag LOCUS_15290 229 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3471 1717 gene locus_tag LOCUS_15300 3471 1717 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_15300 5993 3483 gene locus_tag LOCUS_15310 5993 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7738 5990 gene locus_tag LOCUS_15320 7738 5990 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_15320 9066 7789 gene locus_tag LOCUS_15330 9066 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 9262 10215 gene locus_tag LOCUS_15340 9262 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 10229 12907 gene locus_tag LOCUS_15350 10229 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 12977 14179 gene locus_tag LOCUS_15360 12977 14179 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_15360 14191 15810 gene locus_tag LOCUS_15370 14191 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 15803 16426 gene locus_tag LOCUS_15380 15803 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 16423 17235 gene locus_tag LOCUS_15390 16423 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 17993 17319 gene locus_tag LOCUS_15400 17993 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 18861 18151 gene locus_tag LOCUS_15410 18861 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 19670 19164 gene locus_tag LOCUS_15420 19670 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 20115 21008 gene locus_tag LOCUS_15430 20115 21008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 20989 21789 gene locus_tag LOCUS_15440 20989 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence049 25 279 gene locus_tag LOCUS_15450 25 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1425 295 gene locus_tag LOCUS_15460 1425 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1405 1986 gene locus_tag LOCUS_15470 1405 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1989 3188 gene locus_tag LOCUS_15480 1989 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3216 3458 gene locus_tag LOCUS_15490 3216 3458 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_15490 4596 3481 gene locus_tag LOCUS_15500 4596 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5425 4631 gene locus_tag LOCUS_15510 gene pssA 5425 4631 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_15510 6081 5431 gene locus_tag LOCUS_15520 6081 5431 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_15520 7174 6158 gene locus_tag LOCUS_15530 gene ilvC 7174 6158 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_15530 7715 7221 gene locus_tag LOCUS_15540 gene ilvN 7715 7221 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_15540 9430 7736 gene locus_tag LOCUS_15550 9430 7736 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_15550 10219 9641 gene locus_tag LOCUS_15560 10219 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11719 10424 gene locus_tag LOCUS_15570 gene gltA 11719 10424 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_15570 11907 11701 gene locus_tag LOCUS_15580 11907 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 11851 13335 gene locus_tag LOCUS_15590 11851 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 13363 16020 gene locus_tag LOCUS_15600 13363 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 16116 16928 gene locus_tag LOCUS_15610 16116 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16925 17692 gene locus_tag LOCUS_15620 gene map 16925 17692 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_15620 17741 18694 gene locus_tag LOCUS_15630 gene era 17741 18694 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_15630 18696 19457 gene locus_tag LOCUS_15640 18696 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 19485 19667 gene locus_tag LOCUS_15650 19485 19667 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_15650 20193 20651 gene locus_tag LOCUS_15660 20193 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence050 1330 425 gene locus_tag LOCUS_15670 1330 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1686 1783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1807 2376 gene locus_tag LOCUS_15680 1807 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2267 3673 gene locus_tag LOCUS_15690 2267 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3708 4733 gene locus_tag LOCUS_15700 3708 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4943 6364 gene locus_tag LOCUS_15710 4943 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5930 6021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7223 6420 gene locus_tag LOCUS_15720 7223 6420 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_15720 8408 7488 gene locus_tag LOCUS_15730 8408 7488 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_15730 11017 8432 gene locus_tag LOCUS_15740 11017 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12149 11058 gene locus_tag LOCUS_15750 12149 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 13287 12142 gene locus_tag LOCUS_15760 13287 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 14369 13266 gene locus_tag LOCUS_15770 14369 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 14534 17239 gene locus_tag LOCUS_15780 gene secA 14534 17239 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533499.1 protein_id gnl|my_center|LOCUS_15780 17385 18608 gene locus_tag LOCUS_15790 gene yedE 17385 18608 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098565.1 protein_id gnl|my_center|LOCUS_15790 19133 19321 gene locus_tag LOCUS_15800 19133 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 19854 19480 gene locus_tag LOCUS_15810 19854 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 19780 20388 gene locus_tag LOCUS_15820 19780 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 20385 20540 gene locus_tag LOCUS_15830 20385 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence051 <1 1883 gene locus_tag LOCUS_15840 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein 5564 1968 gene locus_tag LOCUS_15850 5564 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6806 5607 gene locus_tag LOCUS_15860 6806 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8190 6793 gene locus_tag LOCUS_15870 8190 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10682 8397 gene locus_tag LOCUS_15880 10682 8397 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197904.1 protein_id gnl|my_center|LOCUS_15880 11233 10868 gene locus_tag LOCUS_15890 11233 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 11232 11762 gene locus_tag LOCUS_15900 11232 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 12318 11854 gene locus_tag LOCUS_15910 12318 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 12742 15810 gene locus_tag LOCUS_15920 12742 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 17377 15845 gene locus_tag LOCUS_15930 17377 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 18398 17553 gene locus_tag LOCUS_15940 18398 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 19612 18413 gene locus_tag LOCUS_15950 19612 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 20353 19634 gene locus_tag LOCUS_15960 20353 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence052 850 1929 gene locus_tag LOCUS_15970 850 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1899 3113 gene locus_tag LOCUS_15980 1899 3113 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_15980 4329 3163 gene locus_tag LOCUS_15990 4329 3163 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525967.1 protein_id gnl|my_center|LOCUS_15990 5357 4326 gene locus_tag LOCUS_16000 5357 4326 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_16000 6654 5365 gene locus_tag LOCUS_16010 gene tviB 6654 5365 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_16010 7668 6682 gene locus_tag LOCUS_16020 7668 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 9342 7687 gene locus_tag LOCUS_16030 gene asnB 9342 7687 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_16030 10609 9584 gene locus_tag LOCUS_16040 10609 9584 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525450.1 protein_id gnl|my_center|LOCUS_16040 11342 10623 gene locus_tag LOCUS_16050 11342 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12510 11473 gene locus_tag LOCUS_16060 12510 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 13411 12524 gene locus_tag LOCUS_16070 13411 12524 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817145.1 protein_id gnl|my_center|LOCUS_16070 14803 13424 gene locus_tag LOCUS_16080 14803 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 15754 14855 gene locus_tag LOCUS_16090 15754 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 16356 15859 gene locus_tag LOCUS_16100 16356 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 16866 16603 gene locus_tag LOCUS_16110 16866 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 17715 17461 gene locus_tag LOCUS_16120 17715 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 18067 17684 gene locus_tag LOCUS_16130 18067 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 18422 18051 gene locus_tag LOCUS_16140 18422 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 19419 18676 gene locus_tag LOCUS_16150 19419 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 19647 19832 gene locus_tag LOCUS_16160 19647 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence053 551 372 gene locus_tag LOCUS_16170 551 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 562 1653 gene locus_tag LOCUS_16180 562 1653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_16180 1773 2603 gene locus_tag LOCUS_16190 1773 2603 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_16190 2616 3758 gene locus_tag LOCUS_16200 2616 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4323 3853 gene locus_tag LOCUS_16210 4323 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4583 5287 gene locus_tag LOCUS_16220 gene misR 4583 5287 CDS product two-component system response regulator MisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214312.1 protein_id gnl|my_center|LOCUS_16220 5294 6610 gene locus_tag LOCUS_16230 5294 6610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_16230 7075 6701 gene locus_tag LOCUS_16240 7075 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7311 7072 gene locus_tag LOCUS_16250 7311 7072 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_16250 9350 7464 gene locus_tag LOCUS_16260 9350 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 11623 9347 gene locus_tag LOCUS_16270 11623 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 12178 12375 gene locus_tag LOCUS_16280 gene ccoS 12178 12375 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766953.1 protein_id gnl|my_center|LOCUS_16280 13600 12686 gene locus_tag LOCUS_16290 gene ccoP 13600 12686 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_16290 14319 13639 gene locus_tag LOCUS_16300 gene ccoO 14319 13639 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 protein_id gnl|my_center|LOCUS_16300 15826 14408 gene locus_tag LOCUS_16310 gene ccoN 15826 14408 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_16310 15988 17397 gene locus_tag LOCUS_16320 gene ccoG 15988 17397 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395451.1 protein_id gnl|my_center|LOCUS_16320 17394 17921 gene locus_tag LOCUS_16330 17394 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 17848 18063 gene locus_tag LOCUS_16340 17848 18063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 18215 18406 gene locus_tag LOCUS_16350 18215 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 18422 19330 gene locus_tag LOCUS_16360 18422 19330 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_16360 20107 19886 gene locus_tag LOCUS_16370 20107 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence054 1519 185 gene locus_tag LOCUS_16380 1519 185 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_16380 2359 1592 gene locus_tag LOCUS_16390 2359 1592 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_16390 2787 2356 gene locus_tag LOCUS_16400 2787 2356 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 protein_id gnl|my_center|LOCUS_16400 3245 2784 gene locus_tag LOCUS_16410 3245 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3535 3329 gene locus_tag LOCUS_16420 3535 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3852 5033 gene locus_tag LOCUS_16430 gene argJ 3852 5033 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 protein_id gnl|my_center|LOCUS_16430 5030 5710 gene locus_tag LOCUS_16440 gene yrfG 5030 5710 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_16440 5782 5973 gene locus_tag LOCUS_16450 5782 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 8163 6061 gene locus_tag LOCUS_16460 gene glyS 8163 6061 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_16460 9063 8194 gene locus_tag LOCUS_16470 gene glyQ 9063 8194 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_16470 9102 10403 gene locus_tag LOCUS_16480 9102 10403 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_16480 10378 11490 gene locus_tag LOCUS_16490 gene lpxK 10378 11490 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_16490 11681 12118 gene locus_tag LOCUS_16500 11681 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 12157 12555 gene locus_tag LOCUS_16510 12157 12555 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_16510 14296 12611 gene locus_tag LOCUS_16520 14296 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 14424 14570 gene locus_tag LOCUS_16530 14424 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14585 17683 gene locus_tag LOCUS_16540 14585 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 17680 18543 gene locus_tag LOCUS_16550 17680 18543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence055 <1 897 gene locus_tag LOCUS_16560 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:IS1634 family transposase 1376 867 gene locus_tag LOCUS_16570 1376 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1482 1931 gene locus_tag LOCUS_16580 1482 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2446 2027 gene locus_tag LOCUS_16590 2446 2027 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_16590 2685 2446 gene locus_tag LOCUS_16600 2685 2446 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_16600 3168 8468 gene locus_tag LOCUS_16610 3168 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 9284 8526 gene locus_tag LOCUS_16620 gene rlmB 9284 8526 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 protein_id gnl|my_center|LOCUS_16620 9322 9546 gene locus_tag LOCUS_16630 9322 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 9630 10691 gene locus_tag LOCUS_16640 9630 10691 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_16640 10438 10534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10871 12073 gene locus_tag LOCUS_16650 10871 12073 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_16650 13190 12132 gene locus_tag LOCUS_16660 13190 12132 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_16660 13864 13658 gene locus_tag LOCUS_16670 13864 13658 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_16670 13932 14171 gene locus_tag LOCUS_16680 13932 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14569 16719 gene locus_tag LOCUS_16690 14569 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16726 18630 gene locus_tag LOCUS_16700 16726 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence056 8155 8355 gene locus_tag LOCUS_16710 8155 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 10624 9203 gene locus_tag LOCUS_16720 gene glnA 10624 9203 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_16720 12058 10724 gene locus_tag LOCUS_16730 12058 10724 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_16730 14123 12273 gene locus_tag LOCUS_16740 14123 12273 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_16740 14347 16290 gene locus_tag LOCUS_16750 gene dnaK 14347 16290 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241760.1 protein_id gnl|my_center|LOCUS_16750 16706 16473 gene locus_tag LOCUS_16760 16706 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 17270 17007 gene locus_tag LOCUS_16770 17270 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17860 17510 gene locus_tag LOCUS_16780 17860 17510 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_16780 18098 17880 gene locus_tag LOCUS_16790 18098 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 18332 18120 gene locus_tag LOCUS_16800 18332 18120 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_16800 19070 18417 gene locus_tag LOCUS_16810 19070 18417 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267999.1 protein_id gnl|my_center|LOCUS_16810 19382 19080 gene locus_tag LOCUS_16820 gene ihfA 19382 19080 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence057 593 1357 gene locus_tag LOCUS_16830 gene mtnP 593 1357 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121285.1 protein_id gnl|my_center|LOCUS_16830 1385 1918 gene locus_tag LOCUS_16840 1385 1918 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_16840 1957 3009 gene locus_tag LOCUS_16850 gene mtnA 1957 3009 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_16850 3452 3712 gene locus_tag LOCUS_16860 3452 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4916 3705 gene locus_tag LOCUS_16870 4916 3705 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_16870 6238 4913 gene locus_tag LOCUS_16880 6238 4913 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027071.1 protein_id gnl|my_center|LOCUS_16880 6524 7822 gene locus_tag LOCUS_16890 6524 7822 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_16890 7908 8603 gene locus_tag LOCUS_16900 7908 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 8659 10452 gene locus_tag LOCUS_16910 8659 10452 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_16910 10348 10444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11801 10851 gene locus_tag LOCUS_16920 gene znuA 11801 10851 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_16920 14304 11920 gene locus_tag LOCUS_16930 14304 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 15337 14546 gene locus_tag LOCUS_16940 gene blaOXA 15337 14546 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_16940 17867 16380 gene locus_tag LOCUS_16950 gene hldE 17867 16380 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095747.1 protein_id gnl|my_center|LOCUS_16950 18491 18027 gene locus_tag LOCUS_16960 18491 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence058 295 65 gene locus_tag LOCUS_16970 295 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 686 1165 gene locus_tag LOCUS_16980 686 1165 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_16980 1167 1718 gene locus_tag LOCUS_16990 1167 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1756 4209 gene locus_tag LOCUS_17000 1756 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4303 5844 gene locus_tag LOCUS_17010 4303 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5862 7391 gene locus_tag LOCUS_17020 5862 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7876 7973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8105 9775 gene locus_tag LOCUS_17030 8105 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9833 10219 gene locus_tag LOCUS_17040 9833 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10400 12022 gene locus_tag LOCUS_17050 10400 12022 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_17050 12355 12570 gene locus_tag LOCUS_17060 12355 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 12485 12907 gene locus_tag LOCUS_17070 12485 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13699 14208 gene locus_tag LOCUS_17080 13699 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 14755 14279 gene locus_tag LOCUS_17090 14755 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 18443 14775 gene locus_tag LOCUS_17100 gene mfd 18443 14775 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence059 1845 568 gene locus_tag LOCUS_17110 1845 568 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_17110 2555 1842 gene locus_tag LOCUS_17120 gene mtnP 2555 1842 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_17120 3575 2559 gene locus_tag LOCUS_17130 3575 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3632 4132 gene locus_tag LOCUS_17140 3632 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4154 5344 gene locus_tag LOCUS_17150 4154 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5352 6194 gene locus_tag LOCUS_17160 5352 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 7229 6231 gene locus_tag LOCUS_17170 7229 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 8294 7254 gene locus_tag LOCUS_17180 8294 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_17180 9571 8411 gene locus_tag LOCUS_17190 9571 8411 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_17190 9912 9658 gene locus_tag LOCUS_17200 9912 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 10740 10054 gene locus_tag LOCUS_17210 10740 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_17210 11112 16862 gene locus_tag LOCUS_17220 11112 16862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 16896 17120 gene locus_tag LOCUS_17230 16896 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 17329 17922 gene locus_tag LOCUS_17240 17329 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence060 2023 3774 gene locus_tag LOCUS_17250 2023 3774 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_17250 3874 6105 gene locus_tag LOCUS_17260 3874 6105 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_17260 6175 6966 gene locus_tag LOCUS_17270 6175 6966 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_17270 6963 10910 gene locus_tag LOCUS_17280 gene hrpA 6963 10910 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_17280 11172 10894 gene locus_tag LOCUS_17290 11172 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence061 106 327 gene locus_tag LOCUS_17300 106 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 916 458 gene locus_tag LOCUS_17310 916 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1670 1272 gene locus_tag LOCUS_17320 1670 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2099 1800 gene locus_tag LOCUS_17330 2099 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2112 5582 gene locus_tag LOCUS_17340 2112 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5579 6769 gene locus_tag LOCUS_17350 5579 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7455 6814 gene locus_tag LOCUS_17360 7455 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 7439 7570 gene locus_tag LOCUS_17370 7439 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 7644 8633 gene locus_tag LOCUS_17380 7644 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 8596 9093 gene locus_tag LOCUS_17390 8596 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 10682 9264 gene locus_tag LOCUS_17400 gene pntB 10682 9264 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_17400 12274 10697 gene locus_tag LOCUS_17410 gene pntA 12274 10697 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_17410 12825 13403 gene locus_tag LOCUS_17420 gene rsxA 12825 13403 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_17420 13451 13981 gene locus_tag LOCUS_17430 gene rsxB 13451 13981 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_17430 14044 15582 gene locus_tag LOCUS_17440 gene rsxC 14044 15582 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_17440 15694 16764 gene locus_tag LOCUS_17450 15694 16764 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_17450 16788 17417 gene locus_tag LOCUS_17460 gene rsxG 16788 17417 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261585.1 protein_id gnl|my_center|LOCUS_17460 17414 17740 gene locus_tag LOCUS_17470 17414 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence062 891 127 gene locus_tag LOCUS_17480 891 127 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_17480 1856 888 gene locus_tag LOCUS_17490 1856 888 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_17490 4081 1859 gene locus_tag LOCUS_17500 4081 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4272 4078 gene locus_tag LOCUS_17510 4272 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5537 4422 gene locus_tag LOCUS_17520 5537 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6688 5534 gene locus_tag LOCUS_17530 6688 5534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_17530 7179 6772 gene locus_tag LOCUS_17540 7179 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 7884 7285 gene locus_tag LOCUS_17550 7884 7285 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942120.1 protein_id gnl|my_center|LOCUS_17550 9370 7907 gene locus_tag LOCUS_17560 gene rsmB 9370 7907 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 protein_id gnl|my_center|LOCUS_17560 10070 9393 gene locus_tag LOCUS_17570 gene yihA 10070 9393 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_17570 10089 11084 gene locus_tag LOCUS_17580 gene dusB 10089 11084 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_17580 11094 12185 gene locus_tag LOCUS_17590 gene gnfL 11094 12185 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_17590 12188 13654 gene locus_tag LOCUS_17600 gene ntrC 12188 13654 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004441656.1 protein_id gnl|my_center|LOCUS_17600 13829 14083 gene locus_tag LOCUS_17610 13829 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14100 14864 gene locus_tag LOCUS_17620 14100 14864 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_17620 14937 15164 gene locus_tag LOCUS_17630 14937 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 15171 15737 gene locus_tag LOCUS_17640 15171 15737 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390992.1 protein_id gnl|my_center|LOCUS_17640 16164 15799 gene locus_tag LOCUS_17650 16164 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 16163 16822 gene locus_tag LOCUS_17660 gene pyrE 16163 16822 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073929.1 protein_id gnl|my_center|LOCUS_17660 17315 16833 gene locus_tag LOCUS_17670 17315 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence063 2646 1132 gene locus_tag LOCUS_17680 2646 1132 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_17680 4545 2719 gene locus_tag LOCUS_17690 4545 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7181 4716 gene locus_tag LOCUS_17700 7181 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7642 7199 gene locus_tag LOCUS_17710 7642 7199 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316407.1 protein_id gnl|my_center|LOCUS_17710 9652 7658 gene locus_tag LOCUS_17720 9652 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10737 9649 gene locus_tag LOCUS_17730 10737 9649 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044982.1 protein_id gnl|my_center|LOCUS_17730 11537 11154 gene locus_tag LOCUS_17740 11537 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 11856 11524 gene locus_tag LOCUS_17750 11856 11524 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_17750 12844 11921 gene locus_tag LOCUS_17760 12844 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 13404 12877 gene locus_tag LOCUS_17770 13404 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 13830 14342 gene locus_tag LOCUS_17780 13830 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 14327 14506 gene locus_tag LOCUS_17790 14327 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 14639 17125 gene locus_tag LOCUS_17800 14639 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 17628 17188 gene locus_tag LOCUS_17810 17628 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence064 76 1338 gene locus_tag LOCUS_17820 76 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1356 1844 gene locus_tag LOCUS_17830 1356 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1890 2579 gene locus_tag LOCUS_17840 1890 2579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_17840 2563 3864 gene locus_tag LOCUS_17850 2563 3864 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_17850 6006 3988 gene locus_tag LOCUS_17860 gene tkt 6006 3988 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_17860 6374 7300 gene locus_tag LOCUS_17870 gene hpnC 6374 7300 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_17870 8084 7335 gene locus_tag LOCUS_17880 8084 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 9270 8269 gene locus_tag LOCUS_17890 9270 8269 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064969.1 protein_id gnl|my_center|LOCUS_17890 9801 9373 gene locus_tag LOCUS_17900 9801 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10588 9908 gene locus_tag LOCUS_17910 10588 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11706 10690 gene locus_tag LOCUS_17920 11706 10690 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_17920 13577 11733 gene locus_tag LOCUS_17930 13577 11733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_17930 14554 13655 gene locus_tag LOCUS_17940 gene rfbD 14554 13655 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_17940 14888 15112 gene locus_tag LOCUS_17950 14888 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 15162 16058 gene locus_tag LOCUS_17960 15162 16058 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_17960 16083 17165 gene locus_tag LOCUS_17970 16083 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence065 437 1630 gene locus_tag LOCUS_17980 437 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1623 2567 gene locus_tag LOCUS_17990 1623 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2663 3205 gene locus_tag LOCUS_18000 gene rfbC 2663 3205 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_18000 3498 4637 gene locus_tag LOCUS_18010 3498 4637 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024126.1 protein_id gnl|my_center|LOCUS_18010 4639 5769 gene locus_tag LOCUS_18020 gene wecB 4639 5769 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734455.1 protein_id gnl|my_center|LOCUS_18020 6185 7336 gene locus_tag LOCUS_18030 6185 7336 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_18030 8494 9249 gene locus_tag LOCUS_18040 8494 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 9243 9722 gene locus_tag LOCUS_18050 9243 9722 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065017832.1 protein_id gnl|my_center|LOCUS_18050 9901 9974 gene locus_tag LOCUS_t00230 9901 9974 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12565 10073 gene locus_tag LOCUS_18060 12565 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 12752 13783 gene locus_tag LOCUS_18070 12752 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 13776 15014 gene locus_tag LOCUS_18080 13776 15014 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_18080 15007 15495 gene locus_tag LOCUS_18090 gene moaC 15007 15495 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_18090 15565 16008 gene locus_tag LOCUS_18100 15565 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 16043 17041 gene locus_tag LOCUS_18110 gene moaA 16043 17041 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence066 4372 3935 gene locus_tag LOCUS_18120 4372 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5475 4369 gene locus_tag LOCUS_18130 5475 4369 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_18130 6126 5497 gene locus_tag LOCUS_18140 gene pilV 6126 5497 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925904.1 protein_id gnl|my_center|LOCUS_18140 6641 6162 gene locus_tag LOCUS_18150 6641 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 7109 6693 gene locus_tag LOCUS_18160 gene pilE 7109 6693 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_18160 8361 7321 gene locus_tag LOCUS_18170 8361 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8770 9357 gene locus_tag LOCUS_18180 8770 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9396 9695 gene locus_tag LOCUS_18190 9396 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 10049 10402 gene locus_tag LOCUS_18200 gene erpA 10049 10402 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_18200 10735 11745 gene locus_tag LOCUS_18210 gene gap 10735 11745 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360478.1 protein_id gnl|my_center|LOCUS_18210 11974 12204 gene locus_tag LOCUS_18220 11974 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 12482 14812 gene locus_tag LOCUS_18230 12482 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 14904 15878 gene locus_tag LOCUS_18240 14904 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 16579 15854 gene locus_tag LOCUS_18250 16579 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence067 1155 94 gene locus_tag LOCUS_18260 1155 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1342 1145 gene locus_tag LOCUS_18270 1342 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2774 1779 gene locus_tag LOCUS_18280 gene epmB 2774 1779 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_18280 2830 3393 gene locus_tag LOCUS_18290 gene efp 2830 3393 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_18290 3488 4345 gene locus_tag LOCUS_18300 gene epmA 3488 4345 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185039.1 protein_id gnl|my_center|LOCUS_18300 4364 4918 gene locus_tag LOCUS_18310 4364 4918 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_18310 4954 8802 gene locus_tag LOCUS_18320 4954 8802 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247146.1 protein_id gnl|my_center|LOCUS_18320 8879 11536 gene locus_tag LOCUS_18330 gene pepN 8879 11536 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_18330 11835 12374 gene locus_tag LOCUS_18340 11835 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 12384 13037 gene locus_tag LOCUS_18350 12384 13037 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_18350 15248 13182 gene locus_tag LOCUS_18360 15248 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 15689 15303 gene locus_tag LOCUS_18370 15689 15303 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_18370 16264 15710 gene locus_tag LOCUS_18380 16264 15710 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_18380 16925 16467 gene locus_tag LOCUS_18390 16925 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence068 3319 1385 gene locus_tag LOCUS_18400 3319 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3874 3452 gene locus_tag LOCUS_18410 3874 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5283 3940 gene locus_tag LOCUS_18420 5283 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6067 5309 gene locus_tag LOCUS_18430 6067 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6185 6841 gene locus_tag LOCUS_18440 6185 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6876 8066 gene locus_tag LOCUS_18450 6876 8066 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_18450 9254 8262 gene locus_tag LOCUS_18460 9254 8262 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_18460 10759 9590 gene locus_tag LOCUS_18470 10759 9590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_18470 11663 10929 gene locus_tag LOCUS_18480 gene bpsR2 11663 10929 CDS product N-acyl-homoserine lactone dependent regulator BpsR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558040.1 protein_id gnl|my_center|LOCUS_18480 11904 12290 gene locus_tag LOCUS_18490 11904 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 12740 13435 gene locus_tag LOCUS_18500 12740 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_18500 14511 13549 gene locus_tag LOCUS_18510 14511 13549 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_18510 14458 14706 gene locus_tag LOCUS_18520 14458 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 14703 15314 gene locus_tag LOCUS_18530 14703 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 15319 16122 gene locus_tag LOCUS_18540 15319 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16147 16632 gene locus_tag LOCUS_18550 16147 16632 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence069 2401 1307 gene locus_tag LOCUS_18560 2401 1307 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_18560 2808 2401 gene locus_tag LOCUS_18570 2808 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3367 2783 gene locus_tag LOCUS_18580 3367 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4329 3376 gene locus_tag LOCUS_18590 4329 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4454 4549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5288 4611 gene locus_tag LOCUS_18600 5288 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5752 5303 gene locus_tag LOCUS_18610 5752 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7428 5755 gene locus_tag LOCUS_18620 7428 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7630 7729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9160 8333 gene locus_tag LOCUS_18630 9160 8333 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_18630 9229 9363 gene locus_tag LOCUS_18640 9229 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 10355 9525 gene locus_tag LOCUS_18650 10355 9525 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_18650 11036 11938 gene locus_tag LOCUS_18660 11036 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 11970 12683 gene locus_tag LOCUS_18670 11970 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 13949 12783 gene locus_tag LOCUS_18680 13949 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 14208 14306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence070 3175 410 gene locus_tag LOCUS_18690 3175 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3906 3256 gene locus_tag LOCUS_18700 3906 3256 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_18700 4201 4893 gene locus_tag LOCUS_18710 4201 4893 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_18710 4969 5529 gene locus_tag LOCUS_18720 4969 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5586 6650 gene locus_tag LOCUS_18730 5586 6650 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 protein_id gnl|my_center|LOCUS_18730 6634 7944 gene locus_tag LOCUS_18740 6634 7944 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_18740 7961 9577 gene locus_tag LOCUS_18750 gene purH 7961 9577 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_18750 9764 10063 gene locus_tag LOCUS_18760 9764 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 10165 12660 gene locus_tag LOCUS_18770 10165 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 12701 13195 gene locus_tag LOCUS_18780 12701 13195 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233853.1 protein_id gnl|my_center|LOCUS_18780 13733 13206 gene locus_tag LOCUS_18790 13733 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 13964 14848 gene locus_tag LOCUS_18800 gene argB 13964 14848 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_18800 14911 16284 gene locus_tag LOCUS_18810 14911 16284 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence071 133 2262 gene locus_tag LOCUS_18820 133 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2390 2800 gene locus_tag LOCUS_18830 2390 2800 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938720.1 protein_id gnl|my_center|LOCUS_18830 4678 2846 gene locus_tag LOCUS_18840 gene glmS 4678 2846 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_18840 6313 4763 gene locus_tag LOCUS_18850 gene glmU 6313 4763 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_18850 5198 5296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6691 6377 gene locus_tag LOCUS_18860 6691 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8073 6763 gene locus_tag LOCUS_18870 gene atpD 8073 6763 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719462.1 protein_id gnl|my_center|LOCUS_18870 6794 6889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9100 8228 gene locus_tag LOCUS_18880 9100 8228 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_18880 10712 9117 gene locus_tag LOCUS_18890 gene atpA 10712 9117 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 protein_id gnl|my_center|LOCUS_18890 11256 10717 gene locus_tag LOCUS_18900 11256 10717 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_18900 12143 11499 gene locus_tag LOCUS_18910 12143 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 12946 12161 gene locus_tag LOCUS_18920 12946 12161 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_18920 <16461 12943 gene locus_tag LOCUS_18930 <16461 12943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729624.1:methionine synthase >Feature sequence072 617 45 gene locus_tag LOCUS_18940 617 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1878 760 gene locus_tag LOCUS_18950 1878 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3539 1962 gene locus_tag LOCUS_18960 3539 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4663 3536 gene locus_tag LOCUS_18970 4663 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5179 4751 gene locus_tag LOCUS_18980 5179 4751 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_18980 5254 6558 gene locus_tag LOCUS_18990 5254 6558 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 protein_id gnl|my_center|LOCUS_18990 8683 6575 gene locus_tag LOCUS_19000 8683 6575 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_19000 9402 8722 gene locus_tag LOCUS_19010 9402 8722 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_19010 9666 9412 gene locus_tag LOCUS_19020 9666 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 10907 9714 gene locus_tag LOCUS_19030 10907 9714 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_19030 11505 12584 gene locus_tag LOCUS_19040 11505 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 13526 12669 gene locus_tag LOCUS_19050 13526 12669 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_19050 14869 13523 gene locus_tag LOCUS_19060 gene xseA 14869 13523 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099131.1 protein_id gnl|my_center|LOCUS_19060 16075 15014 gene locus_tag LOCUS_19070 gene amrS 16075 15014 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence073 130 1062 gene locus_tag LOCUS_19080 130 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1059 1937 gene locus_tag LOCUS_19090 1059 1937 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023294.1 protein_id gnl|my_center|LOCUS_19090 1978 2580 gene locus_tag LOCUS_19100 1978 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2583 3101 gene locus_tag LOCUS_19110 2583 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3914 3201 gene locus_tag LOCUS_19120 3914 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4420 3977 gene locus_tag LOCUS_19130 4420 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5750 4848 gene locus_tag LOCUS_19140 5750 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6886 5783 gene locus_tag LOCUS_19150 6886 5783 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_19150 8275 6947 gene locus_tag LOCUS_19160 8275 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 9192 8272 gene locus_tag LOCUS_19170 9192 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 9942 9235 gene locus_tag LOCUS_19180 9942 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 11934 10276 gene locus_tag LOCUS_19190 gene kaiC 11934 10276 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_19190 14355 12256 gene locus_tag LOCUS_19200 14355 12256 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_19200 15709 14366 gene locus_tag LOCUS_19210 15709 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 <16421 15713 gene locus_tag LOCUS_19220 <16421 15713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943408.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence074 2110 509 gene locus_tag LOCUS_19230 2110 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3502 2126 gene locus_tag LOCUS_19240 3502 2126 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_19240 4250 3510 gene locus_tag LOCUS_19250 4250 3510 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_19250 4835 5086 gene locus_tag LOCUS_19260 4835 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5779 5096 gene locus_tag LOCUS_19270 5779 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5961 7274 gene locus_tag LOCUS_19280 5961 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203852.1 protein_id gnl|my_center|LOCUS_19280 8716 7316 gene locus_tag LOCUS_19290 8716 7316 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_19290 11538 8713 gene locus_tag LOCUS_19300 11538 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 12717 11572 gene locus_tag LOCUS_19310 12717 11572 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941807.1 protein_id gnl|my_center|LOCUS_19310 14018 12954 gene locus_tag LOCUS_19320 14018 12954 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_19320 15031 14144 gene locus_tag LOCUS_19330 gene htpX 15031 14144 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_19330 15222 16109 gene locus_tag LOCUS_19340 gene nhaR 15222 16109 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence075 397 1287 gene locus_tag LOCUS_19350 397 1287 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_19350 1292 2971 gene locus_tag LOCUS_19360 gene ettA 1292 2971 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_19360 3006 3917 gene locus_tag LOCUS_19370 3006 3917 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063911.1 protein_id gnl|my_center|LOCUS_19370 4558 3956 gene locus_tag LOCUS_19380 4558 3956 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_19380 5037 4558 gene locus_tag LOCUS_19390 5037 4558 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933501.1 protein_id gnl|my_center|LOCUS_19390 5125 5496 gene locus_tag LOCUS_19400 5125 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5789 5493 gene locus_tag LOCUS_19410 5789 5493 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_19410 6143 6319 gene locus_tag LOCUS_19420 6143 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 9406 6371 gene locus_tag LOCUS_19430 gene glnE 9406 6371 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_19430 9616 12840 gene locus_tag LOCUS_19440 9616 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 12837 13574 gene locus_tag LOCUS_19450 gene pdxJ 12837 13574 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_19450 13571 13969 gene locus_tag LOCUS_19460 gene acpS 13571 13969 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707403.1 protein_id gnl|my_center|LOCUS_19460 13966 16251 gene locus_tag LOCUS_19470 13966 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence076 170 6 gene locus_tag LOCUS_19480 170 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 118 1200 gene locus_tag LOCUS_19490 118 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494135.1 protein_id gnl|my_center|LOCUS_19490 1729 1166 gene locus_tag LOCUS_19500 1729 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2722 1742 gene locus_tag LOCUS_19510 gene thiS 2722 1742 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_19510 3851 2772 gene locus_tag LOCUS_19520 gene gcvT 3851 2772 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_19520 4675 3848 gene locus_tag LOCUS_19530 gene kdsA 4675 3848 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958364.1 protein_id gnl|my_center|LOCUS_19530 6315 4672 gene locus_tag LOCUS_19540 6315 4672 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_19540 8949 6463 gene locus_tag LOCUS_19550 gene lon 8949 6463 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_19550 10161 9103 gene locus_tag LOCUS_19560 10161 9103 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_19560 10391 11140 gene locus_tag LOCUS_19570 10391 11140 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_19570 12277 11150 gene locus_tag LOCUS_19580 12277 11150 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083543.1 protein_id gnl|my_center|LOCUS_19580 13175 12489 gene locus_tag LOCUS_19590 13175 12489 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_19590 13726 13280 gene locus_tag LOCUS_19600 13726 13280 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389911.1 protein_id gnl|my_center|LOCUS_19600 13975 13763 gene locus_tag LOCUS_19610 13975 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 14107 15021 gene locus_tag LOCUS_19620 14107 15021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 protein_id gnl|my_center|LOCUS_19620 15151 15420 gene locus_tag LOCUS_19630 15151 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence077 212 320 gene locus_tag LOCUS_r00010 212 320 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 379 837 gene locus_tag LOCUS_19640 gene rplM 379 837 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_19640 900 1295 gene locus_tag LOCUS_19650 gene rpsI 900 1295 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384467.1 protein_id gnl|my_center|LOCUS_19650 1426 2481 gene locus_tag LOCUS_19660 gene argC 1426 2481 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_19660 2721 2978 gene locus_tag LOCUS_19670 2721 2978 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_19670 3121 4014 gene locus_tag LOCUS_19680 3121 4014 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_19680 4075 4728 gene locus_tag LOCUS_19690 gene gmk 4075 4728 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_19690 4790 5251 gene locus_tag LOCUS_19700 4790 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5360 7528 gene locus_tag LOCUS_19710 5360 7528 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_19710 7550 7930 gene locus_tag LOCUS_19720 7550 7930 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124713.1 protein_id gnl|my_center|LOCUS_19720 9913 8504 gene locus_tag LOCUS_19730 9913 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 10476 11024 gene locus_tag LOCUS_19740 gene pyrR 10476 11024 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_19740 11076 12035 gene locus_tag LOCUS_19750 11076 12035 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_19750 12040 13329 gene locus_tag LOCUS_19760 12040 13329 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_19760 13326 14216 gene locus_tag LOCUS_19770 13326 14216 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_19770 14244 14810 gene locus_tag LOCUS_19780 14244 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14985 15061 gene locus_tag LOCUS_t00240 14985 15061 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15139 15215 gene locus_tag LOCUS_t00250 15139 15215 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15290 15365 gene locus_tag LOCUS_t00260 15290 15365 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 933 226 gene locus_tag LOCUS_19790 933 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2034 1591 gene locus_tag LOCUS_19800 2034 1591 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_19800 2348 2683 gene locus_tag LOCUS_19810 2348 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2708 3103 gene locus_tag LOCUS_19820 2708 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3078 3692 gene locus_tag LOCUS_19830 3078 3692 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_19830 3731 5530 gene locus_tag LOCUS_19840 gene treZ 3731 5530 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_19840 6227 5559 gene locus_tag LOCUS_19850 6227 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7517 6306 gene locus_tag LOCUS_19860 7517 6306 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_19860 7765 8193 gene locus_tag LOCUS_19870 7765 8193 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392624.1 protein_id gnl|my_center|LOCUS_19870 12452 8205 gene locus_tag LOCUS_19880 12452 8205 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_19880 12655 13110 gene locus_tag LOCUS_19890 12655 13110 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_19890 13097 13528 gene locus_tag LOCUS_19900 13097 13528 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 protein_id gnl|my_center|LOCUS_19900 13585 14556 gene locus_tag LOCUS_19910 13585 14556 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence079 848 1969 gene locus_tag LOCUS_19920 gene acrE 848 1969 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160363.1 protein_id gnl|my_center|LOCUS_19920 1979 5092 gene locus_tag LOCUS_19930 1979 5092 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067600.1 protein_id gnl|my_center|LOCUS_19930 5092 6480 gene locus_tag LOCUS_19940 5092 6480 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526921.1 protein_id gnl|my_center|LOCUS_19940 6605 7996 gene locus_tag LOCUS_19950 6605 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8076 9701 gene locus_tag LOCUS_19960 8076 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11924 9702 gene locus_tag LOCUS_19970 11924 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 13244 11925 gene locus_tag LOCUS_19980 13244 11925 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_19980 13682 14551 gene locus_tag LOCUS_19990 13682 14551 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence080 403 1062 gene locus_tag LOCUS_20000 403 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1151 3628 gene locus_tag LOCUS_20010 1151 3628 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_20010 3813 7751 gene locus_tag LOCUS_20020 3813 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 8025 8909 gene locus_tag LOCUS_20030 gene lsrF 8025 8909 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917724.1 protein_id gnl|my_center|LOCUS_20030 9065 10879 gene locus_tag LOCUS_20040 9065 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 11168 13594 gene locus_tag LOCUS_20050 11168 13594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941940.1 protein_id gnl|my_center|LOCUS_20050 14472 13762 gene locus_tag LOCUS_20060 14472 13762 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence081 2282 2378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3545 3075 gene locus_tag LOCUS_20070 3545 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5409 3640 gene locus_tag LOCUS_20080 5409 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7003 5603 gene locus_tag LOCUS_20090 7003 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 8216 7008 gene locus_tag LOCUS_20100 8216 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8557 8213 gene locus_tag LOCUS_20110 8557 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 9279 8554 gene locus_tag LOCUS_20120 9279 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 10863 9481 gene locus_tag LOCUS_20130 10863 9481 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_20130 13285 10856 gene locus_tag LOCUS_20140 13285 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 13327 13863 gene locus_tag LOCUS_20150 13327 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence082 <1 1711 gene locus_tag LOCUS_20160 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein 1708 2136 gene locus_tag LOCUS_20170 1708 2136 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_20170 2238 2519 gene locus_tag LOCUS_20180 2238 2519 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812626.1 protein_id gnl|my_center|LOCUS_20180 2479 2709 gene locus_tag LOCUS_20190 2479 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3127 2714 gene locus_tag LOCUS_20200 3127 2714 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_20200 3841 3203 gene locus_tag LOCUS_20210 3841 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5921 4044 gene locus_tag LOCUS_20220 gene mutL 5921 4044 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_20220 6302 7507 gene locus_tag LOCUS_20230 gene glgA 6302 7507 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_20230 7554 9530 gene locus_tag LOCUS_20240 7554 9530 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_20240 9594 10934 gene locus_tag LOCUS_20250 9594 10934 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124270.1 protein_id gnl|my_center|LOCUS_20250 10931 11266 gene locus_tag LOCUS_20260 10931 11266 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817378.1 protein_id gnl|my_center|LOCUS_20260 11293 12003 gene locus_tag LOCUS_20270 11293 12003 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337828.1 protein_id gnl|my_center|LOCUS_20270 12092 12754 gene locus_tag LOCUS_20280 gene parA 12092 12754 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_20280 12772 13437 gene locus_tag LOCUS_20290 12772 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence083 122 47 gene locus_tag LOCUS_t00270 122 47 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 343 993 gene locus_tag LOCUS_20300 343 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 990 3236 gene locus_tag LOCUS_20310 990 3236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_20310 3233 4606 gene locus_tag LOCUS_20320 3233 4606 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_20320 4672 5508 gene locus_tag LOCUS_20330 gene galU 4672 5508 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591482.1 protein_id gnl|my_center|LOCUS_20330 5648 9160 gene locus_tag LOCUS_20340 5648 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 9185 9550 gene locus_tag LOCUS_20350 9185 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9547 10797 gene locus_tag LOCUS_20360 9547 10797 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_20360 10830 12140 gene locus_tag LOCUS_20370 10830 12140 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015312606.1 protein_id gnl|my_center|LOCUS_20370 12269 12589 gene locus_tag LOCUS_20380 12269 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 12687 13106 gene locus_tag LOCUS_20390 12687 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence084 944 72 gene locus_tag LOCUS_20400 944 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1652 1062 gene locus_tag LOCUS_20410 1652 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2107 1709 gene locus_tag LOCUS_20420 2107 1709 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_20420 2401 2925 gene locus_tag LOCUS_20430 2401 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2873 3361 gene locus_tag LOCUS_20440 2873 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3672 3481 gene locus_tag LOCUS_20450 3672 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4166 3867 gene locus_tag LOCUS_20460 4166 3867 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388797.1 protein_id gnl|my_center|LOCUS_20460 4337 6070 gene locus_tag LOCUS_20470 4337 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 6858 7910 gene locus_tag LOCUS_20480 6858 7910 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_20480 7952 8296 gene locus_tag LOCUS_20490 7952 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 9018 8371 gene locus_tag LOCUS_20500 9018 8371 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_20500 9800 9015 gene locus_tag LOCUS_20510 9800 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10830 9793 gene locus_tag LOCUS_20520 gene trpS 10830 9793 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 protein_id gnl|my_center|LOCUS_20520 11889 10936 gene locus_tag LOCUS_20530 11889 10936 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 protein_id gnl|my_center|LOCUS_20530 12635 11895 gene locus_tag LOCUS_20540 12635 11895 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973172.1 protein_id gnl|my_center|LOCUS_20540 13031 12651 gene locus_tag LOCUS_20550 13031 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence085 3 458 gene locus_tag LOCUS_20560 3 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1286 693 gene locus_tag LOCUS_20570 1286 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1942 1277 gene locus_tag LOCUS_20580 1942 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1974 2366 gene locus_tag LOCUS_20590 1974 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2381 3226 gene locus_tag LOCUS_20600 2381 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3201 3926 gene locus_tag LOCUS_20610 3201 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4057 4743 gene locus_tag LOCUS_20620 4057 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_20620 4907 5950 gene locus_tag LOCUS_20630 4907 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5947 6672 gene locus_tag LOCUS_20640 5947 6672 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_20640 6697 8388 gene locus_tag LOCUS_20650 6697 8388 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431977.1 protein_id gnl|my_center|LOCUS_20650 8389 10074 gene locus_tag LOCUS_20660 8389 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 10152 11168 gene locus_tag LOCUS_20670 10152 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 11243 11821 gene locus_tag LOCUS_20680 11243 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 11808 12584 gene locus_tag LOCUS_20690 11808 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence086 807 1001 gene locus_tag LOCUS_20700 807 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1113 2420 gene locus_tag LOCUS_20710 1113 2420 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_20710 2605 3027 gene locus_tag LOCUS_20720 2605 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3541 4329 gene locus_tag LOCUS_20730 3541 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4456 4827 gene locus_tag LOCUS_20740 4456 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4884 5288 gene locus_tag LOCUS_20750 4884 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5294 5719 gene locus_tag LOCUS_20760 5294 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6078 6332 gene locus_tag LOCUS_20770 6078 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 6901 6404 gene locus_tag LOCUS_20780 6901 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 8286 6991 gene locus_tag LOCUS_20790 8286 6991 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_20790 10161 8317 gene locus_tag LOCUS_20800 gene ilvD 10161 8317 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807716.1 protein_id gnl|my_center|LOCUS_20800 10295 10912 gene locus_tag LOCUS_20810 10295 10912 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_20810 11636 12634 gene locus_tag LOCUS_20820 11636 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence087 <1 3903 gene locus_tag LOCUS_20830 <1 3903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071149.1:PAS domain S-box protein 5894 3966 gene locus_tag LOCUS_20840 gene asnB 5894 3966 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_20840 6195 5974 gene locus_tag LOCUS_20850 6195 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 6397 6203 gene locus_tag LOCUS_20860 6397 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6981 6394 gene locus_tag LOCUS_20870 6981 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 7147 7004 gene locus_tag LOCUS_20880 7147 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 7477 8616 gene locus_tag LOCUS_20890 gene rubB 7477 8616 CDS product rubredoxin reductase RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_20890 9013 8777 gene locus_tag LOCUS_20900 9013 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 9261 9620 gene locus_tag LOCUS_20910 9261 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 9681 12236 gene locus_tag LOCUS_20920 9681 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence088 743 318 gene locus_tag LOCUS_20930 743 318 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391459.1 protein_id gnl|my_center|LOCUS_20930 1023 3074 gene locus_tag LOCUS_20940 1023 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3193 4269 gene locus_tag LOCUS_20950 3193 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5706 4282 gene locus_tag LOCUS_20960 5706 4282 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_20960 7934 5736 gene locus_tag LOCUS_20970 7934 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 9170 8058 gene locus_tag LOCUS_20980 gene tgt 9170 8058 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_20980 9999 9199 gene locus_tag LOCUS_20990 9999 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20990 9895 10224 gene locus_tag LOCUS_21000 9895 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence089 42 464 gene locus_tag LOCUS_21010 42 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390743.1 protein_id gnl|my_center|LOCUS_21010 461 1753 gene locus_tag LOCUS_21020 461 1753 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 protein_id gnl|my_center|LOCUS_21020 1750 4557 gene locus_tag LOCUS_21030 1750 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 6625 4787 gene locus_tag LOCUS_21040 6625 4787 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_21040 7578 6520 gene locus_tag LOCUS_21050 7578 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 8368 7559 gene locus_tag LOCUS_21060 gene nirQ 8368 7559 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_21060 9826 8444 gene locus_tag LOCUS_21070 gene norB 9826 8444 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_21070 10280 9840 gene locus_tag LOCUS_21080 gene norC 10280 9840 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_21080 10514 11878 gene locus_tag LOCUS_21090 10514 11878 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941701.1 protein_id gnl|my_center|LOCUS_21090 12248 11892 gene locus_tag LOCUS_21100 12248 11892 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_21100 12516 12295 gene locus_tag LOCUS_21110 12516 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence090 2320 845 gene locus_tag LOCUS_21120 2320 845 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_21120 4260 2317 gene locus_tag LOCUS_21130 gene cobJ 4260 2317 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142541.1 protein_id gnl|my_center|LOCUS_21130 5012 4257 gene locus_tag LOCUS_21140 5012 4257 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_21140 6304 5009 gene locus_tag LOCUS_21150 6304 5009 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_21150 7416 6301 gene locus_tag LOCUS_21160 7416 6301 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631402.1 protein_id gnl|my_center|LOCUS_21160 8072 7413 gene locus_tag LOCUS_21170 gene cbiC 8072 7413 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_21170 8923 8096 gene locus_tag LOCUS_21180 8923 8096 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_21180 9143 10495 gene locus_tag LOCUS_21190 9143 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 10514 10687 gene locus_tag LOCUS_21200 10514 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 10704 11954 gene locus_tag LOCUS_21210 10704 11954 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_21210 12197 12451 gene locus_tag LOCUS_21220 12197 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence091 511 1443 gene locus_tag LOCUS_21230 511 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2276 1449 gene locus_tag LOCUS_21240 gene rsmA 2276 1449 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_21240 2478 2678 gene locus_tag LOCUS_21250 2478 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2830 3018 gene locus_tag LOCUS_21260 2830 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4159 3212 gene locus_tag LOCUS_21270 4159 3212 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_21270 4720 4379 gene locus_tag LOCUS_21280 4720 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6524 4815 gene locus_tag LOCUS_21290 6524 4815 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_21290 7353 6541 gene locus_tag LOCUS_21300 gene folE2 7353 6541 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_21300 7535 8446 gene locus_tag LOCUS_21310 7535 8446 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_21310 9892 8600 gene locus_tag LOCUS_21320 9892 8600 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422343.1 protein_id gnl|my_center|LOCUS_21320 10304 12328 gene locus_tag LOCUS_21330 10304 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence092 1 1101 gene locus_tag LOCUS_21340 1 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1216 1497 gene locus_tag LOCUS_21350 1216 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1494 1784 gene locus_tag LOCUS_21360 1494 1784 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_21360 3028 1886 gene locus_tag LOCUS_21370 3028 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4429 3071 gene locus_tag LOCUS_21380 4429 3071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_21380 5184 4465 gene locus_tag LOCUS_21390 5184 4465 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_21390 5312 6847 gene locus_tag LOCUS_21400 5312 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 6854 9952 gene locus_tag LOCUS_21410 6854 9952 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_21410 10092 10373 gene locus_tag LOCUS_21420 10092 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 10393 11691 gene locus_tag LOCUS_21430 10393 11691 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944009.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence093 149 1360 gene locus_tag LOCUS_21440 149 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3413 1512 gene locus_tag LOCUS_21450 3413 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4225 3410 gene locus_tag LOCUS_21460 4225 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5257 4661 gene locus_tag LOCUS_21470 5257 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5823 5467 gene locus_tag LOCUS_21480 5823 5467 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_21480 6138 8387 gene locus_tag LOCUS_21490 6138 8387 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_21490 8718 8506 gene locus_tag LOCUS_21500 8718 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 8994 8794 gene locus_tag LOCUS_21510 8994 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 9571 11310 gene locus_tag LOCUS_21520 9571 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 11633 11349 gene locus_tag LOCUS_21530 11633 11349 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence094 948 379 gene locus_tag LOCUS_21540 948 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_21540 1233 2297 gene locus_tag LOCUS_21550 1233 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2352 4871 gene locus_tag LOCUS_21560 2352 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 5294 6034 gene locus_tag LOCUS_21570 5294 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 6101 7078 gene locus_tag LOCUS_21580 6101 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 7162 8766 gene locus_tag LOCUS_21590 7162 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8763 10313 gene locus_tag LOCUS_21600 gene pelF 8763 10313 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_21600 11480 10488 gene locus_tag LOCUS_21610 11480 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence095 1495 455 gene locus_tag LOCUS_21620 1495 455 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258773.1 protein_id gnl|my_center|LOCUS_21620 1769 3958 gene locus_tag LOCUS_21630 1769 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4018 5493 gene locus_tag LOCUS_21640 4018 5493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_21640 5490 8336 gene locus_tag LOCUS_21650 5490 8336 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_21650 8320 9339 gene locus_tag LOCUS_21660 8320 9339 CDS product PD-(D/E)XK motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383505.1 protein_id gnl|my_center|LOCUS_21660 9343 11163 gene locus_tag LOCUS_21670 9343 11163 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence096 4284 760 gene locus_tag LOCUS_21680 4284 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 5603 6580 gene locus_tag LOCUS_21690 5603 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 6740 11050 gene locus_tag LOCUS_21700 6740 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence097 319 20 gene locus_tag LOCUS_21710 319 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 747 316 gene locus_tag LOCUS_21720 747 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2072 753 gene locus_tag LOCUS_21730 2072 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_21730 3082 2150 gene locus_tag LOCUS_21740 gene rrp1 3082 2150 CDS product cyclic-di-GMP-producing response regulator Rrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010256898.1 protein_id gnl|my_center|LOCUS_21740 3674 3162 gene locus_tag LOCUS_21750 3674 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3919 7485 gene locus_tag LOCUS_21760 3919 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7475 8533 gene locus_tag LOCUS_21770 7475 8533 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_21770 8999 8637 gene locus_tag LOCUS_21780 8999 8637 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_21780 9235 8996 gene locus_tag LOCUS_21790 9235 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 9621 9896 gene locus_tag LOCUS_21800 9621 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence098 2812 2342 gene locus_tag LOCUS_21810 2812 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5963 2904 gene locus_tag LOCUS_21820 5963 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 7394 6225 gene locus_tag LOCUS_21830 gene hemW 7394 6225 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_21830 8141 7458 gene locus_tag LOCUS_21840 gene rph 8141 7458 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_21840 8103 8267 gene locus_tag LOCUS_21850 8103 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 9857 8355 gene locus_tag LOCUS_21860 9857 8355 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546048.1 protein_id gnl|my_center|LOCUS_21860 10630 9917 gene locus_tag LOCUS_21870 gene dsrM 10630 9917 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence099 259 1224 gene locus_tag LOCUS_21880 259 1224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_21880 1221 2003 gene locus_tag LOCUS_21890 1221 2003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_21890 2161 3096 gene locus_tag LOCUS_21900 gene ppk2 2161 3096 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_21900 3202 4683 gene locus_tag LOCUS_21910 3202 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5066 5389 gene locus_tag LOCUS_21920 5066 5389 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_21920 5386 7080 gene locus_tag LOCUS_21930 5386 7080 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_21930 7125 8612 gene locus_tag LOCUS_21940 7125 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 8646 10553 gene locus_tag LOCUS_21950 8646 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence100 275 991 gene locus_tag LOCUS_21960 275 991 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_21960 1034 1939 gene locus_tag LOCUS_21970 1034 1939 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975595.1 protein_id gnl|my_center|LOCUS_21970 1936 3150 gene locus_tag LOCUS_21980 gene neuC 1936 3150 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_21980 3157 4215 gene locus_tag LOCUS_21990 gene neuB 3157 4215 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 protein_id gnl|my_center|LOCUS_21990 4423 6357 gene locus_tag LOCUS_22000 gene htpG 4423 6357 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 protein_id gnl|my_center|LOCUS_22000 6531 7622 gene locus_tag LOCUS_22010 6531 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 7648 9189 gene locus_tag LOCUS_22020 7648 9189 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_22020 10083 9199 gene locus_tag LOCUS_22030 10083 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 10490 10308 gene locus_tag LOCUS_22040 10490 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence101 552 1022 gene locus_tag LOCUS_22050 552 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 1595 1041 gene locus_tag LOCUS_22060 1595 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2226 1570 gene locus_tag LOCUS_22070 2226 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2427 3371 gene locus_tag LOCUS_22080 2427 3371 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941474.1 protein_id gnl|my_center|LOCUS_22080 5439 3361 gene locus_tag LOCUS_22090 5439 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 5694 7388 gene locus_tag LOCUS_22100 5694 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 7385 9559 gene locus_tag LOCUS_22110 7385 9559 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence102 1994 156 gene locus_tag LOCUS_22120 1994 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4054 1991 gene locus_tag LOCUS_22130 4054 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5868 4099 gene locus_tag LOCUS_22140 5868 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 6254 5823 gene locus_tag LOCUS_22150 6254 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 7042 6251 gene locus_tag LOCUS_22160 7042 6251 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387857.1 protein_id gnl|my_center|LOCUS_22160 9356 7125 gene locus_tag LOCUS_22170 9356 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 9760 9431 gene locus_tag LOCUS_22180 9760 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence103 248 39 gene locus_tag LOCUS_22190 248 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1259 372 gene locus_tag LOCUS_22200 1259 372 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855106.1 protein_id gnl|my_center|LOCUS_22200 1852 1256 gene locus_tag LOCUS_22210 1852 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4154 1941 gene locus_tag LOCUS_22220 4154 1941 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_22220 5433 4162 gene locus_tag LOCUS_22230 5433 4162 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_22230 5757 8666 gene locus_tag LOCUS_22240 5757 8666 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_22240 9095 8817 gene locus_tag LOCUS_22250 9095 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 9291 10037 gene locus_tag LOCUS_22260 9291 10037 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence104 325 1545 gene locus_tag LOCUS_22270 325 1545 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 protein_id gnl|my_center|LOCUS_22270 1578 2528 gene locus_tag LOCUS_22280 1578 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2525 3532 gene locus_tag LOCUS_22290 2525 3532 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_22290 3542 5065 gene locus_tag LOCUS_22300 3542 5065 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_22300 5657 5160 gene locus_tag LOCUS_22310 gene tpx 5657 5160 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_22310 6234 5947 gene locus_tag LOCUS_22320 6234 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7139 6867 gene locus_tag LOCUS_22330 7139 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8321 7266 gene locus_tag LOCUS_22340 gene cobD 8321 7266 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_22340 9275 8361 gene locus_tag LOCUS_22350 9275 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence105 892 1866 gene locus_tag LOCUS_22360 gene mtrA 892 1866 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_22360 1890 4088 gene locus_tag LOCUS_22370 1890 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 5967 6257 gene locus_tag LOCUS_22380 5967 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6345 6710 gene locus_tag LOCUS_22390 6345 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 9152 6804 gene locus_tag LOCUS_22400 9152 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence106 97 1227 gene locus_tag LOCUS_22410 97 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1208 1432 gene locus_tag LOCUS_22420 1208 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2333 1614 gene locus_tag LOCUS_22430 2333 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_22430 3259 2675 gene locus_tag LOCUS_22440 3259 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence107 3588 2554 gene locus_tag LOCUS_22450 3588 2554 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016758384.1 protein_id gnl|my_center|LOCUS_22450 3616 4602 gene locus_tag LOCUS_22460 3616 4602 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_22460 5671 8085 gene locus_tag LOCUS_22470 5671 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 8142 8459 gene locus_tag LOCUS_22480 8142 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 8465 9142 gene locus_tag LOCUS_22490 8465 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence108 397 95 gene locus_tag LOCUS_22500 397 95 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652847.1 protein_id gnl|my_center|LOCUS_22500 679 404 gene locus_tag LOCUS_22510 679 404 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_22510 1225 4506 gene locus_tag LOCUS_22520 1225 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 6999 7637 gene locus_tag LOCUS_22530 6999 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence109 110 430 gene locus_tag LOCUS_22540 110 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 539 1345 gene locus_tag LOCUS_22550 gene dapB 539 1345 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543604.1 protein_id gnl|my_center|LOCUS_22550 1416 1754 gene locus_tag LOCUS_22560 1416 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3367 1883 gene locus_tag LOCUS_22570 3367 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence110 815 27 gene locus_tag LOCUS_22580 815 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1866 820 gene locus_tag LOCUS_22590 1866 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1969 2151 gene locus_tag LOCUS_22600 1969 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2565 2200 gene locus_tag LOCUS_22610 2565 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2707 2964 gene locus_tag LOCUS_22620 2707 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2957 3235 gene locus_tag LOCUS_22630 2957 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 5922 3244 gene locus_tag LOCUS_22640 5922 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 6036 6413 gene locus_tag LOCUS_22650 6036 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7603 8247 gene locus_tag LOCUS_22660 7603 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8237 9091 gene locus_tag LOCUS_22670 8237 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence111 1019 276 gene locus_tag LOCUS_22680 1019 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1953 1252 gene locus_tag LOCUS_22690 1953 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3629 2160 gene locus_tag LOCUS_22700 3629 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4264 3641 gene locus_tag LOCUS_22710 4264 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5783 4305 gene locus_tag LOCUS_22720 5783 4305 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_22720 6969 5809 gene locus_tag LOCUS_22730 6969 5809 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_22730 7401 6973 gene locus_tag LOCUS_22740 7401 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 8500 8282 gene locus_tag LOCUS_22750 8500 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 8726 8481 gene locus_tag LOCUS_22760 8726 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence112 751 1554 gene locus_tag LOCUS_22770 751 1554 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267999.1 protein_id gnl|my_center|LOCUS_22770 1973 3316 gene locus_tag LOCUS_22780 1973 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5392 3467 gene locus_tag LOCUS_22790 5392 3467 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_22790 7832 5466 gene locus_tag LOCUS_22800 7832 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8325 7951 gene locus_tag LOCUS_22810 8325 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence113 366 1493 gene locus_tag LOCUS_22820 366 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1553 6046 gene locus_tag LOCUS_22830 1553 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6177 6992 gene locus_tag LOCUS_22840 6177 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 8154 6985 gene locus_tag LOCUS_22850 8154 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8377 8195 gene locus_tag LOCUS_22860 8377 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 >Feature sequence114 3509 906 gene locus_tag LOCUS_22870 gene leuS 3509 906 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105190.1 protein_id gnl|my_center|LOCUS_22870 3977 5677 gene locus_tag LOCUS_22880 gene sdhA 3977 5677 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_22880 5754 6740 gene locus_tag LOCUS_22890 5754 6740 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142938.1 protein_id gnl|my_center|LOCUS_22890 6766 7650 gene locus_tag LOCUS_22900 6766 7650 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_22900 8211 8402 gene locus_tag LOCUS_22910 8211 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence115 766 1815 gene locus_tag LOCUS_22920 gene dapF 766 1815 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_22920 2011 2086 gene locus_tag LOCUS_t00280 2011 2086 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2350 2180 gene locus_tag LOCUS_22930 2350 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3500 2511 gene locus_tag LOCUS_22940 3500 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4545 4075 gene locus_tag LOCUS_22950 4545 4075 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_22950 4701 5603 gene locus_tag LOCUS_22960 4701 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 5606 6079 gene locus_tag LOCUS_22970 5606 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6124 6702 gene locus_tag LOCUS_22980 6124 6702 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_22980 6695 7594 gene locus_tag LOCUS_22990 6695 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence116 142 393 gene locus_tag LOCUS_23000 142 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2437 329 gene locus_tag LOCUS_23010 2437 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1756 1855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3800 2478 gene locus_tag LOCUS_23020 3800 2478 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 protein_id gnl|my_center|LOCUS_23020 7751 3813 gene locus_tag LOCUS_23030 7751 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence117 1 1425 gene locus_tag LOCUS_23040 1 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1422 2924 gene locus_tag LOCUS_23050 1422 2924 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_23050 2938 4323 gene locus_tag LOCUS_23060 2938 4323 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_23060 4313 5404 gene locus_tag LOCUS_23070 gene mraY 4313 5404 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_23070 5405 6751 gene locus_tag LOCUS_23080 gene murD 5405 6751 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_23080 6741 7964 gene locus_tag LOCUS_23090 gene ftsW 6741 7964 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence118 2331 121 gene locus_tag LOCUS_23100 gene priA 2331 121 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_23100 4457 2382 gene locus_tag LOCUS_23110 4457 2382 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_23110 6193 4457 gene locus_tag LOCUS_23120 6193 4457 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_23120 7638 6205 gene locus_tag LOCUS_23130 7638 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence119 1333 209 gene locus_tag LOCUS_23140 1333 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2001 1339 gene locus_tag LOCUS_23150 2001 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2496 2149 gene locus_tag LOCUS_23160 2496 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3875 2496 gene locus_tag LOCUS_23170 gene thrC 3875 2496 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_23170 4592 3933 gene locus_tag LOCUS_23180 4592 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5068 4649 gene locus_tag LOCUS_23190 5068 4649 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256137.1 protein_id gnl|my_center|LOCUS_23190 5400 5104 gene locus_tag LOCUS_23200 gene bigR 5400 5104 CDS product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389407.1 protein_id gnl|my_center|LOCUS_23200 5687 6709 gene locus_tag LOCUS_23210 5687 6709 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162145490.1 protein_id gnl|my_center|LOCUS_23210 6690 7772 gene locus_tag LOCUS_23220 6690 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence120 283 1320 gene locus_tag LOCUS_23230 283 1320 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_23230 1435 1749 gene locus_tag LOCUS_23240 1435 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1827 2048 gene locus_tag LOCUS_23250 1827 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2111 3064 gene locus_tag LOCUS_23260 2111 3064 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_23260 3152 5065 gene locus_tag LOCUS_23270 3152 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 5062 5838 gene locus_tag LOCUS_23280 5062 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 5950 6612 gene locus_tag LOCUS_23290 5950 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence121 1707 421 gene locus_tag LOCUS_23300 gene serS 1707 421 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_23300 4452 1711 gene locus_tag LOCUS_23310 gene gyrA 4452 1711 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_23310 4701 6065 gene locus_tag LOCUS_23320 gene purB 4701 6065 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118712.1 protein_id gnl|my_center|LOCUS_23320 6102 7787 gene locus_tag LOCUS_23330 gene recN 6102 7787 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence122 295 38 gene locus_tag LOCUS_23340 295 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 399 896 gene locus_tag LOCUS_23350 399 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1699 911 gene locus_tag LOCUS_23360 gene menB 1699 911 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_23360 1921 3420 gene locus_tag LOCUS_23370 gene trpE 1921 3420 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_23370 3426 4007 gene locus_tag LOCUS_23380 3426 4007 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_23380 4019 5041 gene locus_tag LOCUS_23390 gene trpD 4019 5041 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_23390 5064 5885 gene locus_tag LOCUS_23400 gene trpC 5064 5885 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_23400 6953 6261 gene locus_tag LOCUS_23410 6953 6261 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048781225.1 protein_id gnl|my_center|LOCUS_23410 7486 7148 gene locus_tag LOCUS_23420 7486 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence123 287 2707 gene locus_tag LOCUS_23430 287 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2774 3088 gene locus_tag LOCUS_23440 2774 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3648 3121 gene locus_tag LOCUS_23450 3648 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5358 3997 gene locus_tag LOCUS_23460 5358 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6813 5572 gene locus_tag LOCUS_23470 gene ftsA 6813 5572 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420913.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence124 950 2350 gene locus_tag LOCUS_23480 950 2350 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_23480 2554 4902 gene locus_tag LOCUS_23490 2554 4902 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244161.1 protein_id gnl|my_center|LOCUS_23490 4905 6692 gene locus_tag LOCUS_23500 4905 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence125 465 389 gene locus_tag LOCUS_t00290 465 389 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1386 529 gene locus_tag LOCUS_23510 1386 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2165 1398 gene locus_tag LOCUS_23520 2165 1398 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_23520 3004 2183 gene locus_tag LOCUS_23530 3004 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3845 3012 gene locus_tag LOCUS_23540 gene nadC 3845 3012 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_23540 6646 3842 gene locus_tag LOCUS_23550 6646 3842 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_23550 7299 6748 gene locus_tag LOCUS_23560 7299 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence126 448 164 gene locus_tag LOCUS_23570 448 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 830 510 gene locus_tag LOCUS_23580 830 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2988 1042 gene locus_tag LOCUS_23590 2988 1042 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_23590 4502 3063 gene locus_tag LOCUS_23600 4502 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4726 4820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5357 6097 gene locus_tag LOCUS_23610 5357 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 6101 6907 gene locus_tag LOCUS_23620 gene lgt 6101 6907 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence127 1205 975 gene locus_tag LOCUS_23630 1205 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1637 1897 gene locus_tag LOCUS_23640 1637 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2027 2245 gene locus_tag LOCUS_23650 2027 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2242 2682 gene locus_tag LOCUS_23660 2242 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2679 4940 gene locus_tag LOCUS_23670 2679 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 5052 5786 gene locus_tag LOCUS_23680 5052 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence128 <1 1127 gene locus_tag LOCUS_23690 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941952.1:methyl-accepting chemotaxis protein 1657 1145 gene locus_tag LOCUS_23700 1657 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3237 1654 gene locus_tag LOCUS_23710 3237 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4400 3234 gene locus_tag LOCUS_23720 4400 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4453 4552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6071 5001 gene locus_tag LOCUS_23730 6071 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 6913 6290 gene locus_tag LOCUS_23740 6913 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence129 316 1482 gene locus_tag LOCUS_23750 316 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1485 1904 gene locus_tag LOCUS_23760 1485 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2300 2004 gene locus_tag LOCUS_23770 2300 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2570 2860 gene locus_tag LOCUS_23780 2570 2860 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_23780 2998 3216 gene locus_tag LOCUS_23790 2998 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3880 3590 gene locus_tag LOCUS_23800 3880 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4883 4323 gene locus_tag LOCUS_23810 4883 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 6395 5046 gene locus_tag LOCUS_23820 6395 5046 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_23820 6907 6557 gene locus_tag LOCUS_23830 6907 6557 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence130 534 1358 gene locus_tag LOCUS_23840 534 1358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_23840 1371 2528 gene locus_tag LOCUS_23850 1371 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2676 3101 gene locus_tag LOCUS_23860 2676 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3657 3214 gene locus_tag LOCUS_23870 3657 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4573 3764 gene locus_tag LOCUS_23880 4573 3764 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_23880 5123 4908 gene locus_tag LOCUS_23890 5123 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence131 1624 1340 gene locus_tag LOCUS_23900 1624 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1869 1621 gene locus_tag LOCUS_23910 1869 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2587 1901 gene locus_tag LOCUS_23920 2587 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3844 2906 gene locus_tag LOCUS_23930 3844 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4834 3923 gene locus_tag LOCUS_23940 4834 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 5538 4930 gene locus_tag LOCUS_23950 5538 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 6106 5771 gene locus_tag LOCUS_23960 6106 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6434 6796 gene locus_tag LOCUS_23970 6434 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence132 441 677 gene locus_tag LOCUS_23980 441 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1887 982 gene locus_tag LOCUS_23990 1887 982 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 protein_id gnl|my_center|LOCUS_23990 2418 1930 gene locus_tag LOCUS_24000 2418 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2628 4904 gene locus_tag LOCUS_24010 2628 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence133 6 326 gene locus_tag LOCUS_24020 6 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 472 987 gene locus_tag LOCUS_24030 472 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1196 2260 gene locus_tag LOCUS_24040 gene hrcA 1196 2260 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528633.1 protein_id gnl|my_center|LOCUS_24040 2350 2988 gene locus_tag LOCUS_24050 2350 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3192 5123 gene locus_tag LOCUS_24060 gene dnaK 3192 5123 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067591.1 protein_id gnl|my_center|LOCUS_24060 5131 6276 gene locus_tag LOCUS_24070 gene dnaJ 5131 6276 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395180.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence134 <1 782 gene locus_tag LOCUS_24080 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941366.1:cytochrome c biogenesis protein CcsA 783 2708 gene locus_tag LOCUS_24090 783 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2896 3525 gene locus_tag LOCUS_24100 2896 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3624 4577 gene locus_tag LOCUS_24110 3624 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6708 4687 gene locus_tag LOCUS_24120 6708 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence135 137 3883 gene locus_tag LOCUS_24130 137 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1684 1780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5147 3957 gene locus_tag LOCUS_24140 5147 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4121 4217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6399 5191 gene locus_tag LOCUS_24150 6399 5191 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence136 1055 153 gene locus_tag LOCUS_24160 1055 153 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_24160 2713 1052 gene locus_tag LOCUS_24170 2713 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6301 2777 gene locus_tag LOCUS_24180 gene dnaE 6301 2777 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence137 279 73 gene locus_tag LOCUS_24190 279 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 912 1115 gene locus_tag LOCUS_24200 912 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1639 4008 gene locus_tag LOCUS_24210 1639 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 4322 4555 gene locus_tag LOCUS_24220 4322 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5122 4811 gene locus_tag LOCUS_24230 5122 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6170 5721 gene locus_tag LOCUS_24240 6170 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence138 <1 2432 gene locus_tag LOCUS_24250 <1 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 2517 3659 gene locus_tag LOCUS_24260 2517 3659 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_24260 3702 5528 gene locus_tag LOCUS_24270 3702 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5500 5682 gene locus_tag LOCUS_24280 5500 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6090 5866 gene locus_tag LOCUS_24290 6090 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence139 1381 3126 gene locus_tag LOCUS_24300 1381 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2307 2406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3323 4093 gene locus_tag LOCUS_24310 3323 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 4278 6338 gene locus_tag LOCUS_24320 4278 6338 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence140 637 1401 gene locus_tag LOCUS_24330 637 1401 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_24330 1515 1670 gene locus_tag LOCUS_24340 1515 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1645 3084 gene locus_tag LOCUS_24350 gene glgA 1645 3084 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_24350 3154 5622 gene locus_tag LOCUS_24360 3154 5622 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389899.1 protein_id gnl|my_center|LOCUS_24360 5755 6213 gene locus_tag LOCUS_24370 5755 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence141 4212 505 gene locus_tag LOCUS_24380 4212 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 6169 4499 gene locus_tag LOCUS_24390 6169 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence142 3136 224 gene locus_tag LOCUS_24400 3136 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 4224 3151 gene locus_tag LOCUS_24410 4224 3151 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875763.1 protein_id gnl|my_center|LOCUS_24410 4559 4260 gene locus_tag LOCUS_24420 4559 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5206 4982 gene locus_tag LOCUS_24430 5206 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5948 5187 gene locus_tag LOCUS_24440 5948 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence143 <1 822 gene locus_tag LOCUS_24450 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057354.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase 819 1199 gene locus_tag LOCUS_24460 819 1199 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_24460 1408 2040 gene locus_tag LOCUS_24470 gene dolP 1408 2040 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 protein_id gnl|my_center|LOCUS_24470 2037 3446 gene locus_tag LOCUS_24480 2037 3446 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_24480 3660 4097 gene locus_tag LOCUS_24490 gene dksA 3660 4097 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769678.1 protein_id gnl|my_center|LOCUS_24490 4654 4268 gene locus_tag LOCUS_24500 4654 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5358 4735 gene locus_tag LOCUS_24510 5358 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6040 5468 gene locus_tag LOCUS_24520 6040 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence144 210 665 gene locus_tag LOCUS_24530 210 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1274 1017 gene locus_tag LOCUS_24540 1274 1017 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390130.1 protein_id gnl|my_center|LOCUS_24540 1754 1398 gene locus_tag LOCUS_24550 1754 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4030 1769 gene locus_tag LOCUS_24560 gene clpA 4030 1769 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931114.1 protein_id gnl|my_center|LOCUS_24560 4359 4045 gene locus_tag LOCUS_24570 gene clpS 4359 4045 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_24570 4573 4944 gene locus_tag LOCUS_24580 4573 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence145 1107 82 gene locus_tag LOCUS_24590 gene rsgA 1107 82 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_24590 1698 1135 gene locus_tag LOCUS_24600 1698 1135 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 protein_id gnl|my_center|LOCUS_24600 3126 1714 gene locus_tag LOCUS_24610 gene mpl 3126 1714 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_24610 3630 3133 gene locus_tag LOCUS_24620 gene ampD 3630 3133 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_24620 3923 3699 gene locus_tag LOCUS_24630 3923 3699 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_24630 4053 3978 gene locus_tag LOCUS_t00300 4053 3978 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4555 4178 gene locus_tag LOCUS_24640 4555 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 5632 4796 gene locus_tag LOCUS_24650 5632 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 5772 5846 gene locus_tag LOCUS_t00310 5772 5846 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 277 50 gene locus_tag LOCUS_24660 277 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1751 768 gene locus_tag LOCUS_24670 1751 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 3978 2092 gene locus_tag LOCUS_24680 gene prpE 3978 2092 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010240.1 protein_id gnl|my_center|LOCUS_24680 5288 4038 gene locus_tag LOCUS_24690 5288 4038 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_24690 5852 5427 gene locus_tag LOCUS_24700 5852 5427 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence147 333 127 gene locus_tag LOCUS_24710 333 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 784 563 gene locus_tag LOCUS_24720 784 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 802 1194 gene locus_tag LOCUS_24730 802 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1194 2159 gene locus_tag LOCUS_24740 1194 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2304 3680 gene locus_tag LOCUS_24750 2304 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2472 2570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3677 4186 gene locus_tag LOCUS_24760 3677 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence148 2485 689 gene locus_tag LOCUS_24770 2485 689 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_24770 3590 2526 gene locus_tag LOCUS_24780 3590 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 5337 3595 gene locus_tag LOCUS_24790 5337 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence149 548 267 gene locus_tag LOCUS_24800 548 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 692 1405 gene locus_tag LOCUS_24810 692 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2062 1412 gene locus_tag LOCUS_24820 2062 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2542 3957 gene locus_tag LOCUS_24830 2542 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3984 4403 gene locus_tag LOCUS_24840 3984 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4969 4484 gene locus_tag LOCUS_24850 4969 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 5083 5643 gene locus_tag LOCUS_24860 5083 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence150 1257 274 gene locus_tag LOCUS_24870 1257 274 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_24870 3243 1792 gene locus_tag LOCUS_24880 3243 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 <5520 3694 gene locus_tag LOCUS_24890 <5520 3694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210190849.1:FG-GAP-like repeat-containing protein >Feature sequence151 539 1558 gene locus_tag LOCUS_24900 539 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1555 3324 gene locus_tag LOCUS_24910 1555 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3370 5502 gene locus_tag LOCUS_24920 3370 5502 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence152 584 1624 gene locus_tag LOCUS_24930 584 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2392 2919 gene locus_tag LOCUS_24940 2392 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_24940 2916 3506 gene locus_tag LOCUS_24950 2916 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3588 3749 gene locus_tag LOCUS_24960 3588 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3819 4466 gene locus_tag LOCUS_24970 3819 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 4463 4639 gene locus_tag LOCUS_24980 4463 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence153 1003 1683 gene locus_tag LOCUS_24990 1003 1683 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_24990 1990 2934 gene locus_tag LOCUS_25000 1990 2934 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence154 4336 3917 gene locus_tag LOCUS_25010 4336 3917 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940930.1 protein_id gnl|my_center|LOCUS_25010 4964 4740 gene locus_tag LOCUS_25020 4964 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence155 <1 713 gene locus_tag LOCUS_25030 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001631036.1:recombinase family protein 710 1108 gene locus_tag LOCUS_25040 710 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 1317 1607 gene locus_tag LOCUS_25050 1317 1607 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_25050 2390 3997 gene locus_tag LOCUS_25060 gene recQ 2390 3997 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence156 38 367 gene locus_tag LOCUS_25070 38 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 567 905 gene locus_tag LOCUS_25080 567 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1126 2082 gene locus_tag LOCUS_25090 1126 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942895.1 protein_id gnl|my_center|LOCUS_25090 2105 3379 gene locus_tag LOCUS_25100 2105 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3393 4346 gene locus_tag LOCUS_25110 3393 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942895.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence157 537 1817 gene locus_tag LOCUS_25120 537 1817 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_25120 2201 3220 gene locus_tag LOCUS_25130 2201 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25130 3222 3608 gene locus_tag LOCUS_25140 3222 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence158 492 1019 gene locus_tag LOCUS_25150 492 1019 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_25150 1021 2163 gene locus_tag LOCUS_25160 1021 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2951 2154 gene locus_tag LOCUS_25170 gene truA 2951 2154 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_25170 3845 2961 gene locus_tag LOCUS_25180 gene cysM 3845 2961 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365492.1 protein_id gnl|my_center|LOCUS_25180 3942 4394 gene locus_tag LOCUS_25190 3942 4394 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence159 1007 768 gene locus_tag LOCUS_25200 1007 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1147 1548 gene locus_tag LOCUS_25210 1147 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1591 4881 gene locus_tag LOCUS_25220 1591 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence160 1141 68 gene locus_tag LOCUS_25230 gene dsrB 1141 68 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_25230 2465 1197 gene locus_tag LOCUS_25240 gene dsrA 2465 1197 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_25240 2705 2547 gene locus_tag LOCUS_25250 2705 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2965 2735 gene locus_tag LOCUS_25260 2965 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3678 2983 gene locus_tag LOCUS_25270 3678 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 4066 4539 gene locus_tag LOCUS_25280 4066 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 4848 4696 gene locus_tag LOCUS_25290 4848 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence161 1028 1669 gene locus_tag LOCUS_25300 1028 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2005 2574 gene locus_tag LOCUS_25310 2005 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2751 3050 gene locus_tag LOCUS_25320 2751 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3419 4375 gene locus_tag LOCUS_25330 3419 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4390 4749 gene locus_tag LOCUS_25340 4390 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence162 612 463 gene locus_tag LOCUS_25350 612 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 748 1143 gene locus_tag LOCUS_25360 748 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1391 2788 gene locus_tag LOCUS_25370 1391 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2866 4137 gene locus_tag LOCUS_25380 2866 4137 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence163 1182 133 gene locus_tag LOCUS_25390 1182 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2089 1253 gene locus_tag LOCUS_25400 2089 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 4327 2711 gene locus_tag LOCUS_25410 4327 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence164 684 2492 gene locus_tag LOCUS_25420 gene dnaG 684 2492 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844506.1 protein_id gnl|my_center|LOCUS_25420 2548 4548 gene locus_tag LOCUS_25430 gene rpoD 2548 4548 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972109.1 protein_id gnl|my_center|LOCUS_25430 4570 4645 gene locus_tag LOCUS_t00320 4570 4645 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 4545 1585 gene locus_tag LOCUS_25440 4545 1585 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079042.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence166 170 442 gene locus_tag LOCUS_25450 170 442 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_25450 462 692 gene locus_tag LOCUS_25460 462 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1220 804 gene locus_tag LOCUS_25470 1220 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1504 1313 gene locus_tag LOCUS_25480 1504 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2004 1660 gene locus_tag LOCUS_25490 2004 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4453 2288 gene locus_tag LOCUS_25500 4453 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence167 75 983 gene locus_tag LOCUS_25510 75 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1352 1750 gene locus_tag LOCUS_25520 1352 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1740 2174 gene locus_tag LOCUS_25530 1740 2174 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_25530 2255 3022 gene locus_tag LOCUS_25540 2255 3022 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_25540 3144 4364 gene locus_tag LOCUS_25550 3144 4364 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence168 426 734 gene locus_tag LOCUS_25560 426 734 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_25560 799 1743 gene locus_tag LOCUS_25570 799 1743 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_25570 1740 4223 gene locus_tag LOCUS_25580 1740 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence169 <1 1473 gene locus_tag LOCUS_25590 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104537.1:phage terminase large subunit family protein 1773 1486 gene locus_tag LOCUS_25600 1773 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2132 1854 gene locus_tag LOCUS_25610 2132 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2255 2458 gene locus_tag LOCUS_25620 2255 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2483 3226 gene locus_tag LOCUS_25630 2483 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence170 1532 360 gene locus_tag LOCUS_25640 1532 360 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_25640 3638 1560 gene locus_tag LOCUS_25650 3638 1560 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940950.1 protein_id gnl|my_center|LOCUS_25650 4222 3665 gene locus_tag LOCUS_25660 4222 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence171 366 34 gene locus_tag LOCUS_25670 366 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1001 387 gene locus_tag LOCUS_25680 1001 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1272 2591 gene locus_tag LOCUS_25690 1272 2591 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494218.1 protein_id gnl|my_center|LOCUS_25690 2627 2857 gene locus_tag LOCUS_25700 2627 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence172 523 20 gene locus_tag LOCUS_25710 523 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2833 695 gene locus_tag LOCUS_25720 2833 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 <4315 2892 gene locus_tag LOCUS_25730 <4315 2892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence173 705 355 gene locus_tag LOCUS_25740 705 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 776 955 gene locus_tag LOCUS_25750 776 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 963 1535 gene locus_tag LOCUS_25760 963 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1746 3686 gene locus_tag LOCUS_25770 1746 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3906 3981 gene locus_tag LOCUS_t00330 3906 3981 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 3548 1806 gene locus_tag LOCUS_25780 3548 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence175 194 667 gene locus_tag LOCUS_25790 194 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 773 3574 gene locus_tag LOCUS_25800 773 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence176 238 163 gene locus_tag LOCUS_t00340 238 163 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 379 303 gene locus_tag LOCUS_t00350 379 303 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 589 2481 gene locus_tag LOCUS_25810 589 2481 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880333.1 protein_id gnl|my_center|LOCUS_25810 <4090 2601 gene locus_tag LOCUS_25820 <4090 2601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546163.1:sulfite exporter TauE/SafE family protein >Feature sequence177 1929 178 gene locus_tag LOCUS_25830 1929 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3862 1949 gene locus_tag LOCUS_25840 3862 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence178 1102 2745 gene locus_tag LOCUS_25850 gene recQ 1102 2745 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_25850 2930 2799 gene locus_tag LOCUS_25860 2930 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence179 1619 687 gene locus_tag LOCUS_25870 1619 687 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_25870 2599 1760 gene locus_tag LOCUS_25880 2599 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3149 3009 gene locus_tag LOCUS_25890 3149 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3719 3228 gene locus_tag LOCUS_25900 3719 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence180 65 1819 gene locus_tag LOCUS_25910 65 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1873 3792 gene locus_tag LOCUS_25920 gene parE 1873 3792 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003707.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence181 910 1029 gene locus_tag LOCUS_25930 910 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3158 2424 gene locus_tag LOCUS_25940 3158 2424 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence182 2022 619 gene locus_tag LOCUS_25950 2022 619 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_25950 3002 2832 gene locus_tag LOCUS_25960 3002 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3431 3617 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccctttcaggcggggcgatgaatgcaag >Feature sequence183 1518 223 gene locus_tag LOCUS_25970 gene umuC 1518 223 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457634.1 protein_id gnl|my_center|LOCUS_25970 1910 1479 gene locus_tag LOCUS_25980 gene umuD 1910 1479 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705912.1 protein_id gnl|my_center|LOCUS_25980 2503 1907 gene locus_tag LOCUS_25990 gene lexA 2503 1907 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140711.1 protein_id gnl|my_center|LOCUS_25990 2946 2665 gene locus_tag LOCUS_26000 2946 2665 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_26000 3274 3044 gene locus_tag LOCUS_26010 3274 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence184 787 11 gene locus_tag LOCUS_26020 787 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2187 799 gene locus_tag LOCUS_26030 2187 799 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence185 321 1181 gene locus_tag LOCUS_26040 gene htpX 321 1181 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_26040 1178 1852 gene locus_tag LOCUS_26050 gene rpe 1178 1852 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480446.1 protein_id gnl|my_center|LOCUS_26050 3005 1869 gene locus_tag LOCUS_26060 3005 1869 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706905.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence186 2468 90 gene locus_tag LOCUS_26070 2468 90 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_26070 2516 3304 gene locus_tag LOCUS_26080 2516 3304 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074301.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence187 2 1468 gene locus_tag LOCUS_26090 2 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 1473 2162 gene locus_tag LOCUS_26100 1473 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2176 2820 gene locus_tag LOCUS_26110 2176 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence188 67 321 gene locus_tag LOCUS_26120 67 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 318 722 gene locus_tag LOCUS_26130 318 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 800 1813 gene locus_tag LOCUS_26140 800 1813 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_26140 2409 2185 gene locus_tag LOCUS_26150 2409 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence189 2800 740 gene locus_tag LOCUS_26160 2800 740 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941954.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence190 230 75 gene locus_tag LOCUS_26170 230 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 756 1697 gene locus_tag LOCUS_26180 756 1697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041077419.1 protein_id gnl|my_center|LOCUS_26180 1681 2550 gene locus_tag LOCUS_26190 1681 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence191 1347 541 gene locus_tag LOCUS_26200 1347 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2267 1428 gene locus_tag LOCUS_26210 2267 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2744 2313 gene locus_tag LOCUS_26220 2744 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2989 3144 gene locus_tag LOCUS_26230 2989 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence192 712 395 gene locus_tag LOCUS_26240 712 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1591 1427 gene locus_tag LOCUS_26250 1591 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1858 3108 gene locus_tag LOCUS_26260 1858 3108 CDS product IS701-like element ISBj6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038951335.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence193 561 286 gene locus_tag LOCUS_26270 gene hbs 561 286 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_26270 1043 1162 gene locus_tag LOCUS_26280 1043 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 1200 2444 gene locus_tag LOCUS_26290 1200 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3019 2858 gene locus_tag LOCUS_26300 3019 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence194 318 542 gene locus_tag LOCUS_26310 318 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 707 2509 gene locus_tag LOCUS_26320 707 2509 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_26320 2542 2907 gene locus_tag LOCUS_26330 2542 2907 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence195 961 143 gene locus_tag LOCUS_26340 gene bioC 961 143 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_26340 1180 1908 gene locus_tag LOCUS_26350 1180 1908 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_26350 1963 2223 gene locus_tag LOCUS_26360 gene grxC 1963 2223 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_26360 2223 3050 gene locus_tag LOCUS_26370 2223 3050 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence196 2373 1048 gene locus_tag LOCUS_26380 2373 1048 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_26380 2732 2394 gene locus_tag LOCUS_26390 gene glnK 2732 2394 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence197 309 1334 gene locus_tag LOCUS_26400 309 1334 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence198 563 309 gene locus_tag LOCUS_26410 563 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1102 791 gene locus_tag LOCUS_26420 1102 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence199 439 260 gene locus_tag LOCUS_26430 439 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 554 417 gene locus_tag LOCUS_26440 554 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 880 1383 gene locus_tag LOCUS_26450 880 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2518 1784 gene locus_tag LOCUS_26460 2518 1784 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence200 2807 579 gene locus_tag LOCUS_26470 2807 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence201 1475 1251 gene locus_tag LOCUS_26480 1475 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2844 1456 gene locus_tag LOCUS_26490 2844 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence202 428 78 gene locus_tag LOCUS_26500 428 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1224 2198 gene locus_tag LOCUS_26510 1224 2198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence203 1 378 gene locus_tag LOCUS_26520 1 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 522 986 gene locus_tag LOCUS_26530 522 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 979 1947 gene locus_tag LOCUS_26540 979 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 <2911 2033 gene locus_tag LOCUS_26550 <2911 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880333.1:GGDEF domain-containing protein >Feature sequence204 1 378 gene locus_tag LOCUS_26560 1 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 522 986 gene locus_tag LOCUS_26570 522 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 979 1947 gene locus_tag LOCUS_26580 979 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 <2911 2033 gene locus_tag LOCUS_26590 <2911 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880333.1:GGDEF domain-containing protein >Feature sequence205 292 47 gene locus_tag LOCUS_26600 292 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2781 1570 gene locus_tag LOCUS_26610 2781 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 >Feature sequence206 1066 692 gene locus_tag LOCUS_26620 1066 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence207 105 263 gene locus_tag LOCUS_26630 105 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1859 582 gene locus_tag LOCUS_26640 1859 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2320 2475 gene locus_tag LOCUS_26650 2320 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence208 1942 1142 gene locus_tag LOCUS_26660 1942 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence209 143 1342 gene locus_tag LOCUS_26670 143 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2230 1379 gene locus_tag LOCUS_26680 gene ppk2 2230 1379 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_26680 2701 2351 gene locus_tag LOCUS_26690 2701 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence210 <1 1264 gene locus_tag LOCUS_26700 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020247.1:DEAD/DEAH box helicase 1773 2342 gene locus_tag LOCUS_26710 1773 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence211 1171 410 gene locus_tag LOCUS_26720 1171 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1151 1417 gene locus_tag LOCUS_26730 1151 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence212 <1 2531 gene locus_tag LOCUS_26740 <1 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057111.1:tetratricopeptide repeat protein >Feature sequence213 787 1011 gene locus_tag LOCUS_26750 787 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1407 1201 gene locus_tag LOCUS_26760 1407 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1688 1386 gene locus_tag LOCUS_26770 1688 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1884 1693 gene locus_tag LOCUS_26780 1884 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2282 1881 gene locus_tag LOCUS_26790 2282 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence214 247 2232 gene locus_tag LOCUS_26800 247 2232 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence215 1024 2442 gene locus_tag LOCUS_26810 1024 2442 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence216 <2439 1645 gene locus_tag LOCUS_26820 <2439 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388962.1:exopolyphosphatase >Feature sequence217 1896 340 gene locus_tag LOCUS_26830 1896 340 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_26830 2432 1917 gene locus_tag LOCUS_26840 2432 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence218 85 2136 gene locus_tag LOCUS_26850 85 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence219 252 46 gene locus_tag LOCUS_26860 252 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1189 257 gene locus_tag LOCUS_26870 1189 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1916 1209 gene locus_tag LOCUS_26880 1916 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence220 <1 2251 gene locus_tag LOCUS_26890 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922337.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence221 494 1372 gene locus_tag LOCUS_26900 494 1372 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_26900 1422 2303 gene locus_tag LOCUS_26910 1422 2303 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence222 <1 789 gene locus_tag LOCUS_26920 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096009.1:flagellin FliC 869 1156 gene locus_tag LOCUS_26930 869 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence223 694 1404 gene locus_tag LOCUS_26940 694 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1524 1778 gene locus_tag LOCUS_26950 1524 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence224 375 533 gene locus_tag LOCUS_26960 375 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 693 1403 gene locus_tag LOCUS_26970 693 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1523 1777 gene locus_tag LOCUS_26980 1523 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence225 127 321 gene locus_tag LOCUS_26990 127 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence226 514 1128 gene locus_tag LOCUS_27000 514 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence227 >Feature sequence228 109 1089 gene locus_tag LOCUS_27010 gene rsmH 109 1089 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_27010 1086 1355 gene locus_tag LOCUS_27020 1086 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence229 1919 594 gene locus_tag LOCUS_27030 1919 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030