>Feature sequence001 1219 194 gene locus_tag LOCUS_00010 1219 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2492 1224 gene locus_tag LOCUS_00020 2492 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3458 2868 gene locus_tag LOCUS_00030 3458 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5087 3516 gene locus_tag LOCUS_00040 5087 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7973 5337 gene locus_tag LOCUS_00050 7973 5337 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_00050 9541 7973 gene locus_tag LOCUS_00060 gene cimA 9541 7973 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_00060 10764 9544 gene locus_tag LOCUS_00070 10764 9544 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_00070 11971 10766 gene locus_tag LOCUS_00080 11971 10766 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_00080 12612 11968 gene locus_tag LOCUS_00090 12612 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13636 12584 gene locus_tag LOCUS_00100 gene thrC 13636 12584 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_00100 14936 13638 gene locus_tag LOCUS_00110 14936 13638 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_00110 15316 14933 gene locus_tag LOCUS_00120 15316 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15413 15339 gene locus_tag LOCUS_t00010 15413 15339 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16984 15524 gene locus_tag LOCUS_00130 16984 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 22222 17024 gene locus_tag LOCUS_00140 22222 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 23371 22244 gene locus_tag LOCUS_00150 23371 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 26312 23628 gene locus_tag LOCUS_00160 26312 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 30049 26309 gene locus_tag LOCUS_00170 30049 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 32174 30060 gene locus_tag LOCUS_00180 32174 30060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 36013 32174 gene locus_tag LOCUS_00190 36013 32174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 38150 36027 gene locus_tag LOCUS_00200 38150 36027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 40500 38158 gene locus_tag LOCUS_00210 40500 38158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 44195 40665 gene locus_tag LOCUS_00220 44195 40665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 48063 44206 gene locus_tag LOCUS_00230 48063 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 48706 48233 gene locus_tag LOCUS_00240 48706 48233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 51456 48721 gene locus_tag LOCUS_00250 51456 48721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 54625 51467 gene locus_tag LOCUS_00260 54625 51467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 57609 54637 gene locus_tag LOCUS_00270 57609 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 61066 57599 gene locus_tag LOCUS_00280 61066 57599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 64570 61076 gene locus_tag LOCUS_00290 64570 61076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 67479 64582 gene locus_tag LOCUS_00300 67479 64582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 71290 67487 gene locus_tag LOCUS_00310 71290 67487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 74553 71302 gene locus_tag LOCUS_00320 74553 71302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 76448 74805 gene locus_tag LOCUS_00330 76448 74805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 77449 76445 gene locus_tag LOCUS_00340 77449 76445 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_00340 79280 77451 gene locus_tag LOCUS_00350 79280 77451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 79975 79271 gene locus_tag LOCUS_00360 79975 79271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 80068 79997 gene locus_tag LOCUS_t00020 80068 79997 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 81393 80308 gene locus_tag LOCUS_00370 81393 80308 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_00370 83171 81405 gene locus_tag LOCUS_00380 83171 81405 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_00380 84319 83210 gene locus_tag LOCUS_00390 84319 83210 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_00390 85090 84332 gene locus_tag LOCUS_00400 85090 84332 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_00400 86810 85092 gene locus_tag LOCUS_00410 86810 85092 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_00410 87573 86821 gene locus_tag LOCUS_00420 87573 86821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_00420 88448 87573 gene locus_tag LOCUS_00430 gene sucD 88448 87573 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_00430 89572 88445 gene locus_tag LOCUS_00440 gene sucC 89572 88445 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765647.1 protein_id gnl|my_center|LOCUS_00440 89737 90516 gene locus_tag LOCUS_00450 89737 90516 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_00450 90636 92444 gene locus_tag LOCUS_00460 90636 92444 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896022.1 protein_id gnl|my_center|LOCUS_00460 92441 93364 gene locus_tag LOCUS_00470 92441 93364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 93813 93481 gene locus_tag LOCUS_00480 gene spoIIAA 93813 93481 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_00480 94243 93815 gene locus_tag LOCUS_00490 94243 93815 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_00490 94996 94244 gene locus_tag LOCUS_00500 94996 94244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 95778 95011 gene locus_tag LOCUS_00510 95778 95011 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_00510 96613 95780 gene locus_tag LOCUS_00520 96613 95780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_00520 97531 96746 gene locus_tag LOCUS_00530 97531 96746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_00530 98189 97545 gene locus_tag LOCUS_00540 98189 97545 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_00540 98549 98271 gene locus_tag LOCUS_00550 98549 98271 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791253.1 protein_id gnl|my_center|LOCUS_00550 99627 98563 gene locus_tag LOCUS_00560 99627 98563 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_00560 100572 99649 gene locus_tag LOCUS_00570 100572 99649 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_00570 101384 100698 gene locus_tag LOCUS_00580 101384 100698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035945.1 protein_id gnl|my_center|LOCUS_00580 104040 101386 gene locus_tag LOCUS_00590 104040 101386 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_00590 104661 104074 gene locus_tag LOCUS_00600 gene kdpC 104661 104074 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_00600 106748 104673 gene locus_tag LOCUS_00610 gene kdpB 106748 104673 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_00610 108496 106745 gene locus_tag LOCUS_00620 gene kdpA 108496 106745 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence002 73 1 gene locus_tag LOCUS_t00030 73 1 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 184 1200 gene locus_tag LOCUS_00630 184 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 3124 1169 gene locus_tag LOCUS_00640 3124 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1856 1955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3545 3150 gene locus_tag LOCUS_00650 3545 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4034 3621 gene locus_tag LOCUS_00660 gene tolR 4034 3621 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_00660 4645 4031 gene locus_tag LOCUS_00670 4645 4031 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280218.1 protein_id gnl|my_center|LOCUS_00670 7269 4795 gene locus_tag LOCUS_00680 7269 4795 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_00680 7335 7434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8652 8023 gene locus_tag LOCUS_00690 8652 8023 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 protein_id gnl|my_center|LOCUS_00690 8945 9193 gene locus_tag LOCUS_00700 8945 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 10756 9482 gene locus_tag LOCUS_00710 10756 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 11549 10863 gene locus_tag LOCUS_00720 11549 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 11876 11625 gene locus_tag LOCUS_00730 11876 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12204 12040 gene locus_tag LOCUS_00740 12204 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13129 12227 gene locus_tag LOCUS_00750 13129 12227 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_00750 14967 13126 gene locus_tag LOCUS_00760 gene lnt 14967 13126 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_00760 15120 14983 gene locus_tag LOCUS_00770 15120 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16379 15117 gene locus_tag LOCUS_00780 16379 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 17014 16376 gene locus_tag LOCUS_00790 17014 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 20064 17035 gene locus_tag LOCUS_00800 gene secA 20064 17035 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_00800 21145 20084 gene locus_tag LOCUS_00810 gene prfB 21145 20084 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_00810 22334 21255 gene locus_tag LOCUS_00820 gene ychF 22334 21255 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_00820 27837 22456 gene locus_tag LOCUS_00830 27837 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 28559 28023 gene locus_tag LOCUS_00840 28559 28023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 28917 28627 gene locus_tag LOCUS_00850 28917 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 30165 28930 gene locus_tag LOCUS_00860 30165 28930 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_00860 31773 30289 gene locus_tag LOCUS_00870 gene murJ 31773 30289 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_00870 31933 32199 gene locus_tag LOCUS_00880 gene rpsT 31933 32199 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_00880 32836 32168 gene locus_tag LOCUS_00890 32836 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 33357 32836 gene locus_tag LOCUS_00900 33357 32836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 34328 33354 gene locus_tag LOCUS_00910 34328 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 45176 34575 gene locus_tag LOCUS_00920 45176 34575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 34592 34691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46754 45243 gene locus_tag LOCUS_00930 46754 45243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 47083 46742 gene locus_tag LOCUS_00940 47083 46742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 47765 47196 gene locus_tag LOCUS_00950 47765 47196 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357138.1 protein_id gnl|my_center|LOCUS_00950 48462 47752 gene locus_tag LOCUS_00960 gene deoC 48462 47752 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_00960 49557 48487 gene locus_tag LOCUS_00970 49557 48487 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_00970 50650 49559 gene locus_tag LOCUS_00980 50650 49559 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_00980 53138 50664 gene locus_tag LOCUS_00990 gene leuS 53138 50664 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_00990 53405 53211 gene locus_tag LOCUS_01000 53405 53211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 53719 53468 gene locus_tag LOCUS_01010 53719 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 55416 53719 gene locus_tag LOCUS_01020 55416 53719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 56088 55438 gene locus_tag LOCUS_01030 56088 55438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 56533 56081 gene locus_tag LOCUS_01040 56533 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 56640 56840 gene locus_tag LOCUS_01050 56640 56840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 56844 57617 gene locus_tag LOCUS_01060 56844 57617 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 protein_id gnl|my_center|LOCUS_01060 57686 58699 gene locus_tag LOCUS_01070 gene thiH 57686 58699 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_01070 60737 58863 gene locus_tag LOCUS_01080 gene mnmG 60737 58863 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 protein_id gnl|my_center|LOCUS_01080 61553 60786 gene locus_tag LOCUS_01090 61553 60786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 62932 61553 gene locus_tag LOCUS_01100 62932 61553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 63951 62947 gene locus_tag LOCUS_01110 63951 62947 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_01110 65276 63954 gene locus_tag LOCUS_01120 65276 63954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 66051 65374 gene locus_tag LOCUS_01130 66051 65374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 66968 66051 gene locus_tag LOCUS_01140 66968 66051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 69299 67128 gene locus_tag LOCUS_01150 69299 67128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 70312 69461 gene locus_tag LOCUS_01160 70312 69461 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_01160 71223 70315 gene locus_tag LOCUS_01170 71223 70315 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_01170 72509 71268 gene locus_tag LOCUS_01180 gene malE 72509 71268 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_01180 75309 72673 gene locus_tag LOCUS_01190 75309 72673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 75699 75454 gene locus_tag LOCUS_01200 75699 75454 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_01200 75961 75704 gene locus_tag LOCUS_01210 75961 75704 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_01210 79747 76043 gene locus_tag LOCUS_01220 79747 76043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 80230 79892 gene locus_tag LOCUS_01230 80230 79892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 80596 80243 gene locus_tag LOCUS_01240 80596 80243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 80860 81051 gene locus_tag LOCUS_01250 80860 81051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 81053 81811 gene locus_tag LOCUS_01260 81053 81811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 88674 81808 gene locus_tag LOCUS_01270 88674 81808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 <97428 88686 gene locus_tag LOCUS_01280 <97428 88686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055032204.1:5'-nucleotidase 88689 88788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 1916 1296 gene locus_tag LOCUS_01290 1916 1296 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_01290 2773 1988 gene locus_tag LOCUS_01300 gene trpC 2773 1988 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_01300 3776 2766 gene locus_tag LOCUS_01310 gene trpD 3776 2766 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_01310 4350 3784 gene locus_tag LOCUS_01320 4350 3784 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_01320 5614 4352 gene locus_tag LOCUS_01330 gene murA 5614 4352 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546097.1 protein_id gnl|my_center|LOCUS_01330 6430 5636 gene locus_tag LOCUS_01340 gene prmC 6430 5636 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_01340 7572 6502 gene locus_tag LOCUS_01350 gene prfA 7572 6502 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_01350 7759 7556 gene locus_tag LOCUS_01360 gene rpmE 7759 7556 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_01360 9158 7812 gene locus_tag LOCUS_01370 gene rho 9158 7812 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_01370 9776 9171 gene locus_tag LOCUS_01380 gene coaE 9776 9171 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_01380 11158 9764 gene locus_tag LOCUS_01390 gene glgA 11158 9764 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_01390 13734 11155 gene locus_tag LOCUS_01400 gene polA 13734 11155 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723249.1 protein_id gnl|my_center|LOCUS_01400 14541 13747 gene locus_tag LOCUS_01410 14541 13747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15543 14542 gene locus_tag LOCUS_01420 15543 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 16409 15543 gene locus_tag LOCUS_01430 gene folD 16409 15543 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_01430 16894 16406 gene locus_tag LOCUS_01440 16894 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 17384 17025 gene locus_tag LOCUS_01450 17384 17025 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_01450 18043 17387 gene locus_tag LOCUS_01460 18043 17387 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_01460 18441 18043 gene locus_tag LOCUS_01470 gene rplS 18441 18043 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_01470 19140 18466 gene locus_tag LOCUS_01480 gene trmD 19140 18466 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_01480 20400 19159 gene locus_tag LOCUS_01490 20400 19159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_01490 23517 20413 gene locus_tag LOCUS_01500 23517 20413 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 protein_id gnl|my_center|LOCUS_01500 24764 23514 gene locus_tag LOCUS_01510 24764 23514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 25180 24761 gene locus_tag LOCUS_01520 25180 24761 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132365.1 protein_id gnl|my_center|LOCUS_01520 26329 25265 gene locus_tag LOCUS_01530 26329 25265 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_01530 27488 26316 gene locus_tag LOCUS_01540 27488 26316 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_01540 32418 27622 gene locus_tag LOCUS_01550 32418 27622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 33828 32698 gene locus_tag LOCUS_01560 gene tgt 33828 32698 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_01560 34787 33921 gene locus_tag LOCUS_01570 34787 33921 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_01570 36150 35146 gene locus_tag LOCUS_01580 gene queA 36150 35146 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_01580 36527 36147 gene locus_tag LOCUS_01590 36527 36147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_01590 36605 36949 gene locus_tag LOCUS_01600 36605 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 38198 36951 gene locus_tag LOCUS_01610 gene ftsA 38198 36951 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926790.1 protein_id gnl|my_center|LOCUS_01610 39076 38195 gene locus_tag LOCUS_01620 39076 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 41432 39036 gene locus_tag LOCUS_01630 41432 39036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 42225 41410 gene locus_tag LOCUS_01640 42225 41410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 43304 42222 gene locus_tag LOCUS_01650 gene murG 43304 42222 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_01650 44394 43297 gene locus_tag LOCUS_01660 gene spoVE 44394 43297 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_01660 45653 44394 gene locus_tag LOCUS_01670 gene murD 45653 44394 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939776.1 protein_id gnl|my_center|LOCUS_01670 46752 45661 gene locus_tag LOCUS_01680 gene mraY 46752 45661 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_01680 48129 46765 gene locus_tag LOCUS_01690 48129 46765 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_01690 49550 48117 gene locus_tag LOCUS_01700 49550 48117 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_01700 51234 49552 gene locus_tag LOCUS_01710 51234 49552 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_01710 51640 51329 gene locus_tag LOCUS_01720 51640 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 52569 51637 gene locus_tag LOCUS_01730 gene rsmH 52569 51637 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_01730 52853 52566 gene locus_tag LOCUS_01740 52853 52566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 52966 53065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54731 53796 gene locus_tag LOCUS_01750 gene ribF 54731 53796 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 protein_id gnl|my_center|LOCUS_01750 55362 54697 gene locus_tag LOCUS_01760 55362 54697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56318 55362 gene locus_tag LOCUS_01770 56318 55362 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_01770 56694 56299 gene locus_tag LOCUS_01780 56694 56299 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_01780 57623 56691 gene locus_tag LOCUS_01790 57623 56691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 58517 57627 gene locus_tag LOCUS_01800 gene xerD 58517 57627 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_01800 59041 58514 gene locus_tag LOCUS_01810 59041 58514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 61046 59031 gene locus_tag LOCUS_01820 gene ligA 61046 59031 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_01820 61320 61054 gene locus_tag LOCUS_01830 61320 61054 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672192.1 protein_id gnl|my_center|LOCUS_01830 61823 61317 gene locus_tag LOCUS_01840 61823 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 61938 61862 gene locus_tag LOCUS_t00040 61938 61862 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 62439 62005 gene locus_tag LOCUS_01850 gene fabZ 62439 62005 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957689.1 protein_id gnl|my_center|LOCUS_01850 63028 62444 gene locus_tag LOCUS_01860 63028 62444 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_01860 64109 63030 gene locus_tag LOCUS_01870 gene ribD 64109 63030 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_01870 64932 64102 gene locus_tag LOCUS_01880 64932 64102 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_01880 65354 64929 gene locus_tag LOCUS_01890 gene nusB 65354 64929 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_01890 65832 65359 gene locus_tag LOCUS_01900 gene ribH 65832 65359 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634050.1 protein_id gnl|my_center|LOCUS_01900 67038 65839 gene locus_tag LOCUS_01910 67038 65839 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_01910 67146 67592 gene locus_tag LOCUS_01920 67146 67592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 69354 67585 gene locus_tag LOCUS_01930 69354 67585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 70351 69380 gene locus_tag LOCUS_01940 70351 69380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 71244 70456 gene locus_tag LOCUS_01950 71244 70456 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_01950 71728 71273 gene locus_tag LOCUS_01960 71728 71273 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880153.1 protein_id gnl|my_center|LOCUS_01960 72300 71725 gene locus_tag LOCUS_01970 gene pgsA 72300 71725 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_01970 73580 72297 gene locus_tag LOCUS_01980 gene rimO 73580 72297 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_01980 74626 73721 gene locus_tag LOCUS_01990 74626 73721 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_01990 76930 74651 gene locus_tag LOCUS_02000 76930 74651 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_02000 79147 77036 gene locus_tag LOCUS_02010 gene pnp 79147 77036 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_02010 79432 79166 gene locus_tag LOCUS_02020 gene rpsO 79432 79166 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_02020 80142 79531 gene locus_tag LOCUS_02030 80142 79531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 80131 80361 gene locus_tag LOCUS_02040 80131 80361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 80579 80382 gene locus_tag LOCUS_02050 80579 80382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 80910 80617 gene locus_tag LOCUS_02060 80910 80617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 82069 80903 gene locus_tag LOCUS_02070 82069 80903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 82665 82093 gene locus_tag LOCUS_02080 82665 82093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence004 1158 397 gene locus_tag LOCUS_02090 1158 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 3839 1173 gene locus_tag LOCUS_02100 3839 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5125 3854 gene locus_tag LOCUS_02110 5125 3854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_02110 9375 5326 gene locus_tag LOCUS_02120 9375 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10525 9650 gene locus_tag LOCUS_02130 10525 9650 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027224428.1 protein_id gnl|my_center|LOCUS_02130 10851 10522 gene locus_tag LOCUS_02140 10851 10522 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_02140 11020 10838 gene locus_tag LOCUS_02150 11020 10838 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_02150 11619 11434 gene locus_tag LOCUS_02160 11619 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 12046 11846 gene locus_tag LOCUS_02170 12046 11846 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941573.1 protein_id gnl|my_center|LOCUS_02170 14109 12220 gene locus_tag LOCUS_02180 14109 12220 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_02180 14351 14124 gene locus_tag LOCUS_02190 14351 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 15351 14344 gene locus_tag LOCUS_02200 15351 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 17800 15527 gene locus_tag LOCUS_02210 17800 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 20121 17815 gene locus_tag LOCUS_02220 20121 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 20487 24842 gene locus_tag LOCUS_02230 20487 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 25448 24918 gene locus_tag LOCUS_02240 25448 24918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 26850 25450 gene locus_tag LOCUS_02250 26850 25450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 27817 26852 gene locus_tag LOCUS_02260 27817 26852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 28617 27817 gene locus_tag LOCUS_02270 28617 27817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 28990 28595 gene locus_tag LOCUS_02280 28990 28595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 29415 28987 gene locus_tag LOCUS_02290 gene gspG 29415 28987 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_02290 30716 29487 gene locus_tag LOCUS_02300 30716 29487 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_02300 32422 30734 gene locus_tag LOCUS_02310 32422 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 34180 32426 gene locus_tag LOCUS_02320 gene xcpQ 34180 32426 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_02320 34677 34183 gene locus_tag LOCUS_02330 34677 34183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 35109 34786 gene locus_tag LOCUS_02340 35109 34786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 36295 35135 gene locus_tag LOCUS_02350 36295 35135 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_02350 40202 36354 gene locus_tag LOCUS_02360 40202 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 41961 40402 gene locus_tag LOCUS_02370 41961 40402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_02370 42305 41958 gene locus_tag LOCUS_02380 42305 41958 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_02380 45140 42351 gene locus_tag LOCUS_02390 45140 42351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 46065 45289 gene locus_tag LOCUS_02400 46065 45289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 47108 46131 gene locus_tag LOCUS_02410 47108 46131 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_02410 47908 47105 gene locus_tag LOCUS_02420 gene lsrF 47908 47105 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219792.1 protein_id gnl|my_center|LOCUS_02420 48132 47923 gene locus_tag LOCUS_02430 48132 47923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 50487 48220 gene locus_tag LOCUS_02440 50487 48220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 51233 50700 gene locus_tag LOCUS_02450 51233 50700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 53225 51249 gene locus_tag LOCUS_02460 53225 51249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932070.1 protein_id gnl|my_center|LOCUS_02460 54221 53235 gene locus_tag LOCUS_02470 54221 53235 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932069.1 protein_id gnl|my_center|LOCUS_02470 55461 54214 gene locus_tag LOCUS_02480 55461 54214 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926846.1 protein_id gnl|my_center|LOCUS_02480 56259 55507 gene locus_tag LOCUS_02490 56259 55507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 56781 56275 gene locus_tag LOCUS_02500 56781 56275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 57281 56778 gene locus_tag LOCUS_02510 57281 56778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 57834 57271 gene locus_tag LOCUS_02520 57834 57271 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_02520 59039 57852 gene locus_tag LOCUS_02530 59039 57852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 60345 59122 gene locus_tag LOCUS_02540 60345 59122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 60394 61545 gene locus_tag LOCUS_02550 60394 61545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 61535 61942 gene locus_tag LOCUS_02560 61535 61942 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_02560 61939 62313 gene locus_tag LOCUS_02570 61939 62313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 63265 62333 gene locus_tag LOCUS_02580 63265 62333 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054639.1 protein_id gnl|my_center|LOCUS_02580 64681 63275 gene locus_tag LOCUS_02590 64681 63275 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_02590 65420 64674 gene locus_tag LOCUS_02600 65420 64674 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_02600 66249 65413 gene locus_tag LOCUS_02610 66249 65413 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_02610 67808 66375 gene locus_tag LOCUS_02620 67808 66375 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_02620 68478 67810 gene locus_tag LOCUS_02630 68478 67810 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence005 3910 4009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7071 4132 gene locus_tag LOCUS_02640 7071 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 8749 7334 gene locus_tag LOCUS_02650 gene nuoN 8749 7334 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_02650 10203 8746 gene locus_tag LOCUS_02660 10203 8746 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_02660 12026 10188 gene locus_tag LOCUS_02670 gene nuoL 12026 10188 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_02670 12328 12020 gene locus_tag LOCUS_02680 gene nuoK 12328 12020 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_02680 12813 12325 gene locus_tag LOCUS_02690 12813 12325 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_02690 13286 12810 gene locus_tag LOCUS_02700 13286 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14260 13289 gene locus_tag LOCUS_02710 gene nuoH 14260 13289 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_02710 15354 14257 gene locus_tag LOCUS_02720 gene nuoD 15354 14257 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_02720 15808 15356 gene locus_tag LOCUS_02730 15808 15356 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_02730 16325 15810 gene locus_tag LOCUS_02740 16325 15810 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_02740 16672 16316 gene locus_tag LOCUS_02750 gene ndhC 16672 16316 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_02750 18005 16734 gene locus_tag LOCUS_02760 gene hemL 18005 16734 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_02760 18478 18002 gene locus_tag LOCUS_02770 gene ahbB 18478 18002 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_02770 18991 18542 gene locus_tag LOCUS_02780 18991 18542 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966079.1 protein_id gnl|my_center|LOCUS_02780 19962 18991 gene locus_tag LOCUS_02790 gene nirJ2 19962 18991 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_02790 20945 19962 gene locus_tag LOCUS_02800 gene hemB 20945 19962 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_02800 22125 20947 gene locus_tag LOCUS_02810 gene nirJ1 22125 20947 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_02810 23654 22122 gene locus_tag LOCUS_02820 gene cobA 23654 22122 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_02820 24580 23651 gene locus_tag LOCUS_02830 gene hemC 24580 23651 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174006.1 protein_id gnl|my_center|LOCUS_02830 25257 24583 gene locus_tag LOCUS_02840 25257 24583 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_02840 26153 25797 gene locus_tag LOCUS_02850 26153 25797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 28563 26407 gene locus_tag LOCUS_02860 28563 26407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 29426 28581 gene locus_tag LOCUS_02870 29426 28581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 29738 29427 gene locus_tag LOCUS_02880 29738 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 30128 29811 gene locus_tag LOCUS_02890 30128 29811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 31736 30192 gene locus_tag LOCUS_02900 31736 30192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33442 31733 gene locus_tag LOCUS_02910 33442 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 34509 33442 gene locus_tag LOCUS_02920 gene hemA 34509 33442 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_02920 36126 34627 gene locus_tag LOCUS_02930 36126 34627 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_02930 36918 36208 gene locus_tag LOCUS_02940 gene tatC 36918 36208 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_02940 37127 36924 gene locus_tag LOCUS_02950 37127 36924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 39798 37153 gene locus_tag LOCUS_02960 39798 37153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 37609 37708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41130 39883 gene locus_tag LOCUS_02970 41130 39883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 41785 41315 gene locus_tag LOCUS_02980 41785 41315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 41852 41951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44308 42638 gene locus_tag LOCUS_02990 44308 42638 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958018.1 protein_id gnl|my_center|LOCUS_02990 45144 44422 gene locus_tag LOCUS_03000 45144 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 45708 45181 gene locus_tag LOCUS_03010 45708 45181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 48832 45788 gene locus_tag LOCUS_03020 48832 45788 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921619.1 protein_id gnl|my_center|LOCUS_03020 49975 48845 gene locus_tag LOCUS_03030 49975 48845 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171251.1 protein_id gnl|my_center|LOCUS_03030 51449 49992 gene locus_tag LOCUS_03040 51449 49992 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_03040 52006 51452 gene locus_tag LOCUS_03050 52006 51452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_03050 53863 52082 gene locus_tag LOCUS_03060 53863 52082 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_03060 54595 53873 gene locus_tag LOCUS_03070 54595 53873 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_03070 54761 55132 gene locus_tag LOCUS_03080 54761 55132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 55598 55428 gene locus_tag LOCUS_03090 55598 55428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 56361 55891 gene locus_tag LOCUS_03100 gene bcp 56361 55891 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_03100 57881 56661 gene locus_tag LOCUS_03110 57881 56661 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_03110 58685 58026 gene locus_tag LOCUS_03120 58685 58026 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721944.1 protein_id gnl|my_center|LOCUS_03120 59177 58788 gene locus_tag LOCUS_03130 59177 58788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 59815 59174 gene locus_tag LOCUS_03140 gene recR 59815 59174 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_03140 61418 59775 gene locus_tag LOCUS_03150 gene dnaX 61418 59775 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_03150 62357 61449 gene locus_tag LOCUS_03160 62357 61449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 64489 62354 gene locus_tag LOCUS_03170 64489 62354 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_03170 64749 64486 gene locus_tag LOCUS_03180 64749 64486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 65039 64782 gene locus_tag LOCUS_03190 65039 64782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 66407 65919 gene locus_tag LOCUS_03200 66407 65919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 67019 66693 gene locus_tag LOCUS_03210 67019 66693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 67366 67193 gene locus_tag LOCUS_03220 67366 67193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 67818 67363 gene locus_tag LOCUS_03230 67818 67363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence006 56 2044 gene locus_tag LOCUS_03240 gene topA 56 2044 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_03240 2123 3007 gene locus_tag LOCUS_03250 gene xerC 2123 3007 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_03250 3014 4282 gene locus_tag LOCUS_03260 3014 4282 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_03260 4279 5337 gene locus_tag LOCUS_03270 gene lpxK 4279 5337 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_03270 5288 7273 gene locus_tag LOCUS_03280 5288 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7270 9360 gene locus_tag LOCUS_03290 7270 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9357 10469 gene locus_tag LOCUS_03300 9357 10469 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_03300 10476 10832 gene locus_tag LOCUS_03310 10476 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10845 11855 gene locus_tag LOCUS_03320 gene waaF 10845 11855 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_03320 11827 12753 gene locus_tag LOCUS_03330 11827 12753 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918274.1 protein_id gnl|my_center|LOCUS_03330 12750 13751 gene locus_tag LOCUS_03340 gene waaF 12750 13751 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_03340 13822 14847 gene locus_tag LOCUS_03350 gene rfaE1 13822 14847 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_03350 14844 15584 gene locus_tag LOCUS_03360 gene kdsB 14844 15584 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_03360 15565 16392 gene locus_tag LOCUS_03370 gene kdsA 15565 16392 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_03370 16394 17356 gene locus_tag LOCUS_03380 16394 17356 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_03380 17353 17850 gene locus_tag LOCUS_03390 17353 17850 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_03390 17847 18677 gene locus_tag LOCUS_03400 17847 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 18688 19410 gene locus_tag LOCUS_03410 gene lptB 18688 19410 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_03410 19451 20344 gene locus_tag LOCUS_03420 gene tig 19451 20344 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545152.1 protein_id gnl|my_center|LOCUS_03420 20344 20946 gene locus_tag LOCUS_03430 gene clpP 20344 20946 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_03430 20988 22127 gene locus_tag LOCUS_03440 20988 22127 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_03440 22170 23762 gene locus_tag LOCUS_03450 gene serA 22170 23762 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_03450 23765 24463 gene locus_tag LOCUS_03460 23765 24463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 24477 25748 gene locus_tag LOCUS_03470 24477 25748 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_03470 25795 26409 gene locus_tag LOCUS_03480 25795 26409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 26406 26930 gene locus_tag LOCUS_03490 26406 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 27004 27717 gene locus_tag LOCUS_03500 27004 27717 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_03500 27714 28535 gene locus_tag LOCUS_03510 27714 28535 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_03510 28605 29762 gene locus_tag LOCUS_03520 28605 29762 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_03520 29759 30871 gene locus_tag LOCUS_03530 gene rseP 29759 30871 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328199.1 protein_id gnl|my_center|LOCUS_03530 30883 32160 gene locus_tag LOCUS_03540 30883 32160 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_03540 32174 33367 gene locus_tag LOCUS_03550 32174 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 33388 33852 gene locus_tag LOCUS_03560 33388 33852 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_03560 33867 34937 gene locus_tag LOCUS_03570 33867 34937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 34977 37451 gene locus_tag LOCUS_03580 34977 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 37448 38428 gene locus_tag LOCUS_03590 gene trpS 37448 38428 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_03590 38443 39210 gene locus_tag LOCUS_03600 38443 39210 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_03600 39197 40198 gene locus_tag LOCUS_03610 gene ruvB 39197 40198 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_03610 40183 41361 gene locus_tag LOCUS_03620 40183 41361 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_03620 41733 41368 gene locus_tag LOCUS_03630 41733 41368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 42283 41735 gene locus_tag LOCUS_03640 42283 41735 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_03640 42470 42733 gene locus_tag LOCUS_03650 42470 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 42875 43312 gene locus_tag LOCUS_03660 42875 43312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 43275 43736 gene locus_tag LOCUS_03670 43275 43736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 43726 44658 gene locus_tag LOCUS_03680 43726 44658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 44670 45560 gene locus_tag LOCUS_03690 44670 45560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 45521 45877 gene locus_tag LOCUS_03700 45521 45877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 45912 46352 gene locus_tag LOCUS_03710 45912 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 46349 47902 gene locus_tag LOCUS_03720 46349 47902 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_03720 47899 48921 gene locus_tag LOCUS_03730 47899 48921 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_03730 49273 48932 gene locus_tag LOCUS_03740 49273 48932 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932665.1 protein_id gnl|my_center|LOCUS_03740 50552 49314 gene locus_tag LOCUS_03750 50552 49314 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_03750 50833 51669 gene locus_tag LOCUS_03760 gene panC 50833 51669 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_03760 51650 52474 gene locus_tag LOCUS_03770 51650 52474 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_03770 52474 52749 gene locus_tag LOCUS_03780 52474 52749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 52864 55647 gene locus_tag LOCUS_03790 gene uvrA 52864 55647 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_03790 55795 58170 gene locus_tag LOCUS_03800 55795 58170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 58185 58847 gene locus_tag LOCUS_03810 58185 58847 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_03810 58844 59251 gene locus_tag LOCUS_03820 58844 59251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 59259 59666 gene locus_tag LOCUS_03830 59259 59666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 59666 59917 gene locus_tag LOCUS_03840 59666 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence007 108 1655 gene locus_tag LOCUS_03850 gene rpsA 108 1655 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_03850 1657 2799 gene locus_tag LOCUS_03860 gene tyrS 1657 2799 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_03860 2927 2999 gene locus_tag LOCUS_t00050 2927 2999 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3024 3176 gene locus_tag LOCUS_03870 gene rpmG 3024 3176 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_03870 3223 3298 gene locus_tag LOCUS_t00060 3223 3298 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3508 4032 gene locus_tag LOCUS_03880 gene nusG 3508 4032 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_03880 4055 4480 gene locus_tag LOCUS_03890 gene rplK 4055 4480 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546433.1 protein_id gnl|my_center|LOCUS_03890 4493 5179 gene locus_tag LOCUS_03900 gene rplA 4493 5179 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081511.1 protein_id gnl|my_center|LOCUS_03900 5176 5706 gene locus_tag LOCUS_03910 gene rplJ 5176 5706 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630583.1 protein_id gnl|my_center|LOCUS_03910 5707 6105 gene locus_tag LOCUS_03920 gene rplL 5707 6105 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_03920 6240 9698 gene locus_tag LOCUS_03930 6240 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9685 13794 gene locus_tag LOCUS_03940 gene rpoC 9685 13794 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_03940 13736 14110 gene locus_tag LOCUS_03950 gene rpsL 13736 14110 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_03950 14114 14584 gene locus_tag LOCUS_03960 gene rpsG 14114 14584 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_03960 14644 16746 gene locus_tag LOCUS_03970 gene fusA 14644 16746 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03970 16777 17970 gene locus_tag LOCUS_03980 gene tuf 16777 17970 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_03980 17999 18301 gene locus_tag LOCUS_03990 gene rpsJ 17999 18301 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_03990 18320 19027 gene locus_tag LOCUS_04000 gene rplC 18320 19027 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_04000 19049 19672 gene locus_tag LOCUS_04010 gene rplD 19049 19672 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_04010 19669 19947 gene locus_tag LOCUS_04020 gene rplW 19669 19947 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_04020 19950 20789 gene locus_tag LOCUS_04030 gene rplB 19950 20789 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701306.1 protein_id gnl|my_center|LOCUS_04030 20792 21079 gene locus_tag LOCUS_04040 gene rpsS 20792 21079 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_04040 21094 21429 gene locus_tag LOCUS_04050 21094 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 21444 22094 gene locus_tag LOCUS_04060 gene rpsC 21444 22094 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529962.1 protein_id gnl|my_center|LOCUS_04060 22107 22526 gene locus_tag LOCUS_04070 gene rplP 22107 22526 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_04070 22532 22738 gene locus_tag LOCUS_04080 gene rpmC 22532 22738 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775731.1 protein_id gnl|my_center|LOCUS_04080 22722 23003 gene locus_tag LOCUS_04090 gene rpsQ 22722 23003 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_04090 23000 23368 gene locus_tag LOCUS_04100 gene rplN 23000 23368 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_04100 23368 23679 gene locus_tag LOCUS_04110 gene rplX 23368 23679 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_04110 23691 24248 gene locus_tag LOCUS_04120 gene rplE 23691 24248 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_04120 24254 24439 gene locus_tag LOCUS_04130 24254 24439 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_04130 24490 24885 gene locus_tag LOCUS_04140 gene rpsH 24490 24885 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_04140 24892 25431 gene locus_tag LOCUS_04150 gene rplF 24892 25431 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_04150 25630 25839 gene locus_tag LOCUS_04160 25630 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25845 26531 gene locus_tag LOCUS_04170 25845 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 26571 27056 gene locus_tag LOCUS_04180 gene rplO 26571 27056 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_04180 27062 28423 gene locus_tag LOCUS_04190 gene secY 27062 28423 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_04190 28420 29076 gene locus_tag LOCUS_04200 28420 29076 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_04200 29060 29821 gene locus_tag LOCUS_04210 gene map 29060 29821 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_04210 29822 30040 gene locus_tag LOCUS_04220 gene infA 29822 30040 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720929.1 protein_id gnl|my_center|LOCUS_04220 30161 30541 gene locus_tag LOCUS_04230 gene rpsM 30161 30541 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_04230 30554 31000 gene locus_tag LOCUS_04240 gene rpsK 30554 31000 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 protein_id gnl|my_center|LOCUS_04240 31013 31621 gene locus_tag LOCUS_04250 gene rpsD 31013 31621 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_04250 31657 32652 gene locus_tag LOCUS_04260 31657 32652 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_04260 32657 33259 gene locus_tag LOCUS_04270 32657 33259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 33265 34431 gene locus_tag LOCUS_04280 33265 34431 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_04280 34527 35600 gene locus_tag LOCUS_04290 34527 35600 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_04290 35676 36302 gene locus_tag LOCUS_04300 gene lipB 35676 36302 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_04300 36303 36536 gene locus_tag LOCUS_04310 36303 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 36537 37688 gene locus_tag LOCUS_04320 36537 37688 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_04320 37691 38608 gene locus_tag LOCUS_04330 37691 38608 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_04330 38547 39212 gene locus_tag LOCUS_04340 38547 39212 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_04340 39218 39883 gene locus_tag LOCUS_04350 39218 39883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 39906 40532 gene locus_tag LOCUS_04360 39906 40532 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_04360 40601 40984 gene locus_tag LOCUS_04370 40601 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 40981 41142 gene locus_tag LOCUS_04380 40981 41142 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_04380 41139 41585 gene locus_tag LOCUS_04390 gene aroQ 41139 41585 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_04390 41607 42668 gene locus_tag LOCUS_04400 41607 42668 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_04400 42649 43215 gene locus_tag LOCUS_04410 gene efp 42649 43215 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_04410 43212 43682 gene locus_tag LOCUS_04420 gene accB 43212 43682 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_04420 43703 45058 gene locus_tag LOCUS_04430 gene accC 43703 45058 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_04430 45066 45416 gene locus_tag LOCUS_04440 45066 45416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 45421 46026 gene locus_tag LOCUS_04450 45421 46026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 46023 47048 gene locus_tag LOCUS_04460 46023 47048 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_04460 47066 47638 gene locus_tag LOCUS_04470 47066 47638 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_04470 47635 47844 gene locus_tag LOCUS_04480 47635 47844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 47741 48238 gene locus_tag LOCUS_04490 47741 48238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 48223 48648 gene locus_tag LOCUS_04500 48223 48648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04500 48614 49276 gene locus_tag LOCUS_04510 48614 49276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 49267 49340 gene locus_tag LOCUS_t00070 49267 49340 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49350 50051 gene locus_tag LOCUS_04520 49350 50051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 50051 51676 gene locus_tag LOCUS_04530 50051 51676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 51673 52152 gene locus_tag LOCUS_04540 51673 52152 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_04540 52155 52661 gene locus_tag LOCUS_04550 52155 52661 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_04550 52624 53820 gene locus_tag LOCUS_04560 52624 53820 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_04560 53780 54850 gene locus_tag LOCUS_04570 53780 54850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 54936 55583 gene locus_tag LOCUS_04580 54936 55583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 55585 55863 gene locus_tag LOCUS_04590 55585 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 55875 56708 gene locus_tag LOCUS_04600 55875 56708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 56708 57331 gene locus_tag LOCUS_04610 56708 57331 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_04610 57328 58416 gene locus_tag LOCUS_04620 gene aroB 57328 58416 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_04620 59062 58472 gene locus_tag LOCUS_04630 59062 58472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 59859 59059 gene locus_tag LOCUS_04640 59859 59059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04640 >Feature sequence008 >Feature sequence009 <1 3426 gene locus_tag LOCUS_04650 <1 3426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha 3624 13877 gene locus_tag LOCUS_04660 3624 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14061 20309 gene locus_tag LOCUS_04670 14061 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 20339 21016 gene locus_tag LOCUS_04680 20339 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21033 22487 gene locus_tag LOCUS_04690 21033 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22584 22988 gene locus_tag LOCUS_04700 22584 22988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 23091 23816 gene locus_tag LOCUS_04710 23091 23816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 23903 24124 gene locus_tag LOCUS_04720 23903 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 24189 24638 gene locus_tag LOCUS_04730 24189 24638 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_04730 24687 25481 gene locus_tag LOCUS_04740 24687 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 25492 28773 gene locus_tag LOCUS_04750 25492 28773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 protein_id gnl|my_center|LOCUS_04750 28777 29865 gene locus_tag LOCUS_04760 gene gcvT 28777 29865 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941043.1 protein_id gnl|my_center|LOCUS_04760 29880 30296 gene locus_tag LOCUS_04770 gene gcvH 29880 30296 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_04770 30300 31637 gene locus_tag LOCUS_04780 gene gcvPA 30300 31637 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_04780 31634 33100 gene locus_tag LOCUS_04790 gene gcvPB 31634 33100 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_04790 33078 33719 gene locus_tag LOCUS_04800 33078 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 33941 35047 gene locus_tag LOCUS_04810 33941 35047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 35052 35402 gene locus_tag LOCUS_04820 35052 35402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 35404 36120 gene locus_tag LOCUS_04830 35404 36120 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_04830 36111 36473 gene locus_tag LOCUS_04840 36111 36473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 36470 37444 gene locus_tag LOCUS_04850 36470 37444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 37547 38158 gene locus_tag LOCUS_04860 37547 38158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 38155 39744 gene locus_tag LOCUS_04870 38155 39744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 39775 40614 gene locus_tag LOCUS_04880 39775 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 40674 42254 gene locus_tag LOCUS_04890 40674 42254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 42344 43900 gene locus_tag LOCUS_04900 42344 43900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 44436 44221 gene locus_tag LOCUS_04910 44436 44221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 44522 50395 gene locus_tag LOCUS_04920 44522 50395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 50259 50358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence010 553 744 gene locus_tag LOCUS_04930 553 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 741 956 gene locus_tag LOCUS_04940 741 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1929 985 gene locus_tag LOCUS_04950 1929 985 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255942.1 protein_id gnl|my_center|LOCUS_04950 3490 1946 gene locus_tag LOCUS_04960 3490 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4603 3500 gene locus_tag LOCUS_04970 4603 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4560 4802 gene locus_tag LOCUS_04980 4560 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4913 4989 gene locus_tag LOCUS_t00080 4913 4989 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5153 5821 gene locus_tag LOCUS_04990 5153 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5829 6563 gene locus_tag LOCUS_05000 gene fabG 5829 6563 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266390.1 protein_id gnl|my_center|LOCUS_05000 6572 8083 gene locus_tag LOCUS_05010 6572 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 8074 9303 gene locus_tag LOCUS_05020 8074 9303 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_05020 9333 9608 gene locus_tag LOCUS_05030 9333 9608 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_05030 9605 10357 gene locus_tag LOCUS_05040 9605 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10354 11643 gene locus_tag LOCUS_05050 10354 11643 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_05050 11646 13133 gene locus_tag LOCUS_05060 11646 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 13133 13786 gene locus_tag LOCUS_05070 13133 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 13779 16151 gene locus_tag LOCUS_05080 13779 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 16144 16809 gene locus_tag LOCUS_05090 16144 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 16823 17194 gene locus_tag LOCUS_05100 16823 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 17187 17693 gene locus_tag LOCUS_05110 17187 17693 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_05110 17678 18808 gene locus_tag LOCUS_05120 17678 18808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 18810 19481 gene locus_tag LOCUS_05130 18810 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 19481 20743 gene locus_tag LOCUS_05140 19481 20743 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05140 20740 22101 gene locus_tag LOCUS_05150 20740 22101 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_05150 22088 23287 gene locus_tag LOCUS_05160 22088 23287 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_05160 23277 24197 gene locus_tag LOCUS_05170 23277 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 24208 24486 gene locus_tag LOCUS_05180 24208 24486 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_05180 24496 25662 gene locus_tag LOCUS_05190 24496 25662 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_05190 25662 26444 gene locus_tag LOCUS_05200 25662 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 26434 26907 gene locus_tag LOCUS_05210 26434 26907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 26995 27573 gene locus_tag LOCUS_05220 26995 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 27573 27812 gene locus_tag LOCUS_05230 27573 27812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 27825 29138 gene locus_tag LOCUS_05240 27825 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 29154 29738 gene locus_tag LOCUS_05250 29154 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 29759 30931 gene locus_tag LOCUS_05260 29759 30931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 30931 32343 gene locus_tag LOCUS_05270 30931 32343 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 protein_id gnl|my_center|LOCUS_05270 32674 32748 gene locus_tag LOCUS_t00090 32674 32748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32904 34664 gene locus_tag LOCUS_05280 32904 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 34678 35703 gene locus_tag LOCUS_05290 34678 35703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 35724 35963 gene locus_tag LOCUS_05300 35724 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 36022 36096 gene locus_tag LOCUS_t00100 36022 36096 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 37665 36085 gene locus_tag LOCUS_05310 37665 36085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 37835 37662 gene locus_tag LOCUS_05320 37835 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 38301 37894 gene locus_tag LOCUS_05330 38301 37894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 39337 38957 gene locus_tag LOCUS_05340 39337 38957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 40818 39328 gene locus_tag LOCUS_05350 40818 39328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 41290 40799 gene locus_tag LOCUS_05360 41290 40799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 41462 41283 gene locus_tag LOCUS_05370 41462 41283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 42501 41593 gene locus_tag LOCUS_05380 42501 41593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 44580 45446 gene locus_tag LOCUS_05390 44580 45446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 45439 45759 gene locus_tag LOCUS_05400 45439 45759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 45764 47386 gene locus_tag LOCUS_05410 45764 47386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 47397 47969 gene locus_tag LOCUS_05420 47397 47969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 47969 48517 gene locus_tag LOCUS_05430 47969 48517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 48683 49834 gene locus_tag LOCUS_05440 48683 49834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 49812 50336 gene locus_tag LOCUS_05450 49812 50336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence011 80 1144 gene locus_tag LOCUS_05460 gene recA 80 1144 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772330.1 protein_id gnl|my_center|LOCUS_05460 1150 1617 gene locus_tag LOCUS_05470 1150 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1614 4256 gene locus_tag LOCUS_05480 gene alaS 1614 4256 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460322.1 protein_id gnl|my_center|LOCUS_05480 4253 5476 gene locus_tag LOCUS_05490 gene hisD 4253 5476 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_05490 5490 6107 gene locus_tag LOCUS_05500 gene hisB 5490 6107 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_05500 6107 6709 gene locus_tag LOCUS_05510 gene hisH 6107 6709 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_05510 6703 7422 gene locus_tag LOCUS_05520 gene hisA 6703 7422 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_05520 7416 8171 gene locus_tag LOCUS_05530 gene hisF 7416 8171 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_05530 8174 9676 gene locus_tag LOCUS_05540 gene trpE 8174 9676 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_05540 9714 9962 gene locus_tag LOCUS_05550 gene rpsP 9714 9962 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_05550 10071 10349 gene locus_tag LOCUS_05560 10071 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 10398 12608 gene locus_tag LOCUS_05570 gene secDF 10398 12608 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_05570 12646 14613 gene locus_tag LOCUS_05580 12646 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14591 15529 gene locus_tag LOCUS_05590 14591 15529 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_05590 15510 16448 gene locus_tag LOCUS_05600 gene pdxA 15510 16448 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 protein_id gnl|my_center|LOCUS_05600 16445 17242 gene locus_tag LOCUS_05610 gene rsmA 16445 17242 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_05610 17261 17641 gene locus_tag LOCUS_05620 17261 17641 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_05620 17638 19278 gene locus_tag LOCUS_05630 17638 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 19280 19564 gene locus_tag LOCUS_05640 gene gatC 19280 19564 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_05640 19566 20990 gene locus_tag LOCUS_05650 gene gatA 19566 20990 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_05650 20959 22437 gene locus_tag LOCUS_05660 gene gatB 20959 22437 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_05660 22430 23875 gene locus_tag LOCUS_05670 22430 23875 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_05670 23882 24784 gene locus_tag LOCUS_05680 23882 24784 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_05680 24765 25730 gene locus_tag LOCUS_05690 gene tsaD 24765 25730 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_05690 25830 26360 gene locus_tag LOCUS_05700 25830 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 26357 26662 gene locus_tag LOCUS_05710 26357 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 26713 26786 gene locus_tag LOCUS_t00110 26713 26786 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26914 28302 gene locus_tag LOCUS_05720 26914 28302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 28441 28896 gene locus_tag LOCUS_05730 28441 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 28995 29891 gene locus_tag LOCUS_05740 28995 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 29995 31164 gene locus_tag LOCUS_05750 29995 31164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 31175 33112 gene locus_tag LOCUS_05760 gene ftsH 31175 33112 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_05760 33109 33978 gene locus_tag LOCUS_05770 gene folP 33109 33978 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_05770 33975 34748 gene locus_tag LOCUS_05780 gene cdaA 33975 34748 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_05780 34851 35588 gene locus_tag LOCUS_05790 gene pdxJ 34851 35588 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772027.1 protein_id gnl|my_center|LOCUS_05790 35588 35938 gene locus_tag LOCUS_05800 gene acpS 35588 35938 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933592.1 protein_id gnl|my_center|LOCUS_05800 36175 35894 gene locus_tag LOCUS_05810 36175 35894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 36285 36740 gene locus_tag LOCUS_05820 36285 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 36799 38178 gene locus_tag LOCUS_05830 36799 38178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 38175 39059 gene locus_tag LOCUS_05840 38175 39059 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_05840 39064 39630 gene locus_tag LOCUS_05850 39064 39630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 40095 39553 gene locus_tag LOCUS_05860 40095 39553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 40229 40990 gene locus_tag LOCUS_05870 40229 40990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 40974 41759 gene locus_tag LOCUS_05880 40974 41759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 41796 42932 gene locus_tag LOCUS_05890 41796 42932 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_05890 42976 43701 gene locus_tag LOCUS_05900 42976 43701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 43718 44716 gene locus_tag LOCUS_05910 43718 44716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 45992 44787 gene locus_tag LOCUS_05920 45992 44787 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_05920 46832 46071 gene locus_tag LOCUS_05930 46832 46071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 48511 46829 gene locus_tag LOCUS_05940 gene recN 48511 46829 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_05940 48640 48712 gene locus_tag LOCUS_t00120 48640 48712 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 48894 48979 gene locus_tag LOCUS_t00130 48894 48979 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 2670 3053 gene locus_tag LOCUS_05950 2670 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3323 27694 gene locus_tag LOCUS_05960 3323 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28245 27748 gene locus_tag LOCUS_05970 gene ilvN 28245 27748 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_05970 29994 28264 gene locus_tag LOCUS_05980 gene ilvB 29994 28264 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_05980 30397 30122 gene locus_tag LOCUS_05990 30397 30122 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332230.1 protein_id gnl|my_center|LOCUS_05990 31942 30476 gene locus_tag LOCUS_06000 gene hpnJ 31942 30476 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_06000 32101 34788 gene locus_tag LOCUS_06010 gene acnA 32101 34788 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_06010 34847 36259 gene locus_tag LOCUS_06020 gene leuC 34847 36259 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210455.1 protein_id gnl|my_center|LOCUS_06020 36265 36876 gene locus_tag LOCUS_06030 gene leuD 36265 36876 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_06030 36881 38563 gene locus_tag LOCUS_06040 gene ilvD 36881 38563 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_06040 38588 39655 gene locus_tag LOCUS_06050 gene aroC 38588 39655 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_06050 39764 40519 gene locus_tag LOCUS_06060 39764 40519 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_06060 40512 42611 gene locus_tag LOCUS_06070 40512 42611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 42619 42972 gene locus_tag LOCUS_06080 42619 42972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 43367 43149 gene locus_tag LOCUS_06090 43367 43149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 43609 44553 gene locus_tag LOCUS_06100 43609 44553 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267049.1 protein_id gnl|my_center|LOCUS_06100 45650 44550 gene locus_tag LOCUS_06110 45650 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 46933 45734 gene locus_tag LOCUS_06120 46933 45734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 47177 46983 gene locus_tag LOCUS_06130 47177 46983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence013 968 123 gene locus_tag LOCUS_06140 968 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1159 965 gene locus_tag LOCUS_06150 1159 965 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_06150 2253 1243 gene locus_tag LOCUS_06160 2253 1243 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_06160 3079 2282 gene locus_tag LOCUS_06170 3079 2282 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_06170 4003 3137 gene locus_tag LOCUS_06180 4003 3137 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_06180 5559 4000 gene locus_tag LOCUS_06190 5559 4000 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_06190 6653 5661 gene locus_tag LOCUS_06200 gene ilvC 6653 5661 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_06200 7582 6668 gene locus_tag LOCUS_06210 gene pfkA 7582 6668 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 protein_id gnl|my_center|LOCUS_06210 9051 7648 gene locus_tag LOCUS_06220 gene ahcY 9051 7648 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_06220 10212 9055 gene locus_tag LOCUS_06230 gene metK 10212 9055 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_06230 10989 10249 gene locus_tag LOCUS_06240 10989 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 12770 10986 gene locus_tag LOCUS_06250 gene ptsP 12770 10986 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_06250 13017 12754 gene locus_tag LOCUS_06260 13017 12754 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250307.1 protein_id gnl|my_center|LOCUS_06260 14264 13020 gene locus_tag LOCUS_06270 14264 13020 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_06270 14788 14318 gene locus_tag LOCUS_06280 14788 14318 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_06280 14894 14821 gene locus_tag LOCUS_t00140 14894 14821 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15062 14981 gene locus_tag LOCUS_t00150 15062 14981 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15151 15077 gene locus_tag LOCUS_t00160 15151 15077 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15727 15167 gene locus_tag LOCUS_06290 gene frr 15727 15167 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_06290 16504 15782 gene locus_tag LOCUS_06300 gene pyrH 16504 15782 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_06300 17068 16550 gene locus_tag LOCUS_06310 gene tsf 17068 16550 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_06310 17979 17074 gene locus_tag LOCUS_06320 gene rpsB 17979 17074 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_06320 18288 19067 gene locus_tag LOCUS_06330 gene hisJ 18288 19067 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_06330 19853 19077 gene locus_tag LOCUS_06340 19853 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 21115 19895 gene locus_tag LOCUS_06350 gene ispG 21115 19895 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004339423.1 protein_id gnl|my_center|LOCUS_06350 21194 22114 gene locus_tag LOCUS_06360 gene ispH 21194 22114 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221497.1 protein_id gnl|my_center|LOCUS_06360 22215 23069 gene locus_tag LOCUS_06370 gene murB 22215 23069 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 protein_id gnl|my_center|LOCUS_06370 23527 23072 gene locus_tag LOCUS_06380 23527 23072 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_06380 24747 23524 gene locus_tag LOCUS_06390 24747 23524 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_06390 26028 24751 gene locus_tag LOCUS_06400 gene sufD 26028 24751 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_06400 26800 26030 gene locus_tag LOCUS_06410 gene sufC 26800 26030 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_06410 28253 26802 gene locus_tag LOCUS_06420 gene sufB 28253 26802 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_06420 28654 28253 gene locus_tag LOCUS_06430 28654 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 29207 28659 gene locus_tag LOCUS_06440 29207 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 30506 29310 gene locus_tag LOCUS_06450 gene lhgO 30506 29310 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_06450 31150 30554 gene locus_tag LOCUS_06460 gene metW 31150 30554 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_06460 32271 31147 gene locus_tag LOCUS_06470 32271 31147 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_06470 33319 32273 gene locus_tag LOCUS_06480 gene nadA 33319 32273 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_06480 34754 33354 gene locus_tag LOCUS_06490 gene miaB 34754 33354 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_06490 35610 34831 gene locus_tag LOCUS_06500 35610 34831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 36290 35595 gene locus_tag LOCUS_06510 36290 35595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36965 36297 gene locus_tag LOCUS_06520 36965 36297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 37138 36941 gene locus_tag LOCUS_06530 37138 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 37550 37353 gene locus_tag LOCUS_06540 37550 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 38168 37605 gene locus_tag LOCUS_06550 38168 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 38909 38181 gene locus_tag LOCUS_06560 38909 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 39759 39148 gene locus_tag LOCUS_06570 39759 39148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 40427 40209 gene locus_tag LOCUS_06580 40427 40209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 40703 40458 gene locus_tag LOCUS_06590 40703 40458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06590 >Feature sequence014 53 334 gene locus_tag LOCUS_06600 53 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 331 831 gene locus_tag LOCUS_06610 331 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 812 1036 gene locus_tag LOCUS_06620 812 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2548 1040 gene locus_tag LOCUS_06630 2548 1040 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_06630 3515 2637 gene locus_tag LOCUS_06640 3515 2637 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_06640 4870 3530 gene locus_tag LOCUS_06650 4870 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5409 4867 gene locus_tag LOCUS_06660 5409 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5623 6732 gene locus_tag LOCUS_06670 5623 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_06670 6729 7184 gene locus_tag LOCUS_06680 6729 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7195 8274 gene locus_tag LOCUS_06690 7195 8274 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_06690 8303 9655 gene locus_tag LOCUS_06700 8303 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 9667 12234 gene locus_tag LOCUS_06710 9667 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 12268 13236 gene locus_tag LOCUS_06720 12268 13236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_06720 13251 15131 gene locus_tag LOCUS_06730 13251 15131 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044858.1 protein_id gnl|my_center|LOCUS_06730 15150 15911 gene locus_tag LOCUS_06740 15150 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 15974 16117 gene locus_tag LOCUS_06750 15974 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16291 17343 gene locus_tag LOCUS_06760 16291 17343 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921780.1 protein_id gnl|my_center|LOCUS_06760 17350 17449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17480 19171 gene locus_tag LOCUS_06770 17480 19171 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 protein_id gnl|my_center|LOCUS_06770 19189 19701 gene locus_tag LOCUS_06780 19189 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 19731 20402 gene locus_tag LOCUS_06790 19731 20402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_06790 20399 21868 gene locus_tag LOCUS_06800 20399 21868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_06800 21978 22409 gene locus_tag LOCUS_06810 21978 22409 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_06810 22837 23505 gene locus_tag LOCUS_06820 22837 23505 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_06820 23520 24017 gene locus_tag LOCUS_06830 gene nuoE 23520 24017 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_06830 24010 25905 gene locus_tag LOCUS_06840 gene nuoF 24010 25905 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_06840 25907 29719 gene locus_tag LOCUS_06850 25907 29719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 27904 28003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29777 30058 gene locus_tag LOCUS_06860 29777 30058 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_06860 30073 30372 gene locus_tag LOCUS_06870 30073 30372 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_06870 30383 31540 gene locus_tag LOCUS_06880 30383 31540 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081668.1 protein_id gnl|my_center|LOCUS_06880 31854 31606 gene locus_tag LOCUS_06890 31854 31606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 31975 32178 gene locus_tag LOCUS_06900 31975 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 32254 32406 gene locus_tag LOCUS_06910 32254 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 32932 33651 gene locus_tag LOCUS_06920 32932 33651 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_06920 33743 35272 gene locus_tag LOCUS_06930 33743 35272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06930 35308 35712 gene locus_tag LOCUS_06940 35308 35712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 35904 38753 gene locus_tag LOCUS_06950 35904 38753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence015 224 808 gene locus_tag LOCUS_06960 224 808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_06960 821 1759 gene locus_tag LOCUS_06970 821 1759 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_06970 1756 2700 gene locus_tag LOCUS_06980 1756 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2672 3460 gene locus_tag LOCUS_06990 gene ttcA 2672 3460 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_06990 3514 5064 gene locus_tag LOCUS_07000 gene thiC 3514 5064 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_07000 7048 5084 gene locus_tag LOCUS_07010 7048 5084 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_07010 8854 7061 gene locus_tag LOCUS_07020 8854 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 9005 10072 gene locus_tag LOCUS_07030 gene bioB 9005 10072 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002111813.1 protein_id gnl|my_center|LOCUS_07030 10075 11010 gene locus_tag LOCUS_07040 gene trxB 10075 11010 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_07040 11012 11743 gene locus_tag LOCUS_07050 11012 11743 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831089.1 protein_id gnl|my_center|LOCUS_07050 11740 13095 gene locus_tag LOCUS_07060 11740 13095 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_07060 13085 14791 gene locus_tag LOCUS_07070 gene menD 13085 14791 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404103.1 protein_id gnl|my_center|LOCUS_07070 14791 15531 gene locus_tag LOCUS_07080 gene surE 14791 15531 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392658.1 protein_id gnl|my_center|LOCUS_07080 15518 16624 gene locus_tag LOCUS_07090 15518 16624 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_07090 16714 18009 gene locus_tag LOCUS_07100 16714 18009 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_07100 18018 19469 gene locus_tag LOCUS_07110 18018 19469 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_07110 19486 20877 gene locus_tag LOCUS_07120 gene fumC 19486 20877 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_07120 20891 21244 gene locus_tag LOCUS_07130 20891 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 22693 21305 gene locus_tag LOCUS_07140 22693 21305 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_07140 22986 22690 gene locus_tag LOCUS_07150 22986 22690 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_07150 24130 23006 gene locus_tag LOCUS_07160 24130 23006 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_07160 24360 24932 gene locus_tag LOCUS_07170 24360 24932 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902514.1 protein_id gnl|my_center|LOCUS_07170 24929 25777 gene locus_tag LOCUS_07180 24929 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 25786 26547 gene locus_tag LOCUS_07190 gene xth 25786 26547 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_07190 26558 27157 gene locus_tag LOCUS_07200 26558 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 27161 27574 gene locus_tag LOCUS_07210 27161 27574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 27575 28879 gene locus_tag LOCUS_07220 gene xseA 27575 28879 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_07220 28887 29084 gene locus_tag LOCUS_07230 gene xseB 28887 29084 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791731.1 protein_id gnl|my_center|LOCUS_07230 29091 29402 gene locus_tag LOCUS_07240 29091 29402 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_07240 29414 29764 gene locus_tag LOCUS_07250 29414 29764 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813961.1 protein_id gnl|my_center|LOCUS_07250 29761 30573 gene locus_tag LOCUS_07260 gene menB 29761 30573 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_07260 30570 31460 gene locus_tag LOCUS_07270 30570 31460 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_07270 31462 32505 gene locus_tag LOCUS_07280 gene menC 31462 32505 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_07280 32588 33850 gene locus_tag LOCUS_07290 gene menE 32588 33850 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933507.1 protein_id gnl|my_center|LOCUS_07290 33865 34266 gene locus_tag LOCUS_07300 33865 34266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence016 491 2968 gene locus_tag LOCUS_07310 gene gyrA 491 2968 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_07310 3026 3102 gene locus_tag LOCUS_t00170 3026 3102 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3219 4202 gene locus_tag LOCUS_07320 3219 4202 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_07320 4289 5239 gene locus_tag LOCUS_07330 4289 5239 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545595.1 protein_id gnl|my_center|LOCUS_07330 5242 6090 gene locus_tag LOCUS_07340 5242 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6094 7815 gene locus_tag LOCUS_07350 6094 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7835 10012 gene locus_tag LOCUS_07360 7835 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10016 10369 gene locus_tag LOCUS_07370 10016 10369 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_07370 10448 12100 gene locus_tag LOCUS_07380 gene ilvD 10448 12100 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_07380 12118 13584 gene locus_tag LOCUS_07390 12118 13584 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_07390 13711 16149 gene locus_tag LOCUS_07400 13711 16149 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_07400 16195 16413 gene locus_tag LOCUS_07410 16195 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 16487 18604 gene locus_tag LOCUS_07420 gene glgB 16487 18604 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_07420 18493 18592 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18725 20443 gene locus_tag LOCUS_07430 gene muiA 18725 20443 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_07430 20447 22873 gene locus_tag LOCUS_07440 20447 22873 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_07440 22882 24414 gene locus_tag LOCUS_07450 22882 24414 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_07450 24425 26455 gene locus_tag LOCUS_07460 24425 26455 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_07460 26465 27346 gene locus_tag LOCUS_07470 26465 27346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 27343 28743 gene locus_tag LOCUS_07480 27343 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 28740 29573 gene locus_tag LOCUS_07490 28740 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 29703 31025 gene locus_tag LOCUS_07500 29703 31025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence017 1817 1641 gene locus_tag LOCUS_07510 1817 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1950 2150 gene locus_tag LOCUS_07520 1950 2150 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948471.1 protein_id gnl|my_center|LOCUS_07520 2542 2931 gene locus_tag LOCUS_07530 2542 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3110 3307 gene locus_tag LOCUS_07540 3110 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3439 4305 gene locus_tag LOCUS_07550 3439 4305 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405355.1 protein_id gnl|my_center|LOCUS_07550 4403 5812 gene locus_tag LOCUS_07560 4403 5812 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_07560 5927 6862 gene locus_tag LOCUS_07570 gene cysK 5927 6862 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_07570 6859 8019 gene locus_tag LOCUS_07580 6859 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7985 8614 gene locus_tag LOCUS_07590 gene metW 7985 8614 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_07590 8618 9334 gene locus_tag LOCUS_07600 8618 9334 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_07600 9355 10503 gene locus_tag LOCUS_07610 9355 10503 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932383.1 protein_id gnl|my_center|LOCUS_07610 10506 11591 gene locus_tag LOCUS_07620 gene gap 10506 11591 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_07620 11588 12592 gene locus_tag LOCUS_07630 11588 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_07630 12604 13401 gene locus_tag LOCUS_07640 gene moeB 12604 13401 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_07640 13411 14655 gene locus_tag LOCUS_07650 13411 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 14657 15664 gene locus_tag LOCUS_07660 gene sfbB 14657 15664 CDS product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 protein_id gnl|my_center|LOCUS_07660 15657 16322 gene locus_tag LOCUS_07670 15657 16322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_07670 16339 17151 gene locus_tag LOCUS_07680 16339 17151 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_07680 17256 17657 gene locus_tag LOCUS_07690 17256 17657 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_07690 17768 18574 gene locus_tag LOCUS_07700 17768 18574 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388821.1 protein_id gnl|my_center|LOCUS_07700 18656 19357 gene locus_tag LOCUS_07710 18656 19357 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_07710 19496 20524 gene locus_tag LOCUS_07720 gene nifS 19496 20524 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_07720 20616 21299 gene locus_tag LOCUS_07730 20616 21299 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388824.1 protein_id gnl|my_center|LOCUS_07730 21656 23095 gene locus_tag LOCUS_07740 21656 23095 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892504.1 protein_id gnl|my_center|LOCUS_07740 23114 24478 gene locus_tag LOCUS_07750 23114 24478 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_07750 24500 25069 gene locus_tag LOCUS_07760 24500 25069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 25066 26379 gene locus_tag LOCUS_07770 25066 26379 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_07770 26376 27746 gene locus_tag LOCUS_07780 26376 27746 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100955.1 protein_id gnl|my_center|LOCUS_07780 27945 33179 gene locus_tag LOCUS_07790 27945 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 33201 33419 gene locus_tag LOCUS_07800 33201 33419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 33456 33719 gene locus_tag LOCUS_07810 33456 33719 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 protein_id gnl|my_center|LOCUS_07810 33940 33716 gene locus_tag LOCUS_07820 33940 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 34392 33952 gene locus_tag LOCUS_07830 34392 33952 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_07830 34686 35156 gene locus_tag LOCUS_07840 34686 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 35260 35442 gene locus_tag LOCUS_07850 35260 35442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence018 594 148 gene locus_tag LOCUS_07860 594 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1132 701 gene locus_tag LOCUS_07870 1132 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1418 1615 gene locus_tag LOCUS_07880 1418 1615 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939689.1 protein_id gnl|my_center|LOCUS_07880 3315 1687 gene locus_tag LOCUS_07890 3315 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4134 3865 gene locus_tag LOCUS_07900 4134 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5516 4206 gene locus_tag LOCUS_07910 5516 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5783 5547 gene locus_tag LOCUS_07920 5783 5547 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_07920 6073 5792 gene locus_tag LOCUS_07930 6073 5792 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_07930 6674 6102 gene locus_tag LOCUS_07940 6674 6102 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434284.1 protein_id gnl|my_center|LOCUS_07940 7123 6674 gene locus_tag LOCUS_07950 7123 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7295 7113 gene locus_tag LOCUS_07960 7295 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7846 7298 gene locus_tag LOCUS_07970 7846 7298 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_07970 8708 7884 gene locus_tag LOCUS_07980 8708 7884 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_07980 10082 8754 gene locus_tag LOCUS_07990 10082 8754 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_07990 10856 10104 gene locus_tag LOCUS_08000 10856 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 11823 10921 gene locus_tag LOCUS_08010 11823 10921 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_08010 12528 11977 gene locus_tag LOCUS_08020 12528 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 13919 12525 gene locus_tag LOCUS_08030 13919 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 14219 13974 gene locus_tag LOCUS_08040 14219 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15321 14260 gene locus_tag LOCUS_08050 gene rsmH 15321 14260 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_08050 15766 15350 gene locus_tag LOCUS_08060 gene ssb 15766 15350 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262509.1 protein_id gnl|my_center|LOCUS_08060 16286 15810 gene locus_tag LOCUS_08070 16286 15810 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082639.1 protein_id gnl|my_center|LOCUS_08070 17052 16339 gene locus_tag LOCUS_08080 17052 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 17275 17057 gene locus_tag LOCUS_08090 17275 17057 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168081.1 protein_id gnl|my_center|LOCUS_08090 18233 17268 gene locus_tag LOCUS_08100 gene mutY 18233 17268 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_08100 19224 18379 gene locus_tag LOCUS_08110 19224 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 19891 19217 gene locus_tag LOCUS_08120 19891 19217 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_08120 20376 19924 gene locus_tag LOCUS_08130 20376 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 21348 20431 gene locus_tag LOCUS_08140 21348 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21554 21982 gene locus_tag LOCUS_08150 21554 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22044 24677 gene locus_tag LOCUS_08160 22044 24677 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047928.1 protein_id gnl|my_center|LOCUS_08160 24715 25746 gene locus_tag LOCUS_08170 24715 25746 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_08170 29288 25992 gene locus_tag LOCUS_08180 29288 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 29410 29559 gene locus_tag LOCUS_08190 29410 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 31353 29713 gene locus_tag LOCUS_08200 gene pckA 31353 29713 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648384.1 protein_id gnl|my_center|LOCUS_08200 33459 31456 gene locus_tag LOCUS_08210 33459 31456 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_08210 33610 34812 gene locus_tag LOCUS_08220 gene glgA 33610 34812 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_08220 34845 35438 gene locus_tag LOCUS_08230 34845 35438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence019 381 1307 gene locus_tag LOCUS_08240 381 1307 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_08240 1321 1896 gene locus_tag LOCUS_08250 1321 1896 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_08250 1909 2934 gene locus_tag LOCUS_08260 gene neuB 1909 2934 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_08260 2931 3737 gene locus_tag LOCUS_08270 2931 3737 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_08270 3740 4777 gene locus_tag LOCUS_08280 gene pseI 3740 4777 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_08280 4747 5826 gene locus_tag LOCUS_08290 4747 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5823 6371 gene locus_tag LOCUS_08300 gene pseH 5823 6371 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265718.1 protein_id gnl|my_center|LOCUS_08300 6365 7438 gene locus_tag LOCUS_08310 6365 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7440 8675 gene locus_tag LOCUS_08320 7440 8675 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073147.1 protein_id gnl|my_center|LOCUS_08320 8672 8968 gene locus_tag LOCUS_08330 8672 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8973 9689 gene locus_tag LOCUS_08340 8973 9689 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_08340 9692 10387 gene locus_tag LOCUS_08350 9692 10387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_08350 10409 11410 gene locus_tag LOCUS_08360 10409 11410 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_08360 11413 12630 gene locus_tag LOCUS_08370 11413 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12640 13584 gene locus_tag LOCUS_08380 12640 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13581 15392 gene locus_tag LOCUS_08390 13581 15392 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_08390 15395 15640 gene locus_tag LOCUS_08400 15395 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15661 17769 gene locus_tag LOCUS_08410 15661 17769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 17797 18393 gene locus_tag LOCUS_08420 17797 18393 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231291.1 protein_id gnl|my_center|LOCUS_08420 18413 19837 gene locus_tag LOCUS_08430 18413 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 19839 21674 gene locus_tag LOCUS_08440 19839 21674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 21688 22482 gene locus_tag LOCUS_08450 21688 22482 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_08450 22490 24424 gene locus_tag LOCUS_08460 gene asnB 22490 24424 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566883.1 protein_id gnl|my_center|LOCUS_08460 24427 25476 gene locus_tag LOCUS_08470 24427 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 25484 26197 gene locus_tag LOCUS_08480 25484 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 26214 26966 gene locus_tag LOCUS_08490 gene kdsB 26214 26966 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848238.1 protein_id gnl|my_center|LOCUS_08490 26963 28474 gene locus_tag LOCUS_08500 26963 28474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 28480 29508 gene locus_tag LOCUS_08510 28480 29508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_08510 29505 30533 gene locus_tag LOCUS_08520 29505 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 30517 31152 gene locus_tag LOCUS_08530 30517 31152 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125472.1 protein_id gnl|my_center|LOCUS_08530 31149 32069 gene locus_tag LOCUS_08540 31149 32069 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_08540 32080 32805 gene locus_tag LOCUS_08550 32080 32805 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022640.1 protein_id gnl|my_center|LOCUS_08550 32808 33911 gene locus_tag LOCUS_08560 32808 33911 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013031008.1 protein_id gnl|my_center|LOCUS_08560 33925 35409 gene locus_tag LOCUS_08570 33925 35409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence020 824 78 gene locus_tag LOCUS_08580 824 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3013 821 gene locus_tag LOCUS_08590 3013 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3793 3191 gene locus_tag LOCUS_08600 3793 3191 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_08600 5256 3832 gene locus_tag LOCUS_08610 5256 3832 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_08610 5884 5318 gene locus_tag LOCUS_08620 5884 5318 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 protein_id gnl|my_center|LOCUS_08620 7137 5881 gene locus_tag LOCUS_08630 7137 5881 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_08630 7930 7139 gene locus_tag LOCUS_08640 gene proB 7930 7139 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_08640 8944 7937 gene locus_tag LOCUS_08650 gene obgE 8944 7937 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496111.1 protein_id gnl|my_center|LOCUS_08650 9316 9005 gene locus_tag LOCUS_08660 gene rplU 9316 9005 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_08660 10817 9450 gene locus_tag LOCUS_08670 gene rng 10817 9450 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_08670 12458 10920 gene locus_tag LOCUS_08680 12458 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 12872 12459 gene locus_tag LOCUS_08690 12872 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13455 12874 gene locus_tag LOCUS_08700 13455 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14042 13452 gene locus_tag LOCUS_08710 14042 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 15120 14029 gene locus_tag LOCUS_08720 gene pilM 15120 14029 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_08720 15647 15261 gene locus_tag LOCUS_08730 15647 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 17129 15918 gene locus_tag LOCUS_08740 17129 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 15964 16063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18352 17144 gene locus_tag LOCUS_08750 18352 17144 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_08750 18852 18352 gene locus_tag LOCUS_08760 18852 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 20664 18964 gene locus_tag LOCUS_08770 gene pilB 20664 18964 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08770 22402 20669 gene locus_tag LOCUS_08780 gene pilB 22402 20669 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_08780 22851 22402 gene locus_tag LOCUS_08790 22851 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 24088 22985 gene locus_tag LOCUS_08800 gene rodA 24088 22985 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_08800 24323 24093 gene locus_tag LOCUS_08810 24323 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 25835 24345 gene locus_tag LOCUS_08820 gene amrB 25835 24345 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_08820 26259 25813 gene locus_tag LOCUS_08830 26259 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 26884 26261 gene locus_tag LOCUS_08840 26884 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 27273 26917 gene locus_tag LOCUS_08850 27273 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 27874 27275 gene locus_tag LOCUS_08860 27874 27275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 28241 27861 gene locus_tag LOCUS_08870 28241 27861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_08870 28472 28248 gene locus_tag LOCUS_08880 28472 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 29838 28591 gene locus_tag LOCUS_08890 29838 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_08890 30458 29862 gene locus_tag LOCUS_08900 30458 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 30995 30465 gene locus_tag LOCUS_08910 30995 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 31870 31067 gene locus_tag LOCUS_08920 31870 31067 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_08920 32535 31882 gene locus_tag LOCUS_08930 32535 31882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941685.1 protein_id gnl|my_center|LOCUS_08930 33406 32522 gene locus_tag LOCUS_08940 gene pfkB 33406 32522 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_08940 33961 33479 gene locus_tag LOCUS_08950 33961 33479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 34887 34240 gene locus_tag LOCUS_08960 34887 34240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence021 996 367 gene locus_tag LOCUS_08970 996 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1652 993 gene locus_tag LOCUS_08980 1652 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2683 1649 gene locus_tag LOCUS_08990 2683 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2902 2687 gene locus_tag LOCUS_09000 2902 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3858 3319 gene locus_tag LOCUS_09010 3858 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5176 3860 gene locus_tag LOCUS_09020 5176 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5525 5316 gene locus_tag LOCUS_09030 5525 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5891 5652 gene locus_tag LOCUS_09040 5891 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6611 5994 gene locus_tag LOCUS_09050 6611 5994 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974147.1 protein_id gnl|my_center|LOCUS_09050 8704 6608 gene locus_tag LOCUS_09060 8704 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8802 10058 gene locus_tag LOCUS_09070 gene nreB 8802 10058 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_09070 11135 10470 gene locus_tag LOCUS_09080 11135 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12820 11147 gene locus_tag LOCUS_09090 12820 11147 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_09090 14714 12888 gene locus_tag LOCUS_09100 14714 12888 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_09100 12904 13003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15457 14717 gene locus_tag LOCUS_09110 15457 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 16389 15457 gene locus_tag LOCUS_09120 16389 15457 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_09120 18266 16386 gene locus_tag LOCUS_09130 18266 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 18664 18293 gene locus_tag LOCUS_09140 18664 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 19003 18680 gene locus_tag LOCUS_09150 19003 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 20587 19124 gene locus_tag LOCUS_09160 20587 19124 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_09160 21258 20587 gene locus_tag LOCUS_09170 21258 20587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_09170 21474 21271 gene locus_tag LOCUS_09180 21474 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 22013 21468 gene locus_tag LOCUS_09190 22013 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 23585 22068 gene locus_tag LOCUS_09200 23585 22068 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546639.1 protein_id gnl|my_center|LOCUS_09200 24579 23578 gene locus_tag LOCUS_09210 24579 23578 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_09210 25937 24567 gene locus_tag LOCUS_09220 25937 24567 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_09220 26181 25918 gene locus_tag LOCUS_09230 26181 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 26416 27420 gene locus_tag LOCUS_09240 26416 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 27429 30311 gene locus_tag LOCUS_09250 27429 30311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 31721 30330 gene locus_tag LOCUS_09260 gene mnmE 31721 30330 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 protein_id gnl|my_center|LOCUS_09260 33046 31697 gene locus_tag LOCUS_09270 33046 31697 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_09270 34603 33047 gene locus_tag LOCUS_09280 gene purH 34603 33047 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_09280 34840 34670 gene locus_tag LOCUS_09290 34840 34670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence022 1186 917 gene locus_tag LOCUS_09300 1186 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2027 2221 gene locus_tag LOCUS_09310 2027 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2856 4070 gene locus_tag LOCUS_09320 2856 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4205 5182 gene locus_tag LOCUS_09330 4205 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5179 6009 gene locus_tag LOCUS_09340 5179 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6022 6753 gene locus_tag LOCUS_09350 6022 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6800 7690 gene locus_tag LOCUS_09360 6800 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7751 9571 gene locus_tag LOCUS_09370 7751 9571 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_09370 9573 9971 gene locus_tag LOCUS_09380 9573 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9986 10144 gene locus_tag LOCUS_09390 9986 10144 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_09390 10187 11356 gene locus_tag LOCUS_09400 10187 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11524 12543 gene locus_tag LOCUS_09410 11524 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 12614 14050 gene locus_tag LOCUS_09420 12614 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 14091 15524 gene locus_tag LOCUS_09430 14091 15524 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231203.1 protein_id gnl|my_center|LOCUS_09430 15514 16242 gene locus_tag LOCUS_09440 15514 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16402 16217 gene locus_tag LOCUS_09450 16402 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 18164 17346 gene locus_tag LOCUS_09460 18164 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 18280 18450 gene locus_tag LOCUS_09470 18280 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 18717 19670 gene locus_tag LOCUS_09480 18717 19670 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_09480 19673 20629 gene locus_tag LOCUS_09490 19673 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 20622 21725 gene locus_tag LOCUS_09500 20622 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 22333 23199 gene locus_tag LOCUS_09510 22333 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23189 24661 gene locus_tag LOCUS_09520 23189 24661 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_09520 24670 25647 gene locus_tag LOCUS_09530 24670 25647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 25651 26688 gene locus_tag LOCUS_09540 25651 26688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 28133 29263 gene locus_tag LOCUS_09550 28133 29263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 29342 30406 gene locus_tag LOCUS_09560 29342 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 30399 31853 gene locus_tag LOCUS_09570 30399 31853 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_09570 31850 33007 gene locus_tag LOCUS_09580 31850 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence023 436 2025 gene locus_tag LOCUS_09590 436 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2036 2722 gene locus_tag LOCUS_09600 2036 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2700 3170 gene locus_tag LOCUS_09610 2700 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3170 4651 gene locus_tag LOCUS_09620 3170 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4660 6393 gene locus_tag LOCUS_09630 4660 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6397 7632 gene locus_tag LOCUS_09640 6397 7632 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09640 7817 8263 gene locus_tag LOCUS_09650 7817 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8337 8741 gene locus_tag LOCUS_09660 8337 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8752 9195 gene locus_tag LOCUS_09670 8752 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9208 9549 gene locus_tag LOCUS_09680 9208 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9558 10157 gene locus_tag LOCUS_09690 9558 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10161 10889 gene locus_tag LOCUS_09700 10161 10889 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933661.1 protein_id gnl|my_center|LOCUS_09700 10873 12831 gene locus_tag LOCUS_09710 10873 12831 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_09710 13004 13450 gene locus_tag LOCUS_09720 13004 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 13685 13434 gene locus_tag LOCUS_09730 13685 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 15132 17033 gene locus_tag LOCUS_09740 15132 17033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 17491 19455 gene locus_tag LOCUS_09750 17491 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19479 19961 gene locus_tag LOCUS_09760 gene kdsC 19479 19961 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_09760 19958 21757 gene locus_tag LOCUS_09770 gene ilvB 19958 21757 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_09770 21768 22826 gene locus_tag LOCUS_09780 21768 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 22827 23852 gene locus_tag LOCUS_09790 22827 23852 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_09790 23849 24868 gene locus_tag LOCUS_09800 23849 24868 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_09800 24862 26016 gene locus_tag LOCUS_09810 24862 26016 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_09810 26009 27643 gene locus_tag LOCUS_09820 26009 27643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 27779 28840 gene locus_tag LOCUS_09830 27779 28840 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073147.1 protein_id gnl|my_center|LOCUS_09830 28837 29784 gene locus_tag LOCUS_09840 28837 29784 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_09840 29777 30196 gene locus_tag LOCUS_09850 29777 30196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 30214 31749 gene locus_tag LOCUS_09860 30214 31749 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_09860 31777 32271 gene locus_tag LOCUS_09870 31777 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 32268 33149 gene locus_tag LOCUS_09880 32268 33149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 33180 34523 gene locus_tag LOCUS_09890 gene rfbH 33180 34523 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence024 96 431 gene locus_tag LOCUS_09900 96 431 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_09900 474 1145 gene locus_tag LOCUS_09910 474 1145 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_09910 1312 2700 gene locus_tag LOCUS_09920 1312 2700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_09920 3098 2697 gene locus_tag LOCUS_09930 3098 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3224 4285 gene locus_tag LOCUS_09940 3224 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4340 9727 gene locus_tag LOCUS_09950 4340 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 9806 10324 gene locus_tag LOCUS_09960 9806 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 11498 10533 gene locus_tag LOCUS_09970 11498 10533 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258380.1 protein_id gnl|my_center|LOCUS_09970 13128 11500 gene locus_tag LOCUS_09980 13128 11500 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_09980 13331 13738 gene locus_tag LOCUS_09990 13331 13738 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_09990 13757 14341 gene locus_tag LOCUS_10000 13757 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14512 15744 gene locus_tag LOCUS_10010 14512 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15789 15926 gene locus_tag LOCUS_10020 15789 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16077 16844 gene locus_tag LOCUS_10030 gene ygiD 16077 16844 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188362.1 protein_id gnl|my_center|LOCUS_10030 16953 17387 gene locus_tag LOCUS_10040 16953 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 17476 17820 gene locus_tag LOCUS_10050 17476 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 17842 18894 gene locus_tag LOCUS_10060 17842 18894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19103 19471 gene locus_tag LOCUS_10070 19103 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 19468 20226 gene locus_tag LOCUS_10080 19468 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 20235 22169 gene locus_tag LOCUS_10090 20235 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 22799 22191 gene locus_tag LOCUS_10100 22799 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22899 24620 gene locus_tag LOCUS_10110 22899 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 24704 25345 gene locus_tag LOCUS_10120 24704 25345 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_10120 25348 27099 gene locus_tag LOCUS_10130 25348 27099 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_10130 27174 27725 gene locus_tag LOCUS_10140 gene msrA 27174 27725 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288119.1 protein_id gnl|my_center|LOCUS_10140 27789 28541 gene locus_tag LOCUS_10150 27789 28541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_10150 28542 29216 gene locus_tag LOCUS_10160 28542 29216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 29216 29584 gene locus_tag LOCUS_10170 gene speD 29216 29584 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 protein_id gnl|my_center|LOCUS_10170 29581 31338 gene locus_tag LOCUS_10180 29581 31338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 31403 31873 gene locus_tag LOCUS_10190 31403 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 32150 32833 gene locus_tag LOCUS_10200 32150 32833 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_10200 32903 33052 gene locus_tag LOCUS_10210 32903 33052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 33951 33049 gene locus_tag LOCUS_10220 gene amrS 33951 33049 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence025 11148 12479 gene locus_tag LOCUS_10230 11148 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12476 13963 gene locus_tag LOCUS_10240 gene atpA 12476 13963 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880405.1 protein_id gnl|my_center|LOCUS_10240 13985 14260 gene locus_tag LOCUS_10250 13985 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14276 14497 gene locus_tag LOCUS_10260 14276 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 14501 14731 gene locus_tag LOCUS_10270 14501 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 14759 15517 gene locus_tag LOCUS_10280 14759 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15527 16384 gene locus_tag LOCUS_10290 15527 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 16397 17854 gene locus_tag LOCUS_10300 gene atpD 16397 17854 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 protein_id gnl|my_center|LOCUS_10300 17879 19624 gene locus_tag LOCUS_10310 17879 19624 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_10310 19605 20816 gene locus_tag LOCUS_10320 19605 20816 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_10320 20818 21633 gene locus_tag LOCUS_10330 20818 21633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 21662 22066 gene locus_tag LOCUS_10340 gene xcpT 21662 22066 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_10340 22104 22481 gene locus_tag LOCUS_10350 22104 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 22478 23086 gene locus_tag LOCUS_10360 22478 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 23083 24114 gene locus_tag LOCUS_10370 23083 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 24180 25652 gene locus_tag LOCUS_10380 24180 25652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 25663 26289 gene locus_tag LOCUS_10390 25663 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26298 27104 gene locus_tag LOCUS_10400 26298 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 27121 27648 gene locus_tag LOCUS_10410 27121 27648 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_10410 27713 27789 gene locus_tag LOCUS_t00180 27713 27789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 30221 27852 gene locus_tag LOCUS_10420 30221 27852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 30195 30323 gene locus_tag LOCUS_10430 30195 30323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 31059 30367 gene locus_tag LOCUS_10440 31059 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 31079 32413 gene locus_tag LOCUS_10450 31079 32413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 32473 33249 gene locus_tag LOCUS_10460 32473 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence026 127 1278 gene locus_tag LOCUS_10470 gene lpxB 127 1278 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_10470 1720 1262 gene locus_tag LOCUS_10480 1720 1262 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_10480 2568 1717 gene locus_tag LOCUS_10490 2568 1717 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_10490 3311 2565 gene locus_tag LOCUS_10500 3311 2565 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_10500 5155 3308 gene locus_tag LOCUS_10510 5155 3308 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_10510 6017 5139 gene locus_tag LOCUS_10520 6017 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7068 6067 gene locus_tag LOCUS_10530 7068 6067 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_10530 8065 7070 gene locus_tag LOCUS_10540 8065 7070 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_10540 8586 8062 gene locus_tag LOCUS_10550 8586 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9500 8583 gene locus_tag LOCUS_10560 9500 8583 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_10560 10604 9537 gene locus_tag LOCUS_10570 10604 9537 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_10570 11778 10585 gene locus_tag LOCUS_10580 11778 10585 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583578.1 protein_id gnl|my_center|LOCUS_10580 12134 11775 gene locus_tag LOCUS_10590 gene spo0F 12134 11775 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_10590 14415 12226 gene locus_tag LOCUS_10600 14415 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 15747 14443 gene locus_tag LOCUS_10610 15747 14443 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463934.1 protein_id gnl|my_center|LOCUS_10610 16759 15836 gene locus_tag LOCUS_10620 gene fabD 16759 15836 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_10620 17744 16761 gene locus_tag LOCUS_10630 17744 16761 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438099.1 protein_id gnl|my_center|LOCUS_10630 18724 17741 gene locus_tag LOCUS_10640 gene plsX 18724 17741 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_10640 18958 18764 gene locus_tag LOCUS_10650 18958 18764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 19384 18962 gene locus_tag LOCUS_10660 19384 18962 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_10660 19863 19381 gene locus_tag LOCUS_10670 gene coaD 19863 19381 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 protein_id gnl|my_center|LOCUS_10670 20455 19865 gene locus_tag LOCUS_10680 gene rsmD 20455 19865 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_10680 21471 20452 gene locus_tag LOCUS_10690 21471 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 23604 21529 gene locus_tag LOCUS_10700 gene recG 23604 21529 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_10700 25234 23615 gene locus_tag LOCUS_10710 25234 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25790 25236 gene locus_tag LOCUS_10720 25790 25236 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_10720 26199 25807 gene locus_tag LOCUS_10730 26199 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 26823 26251 gene locus_tag LOCUS_10740 26823 26251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 28052 27696 gene locus_tag LOCUS_10750 28052 27696 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545156.1 protein_id gnl|my_center|LOCUS_10750 30051 28054 gene locus_tag LOCUS_10760 30051 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 30815 30198 gene locus_tag LOCUS_10770 30815 30198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 31829 30828 gene locus_tag LOCUS_10780 31829 30828 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269667.1 protein_id gnl|my_center|LOCUS_10780 32716 31898 gene locus_tag LOCUS_10790 32716 31898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 33090 32914 gene locus_tag LOCUS_10800 33090 32914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence027 1070 363 gene locus_tag LOCUS_10810 gene rpe 1070 363 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_10810 1337 1257 gene locus_tag LOCUS_t00190 1337 1257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2999 1392 gene locus_tag LOCUS_10820 2999 1392 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_10820 4381 2996 gene locus_tag LOCUS_10830 gene purF 4381 2996 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_10830 7677 4411 gene locus_tag LOCUS_10840 gene carB 7677 4411 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_10840 8769 7678 gene locus_tag LOCUS_10850 gene carA 8769 7678 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_10850 11387 8883 gene locus_tag LOCUS_10860 11387 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 12058 11495 gene locus_tag LOCUS_10870 12058 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13561 12134 gene locus_tag LOCUS_10880 13561 12134 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_10880 18215 13692 gene locus_tag LOCUS_10890 gene gltB 18215 13692 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_10890 18985 18341 gene locus_tag LOCUS_10900 18985 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 19993 19007 gene locus_tag LOCUS_10910 19993 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20111 20821 gene locus_tag LOCUS_10920 20111 20821 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_10920 22699 20822 gene locus_tag LOCUS_10930 22699 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 24616 22718 gene locus_tag LOCUS_10940 24616 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 25301 24621 gene locus_tag LOCUS_10950 25301 24621 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_10950 26914 25298 gene locus_tag LOCUS_10960 26914 25298 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039823.1 protein_id gnl|my_center|LOCUS_10960 27600 26911 gene locus_tag LOCUS_10970 27600 26911 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957790.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence028 2477 1815 gene locus_tag LOCUS_10980 gene cmk 2477 1815 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_10980 3349 2483 gene locus_tag LOCUS_10990 3349 2483 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_10990 4374 3349 gene locus_tag LOCUS_11000 gene aroF 4374 3349 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_11000 5456 4371 gene locus_tag LOCUS_11010 gene hisC 5456 4371 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_11010 5973 5476 gene locus_tag LOCUS_11020 5973 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 7060 5999 gene locus_tag LOCUS_11030 gene pheA 7060 5999 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_11030 7880 7035 gene locus_tag LOCUS_11040 7880 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8506 7880 gene locus_tag LOCUS_11050 gene ruvA 8506 7880 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_11050 8985 8503 gene locus_tag LOCUS_11060 gene ruvC 8985 8503 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_11060 9737 8988 gene locus_tag LOCUS_11070 9737 8988 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_11070 10544 10077 gene locus_tag LOCUS_11080 10544 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 11271 10546 gene locus_tag LOCUS_11090 11271 10546 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_11090 11388 11312 gene locus_tag LOCUS_t00200 11388 11312 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11593 11520 gene locus_tag LOCUS_t00210 11593 11520 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12224 11748 gene locus_tag LOCUS_11100 12224 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 13929 12304 gene locus_tag LOCUS_11110 13929 12304 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_11110 15731 13962 gene locus_tag LOCUS_11120 gene dnaG 15731 13962 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_11120 16314 15751 gene locus_tag LOCUS_11130 16314 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 20086 16622 gene locus_tag LOCUS_11140 gene smc 20086 16622 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546468.1 protein_id gnl|my_center|LOCUS_11140 20373 20155 gene locus_tag LOCUS_11150 20373 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 22124 20925 gene locus_tag LOCUS_11160 22124 20925 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_11160 22908 22126 gene locus_tag LOCUS_11170 22908 22126 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_11170 24059 22905 gene locus_tag LOCUS_11180 24059 22905 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_11180 25485 24268 gene locus_tag LOCUS_11190 gene glgC 25485 24268 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_11190 27626 25488 gene locus_tag LOCUS_11200 27626 25488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence029 192 1316 gene locus_tag LOCUS_11210 192 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1335 2777 gene locus_tag LOCUS_11220 1335 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2774 3538 gene locus_tag LOCUS_11230 2774 3538 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811075.1 protein_id gnl|my_center|LOCUS_11230 3535 4575 gene locus_tag LOCUS_11240 3535 4575 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_11240 4835 6187 gene locus_tag LOCUS_11250 4835 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 6189 6941 gene locus_tag LOCUS_11260 6189 6941 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_11260 6938 8356 gene locus_tag LOCUS_11270 6938 8356 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_11270 8356 9375 gene locus_tag LOCUS_11280 gene gmd 8356 9375 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_11280 9375 10322 gene locus_tag LOCUS_11290 9375 10322 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_11290 10313 11560 gene locus_tag LOCUS_11300 10313 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 11547 12998 gene locus_tag LOCUS_11310 11547 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 13153 14376 gene locus_tag LOCUS_11320 13153 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 14440 15198 gene locus_tag LOCUS_11330 gene tpiA 14440 15198 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_11330 15231 15647 gene locus_tag LOCUS_11340 gene secG 15231 15647 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_11340 15647 17365 gene locus_tag LOCUS_11350 15647 17365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_11350 18011 18922 gene locus_tag LOCUS_11360 18011 18922 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_11360 18922 19938 gene locus_tag LOCUS_11370 18922 19938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_11370 19982 20227 gene locus_tag LOCUS_11380 19982 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 20261 21046 gene locus_tag LOCUS_11390 20261 21046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11390 21108 21800 gene locus_tag LOCUS_11400 21108 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 22003 22317 gene locus_tag LOCUS_11410 22003 22317 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_11410 22292 22567 gene locus_tag LOCUS_11420 22292 22567 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_11420 22820 23035 gene locus_tag LOCUS_11430 22820 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence030 <1 1293 gene locus_tag LOCUS_11440 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188537.1:efflux transporter outer membrane subunit 1303 4530 gene locus_tag LOCUS_11450 1303 4530 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_11450 4533 4712 gene locus_tag LOCUS_11460 4533 4712 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_11460 4829 6121 gene locus_tag LOCUS_11470 4829 6121 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_11470 6558 6118 gene locus_tag LOCUS_11480 6558 6118 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141918.1 protein_id gnl|my_center|LOCUS_11480 6737 7075 gene locus_tag LOCUS_11490 6737 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7088 7864 gene locus_tag LOCUS_11500 7088 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7909 9903 gene locus_tag LOCUS_11510 gene feoB 7909 9903 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_11510 9935 10792 gene locus_tag LOCUS_11520 9935 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10783 11547 gene locus_tag LOCUS_11530 10783 11547 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_11530 11588 12922 gene locus_tag LOCUS_11540 11588 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 12903 13613 gene locus_tag LOCUS_11550 12903 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13623 15587 gene locus_tag LOCUS_11560 13623 15587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 15584 15889 gene locus_tag LOCUS_11570 15584 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 15894 16070 gene locus_tag LOCUS_11580 15894 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 16191 17366 gene locus_tag LOCUS_11590 16191 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 17557 17656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18000 18758 gene locus_tag LOCUS_11600 18000 18758 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_11600 18736 19575 gene locus_tag LOCUS_11610 18736 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 19591 20829 gene locus_tag LOCUS_11620 19591 20829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 21168 22577 gene locus_tag LOCUS_11630 21168 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 22574 23221 gene locus_tag LOCUS_11640 22574 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 23221 24822 gene locus_tag LOCUS_11650 23221 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence031 111 1394 gene locus_tag LOCUS_11660 111 1394 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_11660 1594 2463 gene locus_tag LOCUS_11670 1594 2463 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_11670 2548 3087 gene locus_tag LOCUS_11680 gene folE 2548 3087 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 protein_id gnl|my_center|LOCUS_11680 3084 3812 gene locus_tag LOCUS_11690 3084 3812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312872.1 protein_id gnl|my_center|LOCUS_11690 3825 4187 gene locus_tag LOCUS_11700 gene folX 3825 4187 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_11700 4184 4576 gene locus_tag LOCUS_11710 gene folK 4184 4576 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156774.1 protein_id gnl|my_center|LOCUS_11710 4589 5095 gene locus_tag LOCUS_11720 4589 5095 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 protein_id gnl|my_center|LOCUS_11720 5206 5949 gene locus_tag LOCUS_11730 gene fabG 5206 5949 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_11730 5982 6218 gene locus_tag LOCUS_11740 gene acpP 5982 6218 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_11740 6325 7566 gene locus_tag LOCUS_11750 gene fabF 6325 7566 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_11750 7605 8660 gene locus_tag LOCUS_11760 7605 8660 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_11760 8708 9691 gene locus_tag LOCUS_11770 8708 9691 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_11770 9691 10434 gene locus_tag LOCUS_11780 gene truA 9691 10434 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_11780 10557 10994 gene locus_tag LOCUS_11790 gene rplM 10557 10994 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_11790 11022 11417 gene locus_tag LOCUS_11800 gene rpsI 11022 11417 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_11800 11576 12595 gene locus_tag LOCUS_11810 gene argC 11576 12595 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_11810 12592 13728 gene locus_tag LOCUS_11820 gene argJ 12592 13728 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_11820 13712 14566 gene locus_tag LOCUS_11830 gene argB 13712 14566 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_11830 14572 15759 gene locus_tag LOCUS_11840 14572 15759 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_11840 15756 16682 gene locus_tag LOCUS_11850 gene argF 15756 16682 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_11850 16699 17874 gene locus_tag LOCUS_11860 16699 17874 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 protein_id gnl|my_center|LOCUS_11860 17903 19279 gene locus_tag LOCUS_11870 gene argH 17903 19279 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_11870 19279 20553 gene locus_tag LOCUS_11880 gene lysA 19279 20553 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_11880 20555 21391 gene locus_tag LOCUS_11890 gene dapF 20555 21391 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_11890 21381 22265 gene locus_tag LOCUS_11900 gene dapA 21381 22265 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_11900 22272 22988 gene locus_tag LOCUS_11910 gene dapB 22272 22988 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926993.1 protein_id gnl|my_center|LOCUS_11910 23010 24215 gene locus_tag LOCUS_11920 23010 24215 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_11920 24226 24621 gene locus_tag LOCUS_11930 gene folK 24226 24621 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_11930 24652 25194 gene locus_tag LOCUS_11940 24652 25194 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_11940 25142 26257 gene locus_tag LOCUS_11950 gene dprA 25142 26257 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence032 413 90 gene locus_tag LOCUS_11960 413 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 903 433 gene locus_tag LOCUS_11970 903 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1748 903 gene locus_tag LOCUS_11980 1748 903 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582857.1 protein_id gnl|my_center|LOCUS_11980 2005 1853 gene locus_tag LOCUS_11990 2005 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3026 2079 gene locus_tag LOCUS_12000 3026 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3859 3023 gene locus_tag LOCUS_12010 3859 3023 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392930.1 protein_id gnl|my_center|LOCUS_12010 5248 3863 gene locus_tag LOCUS_12020 5248 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6279 5245 gene locus_tag LOCUS_12030 6279 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7453 6266 gene locus_tag LOCUS_12040 7453 6266 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_12040 9068 7473 gene locus_tag LOCUS_12050 9068 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 9253 9795 gene locus_tag LOCUS_12060 9253 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 10735 9812 gene locus_tag LOCUS_12070 10735 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 11649 10750 gene locus_tag LOCUS_12080 11649 10750 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 protein_id gnl|my_center|LOCUS_12080 12533 11646 gene locus_tag LOCUS_12090 gene mneP 12533 11646 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_12090 13343 12546 gene locus_tag LOCUS_12100 13343 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 13875 13429 gene locus_tag LOCUS_12110 13875 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 14732 13872 gene locus_tag LOCUS_12120 14732 13872 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582857.1 protein_id gnl|my_center|LOCUS_12120 14868 14737 gene locus_tag LOCUS_12130 14868 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 15221 14868 gene locus_tag LOCUS_12140 15221 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 15934 15218 gene locus_tag LOCUS_12150 15934 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 16607 16029 gene locus_tag LOCUS_12160 16607 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 16869 16663 gene locus_tag LOCUS_12170 16869 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 17985 16942 gene locus_tag LOCUS_12180 17985 16942 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_12180 19809 18007 gene locus_tag LOCUS_12190 19809 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 20609 19821 gene locus_tag LOCUS_12200 20609 19821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 21628 20822 gene locus_tag LOCUS_12210 21628 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 22566 21655 gene locus_tag LOCUS_12220 22566 21655 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869948.1 protein_id gnl|my_center|LOCUS_12220 23546 22653 gene locus_tag LOCUS_12230 23546 22653 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949089.1 protein_id gnl|my_center|LOCUS_12230 23811 23536 gene locus_tag LOCUS_12240 23811 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 25013 23808 gene locus_tag LOCUS_12250 25013 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 25288 25025 gene locus_tag LOCUS_12260 25288 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 25533 25309 gene locus_tag LOCUS_12270 25533 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence033 1 942 gene locus_tag LOCUS_12280 1 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 947 2185 gene locus_tag LOCUS_12290 947 2185 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_12290 2185 3939 gene locus_tag LOCUS_12300 2185 3939 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_12300 3958 5124 gene locus_tag LOCUS_12310 3958 5124 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830450.1 protein_id gnl|my_center|LOCUS_12310 5091 6437 gene locus_tag LOCUS_12320 5091 6437 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_12320 6789 9518 gene locus_tag LOCUS_12330 6789 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9766 11016 gene locus_tag LOCUS_12340 9766 11016 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_12340 11153 11557 gene locus_tag LOCUS_12350 11153 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 12482 12922 gene locus_tag LOCUS_12360 12482 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 12999 13116 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgtatgtgtcccgttttttt 13316 14569 gene locus_tag LOCUS_12370 13316 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14764 15276 gene locus_tag LOCUS_12380 14764 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 15285 16478 gene locus_tag LOCUS_12390 15285 16478 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_12390 16475 17392 gene locus_tag LOCUS_12400 16475 17392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 17389 18717 gene locus_tag LOCUS_12410 17389 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 18752 19150 gene locus_tag LOCUS_12420 18752 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 19251 19820 gene locus_tag LOCUS_12430 19251 19820 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_12430 19894 20436 gene locus_tag LOCUS_12440 19894 20436 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_12440 20459 21697 gene locus_tag LOCUS_12450 20459 21697 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_12450 21694 22023 gene locus_tag LOCUS_12460 21694 22023 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence034 1338 463 gene locus_tag LOCUS_12470 1338 463 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_12470 1943 1311 gene locus_tag LOCUS_12480 1943 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3893 2283 gene locus_tag LOCUS_12490 3893 2283 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082534.1 protein_id gnl|my_center|LOCUS_12490 4027 3890 gene locus_tag LOCUS_12500 4027 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6186 4189 gene locus_tag LOCUS_12510 6186 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6529 6176 gene locus_tag LOCUS_12520 6529 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7408 6674 gene locus_tag LOCUS_12530 7408 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 10468 7577 gene locus_tag LOCUS_12540 10468 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 10837 10762 gene locus_tag LOCUS_t00220 10837 10762 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12194 10923 gene locus_tag LOCUS_12550 12194 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 12821 12351 gene locus_tag LOCUS_12560 12821 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 13960 12818 gene locus_tag LOCUS_12570 13960 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 15349 13964 gene locus_tag LOCUS_12580 gene mshL 15349 13964 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_12580 15759 15346 gene locus_tag LOCUS_12590 15759 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 18235 15746 gene locus_tag LOCUS_12600 18235 15746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 18591 18235 gene locus_tag LOCUS_12610 18591 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 19696 18545 gene locus_tag LOCUS_12620 19696 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 20373 19693 gene locus_tag LOCUS_12630 20373 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 21031 20360 gene locus_tag LOCUS_12640 21031 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 21287 20991 gene locus_tag LOCUS_12650 21287 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 21588 21298 gene locus_tag LOCUS_12660 21588 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 22829 21585 gene locus_tag LOCUS_12670 22829 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 24189 22960 gene locus_tag LOCUS_12680 gene yegQ 24189 22960 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence035 173 889 gene locus_tag LOCUS_12690 173 889 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_12690 889 1767 gene locus_tag LOCUS_12700 889 1767 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_12700 1767 3566 gene locus_tag LOCUS_12710 1767 3566 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_12710 3584 7111 gene locus_tag LOCUS_12720 3584 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 5428 5527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7225 10602 gene locus_tag LOCUS_12730 7225 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 11482 11581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11639 13411 gene locus_tag LOCUS_12740 11639 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 13496 14173 gene locus_tag LOCUS_12750 13496 14173 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_12750 14170 15216 gene locus_tag LOCUS_12760 14170 15216 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176676.1 protein_id gnl|my_center|LOCUS_12760 15244 16605 gene locus_tag LOCUS_12770 15244 16605 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141831.1 protein_id gnl|my_center|LOCUS_12770 16605 17186 gene locus_tag LOCUS_12780 16605 17186 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_12780 17183 17572 gene locus_tag LOCUS_12790 gene crcB 17183 17572 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_12790 17551 18504 gene locus_tag LOCUS_12800 17551 18504 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_12800 18495 19247 gene locus_tag LOCUS_12810 18495 19247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_12810 19232 20041 gene locus_tag LOCUS_12820 19232 20041 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_12820 20238 22151 gene locus_tag LOCUS_12830 20238 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 22418 22570 gene locus_tag LOCUS_12840 22418 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 22642 22869 gene locus_tag LOCUS_12850 22642 22869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 22903 23244 gene locus_tag LOCUS_12860 22903 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 23288 23614 gene locus_tag LOCUS_12870 23288 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence036 179 1828 gene locus_tag LOCUS_12880 gene sulP 179 1828 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_12880 1877 2560 gene locus_tag LOCUS_12890 1877 2560 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_12890 2561 4372 gene locus_tag LOCUS_12900 2561 4372 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_12900 4369 5286 gene locus_tag LOCUS_12910 4369 5286 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_12910 5290 5943 gene locus_tag LOCUS_12920 5290 5943 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_12920 5943 7358 gene locus_tag LOCUS_12930 5943 7358 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_12930 7355 8866 gene locus_tag LOCUS_12940 7355 8866 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_12940 8876 9562 gene locus_tag LOCUS_12950 8876 9562 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_12950 9559 10656 gene locus_tag LOCUS_12960 9559 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10653 12071 gene locus_tag LOCUS_12970 10653 12071 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_12970 13594 12164 gene locus_tag LOCUS_12980 13594 12164 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_12980 14039 15265 gene locus_tag LOCUS_12990 14039 15265 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_12990 15360 15701 gene locus_tag LOCUS_13000 15360 15701 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_13000 15905 16672 gene locus_tag LOCUS_13010 15905 16672 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401225.1 protein_id gnl|my_center|LOCUS_13010 16728 16961 gene locus_tag LOCUS_13020 16728 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 16998 17516 gene locus_tag LOCUS_13030 16998 17516 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019758.1 protein_id gnl|my_center|LOCUS_13030 17494 18039 gene locus_tag LOCUS_13040 17494 18039 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931712.1 protein_id gnl|my_center|LOCUS_13040 18041 19564 gene locus_tag LOCUS_13050 gene atpA 18041 19564 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_13050 19569 20417 gene locus_tag LOCUS_13060 gene atpG 19569 20417 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_13060 20424 21827 gene locus_tag LOCUS_13070 gene atpD 20424 21827 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13070 21831 22115 gene locus_tag LOCUS_13080 21831 22115 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence037 371 60 gene locus_tag LOCUS_13090 371 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 814 1284 gene locus_tag LOCUS_13100 814 1284 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_13100 1296 1637 gene locus_tag LOCUS_13110 1296 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_13110 1652 3385 gene locus_tag LOCUS_13120 gene nuoF 1652 3385 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_13120 3419 5179 gene locus_tag LOCUS_13130 3419 5179 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13130 5295 5543 gene locus_tag LOCUS_13140 5295 5543 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545214.1 protein_id gnl|my_center|LOCUS_13140 5546 6919 gene locus_tag LOCUS_13150 5546 6919 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_13150 6916 7533 gene locus_tag LOCUS_13160 6916 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7517 8758 gene locus_tag LOCUS_13170 gene hydF 7517 8758 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_13170 8799 10298 gene locus_tag LOCUS_13180 gene hydG 8799 10298 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546878.1 protein_id gnl|my_center|LOCUS_13180 10356 10637 gene locus_tag LOCUS_13190 10356 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11085 11184 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11209 11775 gene locus_tag LOCUS_13200 11209 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11905 15594 gene locus_tag LOCUS_13210 11905 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13175 13274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15680 17014 gene locus_tag LOCUS_13220 15680 17014 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403840.1 protein_id gnl|my_center|LOCUS_13220 17287 18021 gene locus_tag LOCUS_13230 17287 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 18064 20193 gene locus_tag LOCUS_13240 18064 20193 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_13240 20160 20828 gene locus_tag LOCUS_13250 20160 20828 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_13250 20914 21528 gene locus_tag LOCUS_13260 gene azoR 20914 21528 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074045.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence038 142 297 gene locus_tag LOCUS_13270 142 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 300 872 gene locus_tag LOCUS_13280 300 872 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_13280 1076 10810 gene locus_tag LOCUS_13290 1076 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 10954 11493 gene locus_tag LOCUS_13300 10954 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 11474 13024 gene locus_tag LOCUS_13310 11474 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 13137 14723 gene locus_tag LOCUS_13320 13137 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 14787 15578 gene locus_tag LOCUS_13330 14787 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15725 16339 gene locus_tag LOCUS_13340 15725 16339 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_13340 16332 17312 gene locus_tag LOCUS_13350 16332 17312 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_13350 17405 17815 gene locus_tag LOCUS_13360 17405 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17855 18409 gene locus_tag LOCUS_13370 17855 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18551 19531 gene locus_tag LOCUS_13380 18551 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 19525 20286 gene locus_tag LOCUS_13390 19525 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence039 882 64 gene locus_tag LOCUS_13400 882 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1338 898 gene locus_tag LOCUS_13410 1338 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2168 1347 gene locus_tag LOCUS_13420 2168 1347 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_13420 2490 2146 gene locus_tag LOCUS_13430 2490 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2686 2483 gene locus_tag LOCUS_13440 2686 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2803 2902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4667 3294 gene locus_tag LOCUS_13450 4667 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5144 4755 gene locus_tag LOCUS_13460 5144 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6054 5149 gene locus_tag LOCUS_13470 6054 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7402 6008 gene locus_tag LOCUS_13480 gene mtaB 7402 6008 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_13480 7460 8422 gene locus_tag LOCUS_13490 gene dusB 7460 8422 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_13490 9053 8478 gene locus_tag LOCUS_13500 9053 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9658 9068 gene locus_tag LOCUS_13510 9658 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10002 9661 gene locus_tag LOCUS_13520 10002 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 10747 10079 gene locus_tag LOCUS_13530 10747 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11603 10740 gene locus_tag LOCUS_13540 gene nadC 11603 10740 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_13540 12218 11679 gene locus_tag LOCUS_13550 12218 11679 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949045.1 protein_id gnl|my_center|LOCUS_13550 13679 12807 gene locus_tag LOCUS_13560 gene dinD 13679 12807 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 protein_id gnl|my_center|LOCUS_13560 13846 13756 gene locus_tag LOCUS_t00230 13846 13756 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18095 14691 gene locus_tag LOCUS_13570 18095 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 18567 18283 gene locus_tag LOCUS_13580 18567 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 20186 18726 gene locus_tag LOCUS_13590 20186 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence040 756 1739 gene locus_tag LOCUS_13600 756 1739 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_13600 1714 2853 gene locus_tag LOCUS_13610 1714 2853 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_13610 2867 3889 gene locus_tag LOCUS_13620 gene neuB 2867 3889 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_13620 3886 5058 gene locus_tag LOCUS_13630 gene neuC 3886 5058 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_13630 5051 5725 gene locus_tag LOCUS_13640 5051 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5722 6795 gene locus_tag LOCUS_13650 5722 6795 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392278.1 protein_id gnl|my_center|LOCUS_13650 6800 7567 gene locus_tag LOCUS_13660 gene wbuZ 6800 7567 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_13660 7569 8231 gene locus_tag LOCUS_13670 gene hisH 7569 8231 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_13670 8218 9504 gene locus_tag LOCUS_13680 8218 9504 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_13680 9520 10446 gene locus_tag LOCUS_13690 9520 10446 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_13690 10439 11158 gene locus_tag LOCUS_13700 gene legF 10439 11158 CDS product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864263.1 protein_id gnl|my_center|LOCUS_13700 11155 11943 gene locus_tag LOCUS_13710 11155 11943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_13710 11945 13831 gene locus_tag LOCUS_13720 11945 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13846 15837 gene locus_tag LOCUS_13730 13846 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 15830 16561 gene locus_tag LOCUS_13740 15830 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16570 17391 gene locus_tag LOCUS_13750 16570 17391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 17406 18365 gene locus_tag LOCUS_13760 17406 18365 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_13760 18785 18531 gene locus_tag LOCUS_13770 18785 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence041 83 556 gene locus_tag LOCUS_13780 83 556 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_13780 559 1755 gene locus_tag LOCUS_13790 559 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1755 2561 gene locus_tag LOCUS_13800 1755 2561 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922116.1 protein_id gnl|my_center|LOCUS_13800 2641 3927 gene locus_tag LOCUS_13810 2641 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3943 5895 gene locus_tag LOCUS_13820 3943 5895 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_13820 6102 6353 gene locus_tag LOCUS_13830 6102 6353 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_13830 6425 6661 gene locus_tag LOCUS_13840 6425 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6662 7039 gene locus_tag LOCUS_13850 6662 7039 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388817.1 protein_id gnl|my_center|LOCUS_13850 7257 13280 gene locus_tag LOCUS_13860 7257 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 13417 13596 gene locus_tag LOCUS_13870 13417 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13897 15003 gene locus_tag LOCUS_13880 gene hemW 13897 15003 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170096.1 protein_id gnl|my_center|LOCUS_13880 15003 16034 gene locus_tag LOCUS_13890 15003 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 16031 16198 gene locus_tag LOCUS_13900 16031 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 16209 16607 gene locus_tag LOCUS_13910 16209 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 17743 16667 gene locus_tag LOCUS_13920 17743 16667 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_13920 17819 18517 gene locus_tag LOCUS_13930 17819 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence042 251 619 gene locus_tag LOCUS_13940 251 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 616 1059 gene locus_tag LOCUS_13950 616 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1059 2150 gene locus_tag LOCUS_13960 1059 2150 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_13960 2147 2803 gene locus_tag LOCUS_13970 2147 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3062 9751 gene locus_tag LOCUS_13980 3062 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 9748 10026 gene locus_tag LOCUS_13990 9748 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 10193 10576 gene locus_tag LOCUS_14000 10193 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 10626 12221 gene locus_tag LOCUS_14010 10626 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 12429 15551 gene locus_tag LOCUS_14020 12429 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 15566 18184 gene locus_tag LOCUS_14030 15566 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 19949 18174 gene locus_tag LOCUS_14040 gene recQ 19949 18174 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence043 2770 920 gene locus_tag LOCUS_14050 gene htpG 2770 920 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932510.1 protein_id gnl|my_center|LOCUS_14050 2969 3655 gene locus_tag LOCUS_14060 2969 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4036 3548 gene locus_tag LOCUS_14070 4036 3548 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871639.1 protein_id gnl|my_center|LOCUS_14070 5771 4002 gene locus_tag LOCUS_14080 gene pyk 5771 4002 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_14080 6781 6005 gene locus_tag LOCUS_14090 6781 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7599 6778 gene locus_tag LOCUS_14100 gene nudC 7599 6778 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966666.1 protein_id gnl|my_center|LOCUS_14100 8237 8491 gene locus_tag LOCUS_14110 8237 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 9313 8483 gene locus_tag LOCUS_14120 9313 8483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_14120 12386 9294 gene locus_tag LOCUS_14130 12386 9294 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471479.1 protein_id gnl|my_center|LOCUS_14130 14217 12763 gene locus_tag LOCUS_14140 14217 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 14491 14285 gene locus_tag LOCUS_14150 14491 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 15434 14385 gene locus_tag LOCUS_14160 15434 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 15896 15765 gene locus_tag LOCUS_14170 15896 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 16160 15957 gene locus_tag LOCUS_14180 16160 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 17147 16443 gene locus_tag LOCUS_14190 17147 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 17862 17284 gene locus_tag LOCUS_14200 17862 17284 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_14200 18162 18437 gene locus_tag LOCUS_14210 18162 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 18606 18932 gene locus_tag LOCUS_14220 18606 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 19305 19030 gene locus_tag LOCUS_14230 19305 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 19608 19318 gene locus_tag LOCUS_14240 19608 19318 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence044 1719 937 gene locus_tag LOCUS_14250 gene proC 1719 937 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_14250 2488 1802 gene locus_tag LOCUS_14260 2488 1802 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_14260 2876 2466 gene locus_tag LOCUS_14270 2876 2466 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_14270 5719 2924 gene locus_tag LOCUS_14280 5719 2924 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842727.1 protein_id gnl|my_center|LOCUS_14280 8783 5697 gene locus_tag LOCUS_14290 8783 5697 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939340.1 protein_id gnl|my_center|LOCUS_14290 9538 8780 gene locus_tag LOCUS_14300 9538 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 9966 9589 gene locus_tag LOCUS_14310 9966 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 10936 10085 gene locus_tag LOCUS_14320 10936 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 11233 10940 gene locus_tag LOCUS_14330 11233 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 11858 11226 gene locus_tag LOCUS_14340 11858 11226 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_14340 12238 11855 gene locus_tag LOCUS_14350 12238 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 12922 12326 gene locus_tag LOCUS_14360 12922 12326 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_14360 14467 13073 gene locus_tag LOCUS_14370 14467 13073 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_14370 14809 14471 gene locus_tag LOCUS_14380 14809 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 15888 14860 gene locus_tag LOCUS_14390 15888 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence045 320 114 gene locus_tag LOCUS_14400 320 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1779 358 gene locus_tag LOCUS_14410 gene scfB 1779 358 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462310.1 protein_id gnl|my_center|LOCUS_14410 2289 1789 gene locus_tag LOCUS_14420 2289 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2708 2286 gene locus_tag LOCUS_14430 2708 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3149 2775 gene locus_tag LOCUS_14440 3149 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3541 3155 gene locus_tag LOCUS_14450 3541 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5381 3720 gene locus_tag LOCUS_14460 gene hcp 5381 3720 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_14460 6235 5402 gene locus_tag LOCUS_14470 6235 5402 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_14470 6639 6289 gene locus_tag LOCUS_14480 6639 6289 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081895.1 protein_id gnl|my_center|LOCUS_14480 7151 6792 gene locus_tag LOCUS_14490 7151 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 9293 7185 gene locus_tag LOCUS_14500 9293 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 10627 9302 gene locus_tag LOCUS_14510 10627 9302 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_14510 11019 10627 gene locus_tag LOCUS_14520 11019 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11551 11117 gene locus_tag LOCUS_14530 11551 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12772 11591 gene locus_tag LOCUS_14540 12772 11591 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_14540 14229 12784 gene locus_tag LOCUS_14550 14229 12784 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_14550 15063 14374 gene locus_tag LOCUS_14560 15063 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 16042 15077 gene locus_tag LOCUS_14570 16042 15077 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393683.1 protein_id gnl|my_center|LOCUS_14570 16182 16033 gene locus_tag LOCUS_14580 16182 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 16231 16303 gene locus_tag LOCUS_t00240 16231 16303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16936 16319 gene locus_tag LOCUS_14590 16936 16319 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_14590 18630 17014 gene locus_tag LOCUS_14600 18630 17014 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence046 910 1827 gene locus_tag LOCUS_14610 910 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1906 2709 gene locus_tag LOCUS_14620 1906 2709 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957897.1 protein_id gnl|my_center|LOCUS_14620 2706 3815 gene locus_tag LOCUS_14630 gene ahbD 2706 3815 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_14630 3805 4668 gene locus_tag LOCUS_14640 3805 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4692 5720 gene locus_tag LOCUS_14650 4692 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5724 7244 gene locus_tag LOCUS_14660 5724 7244 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_14660 7237 8076 gene locus_tag LOCUS_14670 7237 8076 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_14670 8096 9028 gene locus_tag LOCUS_14680 8096 9028 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_14680 9047 9832 gene locus_tag LOCUS_14690 9047 9832 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_14690 9843 10550 gene locus_tag LOCUS_14700 9843 10550 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_14700 10552 11532 gene locus_tag LOCUS_14710 10552 11532 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688109.1 protein_id gnl|my_center|LOCUS_14710 11522 13048 gene locus_tag LOCUS_14720 11522 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 14873 15946 gene locus_tag LOCUS_14730 14873 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 16051 17448 gene locus_tag LOCUS_14740 16051 17448 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_14740 17619 18509 gene locus_tag LOCUS_14750 17619 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence047 92 1759 gene locus_tag LOCUS_14760 gene groL 92 1759 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029966.1 protein_id gnl|my_center|LOCUS_14760 1925 4924 gene locus_tag LOCUS_14770 1925 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4917 9044 gene locus_tag LOCUS_14780 4917 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 9358 11094 gene locus_tag LOCUS_14790 gene guaA 9358 11094 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence048 480 1043 gene locus_tag LOCUS_14800 480 1043 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128393.1 protein_id gnl|my_center|LOCUS_14800 1045 2100 gene locus_tag LOCUS_14810 1045 2100 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_14810 2186 4636 gene locus_tag LOCUS_14820 2186 4636 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_14820 4633 5637 gene locus_tag LOCUS_14830 4633 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5639 6439 gene locus_tag LOCUS_14840 5639 6439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_14840 6436 7209 gene locus_tag LOCUS_14850 6436 7209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_14850 7219 8007 gene locus_tag LOCUS_14860 7219 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8008 9393 gene locus_tag LOCUS_14870 gene radA 8008 9393 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_14870 9394 10374 gene locus_tag LOCUS_14880 9394 10374 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_14880 10379 11059 gene locus_tag LOCUS_14890 gene ispD 10379 11059 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_14890 11056 11568 gene locus_tag LOCUS_14900 gene ispF 11056 11568 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_14900 11582 12244 gene locus_tag LOCUS_14910 gene cysE 11582 12244 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_14910 12241 13644 gene locus_tag LOCUS_14920 gene cysS 12241 13644 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_14920 13646 13891 gene locus_tag LOCUS_14930 13646 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 13895 14512 gene locus_tag LOCUS_14940 gene tmk 13895 14512 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775041.1 protein_id gnl|my_center|LOCUS_14940 14512 15474 gene locus_tag LOCUS_14950 gene holB 14512 15474 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_14950 15483 16289 gene locus_tag LOCUS_14960 15483 16289 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence049 699 109 gene locus_tag LOCUS_14970 699 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2069 696 gene locus_tag LOCUS_14980 2069 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2313 2092 gene locus_tag LOCUS_14990 2313 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2497 2327 gene locus_tag LOCUS_15000 2497 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2942 2523 gene locus_tag LOCUS_15010 2942 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4267 3383 gene locus_tag LOCUS_15020 4267 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5262 4495 gene locus_tag LOCUS_15030 5262 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5594 5262 gene locus_tag LOCUS_15040 5594 5262 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_15040 7504 5609 gene locus_tag LOCUS_15050 7504 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8617 7547 gene locus_tag LOCUS_15060 8617 7547 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510777.1 protein_id gnl|my_center|LOCUS_15060 9438 8614 gene locus_tag LOCUS_15070 gene cysW 9438 8614 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_15070 10278 9442 gene locus_tag LOCUS_15080 gene cysT 10278 9442 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_15080 10572 10384 gene locus_tag LOCUS_15090 10572 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 12683 10575 gene locus_tag LOCUS_15100 gene feoB 12683 10575 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_15100 12916 12680 gene locus_tag LOCUS_15110 12916 12680 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943881.1 protein_id gnl|my_center|LOCUS_15110 13474 12986 gene locus_tag LOCUS_15120 13474 12986 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_15120 14226 13561 gene locus_tag LOCUS_15130 gene phoU 14226 13561 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_15130 14995 14234 gene locus_tag LOCUS_15140 gene pstB 14995 14234 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_15140 15857 14985 gene locus_tag LOCUS_15150 gene pstA 15857 14985 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_15150 16783 15854 gene locus_tag LOCUS_15160 gene pstC 16783 15854 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_15160 17647 16823 gene locus_tag LOCUS_15170 17647 16823 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence050 230 637 gene locus_tag LOCUS_15180 230 637 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_15180 809 1534 gene locus_tag LOCUS_15190 809 1534 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_15190 1531 1770 gene locus_tag LOCUS_15200 1531 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2143 3033 gene locus_tag LOCUS_15210 2143 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3060 3659 gene locus_tag LOCUS_15220 3060 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3701 3865 gene locus_tag LOCUS_15230 3701 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3912 5288 gene locus_tag LOCUS_15240 3912 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5288 6145 gene locus_tag LOCUS_15250 gene purU 5288 6145 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_15250 6150 7592 gene locus_tag LOCUS_15260 6150 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7856 11425 gene locus_tag LOCUS_15270 gene nifJ 7856 11425 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_15270 11487 13574 gene locus_tag LOCUS_15280 11487 13574 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15280 13594 14127 gene locus_tag LOCUS_15290 13594 14127 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_15290 14198 16684 gene locus_tag LOCUS_15300 14198 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 17140 16685 gene locus_tag LOCUS_15310 17140 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence051 1873 764 gene locus_tag LOCUS_15320 1873 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2825 1890 gene locus_tag LOCUS_15330 2825 1890 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_15330 4368 2839 gene locus_tag LOCUS_15340 4368 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5315 4368 gene locus_tag LOCUS_15350 5315 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6570 5449 gene locus_tag LOCUS_15360 6570 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 8650 6593 gene locus_tag LOCUS_15370 8650 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 9459 8647 gene locus_tag LOCUS_15380 9459 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10482 9469 gene locus_tag LOCUS_15390 10482 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11567 10491 gene locus_tag LOCUS_15400 11567 10491 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940262.1 protein_id gnl|my_center|LOCUS_15400 13220 11622 gene locus_tag LOCUS_15410 13220 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 14623 13274 gene locus_tag LOCUS_15420 14623 13274 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_15420 15708 14650 gene locus_tag LOCUS_15430 15708 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 16714 15689 gene locus_tag LOCUS_15440 16714 15689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence052 34 1299 gene locus_tag LOCUS_15450 34 1299 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_15450 1309 2169 gene locus_tag LOCUS_15460 gene accD 1309 2169 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_15460 2252 3790 gene locus_tag LOCUS_15470 2252 3790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_15470 3807 4745 gene locus_tag LOCUS_15480 3807 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4752 5855 gene locus_tag LOCUS_15490 gene ugpC 4752 5855 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_15490 5824 7125 gene locus_tag LOCUS_15500 5824 7125 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_15500 7146 8171 gene locus_tag LOCUS_15510 7146 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15510 8266 9192 gene locus_tag LOCUS_15520 8266 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 9212 11359 gene locus_tag LOCUS_15530 9212 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11381 12706 gene locus_tag LOCUS_15540 11381 12706 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_15540 12699 14000 gene locus_tag LOCUS_15550 12699 14000 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_15550 14014 14955 gene locus_tag LOCUS_15560 14014 14955 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_15560 14957 15574 gene locus_tag LOCUS_15570 14957 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 15747 16283 gene locus_tag LOCUS_15580 15747 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence053 265 71 gene locus_tag LOCUS_15590 265 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1172 342 gene locus_tag LOCUS_15600 gene lpxI 1172 342 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_15600 2005 1172 gene locus_tag LOCUS_15610 gene lpxA 2005 1172 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_15610 3302 1989 gene locus_tag LOCUS_15620 3302 1989 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_15620 4342 3302 gene locus_tag LOCUS_15630 gene lpxD 4342 3302 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_15630 4867 4349 gene locus_tag LOCUS_15640 4867 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7387 4958 gene locus_tag LOCUS_15650 gene bamA 7387 4958 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_15650 8774 7437 gene locus_tag LOCUS_15660 gene dnaB 8774 7437 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_15660 9199 8756 gene locus_tag LOCUS_15670 gene rplI 9199 8756 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_15670 9505 9203 gene locus_tag LOCUS_15680 9505 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 10015 9569 gene locus_tag LOCUS_15690 10015 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 10367 10059 gene locus_tag LOCUS_15700 10367 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 10956 10354 gene locus_tag LOCUS_15710 gene pth 10956 10354 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_15710 11712 10972 gene locus_tag LOCUS_15720 11712 10972 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_15720 12718 11768 gene locus_tag LOCUS_15730 12718 11768 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_15730 13980 12724 gene locus_tag LOCUS_15740 gene glmU 13980 12724 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_15740 14191 15666 gene locus_tag LOCUS_15750 14191 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 <16207 15629 gene locus_tag LOCUS_15760 <16207 15629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014331956.1:polysaccharide deacetylase family protein >Feature sequence054 641 33 gene locus_tag LOCUS_15770 641 33 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_15770 1354 641 gene locus_tag LOCUS_15780 gene rph 1354 641 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313989.1 protein_id gnl|my_center|LOCUS_15780 1524 1351 gene locus_tag LOCUS_15790 1524 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1712 1811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3554 2466 gene locus_tag LOCUS_15800 3554 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3108 3207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4356 3547 gene locus_tag LOCUS_15810 gene murI 4356 3547 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_15810 5377 4340 gene locus_tag LOCUS_15820 5377 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6572 5379 gene locus_tag LOCUS_15830 6572 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8496 6664 gene locus_tag LOCUS_15840 gene mutL 8496 6664 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974632.1 protein_id gnl|my_center|LOCUS_15840 11050 8489 gene locus_tag LOCUS_15850 gene mutS 11050 8489 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_15850 11632 11093 gene locus_tag LOCUS_15860 11632 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 12811 11645 gene locus_tag LOCUS_15870 12811 11645 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940226.1 protein_id gnl|my_center|LOCUS_15870 16026 12841 gene locus_tag LOCUS_15880 16026 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15880 >Feature sequence055 356 1402 gene locus_tag LOCUS_15890 356 1402 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 protein_id gnl|my_center|LOCUS_15890 1616 1990 gene locus_tag LOCUS_15900 1616 1990 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_15900 2204 2303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2419 3021 gene locus_tag LOCUS_15910 2419 3021 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_15910 3100 3618 gene locus_tag LOCUS_15920 gene cobU 3100 3618 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_15920 3634 4689 gene locus_tag LOCUS_15930 gene cobT 3634 4689 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_15930 4819 5466 gene locus_tag LOCUS_15940 gene cobS 4819 5466 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_15940 5463 6296 gene locus_tag LOCUS_15950 gene btuF 5463 6296 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960255.1 protein_id gnl|my_center|LOCUS_15950 6293 7282 gene locus_tag LOCUS_15960 6293 7282 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_15960 7282 8082 gene locus_tag LOCUS_15970 7282 8082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_15970 8328 10343 gene locus_tag LOCUS_15980 8328 10343 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_15980 10706 11152 gene locus_tag LOCUS_15990 10706 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11277 15590 gene locus_tag LOCUS_16000 11277 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence056 <1 953 gene locus_tag LOCUS_16010 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064511.1:radical SAM protein 970 2031 gene locus_tag LOCUS_16020 970 2031 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_16020 2280 4160 gene locus_tag LOCUS_16030 2280 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 4185 6077 gene locus_tag LOCUS_16040 4185 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 6131 7567 gene locus_tag LOCUS_16050 6131 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7569 9389 gene locus_tag LOCUS_16060 7569 9389 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_16060 9391 9789 gene locus_tag LOCUS_16070 9391 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 9803 9961 gene locus_tag LOCUS_16080 9803 9961 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_16080 10015 11553 gene locus_tag LOCUS_16090 10015 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11590 13074 gene locus_tag LOCUS_16100 11590 13074 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_16100 13064 14548 gene locus_tag LOCUS_16110 13064 14548 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_16110 14538 15704 gene locus_tag LOCUS_16120 14538 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence057 3629 6 gene locus_tag LOCUS_16130 3629 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4522 4217 gene locus_tag LOCUS_16140 4522 4217 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_16140 4829 4503 gene locus_tag LOCUS_16150 4829 4503 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_16150 5761 5144 gene locus_tag LOCUS_16160 5761 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6499 5819 gene locus_tag LOCUS_16170 6499 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7312 6512 gene locus_tag LOCUS_16180 7312 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887787.1 protein_id gnl|my_center|LOCUS_16180 8473 7742 gene locus_tag LOCUS_16190 8473 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8705 8804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10406 8844 gene locus_tag LOCUS_16200 10406 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11076 10513 gene locus_tag LOCUS_16210 11076 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 11431 11264 gene locus_tag LOCUS_16220 11431 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 12396 11428 gene locus_tag LOCUS_16230 12396 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 12877 12410 gene locus_tag LOCUS_16240 12877 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 14120 13137 gene locus_tag LOCUS_16250 14120 13137 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_16250 14914 14273 gene locus_tag LOCUS_16260 14914 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 15185 14901 gene locus_tag LOCUS_16270 15185 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence058 <1 855 gene locus_tag LOCUS_16280 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937401.1:GDP-L-fucose synthase 840 2234 gene locus_tag LOCUS_16290 840 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2280 3212 gene locus_tag LOCUS_16300 2280 3212 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_16300 3216 5534 gene locus_tag LOCUS_16310 3216 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 4403 4502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5429 6229 gene locus_tag LOCUS_16320 5429 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6243 7241 gene locus_tag LOCUS_16330 6243 7241 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_16330 7238 7939 gene locus_tag LOCUS_16340 7238 7939 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_16340 7936 9105 gene locus_tag LOCUS_16350 gene per 7936 9105 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_16350 9119 10897 gene locus_tag LOCUS_16360 gene msbA 9119 10897 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_16360 10955 11911 gene locus_tag LOCUS_16370 gene waaF 10955 11911 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16370 11970 13085 gene locus_tag LOCUS_16380 11970 13085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_16380 13134 13910 gene locus_tag LOCUS_16390 13134 13910 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695696.1 protein_id gnl|my_center|LOCUS_16390 13925 15349 gene locus_tag LOCUS_16400 13925 15349 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence059 110 829 gene locus_tag LOCUS_16410 110 829 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_16410 826 2421 gene locus_tag LOCUS_16420 826 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2421 3449 gene locus_tag LOCUS_16430 2421 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3455 4186 gene locus_tag LOCUS_16440 3455 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4227 5540 gene locus_tag LOCUS_16450 4227 5540 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546536.1 protein_id gnl|my_center|LOCUS_16450 5565 5993 gene locus_tag LOCUS_16460 5565 5993 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_16460 6038 6853 gene locus_tag LOCUS_16470 6038 6853 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_16470 6858 7400 gene locus_tag LOCUS_16480 6858 7400 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_16480 7676 8851 gene locus_tag LOCUS_16490 7676 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 8971 10449 gene locus_tag LOCUS_16500 gene malQ 8971 10449 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_16500 10458 11000 gene locus_tag LOCUS_16510 10458 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 10942 11979 gene locus_tag LOCUS_16520 gene rfaD 10942 11979 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_16520 11991 13106 gene locus_tag LOCUS_16530 11991 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 13160 13594 gene locus_tag LOCUS_16540 13160 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 13736 13969 gene locus_tag LOCUS_16550 13736 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence060 903 445 gene locus_tag LOCUS_16560 903 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1547 912 gene locus_tag LOCUS_16570 1547 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3174 1531 gene locus_tag LOCUS_16580 3174 1531 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_16580 4695 3190 gene locus_tag LOCUS_16590 4695 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5177 4692 gene locus_tag LOCUS_16600 5177 4692 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_16600 6249 5182 gene locus_tag LOCUS_16610 gene cheB 6249 5182 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_16610 8579 6258 gene locus_tag LOCUS_16620 8579 6258 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 protein_id gnl|my_center|LOCUS_16620 10040 8607 gene locus_tag LOCUS_16630 10040 8607 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941693.1 protein_id gnl|my_center|LOCUS_16630 10692 10093 gene locus_tag LOCUS_16640 10692 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12636 10738 gene locus_tag LOCUS_16650 12636 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 14691 12667 gene locus_tag LOCUS_16660 gene cirA 14691 12667 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence061 >Feature sequence062 18 458 gene locus_tag LOCUS_16670 18 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 471 845 gene locus_tag LOCUS_16680 471 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 859 1038 gene locus_tag LOCUS_16690 859 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1031 1735 gene locus_tag LOCUS_16700 1031 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1806 2108 gene locus_tag LOCUS_16710 1806 2108 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965233.1 protein_id gnl|my_center|LOCUS_16710 2196 4241 gene locus_tag LOCUS_16720 gene uvrB 2196 4241 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_16720 4238 4852 gene locus_tag LOCUS_16730 4238 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4879 4978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5289 5215 gene locus_tag LOCUS_t00250 5289 5215 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5325 6344 gene locus_tag LOCUS_16740 5325 6344 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_16740 6525 13424 gene locus_tag LOCUS_16750 6525 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 13504 14253 gene locus_tag LOCUS_16760 13504 14253 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_16760 14480 14770 gene locus_tag LOCUS_16770 gene groES 14480 14770 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence063 360 638 gene locus_tag LOCUS_16780 360 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 808 978 gene locus_tag LOCUS_16790 808 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1596 2717 gene locus_tag LOCUS_16800 1596 2717 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_16800 2762 3547 gene locus_tag LOCUS_16810 gene rfbF 2762 3547 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_16810 3529 4605 gene locus_tag LOCUS_16820 gene rfbG 3529 4605 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_16820 4607 5056 gene locus_tag LOCUS_16830 4607 5056 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_16830 5092 6015 gene locus_tag LOCUS_16840 5092 6015 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601375.1 protein_id gnl|my_center|LOCUS_16840 6012 6905 gene locus_tag LOCUS_16850 6012 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6961 7992 gene locus_tag LOCUS_16860 gene pseB 6961 7992 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_16860 7996 9456 gene locus_tag LOCUS_16870 7996 9456 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093056.1 protein_id gnl|my_center|LOCUS_16870 9490 10905 gene locus_tag LOCUS_16880 9490 10905 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_16880 10916 11935 gene locus_tag LOCUS_16890 10916 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12080 14224 gene locus_tag LOCUS_16900 12080 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence064 233 1408 gene locus_tag LOCUS_16910 gene mnmA 233 1408 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_16910 1422 2117 gene locus_tag LOCUS_16920 1422 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2157 3431 gene locus_tag LOCUS_16930 2157 3431 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_16930 4592 3522 gene locus_tag LOCUS_16940 4592 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4963 5190 gene locus_tag LOCUS_16950 4963 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5637 5768 gene locus_tag LOCUS_16960 5637 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5897 6301 gene locus_tag LOCUS_16970 5897 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6249 6575 gene locus_tag LOCUS_16980 6249 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6594 6959 gene locus_tag LOCUS_16990 6594 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6970 8016 gene locus_tag LOCUS_17000 6970 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8062 8772 gene locus_tag LOCUS_17010 8062 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8777 9094 gene locus_tag LOCUS_17020 gene cutA 8777 9094 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_17020 10553 9084 gene locus_tag LOCUS_17030 10553 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 10721 10948 gene locus_tag LOCUS_17040 10721 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10945 11304 gene locus_tag LOCUS_17050 10945 11304 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_17050 11400 12275 gene locus_tag LOCUS_17060 gene hisG 11400 12275 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_17060 12415 13377 gene locus_tag LOCUS_17070 12415 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13352 14260 gene locus_tag LOCUS_17080 gene ispE 13352 14260 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_17080 14271 14342 gene locus_tag LOCUS_t00260 14271 14342 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 781 960 gene locus_tag LOCUS_17090 781 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1294 1473 gene locus_tag LOCUS_17100 1294 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1430 2692 gene locus_tag LOCUS_17110 1430 2692 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_17110 4349 2712 gene locus_tag LOCUS_17120 4349 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5336 4527 gene locus_tag LOCUS_17130 5336 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5820 5347 gene locus_tag LOCUS_17140 5820 5347 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870031.1 protein_id gnl|my_center|LOCUS_17140 7757 5817 gene locus_tag LOCUS_17150 7757 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 9340 7754 gene locus_tag LOCUS_17160 9340 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 9689 9342 gene locus_tag LOCUS_17170 9689 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10817 9714 gene locus_tag LOCUS_17180 10817 9714 CDS product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924577.1 protein_id gnl|my_center|LOCUS_17180 11172 10882 gene locus_tag LOCUS_17190 11172 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 11688 11467 gene locus_tag LOCUS_17200 11688 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 12258 12079 gene locus_tag LOCUS_17210 12258 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 12796 13071 gene locus_tag LOCUS_17220 12796 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 13199 14038 gene locus_tag LOCUS_17230 13199 14038 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563806.1 protein_id gnl|my_center|LOCUS_17230 14191 14069 gene locus_tag LOCUS_17240 14191 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 14428 14306 gene locus_tag LOCUS_17250 14428 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence066 617 459 gene locus_tag LOCUS_17260 617 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 685 1458 gene locus_tag LOCUS_17270 685 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2689 1445 gene locus_tag LOCUS_17280 2689 1445 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170096.1 protein_id gnl|my_center|LOCUS_17280 4382 2721 gene locus_tag LOCUS_17290 4382 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5533 4388 gene locus_tag LOCUS_17300 5533 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 6455 5565 gene locus_tag LOCUS_17310 6455 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 6351 6638 gene locus_tag LOCUS_17320 6351 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6805 7593 gene locus_tag LOCUS_17330 6805 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 7583 8668 gene locus_tag LOCUS_17340 7583 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 9826 8693 gene locus_tag LOCUS_17350 9826 8693 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_17350 10834 9830 gene locus_tag LOCUS_17360 10834 9830 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_17360 11799 10834 gene locus_tag LOCUS_17370 gene pdhA 11799 10834 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_17370 13069 11864 gene locus_tag LOCUS_17380 13069 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 14249 13071 gene locus_tag LOCUS_17390 14249 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence067 129 1274 gene locus_tag LOCUS_17400 129 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1279 2355 gene locus_tag LOCUS_17410 1279 2355 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_17410 2441 3538 gene locus_tag LOCUS_17420 2441 3538 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_17420 3644 4423 gene locus_tag LOCUS_17430 3644 4423 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_17430 4420 5019 gene locus_tag LOCUS_17440 gene gmhB 4420 5019 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_17440 4940 6055 gene locus_tag LOCUS_17450 4940 6055 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_17450 6076 7755 gene locus_tag LOCUS_17460 gene priA 6076 7755 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000641110.1 protein_id gnl|my_center|LOCUS_17460 7752 8687 gene locus_tag LOCUS_17470 gene fmt 7752 8687 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_17470 8684 10198 gene locus_tag LOCUS_17480 8684 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 10188 10931 gene locus_tag LOCUS_17490 10188 10931 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_17490 10928 13126 gene locus_tag LOCUS_17500 10928 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 13105 13794 gene locus_tag LOCUS_17510 13105 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence068 95 370 gene locus_tag LOCUS_17520 95 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2102 417 gene locus_tag LOCUS_17530 gene recJ 2102 417 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_17530 3837 2158 gene locus_tag LOCUS_17540 gene argS 3837 2158 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_17540 4280 3840 gene locus_tag LOCUS_17550 gene rsfS 4280 3840 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674576.1 protein_id gnl|my_center|LOCUS_17550 4451 4281 gene locus_tag LOCUS_17560 4451 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5877 4612 gene locus_tag LOCUS_17570 5877 4612 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_17570 6680 5889 gene locus_tag LOCUS_17580 gene trpA 6680 5889 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_17580 7861 6677 gene locus_tag LOCUS_17590 gene trpB 7861 6677 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_17590 8565 7858 gene locus_tag LOCUS_17600 8565 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 9694 8552 gene locus_tag LOCUS_17610 9694 8552 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_17610 10003 9701 gene locus_tag LOCUS_17620 10003 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 10160 10375 gene locus_tag LOCUS_17630 10160 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 13582 10778 gene locus_tag LOCUS_17640 13582 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence069 2933 1239 gene locus_tag LOCUS_17650 gene mrdA 2933 1239 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869951.1 protein_id gnl|my_center|LOCUS_17650 3447 3055 gene locus_tag LOCUS_17660 3447 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3575 3674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5509 4436 gene locus_tag LOCUS_17670 5509 4436 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_17670 5558 5657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7014 5785 gene locus_tag LOCUS_17680 gene aroA 7014 5785 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 protein_id gnl|my_center|LOCUS_17680 7989 7132 gene locus_tag LOCUS_17690 7989 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 9003 8098 gene locus_tag LOCUS_17700 9003 8098 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_17700 9743 9015 gene locus_tag LOCUS_17710 gene lgt 9743 9015 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922849.1 protein_id gnl|my_center|LOCUS_17710 10301 9798 gene locus_tag LOCUS_17720 gene lspA 10301 9798 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_17720 10713 10327 gene locus_tag LOCUS_17730 10713 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 13559 10740 gene locus_tag LOCUS_17740 gene ileS 13559 10740 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence070 >Feature sequence071 5478 5577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5743 7476 gene locus_tag LOCUS_17750 gene thrS 5743 7476 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_17750 7597 8064 gene locus_tag LOCUS_17760 gene infC 7597 8064 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_17760 8082 8279 gene locus_tag LOCUS_17770 gene rpmI 8082 8279 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125262.1 protein_id gnl|my_center|LOCUS_17770 8272 8661 gene locus_tag LOCUS_17780 gene rplT 8272 8661 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_17780 8752 9765 gene locus_tag LOCUS_17790 gene pheS 8752 9765 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_17790 9854 11953 gene locus_tag LOCUS_17800 gene pheT 9854 11953 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_17800 12175 12666 gene locus_tag LOCUS_17810 12175 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 12818 13090 gene locus_tag LOCUS_17820 12818 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 13083 13343 gene locus_tag LOCUS_17830 13083 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence072 1268 90 gene locus_tag LOCUS_17840 1268 90 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_17840 2329 1268 gene locus_tag LOCUS_17850 2329 1268 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_17850 3108 2380 gene locus_tag LOCUS_17860 3108 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4914 3121 gene locus_tag LOCUS_17870 4914 3121 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_17870 5279 4929 gene locus_tag LOCUS_17880 5279 4929 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405144.1 protein_id gnl|my_center|LOCUS_17880 7225 5276 gene locus_tag LOCUS_17890 7225 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 7835 7335 gene locus_tag LOCUS_17900 7835 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 8676 7897 gene locus_tag LOCUS_17910 gene rlmB 8676 7897 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_17910 9398 8673 gene locus_tag LOCUS_17920 9398 8673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061211.1 protein_id gnl|my_center|LOCUS_17920 9898 9395 gene locus_tag LOCUS_17930 9898 9395 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_17930 10911 9895 gene locus_tag LOCUS_17940 10911 9895 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_17940 10910 11092 gene locus_tag LOCUS_17950 10910 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 13027 11075 gene locus_tag LOCUS_17960 13027 11075 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence073 457 2154 gene locus_tag LOCUS_17970 457 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2151 3890 gene locus_tag LOCUS_17980 2151 3890 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_17980 3896 4144 gene locus_tag LOCUS_17990 3896 4144 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_17990 4141 4536 gene locus_tag LOCUS_18000 4141 4536 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_18000 4533 6002 gene locus_tag LOCUS_18010 4533 6002 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_18010 6039 7169 gene locus_tag LOCUS_18020 6039 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 7365 8012 gene locus_tag LOCUS_18030 7365 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 8015 8482 gene locus_tag LOCUS_18040 8015 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 8504 8923 gene locus_tag LOCUS_18050 8504 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9501 8896 gene locus_tag LOCUS_18060 9501 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9740 9546 gene locus_tag LOCUS_18070 9740 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9840 10067 gene locus_tag LOCUS_18080 9840 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10120 10734 gene locus_tag LOCUS_18090 10120 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10756 10977 gene locus_tag LOCUS_18100 10756 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 11047 11119 gene locus_tag LOCUS_t00270 11047 11119 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 828 664 gene locus_tag LOCUS_18110 828 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1165 1413 gene locus_tag LOCUS_18120 1165 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2337 1351 gene locus_tag LOCUS_18130 2337 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3533 2346 gene locus_tag LOCUS_18140 gene paaF 3533 2346 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038746825.1 protein_id gnl|my_center|LOCUS_18140 4878 3550 gene locus_tag LOCUS_18150 4878 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5844 4948 gene locus_tag LOCUS_18160 5844 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 7993 9207 gene locus_tag LOCUS_18170 7993 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 9232 10329 gene locus_tag LOCUS_18180 9232 10329 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_18180 11504 10317 gene locus_tag LOCUS_18190 11504 10317 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170096.1 protein_id gnl|my_center|LOCUS_18190 12772 11561 gene locus_tag LOCUS_18200 12772 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence075 64 552 gene locus_tag LOCUS_18210 64 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 813 1718 gene locus_tag LOCUS_18220 813 1718 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_18220 2018 5188 gene locus_tag LOCUS_18230 2018 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 5185 6144 gene locus_tag LOCUS_18240 5185 6144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_18240 6157 7782 gene locus_tag LOCUS_18250 6157 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 7775 9367 gene locus_tag LOCUS_18260 7775 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9377 10549 gene locus_tag LOCUS_18270 9377 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 10546 11379 gene locus_tag LOCUS_18280 10546 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 11382 12548 gene locus_tag LOCUS_18290 11382 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence076 106 333 gene locus_tag LOCUS_18300 106 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 339 791 gene locus_tag LOCUS_18310 339 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18310 1020 1382 gene locus_tag LOCUS_18320 1020 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1695 2309 gene locus_tag LOCUS_18330 1695 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2334 3074 gene locus_tag LOCUS_18340 2334 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3180 3368 gene locus_tag LOCUS_18350 3180 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3401 3928 gene locus_tag LOCUS_18360 3401 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4046 4375 gene locus_tag LOCUS_18370 4046 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4474 5070 gene locus_tag LOCUS_18380 4474 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5094 5519 gene locus_tag LOCUS_18390 5094 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5741 6376 gene locus_tag LOCUS_18400 5741 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 6447 7184 gene locus_tag LOCUS_18410 6447 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 7278 7805 gene locus_tag LOCUS_18420 7278 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 7823 8431 gene locus_tag LOCUS_18430 7823 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8506 8991 gene locus_tag LOCUS_18440 8506 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 9629 9883 gene locus_tag LOCUS_18450 9629 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 10126 11052 gene locus_tag LOCUS_18460 10126 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 11141 11707 gene locus_tag LOCUS_18470 11141 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 11767 12234 gene locus_tag LOCUS_18480 11767 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence077 889 734 gene locus_tag LOCUS_18490 889 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2915 1005 gene locus_tag LOCUS_18500 2915 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3955 3140 gene locus_tag LOCUS_18510 3955 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4914 3985 gene locus_tag LOCUS_18520 4914 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 6132 4972 gene locus_tag LOCUS_18530 6132 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 7048 6395 gene locus_tag LOCUS_18540 7048 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 9400 7049 gene locus_tag LOCUS_18550 9400 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 10089 9397 gene locus_tag LOCUS_18560 10089 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 10746 10111 gene locus_tag LOCUS_18570 10746 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 12258 10915 gene locus_tag LOCUS_18580 12258 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence078 312 995 gene locus_tag LOCUS_18590 312 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 985 1776 gene locus_tag LOCUS_18600 985 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1773 2567 gene locus_tag LOCUS_18610 1773 2567 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_18610 2933 3943 gene locus_tag LOCUS_18620 2933 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4006 4105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4522 4382 gene locus_tag LOCUS_18630 4522 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4949 5323 gene locus_tag LOCUS_18640 4949 5323 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_18640 5513 6355 gene locus_tag LOCUS_18650 5513 6355 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_18650 6352 7617 gene locus_tag LOCUS_18660 6352 7617 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 protein_id gnl|my_center|LOCUS_18660 7614 8081 gene locus_tag LOCUS_18670 7614 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 8180 8866 gene locus_tag LOCUS_18680 8180 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 8863 10137 gene locus_tag LOCUS_18690 8863 10137 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705999.1 protein_id gnl|my_center|LOCUS_18690 10350 10449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10638 12179 gene locus_tag LOCUS_18700 gene guaB 10638 12179 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence079 159 1610 gene locus_tag LOCUS_18710 159 1610 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_18710 1702 4986 gene locus_tag LOCUS_18720 1702 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5004 5774 gene locus_tag LOCUS_18730 5004 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5771 6154 gene locus_tag LOCUS_18740 5771 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6178 6765 gene locus_tag LOCUS_18750 6178 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 7756 6755 gene locus_tag LOCUS_18760 7756 6755 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_18760 8392 7766 gene locus_tag LOCUS_18770 8392 7766 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_18770 8570 9277 gene locus_tag LOCUS_18780 8570 9277 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_18780 9267 11039 gene locus_tag LOCUS_18790 gene phoR 9267 11039 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_18790 11127 11738 gene locus_tag LOCUS_18800 11127 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence080 904 2700 gene locus_tag LOCUS_18810 904 2700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_18810 2740 4134 gene locus_tag LOCUS_18820 2740 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4148 5536 gene locus_tag LOCUS_18830 4148 5536 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_18830 5617 6474 gene locus_tag LOCUS_18840 5617 6474 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_18840 6491 7225 gene locus_tag LOCUS_18850 6491 7225 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_18850 7240 8631 gene locus_tag LOCUS_18860 gene gabT 7240 8631 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 protein_id gnl|my_center|LOCUS_18860 8633 9064 gene locus_tag LOCUS_18870 8633 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 9084 9746 gene locus_tag LOCUS_18880 9084 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 9757 10560 gene locus_tag LOCUS_18890 9757 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 10565 11446 gene locus_tag LOCUS_18900 10565 11446 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082140.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence081 56 235 gene locus_tag LOCUS_18910 56 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 211 441 gene locus_tag LOCUS_18920 211 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 700 776 gene locus_tag LOCUS_t00280 700 776 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 790 864 gene locus_tag LOCUS_t00290 790 864 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 987 3938 gene locus_tag LOCUS_r00010 987 3938 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4010 4081 gene locus_tag LOCUS_r00020 4010 4081 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 60 percent of the 5S ribosomal RNA 4535 6214 gene locus_tag LOCUS_18930 4535 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 6305 6395 gene locus_tag LOCUS_t00300 6305 6395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6681 8009 gene locus_tag LOCUS_18940 6681 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8049 10076 gene locus_tag LOCUS_18950 8049 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 10159 10701 gene locus_tag LOCUS_18960 10159 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 11794 10790 gene locus_tag LOCUS_18970 11794 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence082 >Feature sequence083 <1 1901 gene locus_tag LOCUS_18980 <1 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941826.1:phosphoenolpyruvate--protein phosphotransferase 1894 3525 gene locus_tag LOCUS_18990 1894 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3532 5901 gene locus_tag LOCUS_19000 3532 5901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_19000 5963 7333 gene locus_tag LOCUS_19010 5963 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 7330 8736 gene locus_tag LOCUS_19020 7330 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 8723 10111 gene locus_tag LOCUS_19030 8723 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 10089 11555 gene locus_tag LOCUS_19040 10089 11555 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence084 2090 1185 gene locus_tag LOCUS_19050 gene miaA 2090 1185 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_19050 2836 2090 gene locus_tag LOCUS_19060 2836 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3257 2901 gene locus_tag LOCUS_19070 3257 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3987 3259 gene locus_tag LOCUS_19080 3987 3259 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_19080 4728 3991 gene locus_tag LOCUS_19090 4728 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 6152 4725 gene locus_tag LOCUS_19100 6152 4725 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929142.1 protein_id gnl|my_center|LOCUS_19100 6565 6161 gene locus_tag LOCUS_19110 6565 6161 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_19110 7043 6552 gene locus_tag LOCUS_19120 gene nrdR 7043 6552 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_19120 8290 7043 gene locus_tag LOCUS_19130 8290 7043 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_19130 8828 8376 gene locus_tag LOCUS_19140 gene rpiB 8828 8376 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19140 9913 8843 gene locus_tag LOCUS_19150 9913 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 10398 9922 gene locus_tag LOCUS_19160 gene purE 10398 9922 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 protein_id gnl|my_center|LOCUS_19160 <11363 10395 gene locus_tag LOCUS_19170 <11363 10395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941272.1:phosphoribosylamine--glycine ligase >Feature sequence085 <1 1231 gene locus_tag LOCUS_19180 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393598.1:aminodeoxychorismate synthase component I 1240 1977 gene locus_tag LOCUS_19190 1240 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1950 3110 gene locus_tag LOCUS_19200 1950 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3123 3608 gene locus_tag LOCUS_19210 3123 3608 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_19210 3686 4852 gene locus_tag LOCUS_19220 3686 4852 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_19220 4836 5258 gene locus_tag LOCUS_19230 4836 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5255 5674 gene locus_tag LOCUS_19240 5255 5674 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_19240 5678 6580 gene locus_tag LOCUS_19250 5678 6580 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_19250 6570 6857 gene locus_tag LOCUS_19260 6570 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 6844 7833 gene locus_tag LOCUS_19270 gene era 6844 7833 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_19270 7887 8546 gene locus_tag LOCUS_19280 7887 8546 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_19280 8560 9855 gene locus_tag LOCUS_19290 8560 9855 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_19290 9855 11120 gene locus_tag LOCUS_19300 9855 11120 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence086 358 1953 gene locus_tag LOCUS_19310 358 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1967 2656 gene locus_tag LOCUS_19320 1967 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2664 3095 gene locus_tag LOCUS_19330 2664 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3760 3859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4045 5778 gene locus_tag LOCUS_19340 4045 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 5781 7016 gene locus_tag LOCUS_19350 5781 7016 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_19350 7203 7649 gene locus_tag LOCUS_19360 7203 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 7787 8128 gene locus_tag LOCUS_19370 7787 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8139 8591 gene locus_tag LOCUS_19380 8139 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 8600 8944 gene locus_tag LOCUS_19390 8600 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 8944 9549 gene locus_tag LOCUS_19400 8944 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 9861 9960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence087 541 1143 gene locus_tag LOCUS_19410 541 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 4228 1070 gene locus_tag LOCUS_19420 4228 1070 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940506.1 protein_id gnl|my_center|LOCUS_19420 5382 4225 gene locus_tag LOCUS_19430 5382 4225 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_19430 6959 5379 gene locus_tag LOCUS_19440 6959 5379 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071251.1 protein_id gnl|my_center|LOCUS_19440 7683 8057 gene locus_tag LOCUS_19450 7683 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 8106 8702 gene locus_tag LOCUS_19460 gene tpx 8106 8702 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_19460 8720 9154 gene locus_tag LOCUS_19470 8720 9154 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693236.1 protein_id gnl|my_center|LOCUS_19470 9246 10031 gene locus_tag LOCUS_19480 9246 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 10171 10656 gene locus_tag LOCUS_19490 10171 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence088 252 536 gene locus_tag LOCUS_19500 252 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 647 1117 gene locus_tag LOCUS_19510 647 1117 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_19510 1266 1365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1384 2067 gene locus_tag LOCUS_19520 1384 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2067 4169 gene locus_tag LOCUS_19530 gene clpB 2067 4169 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_19530 4290 5294 gene locus_tag LOCUS_19540 4290 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5374 6105 gene locus_tag LOCUS_19550 5374 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 6611 6710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6830 8656 gene locus_tag LOCUS_19560 gene dnaK 6830 8656 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_19560 8745 9890 gene locus_tag LOCUS_19570 gene dnaJ 8745 9890 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_19570 9973 10248 gene locus_tag LOCUS_19580 9973 10248 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence089 285 1235 gene locus_tag LOCUS_19590 285 1235 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 protein_id gnl|my_center|LOCUS_19590 1232 3391 gene locus_tag LOCUS_19600 1232 3391 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_19600 6397 3773 gene locus_tag LOCUS_19610 6397 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 7501 6767 gene locus_tag LOCUS_19620 7501 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 8245 7694 gene locus_tag LOCUS_19630 gene ybeY 8245 7694 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404820.1 protein_id gnl|my_center|LOCUS_19630 9650 8316 gene locus_tag LOCUS_19640 9650 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 10578 9628 gene locus_tag LOCUS_19650 10578 9628 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence090 150 902 gene locus_tag LOCUS_19660 150 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 950 1342 gene locus_tag LOCUS_19670 950 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 1356 1520 gene locus_tag LOCUS_19680 1356 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2943 1669 gene locus_tag LOCUS_19690 2943 1669 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_19690 3248 3084 gene locus_tag LOCUS_19700 3248 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3912 3268 gene locus_tag LOCUS_19710 3912 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4208 3909 gene locus_tag LOCUS_19720 4208 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4555 4346 gene locus_tag LOCUS_19730 4555 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4756 4683 gene locus_tag LOCUS_t00310 4756 4683 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6112 4814 gene locus_tag LOCUS_19740 gene gltX 6112 4814 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_19740 6492 6109 gene locus_tag LOCUS_19750 6492 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 7287 6505 gene locus_tag LOCUS_19760 7287 6505 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_19760 8849 7287 gene locus_tag LOCUS_19770 gene rny 8849 7287 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_19770 9442 8882 gene locus_tag LOCUS_19780 9442 8882 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_19780 <10748 9514 gene locus_tag LOCUS_19790 <10748 9514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546821.1:replication-associated recombination protein A >Feature sequence091 322 1149 gene locus_tag LOCUS_19800 322 1149 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_19800 1178 1744 gene locus_tag LOCUS_19810 gene gmk 1178 1744 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_19810 1971 2213 gene locus_tag LOCUS_19820 1971 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2210 2749 gene locus_tag LOCUS_19830 2210 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2894 2967 gene locus_tag LOCUS_t00320 2894 2967 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3210 3294 gene locus_tag LOCUS_t00330 3210 3294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3553 3630 gene locus_tag LOCUS_t00340 3553 3630 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 174 1283 gene locus_tag LOCUS_19840 gene mtnA 174 1283 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_19840 1163 1262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1340 2281 gene locus_tag LOCUS_19850 gene thiL 1340 2281 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_19850 2281 2751 gene locus_tag LOCUS_19860 gene tsaE 2281 2751 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405136.1 protein_id gnl|my_center|LOCUS_19860 2748 3518 gene locus_tag LOCUS_19870 gene tsaB 2748 3518 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_19870 3515 4660 gene locus_tag LOCUS_19880 gene alr 3515 4660 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_19880 4657 5376 gene locus_tag LOCUS_19890 4657 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 5421 5705 gene locus_tag LOCUS_19900 5421 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5769 6287 gene locus_tag LOCUS_19910 5769 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7861 6755 gene locus_tag LOCUS_19920 gene lptG 7861 6755 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_19920 8898 7849 gene locus_tag LOCUS_19930 gene lptF 8898 7849 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658246.1 protein_id gnl|my_center|LOCUS_19930 9664 8921 gene locus_tag LOCUS_19940 9664 8921 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence093 864 1184 gene locus_tag LOCUS_19950 864 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1199 1762 gene locus_tag LOCUS_19960 gene pyrE 1199 1762 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930785.1 protein_id gnl|my_center|LOCUS_19960 1762 3132 gene locus_tag LOCUS_19970 1762 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3129 3563 gene locus_tag LOCUS_19980 3129 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3669 7889 gene locus_tag LOCUS_19990 3669 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 9361 7946 gene locus_tag LOCUS_20000 gene lpdA 9361 7946 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence094 148 2043 gene locus_tag LOCUS_20010 148 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2460 3551 gene locus_tag LOCUS_20020 2460 3551 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_20020 3572 5524 gene locus_tag LOCUS_20030 3572 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5528 7801 gene locus_tag LOCUS_20040 5528 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8232 9029 gene locus_tag LOCUS_20050 8232 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence095 278 754 gene locus_tag LOCUS_20060 278 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 747 1079 gene locus_tag LOCUS_20070 747 1079 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546474.1 protein_id gnl|my_center|LOCUS_20070 1333 3963 gene locus_tag LOCUS_20080 1333 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4014 7571 gene locus_tag LOCUS_20090 4014 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 7589 8005 gene locus_tag LOCUS_20100 7589 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8104 9378 gene locus_tag LOCUS_20110 8104 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence096 1449 4 gene locus_tag LOCUS_20120 1449 4 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_20120 2433 1450 gene locus_tag LOCUS_20130 2433 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3458 2427 gene locus_tag LOCUS_20140 3458 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4428 3448 gene locus_tag LOCUS_20150 4428 3448 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_20150 5068 4445 gene locus_tag LOCUS_20160 5068 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 6375 5053 gene locus_tag LOCUS_20170 6375 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 6839 6429 gene locus_tag LOCUS_20180 6839 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6891 8504 gene locus_tag LOCUS_20190 6891 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 8501 9217 gene locus_tag LOCUS_20200 8501 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence097 <1 1218 gene locus_tag LOCUS_20210 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140087.1:MFS transporter 1218 1811 gene locus_tag LOCUS_20220 gene purN 1218 1811 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369276.1 protein_id gnl|my_center|LOCUS_20220 1808 3319 gene locus_tag LOCUS_20230 1808 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4280 3324 gene locus_tag LOCUS_20240 4280 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 6829 4277 gene locus_tag LOCUS_20250 6829 4277 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142643.1 protein_id gnl|my_center|LOCUS_20250 7033 8301 gene locus_tag LOCUS_20260 gene eno 7033 8301 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018115.1 protein_id gnl|my_center|LOCUS_20260 8325 8864 gene locus_tag LOCUS_20270 8325 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8973 9049 gene locus_tag LOCUS_t00350 8973 9049 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 1113 130 gene locus_tag LOCUS_20280 1113 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3086 1116 gene locus_tag LOCUS_20290 3086 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4178 3108 gene locus_tag LOCUS_20300 4178 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4322 4185 gene locus_tag LOCUS_20310 4322 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5527 4319 gene locus_tag LOCUS_20320 gene dltB 5527 4319 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808967.1 protein_id gnl|my_center|LOCUS_20320 5790 5524 gene locus_tag LOCUS_20330 5790 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7681 5816 gene locus_tag LOCUS_20340 7681 5816 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_20340 <8977 7678 gene locus_tag LOCUS_20350 <8977 7678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:radical SAM protein >Feature sequence099 225 52 gene locus_tag LOCUS_20360 225 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1366 275 gene locus_tag LOCUS_20370 1366 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1599 1793 gene locus_tag LOCUS_20380 1599 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2032 1844 gene locus_tag LOCUS_20390 2032 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3116 3271 gene locus_tag LOCUS_20400 3116 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3569 7102 gene locus_tag LOCUS_20410 3569 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 7525 7214 gene locus_tag LOCUS_20420 7525 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 8698 7649 gene locus_tag LOCUS_20430 8698 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence100 1255 2376 gene locus_tag LOCUS_20440 1255 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3742 2342 gene locus_tag LOCUS_20450 3742 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3929 4180 gene locus_tag LOCUS_20460 3929 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4313 5062 gene locus_tag LOCUS_20470 4313 5062 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267634.1 protein_id gnl|my_center|LOCUS_20470 5214 5537 gene locus_tag LOCUS_20480 gene trxA 5214 5537 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_20480 5538 5888 gene locus_tag LOCUS_20490 5538 5888 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_20490 5905 6393 gene locus_tag LOCUS_20500 gene def 5905 6393 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_20500 6398 6497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6600 7322 gene locus_tag LOCUS_20510 gene lipA 6600 7322 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_20510 7319 8299 gene locus_tag LOCUS_20520 7319 8299 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence101 99 1019 gene locus_tag LOCUS_20530 99 1019 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_20530 1083 1904 gene locus_tag LOCUS_20540 1083 1904 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_20540 1906 2850 gene locus_tag LOCUS_20550 1906 2850 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_20550 2868 4190 gene locus_tag LOCUS_20560 2868 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4894 4163 gene locus_tag LOCUS_20570 4894 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4959 5855 gene locus_tag LOCUS_20580 4959 5855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_20580 5837 7186 gene locus_tag LOCUS_20590 5837 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 7405 7504 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7570 8610 gene locus_tag LOCUS_20600 gene rlmD 7570 8610 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence102 17 373 gene locus_tag LOCUS_20610 17 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 454 738 gene locus_tag LOCUS_20620 454 738 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_20620 741 2033 gene locus_tag LOCUS_20630 741 2033 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_20630 2047 3267 gene locus_tag LOCUS_20640 2047 3267 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_20640 3264 6554 gene locus_tag LOCUS_20650 3264 6554 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444632.1 protein_id gnl|my_center|LOCUS_20650 6702 7466 gene locus_tag LOCUS_20660 6702 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence103 433 1728 gene locus_tag LOCUS_20670 gene purB 433 1728 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_20670 1739 2446 gene locus_tag LOCUS_20680 1739 2446 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_20680 2443 5352 gene locus_tag LOCUS_20690 gene purL 2443 5352 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_20690 5361 6023 gene locus_tag LOCUS_20700 5361 6023 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_20700 6026 6826 gene locus_tag LOCUS_20710 6026 6826 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_20710 6872 7405 gene locus_tag LOCUS_20720 6872 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 7435 8433 gene locus_tag LOCUS_20730 gene purM 7435 8433 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703153.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence104 56 721 gene locus_tag LOCUS_20740 gene rsmI 56 721 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_20740 784 1593 gene locus_tag LOCUS_20750 784 1593 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016475763.1 protein_id gnl|my_center|LOCUS_20750 1827 2366 gene locus_tag LOCUS_20760 gene pyrR 1827 2366 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_20760 2363 3289 gene locus_tag LOCUS_20770 2363 3289 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_20770 3303 4592 gene locus_tag LOCUS_20780 3303 4592 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_20780 4576 5394 gene locus_tag LOCUS_20790 gene mutM 4576 5394 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114602.1 protein_id gnl|my_center|LOCUS_20790 5391 6164 gene locus_tag LOCUS_20800 5391 6164 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_20800 6161 7066 gene locus_tag LOCUS_20810 6161 7066 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_20810 7063 7815 gene locus_tag LOCUS_20820 gene pyrF 7063 7815 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_20820 7832 7906 gene locus_tag LOCUS_t00360 7832 7906 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 1510 731 gene locus_tag LOCUS_20830 1510 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2691 1519 gene locus_tag LOCUS_20840 2691 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3722 2607 gene locus_tag LOCUS_20850 3722 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 4053 3742 gene locus_tag LOCUS_20860 4053 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4444 4046 gene locus_tag LOCUS_20870 4444 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4708 7380 gene locus_tag LOCUS_20880 gene aceE 4708 7380 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence106 921 403 gene locus_tag LOCUS_20890 921 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1674 1093 gene locus_tag LOCUS_20900 1674 1093 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_20900 2690 1761 gene locus_tag LOCUS_20910 2690 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3138 2701 gene locus_tag LOCUS_20920 3138 2701 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_20920 3897 3286 gene locus_tag LOCUS_20930 3897 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5165 3894 gene locus_tag LOCUS_20940 gene serS 5165 3894 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_20940 5690 5259 gene locus_tag LOCUS_20950 5690 5259 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 protein_id gnl|my_center|LOCUS_20950 6987 5683 gene locus_tag LOCUS_20960 6987 5683 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_20960 7537 6989 gene locus_tag LOCUS_20970 7537 6989 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence107 6274 3536 gene locus_tag LOCUS_20980 6274 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 7776 6274 gene locus_tag LOCUS_20990 7776 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6286 6385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence108 2359 914 gene locus_tag LOCUS_21000 2359 914 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_21000 3044 2427 gene locus_tag LOCUS_21010 3044 2427 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388406.1 protein_id gnl|my_center|LOCUS_21010 3828 3037 gene locus_tag LOCUS_21020 3828 3037 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_21020 5024 3825 gene locus_tag LOCUS_21030 5024 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7070 5040 gene locus_tag LOCUS_21040 7070 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence109 <1 1247 gene locus_tag LOCUS_21050 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940922.1:radical SAM protein 1724 1188 gene locus_tag LOCUS_21060 1724 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2581 1790 gene locus_tag LOCUS_21070 gene panB 2581 1790 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_21070 4004 2649 gene locus_tag LOCUS_21080 gene gltA 4004 2649 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_21080 4795 3929 gene locus_tag LOCUS_21090 4795 3929 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_21090 5587 4805 gene locus_tag LOCUS_21100 5587 4805 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_21100 6072 5638 gene locus_tag LOCUS_21110 gene dtd 6072 5638 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_21110 6890 6150 gene locus_tag LOCUS_21120 6890 6150 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_21120 7356 6958 gene locus_tag LOCUS_21130 7356 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence110 416 1705 gene locus_tag LOCUS_21140 416 1705 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_21140 1707 3017 gene locus_tag LOCUS_21150 1707 3017 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_21150 3004 4077 gene locus_tag LOCUS_21160 3004 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4074 4784 gene locus_tag LOCUS_21170 4074 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 protein_id gnl|my_center|LOCUS_21170 4897 6243 gene locus_tag LOCUS_21180 4897 6243 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_21180 6224 6868 gene locus_tag LOCUS_21190 6224 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence111 304 232 gene locus_tag LOCUS_t00370 304 232 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 993 349 gene locus_tag LOCUS_21200 993 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1568 1044 gene locus_tag LOCUS_21210 1568 1044 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_21210 2437 1547 gene locus_tag LOCUS_21220 gene degA 2437 1547 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_21220 3248 2397 gene locus_tag LOCUS_21230 3248 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6161 3345 gene locus_tag LOCUS_21240 gene ppdK 6161 3345 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679160.1 protein_id gnl|my_center|LOCUS_21240 <7425 6293 gene locus_tag LOCUS_21250 <7425 6293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000287157.1:glycine--tRNA ligase >Feature sequence112 1209 727 gene locus_tag LOCUS_21260 gene tagD 1209 727 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_21260 2279 1206 gene locus_tag LOCUS_21270 2279 1206 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_21270 3118 2324 gene locus_tag LOCUS_21280 3118 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 5554 4187 gene locus_tag LOCUS_21290 5554 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6108 5551 gene locus_tag LOCUS_21300 6108 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 6999 6115 gene locus_tag LOCUS_21310 6999 6115 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence113 826 227 gene locus_tag LOCUS_21320 gene lexA 826 227 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_21320 1357 872 gene locus_tag LOCUS_21330 1357 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2110 1439 gene locus_tag LOCUS_21340 2110 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2601 2107 gene locus_tag LOCUS_21350 2601 2107 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889089.1 protein_id gnl|my_center|LOCUS_21350 2922 2614 gene locus_tag LOCUS_21360 2922 2614 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_21360 4258 3008 gene locus_tag LOCUS_21370 4258 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5119 4265 gene locus_tag LOCUS_21380 5119 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5561 5220 gene locus_tag LOCUS_21390 5561 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 protein_id gnl|my_center|LOCUS_21390 6134 5577 gene locus_tag LOCUS_21400 6134 5577 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_21400 6462 6220 gene locus_tag LOCUS_21410 6462 6220 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082425.1 protein_id gnl|my_center|LOCUS_21410 7066 6506 gene locus_tag LOCUS_21420 7066 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence114 <1 1002 gene locus_tag LOCUS_21430 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023679.1:dTDP-glucose 4,6-dehydratase 1003 1725 gene locus_tag LOCUS_21440 1003 1725 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_21440 1725 2603 gene locus_tag LOCUS_21450 1725 2603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_21450 2581 3723 gene locus_tag LOCUS_21460 2581 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3720 4778 gene locus_tag LOCUS_21470 3720 4778 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149760579.1 protein_id gnl|my_center|LOCUS_21470 4775 6181 gene locus_tag LOCUS_21480 4775 6181 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence115 683 1261 gene locus_tag LOCUS_21490 683 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1258 6411 gene locus_tag LOCUS_21500 1258 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence116 686 468 gene locus_tag LOCUS_21510 686 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1481 1224 gene locus_tag LOCUS_21520 1481 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3451 3026 gene locus_tag LOCUS_21530 3451 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3816 4268 gene locus_tag LOCUS_21540 3816 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4664 6211 gene locus_tag LOCUS_21550 4664 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6515 6345 gene locus_tag LOCUS_21560 6515 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence117 4456 362 gene locus_tag LOCUS_21570 4456 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4618 5103 gene locus_tag LOCUS_21580 4618 5103 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_21580 5100 5774 gene locus_tag LOCUS_21590 5100 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21590 5835 6737 gene locus_tag LOCUS_21600 5835 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence118 921 118 gene locus_tag LOCUS_21610 gene uppP 921 118 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_21610 1067 1522 gene locus_tag LOCUS_21620 1067 1522 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_21620 1497 1958 gene locus_tag LOCUS_21630 1497 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1948 2880 gene locus_tag LOCUS_21640 gene trmB 1948 2880 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879977.1 protein_id gnl|my_center|LOCUS_21640 2877 3728 gene locus_tag LOCUS_21650 2877 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3782 4612 gene locus_tag LOCUS_21660 3782 4612 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_21660 4753 5070 gene locus_tag LOCUS_21670 4753 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5158 6987 gene locus_tag LOCUS_21680 gene glmS 5158 6987 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence119 494 83 gene locus_tag LOCUS_tm00010 494 83 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1069 617 gene locus_tag LOCUS_21690 gene smpB 1069 617 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_21690 1664 1077 gene locus_tag LOCUS_21700 1664 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2233 1676 gene locus_tag LOCUS_21710 2233 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2424 2508 gene locus_tag LOCUS_t00380 2424 2508 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4256 2907 gene locus_tag LOCUS_21720 4256 2907 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_21720 7036 4376 gene locus_tag LOCUS_21730 7036 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence120 4591 4690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence121 433 119 gene locus_tag LOCUS_21740 433 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1654 968 gene locus_tag LOCUS_21750 1654 968 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_21750 2351 1668 gene locus_tag LOCUS_21760 2351 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2649 2332 gene locus_tag LOCUS_21770 2649 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2988 2776 gene locus_tag LOCUS_21780 2988 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3431 3171 gene locus_tag LOCUS_21790 3431 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3750 3466 gene locus_tag LOCUS_21800 3750 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4157 3771 gene locus_tag LOCUS_21810 4157 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5134 4808 gene locus_tag LOCUS_21820 5134 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6077 5127 gene locus_tag LOCUS_21830 6077 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 <6931 6252 gene locus_tag LOCUS_21840 <6931 6252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065307.1:helix-turn-helix domain-containing protein >Feature sequence122 3123 3707 gene locus_tag LOCUS_21850 3123 3707 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence123 66 488 gene locus_tag LOCUS_21860 66 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 485 1810 gene locus_tag LOCUS_21870 485 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2378 1905 gene locus_tag LOCUS_21880 gene greA 2378 1905 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840123.1 protein_id gnl|my_center|LOCUS_21880 2615 2382 gene locus_tag LOCUS_21890 2615 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2939 2640 gene locus_tag LOCUS_21900 2939 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3334 3041 gene locus_tag LOCUS_21910 3334 3041 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_21910 4385 3348 gene locus_tag LOCUS_21920 4385 3348 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_21920 4980 4387 gene locus_tag LOCUS_21930 4980 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 5738 5004 gene locus_tag LOCUS_21940 5738 5004 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_21940 6076 5735 gene locus_tag LOCUS_21950 6076 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 <6910 6076 gene locus_tag LOCUS_21960 <6910 6076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004596488.1:ABC transporter permease >Feature sequence124 <1 600 gene locus_tag LOCUS_21970 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263795.1:toxin-antitoxin system YwqK family antitoxin 625 939 gene locus_tag LOCUS_21980 625 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 942 1121 gene locus_tag LOCUS_21990 942 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1186 2403 gene locus_tag LOCUS_22000 1186 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2400 3389 gene locus_tag LOCUS_22010 2400 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3418 5499 gene locus_tag LOCUS_22020 3418 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 5499 6473 gene locus_tag LOCUS_22030 5499 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence125 >Feature sequence126 634 479 gene locus_tag LOCUS_22040 634 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1545 2690 gene locus_tag LOCUS_22050 1545 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4600 2705 gene locus_tag LOCUS_22060 4600 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5187 4639 gene locus_tag LOCUS_22070 5187 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6395 5184 gene locus_tag LOCUS_22080 6395 5184 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence127 249 52 gene locus_tag LOCUS_22090 249 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1183 857 gene locus_tag LOCUS_22100 1183 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941407.1 protein_id gnl|my_center|LOCUS_22100 <6438 1185 gene locus_tag LOCUS_22110 <6438 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001535.1:SpvB/TcaC N-terminal domain-containing protein >Feature sequence128 50 289 gene locus_tag LOCUS_22120 50 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 279 656 gene locus_tag LOCUS_22130 279 656 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_22130 683 2125 gene locus_tag LOCUS_22140 gene lysS 683 2125 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_22140 2126 3328 gene locus_tag LOCUS_22150 2126 3328 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_22150 3413 4084 gene locus_tag LOCUS_22160 3413 4084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence129 1 95 gene locus_tag LOCUS_t00390 1 95 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 247 1644 gene locus_tag LOCUS_22170 gene selA 247 1644 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_22170 1641 3578 gene locus_tag LOCUS_22180 gene selB 1641 3578 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_22180 3575 4522 gene locus_tag LOCUS_22190 3575 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4727 4858 gene locus_tag LOCUS_22200 4727 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4845 5984 gene locus_tag LOCUS_22210 4845 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence130 2 1180 gene locus_tag LOCUS_22220 2 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1180 1368 gene locus_tag LOCUS_22230 1180 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1371 2000 gene locus_tag LOCUS_22240 1371 2000 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147798296.1 protein_id gnl|my_center|LOCUS_22240 1997 3988 gene locus_tag LOCUS_22250 gene dndD 1997 3988 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_22250 3990 5516 gene locus_tag LOCUS_22260 3990 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence131 45 236 gene locus_tag LOCUS_22270 45 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 244 1971 gene locus_tag LOCUS_22280 244 1971 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_22280 1968 2513 gene locus_tag LOCUS_22290 1968 2513 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_22290 2510 3034 gene locus_tag LOCUS_22300 2510 3034 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_22300 3125 3328 gene locus_tag LOCUS_22310 3125 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3397 4149 gene locus_tag LOCUS_22320 gene gpmA 3397 4149 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_22320 4314 4538 gene locus_tag LOCUS_22330 gene cspB 4314 4538 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161732.1 protein_id gnl|my_center|LOCUS_22330 4617 5405 gene locus_tag LOCUS_22340 4617 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5402 5767 gene locus_tag LOCUS_22350 5402 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence132 1075 1536 gene locus_tag LOCUS_22360 1075 1536 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_22360 1571 2368 gene locus_tag LOCUS_22370 1571 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2380 3333 gene locus_tag LOCUS_22380 2380 3333 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_22380 3354 4388 gene locus_tag LOCUS_22390 gene rlmN 3354 4388 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_22390 4410 5642 gene locus_tag LOCUS_22400 4410 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence133 2172 430 gene locus_tag LOCUS_22410 2172 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5583 2173 gene locus_tag LOCUS_22420 5583 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence134 1853 1257 gene locus_tag LOCUS_22430 1853 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3650 1869 gene locus_tag LOCUS_22440 3650 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5312 3657 gene locus_tag LOCUS_22450 5312 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence135 <1 830 gene locus_tag LOCUS_22460 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294580.1:AAA family ATPase 836 1408 gene locus_tag LOCUS_22470 836 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1405 2943 gene locus_tag LOCUS_22480 1405 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2946 3641 gene locus_tag LOCUS_22490 2946 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3638 5443 gene locus_tag LOCUS_22500 3638 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence136 1 879 gene locus_tag LOCUS_22510 1 879 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_22510 876 2036 gene locus_tag LOCUS_22520 gene bioF 876 2036 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_22520 2029 2769 gene locus_tag LOCUS_22530 2029 2769 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957948.1 protein_id gnl|my_center|LOCUS_22530 2766 3515 gene locus_tag LOCUS_22540 2766 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 3517 5565 gene locus_tag LOCUS_22550 3517 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence137 >Feature sequence138 2204 1410 gene locus_tag LOCUS_22560 2204 1410 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 protein_id gnl|my_center|LOCUS_22560 3016 2231 gene locus_tag LOCUS_22570 3016 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 4170 3061 gene locus_tag LOCUS_22580 4170 3061 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_22580 5327 4215 gene locus_tag LOCUS_22590 5327 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence139 325 1011 gene locus_tag LOCUS_22600 325 1011 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921664.1 protein_id gnl|my_center|LOCUS_22600 1821 985 gene locus_tag LOCUS_22610 1821 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2783 1818 gene locus_tag LOCUS_22620 2783 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3726 2806 gene locus_tag LOCUS_22630 3726 2806 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_22630 3893 5431 gene locus_tag LOCUS_22640 3893 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence140 <1 969 gene locus_tag LOCUS_22650 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941999.1:sulfate ABC transporter substrate-binding protein 990 1994 gene locus_tag LOCUS_22660 990 1994 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_22660 2037 3206 gene locus_tag LOCUS_22670 2037 3206 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_22670 3203 4354 gene locus_tag LOCUS_22680 3203 4354 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_22680 4364 5317 gene locus_tag LOCUS_22690 gene cysK 4364 5317 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence141 >Feature sequence142 282 1241 gene locus_tag LOCUS_22700 282 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1256 1879 gene locus_tag LOCUS_22710 1256 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1880 2503 gene locus_tag LOCUS_22720 1880 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2532 3596 gene locus_tag LOCUS_22730 gene rhuM 2532 3596 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_22730 3847 5085 gene locus_tag LOCUS_22740 3847 5085 CDS product ISL3-like element IS1001 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039524.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence143 1204 527 gene locus_tag LOCUS_22750 gene fsa 1204 527 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 protein_id gnl|my_center|LOCUS_22750 1824 1225 gene locus_tag LOCUS_22760 1824 1225 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_22760 2360 1824 gene locus_tag LOCUS_22770 2360 1824 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957728.1 protein_id gnl|my_center|LOCUS_22770 3370 2357 gene locus_tag LOCUS_22780 3370 2357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_22780 4209 3367 gene locus_tag LOCUS_22790 4209 3367 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776489.1 protein_id gnl|my_center|LOCUS_22790 5213 4227 gene locus_tag LOCUS_22800 5213 4227 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence144 61 1176 gene locus_tag LOCUS_22810 gene waaC 61 1176 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_22810 1226 2260 gene locus_tag LOCUS_22820 1226 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2285 3181 gene locus_tag LOCUS_22830 2285 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3509 4735 gene locus_tag LOCUS_22840 3509 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence145 >Feature sequence146 180 55 gene locus_tag LOCUS_22850 180 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 495 313 gene locus_tag LOCUS_22860 495 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1646 537 gene locus_tag LOCUS_22870 1646 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3756 1648 gene locus_tag LOCUS_22880 3756 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence147 3370 1847 gene locus_tag LOCUS_22890 3370 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 4085 3384 gene locus_tag LOCUS_22900 4085 3384 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391446.1 protein_id gnl|my_center|LOCUS_22900 4780 4082 gene locus_tag LOCUS_22910 4780 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence148 2574 475 gene locus_tag LOCUS_22920 2574 475 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_22920 3975 2752 gene locus_tag LOCUS_22930 3975 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4603 4055 gene locus_tag LOCUS_22940 4603 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence149 90 1007 gene locus_tag LOCUS_22950 90 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1595 1011 gene locus_tag LOCUS_22960 1595 1011 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_22960 1800 1606 gene locus_tag LOCUS_22970 1800 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2179 2278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2640 2305 gene locus_tag LOCUS_22980 2640 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3753 3007 gene locus_tag LOCUS_22990 3753 3007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_22990 4538 3750 gene locus_tag LOCUS_23000 4538 3750 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence150 1692 124 gene locus_tag LOCUS_23010 1692 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2419 1658 gene locus_tag LOCUS_23020 2419 1658 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705153.1 protein_id gnl|my_center|LOCUS_23020 3229 2450 gene locus_tag LOCUS_23030 3229 2450 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070470.1 protein_id gnl|my_center|LOCUS_23030 <4798 3324 gene locus_tag LOCUS_23040 <4798 3324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941694.1:methyl-accepting chemotaxis protein >Feature sequence151 368 952 gene locus_tag LOCUS_23050 368 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 967 1590 gene locus_tag LOCUS_23060 gene hisH 967 1590 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_23060 1580 2323 gene locus_tag LOCUS_23070 gene hisF 1580 2323 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_23070 2332 3483 gene locus_tag LOCUS_23080 gene pseA 2332 3483 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence152 601 3186 gene locus_tag LOCUS_23090 601 3186 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_23090 3270 4631 gene locus_tag LOCUS_23100 3270 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence153 >Feature sequence154 84 1229 gene locus_tag LOCUS_23110 84 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1299 1691 gene locus_tag LOCUS_23120 1299 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1688 3037 gene locus_tag LOCUS_23130 1688 3037 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_23130 3028 4311 gene locus_tag LOCUS_23140 3028 4311 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence155 1328 450 gene locus_tag LOCUS_23150 1328 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 <4501 1367 gene locus_tag LOCUS_23160 <4501 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000947422.1:efflux RND transporter permease subunit >Feature sequence156 1400 375 gene locus_tag LOCUS_23170 1400 375 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_23170 2335 1397 gene locus_tag LOCUS_23180 2335 1397 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_23180 3372 2341 gene locus_tag LOCUS_23190 3372 2341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_23190 4111 3440 gene locus_tag LOCUS_23200 4111 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence157 59 1591 gene locus_tag LOCUS_23210 gene iorA 59 1591 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_23210 1593 2078 gene locus_tag LOCUS_23220 1593 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2075 3376 gene locus_tag LOCUS_23230 2075 3376 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_23230 3487 3918 gene locus_tag LOCUS_23240 3487 3918 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence158 2820 4004 gene locus_tag LOCUS_23250 2820 4004 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence159 2564 1356 gene locus_tag LOCUS_23260 2564 1356 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_23260 3061 2930 gene locus_tag LOCUS_23270 3061 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3566 3147 gene locus_tag LOCUS_23280 3566 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3762 3983 gene locus_tag LOCUS_23290 3762 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence160 2257 3702 gene locus_tag LOCUS_23300 2257 3702 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_23300 3955 4128 gene locus_tag LOCUS_23310 3955 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence161 3106 1829 gene locus_tag LOCUS_23320 3106 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3575 3099 gene locus_tag LOCUS_23330 3575 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3985 3572 gene locus_tag LOCUS_23340 3985 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence162 >Feature sequence163 270 1322 gene locus_tag LOCUS_23350 270 1322 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_23350 1421 1864 gene locus_tag LOCUS_23360 1421 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2630 1974 gene locus_tag LOCUS_23370 2630 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3054 3236 gene locus_tag LOCUS_23380 3054 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence164 >Feature sequence165 <1 758 gene locus_tag LOCUS_23390 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061535.1:FkbM family methyltransferase 785 1474 gene locus_tag LOCUS_23400 785 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1476 2591 gene locus_tag LOCUS_23410 1476 2591 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_23410 2670 3830 gene locus_tag LOCUS_23420 2670 3830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence166 1640 1987 gene locus_tag LOCUS_23430 1640 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1996 2853 gene locus_tag LOCUS_23440 1996 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2863 3762 gene locus_tag LOCUS_23450 2863 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence167 93 689 gene locus_tag LOCUS_23460 93 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 711 1871 gene locus_tag LOCUS_23470 711 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1868 2572 gene locus_tag LOCUS_23480 1868 2572 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_23480 2572 2934 gene locus_tag LOCUS_23490 2572 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence168 >Feature sequence169 138 1694 gene locus_tag LOCUS_23500 gene mdoG 138 1694 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_23500 1691 3553 gene locus_tag LOCUS_23510 1691 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence170 1459 941 gene locus_tag LOCUS_23520 1459 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence171 572 213 gene locus_tag LOCUS_23530 572 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3036 709 gene locus_tag LOCUS_23540 3036 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence172 408 190 gene locus_tag LOCUS_23550 408 190 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_23550 682 479 gene locus_tag LOCUS_23560 682 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 889 683 gene locus_tag LOCUS_23570 889 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2384 1530 gene locus_tag LOCUS_23580 2384 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 2642 2478 gene locus_tag LOCUS_23590 2642 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3342 2746 gene locus_tag LOCUS_23600 3342 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence173 281 1726 gene locus_tag LOCUS_23610 gene atpA 281 1726 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_23610 1733 2584 gene locus_tag LOCUS_23620 1733 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence174 189 986 gene locus_tag LOCUS_23630 gene moeB 189 986 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_23630 1030 3387 gene locus_tag LOCUS_23640 1030 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence175 2510 1626 gene locus_tag LOCUS_23650 gene metF 2510 1626 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence176 >Feature sequence177 <1 1096 gene locus_tag LOCUS_23660 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070853.1:type IV pilus twitching motility protein PilT 1840 1100 gene locus_tag LOCUS_23670 1840 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1916 3250 gene locus_tag LOCUS_23680 1916 3250 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence178 488 1726 gene locus_tag LOCUS_23690 488 1726 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_23690 1723 2313 gene locus_tag LOCUS_23700 1723 2313 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_23700 2428 3213 gene locus_tag LOCUS_23710 2428 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence179 >Feature sequence180 >Feature sequence181 1211 555 gene locus_tag LOCUS_23720 1211 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1910 1260 gene locus_tag LOCUS_23730 1910 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2766 2140 gene locus_tag LOCUS_23740 2766 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence182 202 342 gene locus_tag LOCUS_23750 202 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 317 2998 gene locus_tag LOCUS_23760 317 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence183 1647 763 gene locus_tag LOCUS_23770 1647 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2413 1652 gene locus_tag LOCUS_23780 2413 1652 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268058.1 protein_id gnl|my_center|LOCUS_23780 3002 2436 gene locus_tag LOCUS_23790 3002 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence184 2249 1308 gene locus_tag LOCUS_23800 2249 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence185 >Feature sequence186 822 85 gene locus_tag LOCUS_23810 822 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1656 826 gene locus_tag LOCUS_23820 1656 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2630 1653 gene locus_tag LOCUS_23830 2630 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence187 >Feature sequence188 220 1179 gene locus_tag LOCUS_23840 220 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1582 1187 gene locus_tag LOCUS_23850 1582 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2583 1579 gene locus_tag LOCUS_23860 2583 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence189 2269 632 gene locus_tag LOCUS_23870 2269 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence190 391 681 gene locus_tag LOCUS_23880 391 681 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_23880 674 1078 gene locus_tag LOCUS_23890 674 1078 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_23890 1378 2244 gene locus_tag LOCUS_23900 1378 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence191 2294 1158 gene locus_tag LOCUS_23910 2294 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence192 >Feature sequence193 733 113 gene locus_tag LOCUS_23920 733 113 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_23920 1511 720 gene locus_tag LOCUS_23930 gene trpC 1511 720 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_23930 <2242 1504 gene locus_tag LOCUS_23940 <2242 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869732.1:anthranilate phosphoribosyltransferase >Feature sequence194 2220 616 gene locus_tag LOCUS_23950 2220 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence195 1936 1667 gene locus_tag LOCUS_23960 1936 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence196 1982 1017 gene locus_tag LOCUS_23970 1982 1017 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_23970