>Feature sequence0001 631 1055 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgccgccgaggccgccg 1181 1528 gene locus_tag LOCUS_00010 1181 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1525 1803 gene locus_tag LOCUS_00020 1525 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1996 2355 gene locus_tag LOCUS_00030 1996 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2379 2627 gene locus_tag LOCUS_00040 2379 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2705 3406 gene locus_tag LOCUS_00050 2705 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3407 3739 gene locus_tag LOCUS_00060 3407 3739 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226983.1 protein_id gnl|my_center|LOCUS_00060 3751 3966 gene locus_tag LOCUS_00070 3751 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3963 4244 gene locus_tag LOCUS_00080 3963 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4241 4555 gene locus_tag LOCUS_00090 4241 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 4668 5024 gene locus_tag LOCUS_00100 4668 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6141 5143 gene locus_tag LOCUS_00110 6141 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6299 6508 gene locus_tag LOCUS_00120 6299 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 6583 7095 gene locus_tag LOCUS_00130 6583 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7279 7626 gene locus_tag LOCUS_00140 7279 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7692 8183 gene locus_tag LOCUS_00150 7692 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8785 8453 gene locus_tag LOCUS_00160 8785 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 10209 8941 gene locus_tag LOCUS_00170 10209 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 10422 10688 gene locus_tag LOCUS_00180 10422 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 10771 11109 gene locus_tag LOCUS_00190 10771 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 11241 11945 gene locus_tag LOCUS_00200 11241 11945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 12819 12022 gene locus_tag LOCUS_00210 12819 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 13606 13070 gene locus_tag LOCUS_00220 13606 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 14148 13603 gene locus_tag LOCUS_00230 14148 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 14792 14145 gene locus_tag LOCUS_00240 14792 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 15012 14752 gene locus_tag LOCUS_00250 15012 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 15265 14948 gene locus_tag LOCUS_00260 15265 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 16879 15275 gene locus_tag LOCUS_00270 16879 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18040 17042 gene locus_tag LOCUS_00280 18040 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 18675 18178 gene locus_tag LOCUS_00290 18675 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 19103 18765 gene locus_tag LOCUS_00300 19103 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 20020 19148 gene locus_tag LOCUS_00310 20020 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 20155 20907 gene locus_tag LOCUS_00320 20155 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 21431 20916 gene locus_tag LOCUS_00330 21431 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22169 21438 gene locus_tag LOCUS_00340 22169 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 23664 22180 gene locus_tag LOCUS_00350 23664 22180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 25055 23703 gene locus_tag LOCUS_00360 25055 23703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 28625 25197 gene locus_tag LOCUS_00370 28625 25197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 28855 29328 gene locus_tag LOCUS_00380 28855 29328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 29880 29353 gene locus_tag LOCUS_00390 29880 29353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 30680 29988 gene locus_tag LOCUS_00400 30680 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 32041 30800 gene locus_tag LOCUS_00410 32041 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 32569 32168 gene locus_tag LOCUS_00420 32569 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 33174 32650 gene locus_tag LOCUS_00430 33174 32650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 33681 33181 gene locus_tag LOCUS_00440 33681 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 34281 33862 gene locus_tag LOCUS_00450 34281 33862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 35328 34360 gene locus_tag LOCUS_00460 35328 34360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 35742 35347 gene locus_tag LOCUS_00470 35742 35347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 37585 35963 gene locus_tag LOCUS_00480 37585 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 40063 37748 gene locus_tag LOCUS_00490 40063 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 40589 40137 gene locus_tag LOCUS_00500 40589 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 40758 41564 gene locus_tag LOCUS_00510 40758 41564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 42186 41719 gene locus_tag LOCUS_00520 42186 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 42629 42165 gene locus_tag LOCUS_00530 42629 42165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 43412 42690 gene locus_tag LOCUS_00540 43412 42690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 43723 43349 gene locus_tag LOCUS_00550 43723 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 46175 43707 gene locus_tag LOCUS_00560 46175 43707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 47669 46197 gene locus_tag LOCUS_00570 47669 46197 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_00570 48186 47647 gene locus_tag LOCUS_00580 48186 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 48886 48173 gene locus_tag LOCUS_00590 48886 48173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 49380 48943 gene locus_tag LOCUS_00600 49380 48943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 49678 49367 gene locus_tag LOCUS_00610 49678 49367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 50724 50023 gene locus_tag LOCUS_00620 50724 50023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 51475 50864 gene locus_tag LOCUS_00630 51475 50864 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_00630 52644 51475 gene locus_tag LOCUS_00640 52644 51475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 52907 52668 gene locus_tag LOCUS_00650 52907 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 53130 52891 gene locus_tag LOCUS_00660 53130 52891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 54327 53167 gene locus_tag LOCUS_00670 54327 53167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 55823 54324 gene locus_tag LOCUS_00680 gene dnaB 55823 54324 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_00680 56635 55853 gene locus_tag LOCUS_00690 56635 55853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 58046 56676 gene locus_tag LOCUS_00700 58046 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 58718 58263 gene locus_tag LOCUS_00710 58718 58263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 58693 59154 gene locus_tag LOCUS_00720 58693 59154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 59474 59220 gene locus_tag LOCUS_00730 59474 59220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 60460 59471 gene locus_tag LOCUS_00740 60460 59471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 60880 60659 gene locus_tag LOCUS_00750 60880 60659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 62768 61011 gene locus_tag LOCUS_00760 62768 61011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence0002 360 1175 gene locus_tag LOCUS_00770 360 1175 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_00770 1579 1504 gene locus_tag LOCUS_t00010 1579 1504 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2389 1721 gene locus_tag LOCUS_00780 2389 1721 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_00780 3318 2590 gene locus_tag LOCUS_00790 3318 2590 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_00790 5187 3451 gene locus_tag LOCUS_00800 gene sdhA 5187 3451 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_00800 5689 5240 gene locus_tag LOCUS_00810 5689 5240 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893078.1 protein_id gnl|my_center|LOCUS_00810 6115 5726 gene locus_tag LOCUS_00820 gene sdhC 6115 5726 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_00820 8126 6489 gene locus_tag LOCUS_00830 8126 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 9059 8142 gene locus_tag LOCUS_00840 9059 8142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_00840 9616 9029 gene locus_tag LOCUS_00850 9616 9029 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_00850 9877 11376 gene locus_tag LOCUS_00860 9877 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12333 11539 gene locus_tag LOCUS_00870 12333 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 12428 12763 gene locus_tag LOCUS_00880 12428 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 13858 12764 gene locus_tag LOCUS_00890 13858 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 15086 13905 gene locus_tag LOCUS_00900 15086 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 15433 15660 gene locus_tag LOCUS_00910 15433 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 18338 15828 gene locus_tag LOCUS_00920 18338 15828 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_00920 19856 18549 gene locus_tag LOCUS_00930 19856 18549 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_00930 20098 20259 gene locus_tag LOCUS_00940 20098 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 22166 20262 gene locus_tag LOCUS_00950 gene ftsH 22166 20262 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_00950 23675 22353 gene locus_tag LOCUS_00960 23675 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 24586 23783 gene locus_tag LOCUS_00970 24586 23783 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_00970 25070 24588 gene locus_tag LOCUS_00980 25070 24588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence0003 366 31 gene locus_tag LOCUS_00990 366 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 274 615 gene locus_tag LOCUS_01000 274 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2965 632 gene locus_tag LOCUS_01010 2965 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5698 3395 gene locus_tag LOCUS_01020 5698 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7409 5973 gene locus_tag LOCUS_01030 7409 5973 CDS product DUF1972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141784.1 protein_id gnl|my_center|LOCUS_01030 7734 8555 gene locus_tag LOCUS_01040 7734 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8635 9846 gene locus_tag LOCUS_01050 8635 9846 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_01050 9865 10548 gene locus_tag LOCUS_01060 9865 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10770 11249 gene locus_tag LOCUS_01070 10770 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11318 12121 gene locus_tag LOCUS_01080 11318 12121 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227787.1 protein_id gnl|my_center|LOCUS_01080 15466 12227 gene locus_tag LOCUS_01090 15466 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 17122 15767 gene locus_tag LOCUS_01100 17122 15767 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391935.1 protein_id gnl|my_center|LOCUS_01100 17916 17224 gene locus_tag LOCUS_01110 17916 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 17867 18046 gene locus_tag LOCUS_01120 17867 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 19536 18271 gene locus_tag LOCUS_01130 19536 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 20215 21321 gene locus_tag LOCUS_01140 20215 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 21756 22412 gene locus_tag LOCUS_01150 21756 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 22479 24338 gene locus_tag LOCUS_01160 22479 24338 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence0004 641 3328 gene locus_tag LOCUS_01170 641 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3714 3370 gene locus_tag LOCUS_01180 3714 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4344 3940 gene locus_tag LOCUS_01190 gene rpsI 4344 3940 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_01190 4885 4361 gene locus_tag LOCUS_01200 gene rplM 4885 4361 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_01200 5798 4998 gene locus_tag LOCUS_01210 gene truA 5798 4998 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_01210 6443 5811 gene locus_tag LOCUS_01220 6443 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 7523 6528 gene locus_tag LOCUS_01230 7523 6528 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_01230 8168 7539 gene locus_tag LOCUS_01240 gene rpsD 8168 7539 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_01240 8876 8469 gene locus_tag LOCUS_01250 gene rpsK 8876 8469 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_01250 9341 8961 gene locus_tag LOCUS_01260 gene rpsM 9341 8961 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_01260 9886 10095 gene locus_tag LOCUS_01270 9886 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 10203 9982 gene locus_tag LOCUS_01280 gene infA 10203 9982 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_01280 11394 10624 gene locus_tag LOCUS_01290 gene map 11394 10624 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01290 12124 11435 gene locus_tag LOCUS_01300 12124 11435 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258252.1 protein_id gnl|my_center|LOCUS_01300 13775 12435 gene locus_tag LOCUS_01310 gene secY 13775 12435 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_01310 13812 13997 gene locus_tag LOCUS_01320 13812 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14512 13994 gene locus_tag LOCUS_01330 gene rplO 14512 13994 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258250.1 protein_id gnl|my_center|LOCUS_01330 14694 14509 gene locus_tag LOCUS_01340 gene rpmD 14694 14509 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869911.1 protein_id gnl|my_center|LOCUS_01340 14955 14722 gene locus_tag LOCUS_01350 14955 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 15613 14852 gene locus_tag LOCUS_01360 15613 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 16053 15628 gene locus_tag LOCUS_01370 gene rplR 16053 15628 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_01370 16758 16198 gene locus_tag LOCUS_01380 gene rplF 16758 16198 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055712.1 protein_id gnl|my_center|LOCUS_01380 17164 16769 gene locus_tag LOCUS_01390 gene rpsH 17164 16769 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_01390 17374 17189 gene locus_tag LOCUS_01400 17374 17189 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_01400 18223 17585 gene locus_tag LOCUS_01410 gene rplE 18223 17585 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01410 18693 18226 gene locus_tag LOCUS_01420 18693 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 19079 18711 gene locus_tag LOCUS_01430 gene rplN 19079 18711 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_01430 19443 19081 gene locus_tag LOCUS_01440 19443 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 19705 19451 gene locus_tag LOCUS_01450 19705 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 20072 19692 gene locus_tag LOCUS_01460 gene rplP 20072 19692 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence0005 1940 915 gene locus_tag LOCUS_01470 gene idsA 1940 915 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_01470 2331 3833 gene locus_tag LOCUS_01480 gene selA 2331 3833 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_01480 5323 4283 gene locus_tag LOCUS_01490 5323 4283 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233579.1 protein_id gnl|my_center|LOCUS_01490 6039 5518 gene locus_tag LOCUS_01500 6039 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 6400 7392 gene locus_tag LOCUS_01510 6400 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 7631 7386 gene locus_tag LOCUS_01520 7631 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 7531 8088 gene locus_tag LOCUS_01530 7531 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8996 8124 gene locus_tag LOCUS_01540 8996 8124 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_01540 10061 9129 gene locus_tag LOCUS_01550 gene xerD 10061 9129 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_01550 11195 10245 gene locus_tag LOCUS_01560 11195 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 12001 11378 gene locus_tag LOCUS_01570 12001 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12667 12056 gene locus_tag LOCUS_01580 12667 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 14448 12865 gene locus_tag LOCUS_01590 gene pruA 14448 12865 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_01590 14784 17438 gene locus_tag LOCUS_01600 14784 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18883 17435 gene locus_tag LOCUS_01610 18883 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 19604 18897 gene locus_tag LOCUS_01620 gene nth 19604 18897 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence0006 925 1009 gene locus_tag LOCUS_t00020 925 1009 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1327 2868 gene locus_tag LOCUS_01630 gene tig 1327 2868 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_01630 3274 4551 gene locus_tag LOCUS_01640 gene clpX 3274 4551 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_01640 4719 7304 gene locus_tag LOCUS_01650 gene lon 4719 7304 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_01650 7608 9137 gene locus_tag LOCUS_01660 7608 9137 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_01660 9317 10639 gene locus_tag LOCUS_01670 9317 10639 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_01670 10663 11073 gene locus_tag LOCUS_01680 10663 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 11166 12455 gene locus_tag LOCUS_01690 11166 12455 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256882.1 protein_id gnl|my_center|LOCUS_01690 13279 12506 gene locus_tag LOCUS_01700 13279 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 14010 13306 gene locus_tag LOCUS_01710 14010 13306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_01710 14804 14013 gene locus_tag LOCUS_01720 14804 14013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_01720 16132 14807 gene locus_tag LOCUS_01730 16132 14807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_01730 17101 16145 gene locus_tag LOCUS_01740 17101 16145 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820410.1 protein_id gnl|my_center|LOCUS_01740 18568 17285 gene locus_tag LOCUS_01750 18568 17285 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence0007 687 265 gene locus_tag LOCUS_01760 687 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1310 696 gene locus_tag LOCUS_01770 1310 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2160 1378 gene locus_tag LOCUS_01780 2160 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4466 2187 gene locus_tag LOCUS_01790 4466 2187 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_01790 5800 4604 gene locus_tag LOCUS_01800 5800 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 7428 5965 gene locus_tag LOCUS_01810 7428 5965 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_01810 8083 8361 gene locus_tag LOCUS_01820 8083 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_01820 9091 8624 gene locus_tag LOCUS_01830 9091 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9317 9832 gene locus_tag LOCUS_01840 gene moaC 9317 9832 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_01840 9993 11492 gene locus_tag LOCUS_01850 9993 11492 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_01850 11657 12643 gene locus_tag LOCUS_01860 11657 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 14701 12734 gene locus_tag LOCUS_01870 14701 12734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_01870 15626 14763 gene locus_tag LOCUS_01880 15626 14763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227235.1 protein_id gnl|my_center|LOCUS_01880 16789 15626 gene locus_tag LOCUS_01890 16789 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18006 17185 gene locus_tag LOCUS_01900 18006 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18609 18436 gene locus_tag LOCUS_01910 18609 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 19145 18558 gene locus_tag LOCUS_01920 19145 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence0008 <1 686 gene locus_tag LOCUS_01930 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:Stk1 family PASTA domain-containing Ser/Thr kinase 835 1587 gene locus_tag LOCUS_01940 835 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3775 1850 gene locus_tag LOCUS_01950 gene gyrB 3775 1850 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258861.1 protein_id gnl|my_center|LOCUS_01950 6446 4287 gene locus_tag LOCUS_01960 6446 4287 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_01960 7292 6531 gene locus_tag LOCUS_01970 7292 6531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_01970 10662 7342 gene locus_tag LOCUS_01980 10662 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11488 10706 gene locus_tag LOCUS_01990 11488 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 12472 11606 gene locus_tag LOCUS_02000 12472 11606 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_02000 12644 14464 gene locus_tag LOCUS_02010 12644 14464 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_02010 14551 16329 gene locus_tag LOCUS_02020 14551 16329 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_02020 16493 16951 gene locus_tag LOCUS_02030 16493 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 17036 18229 gene locus_tag LOCUS_02040 17036 18229 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence0009 3059 282 gene locus_tag LOCUS_02050 3059 282 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_02050 3436 3224 gene locus_tag LOCUS_02060 3436 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5687 3582 gene locus_tag LOCUS_02070 5687 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6319 6675 gene locus_tag LOCUS_02080 6319 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6653 6847 gene locus_tag LOCUS_02090 6653 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02090 7021 6946 gene locus_tag LOCUS_t00030 7021 6946 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7577 7236 gene locus_tag LOCUS_02100 7577 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7624 9489 gene locus_tag LOCUS_02110 7624 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9606 10391 gene locus_tag LOCUS_02120 gene recO 9606 10391 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_02120 10633 11805 gene locus_tag LOCUS_02130 10633 11805 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763164.1 protein_id gnl|my_center|LOCUS_02130 12015 12410 gene locus_tag LOCUS_02140 12015 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 12646 13449 gene locus_tag LOCUS_02150 12646 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13876 15843 gene locus_tag LOCUS_02160 gene dxs 13876 15843 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_02160 16022 17398 gene locus_tag LOCUS_02170 16022 17398 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403699.1 protein_id gnl|my_center|LOCUS_02170 17663 18298 gene locus_tag LOCUS_02180 17663 18298 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence0010 1001 192 gene locus_tag LOCUS_02190 1001 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 1595 1990 gene locus_tag LOCUS_02200 1595 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2365 2126 gene locus_tag LOCUS_02210 2365 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2798 4033 gene locus_tag LOCUS_02220 2798 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4269 4922 gene locus_tag LOCUS_02230 4269 4922 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_02230 4980 6011 gene locus_tag LOCUS_02240 4980 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 6116 7039 gene locus_tag LOCUS_02250 gene larE 6116 7039 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_02250 7299 8003 gene locus_tag LOCUS_02260 7299 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8178 8783 gene locus_tag LOCUS_02270 8178 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 8825 9094 gene locus_tag LOCUS_02280 8825 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9981 10232 gene locus_tag LOCUS_02290 9981 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10733 12016 gene locus_tag LOCUS_02300 gene serS 10733 12016 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_02300 13321 12113 gene locus_tag LOCUS_02310 13321 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 14056 13721 gene locus_tag LOCUS_02320 14056 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 15338 14061 gene locus_tag LOCUS_02330 gene xseA 15338 14061 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_02330 16009 15488 gene locus_tag LOCUS_02340 gene accB 16009 15488 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259570.1 protein_id gnl|my_center|LOCUS_02340 16603 16043 gene locus_tag LOCUS_02350 gene efp 16603 16043 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence0011 90 1796 gene locus_tag LOCUS_02360 90 1796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909313.1 protein_id gnl|my_center|LOCUS_02360 1953 2465 gene locus_tag LOCUS_02370 1953 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2618 3088 gene locus_tag LOCUS_02380 2618 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3166 5055 gene locus_tag LOCUS_02390 3166 5055 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_02390 6037 5339 gene locus_tag LOCUS_02400 6037 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6691 6302 gene locus_tag LOCUS_02410 6691 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 7056 7853 gene locus_tag LOCUS_02420 7056 7853 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_02420 9843 7960 gene locus_tag LOCUS_02430 gene aspS 9843 7960 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_02430 12437 10035 gene locus_tag LOCUS_02440 12437 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 12803 13912 gene locus_tag LOCUS_02450 12803 13912 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_02450 14579 13932 gene locus_tag LOCUS_02460 14579 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14928 15230 gene locus_tag LOCUS_02470 14928 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 16240 15293 gene locus_tag LOCUS_02480 16240 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence0012 1111 6171 gene locus_tag LOCUS_02490 1111 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6279 6917 gene locus_tag LOCUS_02500 gene pdxH 6279 6917 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_02500 7204 8226 gene locus_tag LOCUS_02510 7204 8226 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_02510 8223 9380 gene locus_tag LOCUS_02520 8223 9380 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_02520 9389 10219 gene locus_tag LOCUS_02530 9389 10219 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257507.1 protein_id gnl|my_center|LOCUS_02530 10224 11120 gene locus_tag LOCUS_02540 10224 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11117 12403 gene locus_tag LOCUS_02550 11117 12403 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027422.1 protein_id gnl|my_center|LOCUS_02550 12400 13335 gene locus_tag LOCUS_02560 12400 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13468 14703 gene locus_tag LOCUS_02570 13468 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence0013 <1 1243 gene locus_tag LOCUS_02580 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023258.1:pentapeptide repeat-containing protein 1713 2498 gene locus_tag LOCUS_02590 1713 2498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_02590 3869 2508 gene locus_tag LOCUS_02600 3869 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5367 4192 gene locus_tag LOCUS_02610 5367 4192 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227848.1 protein_id gnl|my_center|LOCUS_02610 5652 8906 gene locus_tag LOCUS_02620 5652 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 9774 8998 gene locus_tag LOCUS_02630 9774 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10600 10055 gene locus_tag LOCUS_02640 10600 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 10702 11004 gene locus_tag LOCUS_02650 10702 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 12436 11117 gene locus_tag LOCUS_02660 gene recF 12436 11117 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922801.1 protein_id gnl|my_center|LOCUS_02660 14448 12970 gene locus_tag LOCUS_02670 gene aroA 14448 12970 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_02670 14734 15582 gene locus_tag LOCUS_02680 14734 15582 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence0014 31 246 gene locus_tag LOCUS_02690 31 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 1739 390 gene locus_tag LOCUS_02700 1739 390 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931696.1 protein_id gnl|my_center|LOCUS_02700 2134 2823 gene locus_tag LOCUS_02710 2134 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3082 3798 gene locus_tag LOCUS_02720 3082 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4467 3847 gene locus_tag LOCUS_02730 4467 3847 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_02730 4899 5141 gene locus_tag LOCUS_02740 4899 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6601 5165 gene locus_tag LOCUS_02750 gene atoC 6601 5165 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_02750 7319 6996 gene locus_tag LOCUS_02760 7319 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7221 7457 gene locus_tag LOCUS_02770 7221 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 8838 7588 gene locus_tag LOCUS_02780 8838 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9117 10259 gene locus_tag LOCUS_02790 9117 10259 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_02790 10311 11228 gene locus_tag LOCUS_02800 10311 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 11396 11770 gene locus_tag LOCUS_02810 11396 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 13291 11966 gene locus_tag LOCUS_02820 13291 11966 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_02820 15136 13337 gene locus_tag LOCUS_02830 gene thrS 15136 13337 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_02830 15246 15665 gene locus_tag LOCUS_02840 15246 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0015 100 981 gene locus_tag LOCUS_02850 100 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1289 2749 gene locus_tag LOCUS_02860 1289 2749 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143733.1 protein_id gnl|my_center|LOCUS_02860 2766 3800 gene locus_tag LOCUS_02870 2766 3800 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_02870 3874 6114 gene locus_tag LOCUS_02880 3874 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6116 7798 gene locus_tag LOCUS_02890 6116 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9255 7978 gene locus_tag LOCUS_02900 9255 7978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161162.1 protein_id gnl|my_center|LOCUS_02900 10433 9252 gene locus_tag LOCUS_02910 10433 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10853 11218 gene locus_tag LOCUS_02920 10853 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11387 12925 gene locus_tag LOCUS_02930 11387 12925 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_02930 13017 13262 gene locus_tag LOCUS_02940 13017 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02940 13259 13693 gene locus_tag LOCUS_02950 13259 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 13690 14406 gene locus_tag LOCUS_02960 gene purQ 13690 14406 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0016 171 1124 gene locus_tag LOCUS_02970 171 1124 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_02970 1168 2514 gene locus_tag LOCUS_02980 1168 2514 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_02980 3488 2607 gene locus_tag LOCUS_02990 3488 2607 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_02990 4641 3460 gene locus_tag LOCUS_03000 4641 3460 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_03000 5810 4644 gene locus_tag LOCUS_03010 5810 4644 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909136.1 protein_id gnl|my_center|LOCUS_03010 7403 5913 gene locus_tag LOCUS_03020 7403 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 8374 7400 gene locus_tag LOCUS_03030 8374 7400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_03030 10082 8532 gene locus_tag LOCUS_03040 gene gltX 10082 8532 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_03040 9985 10326 gene locus_tag LOCUS_03050 9985 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10377 12950 gene locus_tag LOCUS_03060 10377 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13463 13089 gene locus_tag LOCUS_03070 13463 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 14063 13533 gene locus_tag LOCUS_03080 14063 13533 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence0017 <1 1072 gene locus_tag LOCUS_03090 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031484.1:N-acetylmuramoyl-L-alanine amidase 1461 2192 gene locus_tag LOCUS_03100 1461 2192 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_03100 2984 2436 gene locus_tag LOCUS_03110 2984 2436 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975773.1 protein_id gnl|my_center|LOCUS_03110 4012 3263 gene locus_tag LOCUS_03120 4012 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4509 4063 gene locus_tag LOCUS_03130 4509 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4885 8646 gene locus_tag LOCUS_03140 gene smc 4885 8646 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_03140 8690 10171 gene locus_tag LOCUS_03150 8690 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 10294 10369 gene locus_tag LOCUS_t00040 10294 10369 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12299 10428 gene locus_tag LOCUS_03160 gene glmS 12299 10428 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_03160 13396 12719 gene locus_tag LOCUS_03170 13396 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 13955 13626 gene locus_tag LOCUS_03180 13955 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence0018 <1 1187 gene locus_tag LOCUS_03190 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530049.1:AAA family ATPase 2595 1330 gene locus_tag LOCUS_03200 2595 1330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_03200 2858 3232 gene locus_tag LOCUS_03210 2858 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3571 4992 gene locus_tag LOCUS_03220 3571 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5067 5501 gene locus_tag LOCUS_03230 5067 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5498 6247 gene locus_tag LOCUS_03240 5498 6247 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_03240 7554 6913 gene locus_tag LOCUS_03250 7554 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7743 8996 gene locus_tag LOCUS_03260 7743 8996 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_03260 9369 10997 gene locus_tag LOCUS_03270 gene metG 9369 10997 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_03270 11467 12147 gene locus_tag LOCUS_03280 11467 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence0019 <1 970 gene locus_tag LOCUS_03290 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189334.1:peptidylprolyl isomerase 1001 2341 gene locus_tag LOCUS_03300 gene hemW 1001 2341 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_03300 2713 2498 gene locus_tag LOCUS_03310 2713 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3131 2871 gene locus_tag LOCUS_03320 3131 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3081 4781 gene locus_tag LOCUS_03330 3081 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5955 4837 gene locus_tag LOCUS_03340 5955 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6619 6167 gene locus_tag LOCUS_03350 6619 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6877 6632 gene locus_tag LOCUS_03360 6877 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 8334 7219 gene locus_tag LOCUS_03370 gene fni 8334 7219 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_03370 9415 8426 gene locus_tag LOCUS_03380 9415 8426 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_03380 11812 9497 gene locus_tag LOCUS_03390 11812 9497 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151611289.1 protein_id gnl|my_center|LOCUS_03390 12406 11891 gene locus_tag LOCUS_03400 12406 11891 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_03400 12626 13363 gene locus_tag LOCUS_03410 12626 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence0020 <1 922 gene locus_tag LOCUS_03420 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902257.1:S9 family peptidase 1152 1445 gene locus_tag LOCUS_03430 gene rpsP 1152 1445 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_03430 1479 1736 gene locus_tag LOCUS_03440 1479 1736 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_03440 1708 2331 gene locus_tag LOCUS_03450 gene rimM 1708 2331 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_03450 2492 3547 gene locus_tag LOCUS_03460 gene ctaA 2492 3547 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_03460 7632 3892 gene locus_tag LOCUS_03470 7632 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7769 7996 gene locus_tag LOCUS_03480 7769 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8665 9369 gene locus_tag LOCUS_03490 8665 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9397 9615 gene locus_tag LOCUS_03500 9397 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11303 10341 gene locus_tag LOCUS_03510 11303 10341 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257874.1 protein_id gnl|my_center|LOCUS_03510 12146 11379 gene locus_tag LOCUS_03520 12146 11379 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112427.1 protein_id gnl|my_center|LOCUS_03520 12527 12279 gene locus_tag LOCUS_03530 12527 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12970 12503 gene locus_tag LOCUS_03540 12970 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence0021 108 839 gene locus_tag LOCUS_03550 108 839 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_03550 930 2222 gene locus_tag LOCUS_03560 gene purD 930 2222 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_03560 2392 4398 gene locus_tag LOCUS_03570 2392 4398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_03570 8021 4503 gene locus_tag LOCUS_03580 8021 4503 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_03580 8677 9099 gene locus_tag LOCUS_03590 8677 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10129 9122 gene locus_tag LOCUS_03600 10129 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10333 11250 gene locus_tag LOCUS_03610 10333 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12008 11310 gene locus_tag LOCUS_03620 12008 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 12701 12018 gene locus_tag LOCUS_03630 12701 12018 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence0022 237 518 gene locus_tag LOCUS_03640 237 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 573 1064 gene locus_tag LOCUS_03650 573 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1149 1787 gene locus_tag LOCUS_03660 gene nusG 1149 1787 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_03660 2062 2484 gene locus_tag LOCUS_03670 gene rplK 2062 2484 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_03670 2689 3294 gene locus_tag LOCUS_03680 gene rplA 2689 3294 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_03680 3757 4293 gene locus_tag LOCUS_03690 gene rplJ 3757 4293 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258052.1 protein_id gnl|my_center|LOCUS_03690 4445 4834 gene locus_tag LOCUS_03700 gene rplL 4445 4834 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258053.1 protein_id gnl|my_center|LOCUS_03700 5571 5218 gene locus_tag LOCUS_03710 5571 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5489 6775 gene locus_tag LOCUS_03720 5489 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7780 6824 gene locus_tag LOCUS_03730 7780 6824 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_03730 8631 7921 gene locus_tag LOCUS_03740 8631 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8906 9820 gene locus_tag LOCUS_03750 gene fdhD 8906 9820 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_03750 10008 9802 gene locus_tag LOCUS_03760 10008 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11506 10166 gene locus_tag LOCUS_03770 11506 10166 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_03770 11953 11525 gene locus_tag LOCUS_03780 11953 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 <12720 12045 gene locus_tag LOCUS_03790 <12720 12045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000545544.1:acyl-CoA dehydrogenase AcdA >Feature sequence0023 2015 912 gene locus_tag LOCUS_03800 gene hppD 2015 912 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_03800 2691 4349 gene locus_tag LOCUS_03810 2691 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4897 4454 gene locus_tag LOCUS_03820 4897 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5554 7227 gene locus_tag LOCUS_03830 5554 7227 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257675.1 protein_id gnl|my_center|LOCUS_03830 7501 10026 gene locus_tag LOCUS_03840 7501 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10036 10647 gene locus_tag LOCUS_03850 10036 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence0024 <1 1125 gene locus_tag LOCUS_03860 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942105.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 2349 1228 gene locus_tag LOCUS_03870 2349 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3967 2777 gene locus_tag LOCUS_03880 3967 2777 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_03880 5142 4135 gene locus_tag LOCUS_03890 5142 4135 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_03890 6136 5414 gene locus_tag LOCUS_03900 6136 5414 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_03900 7469 6219 gene locus_tag LOCUS_03910 7469 6219 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314978.1 protein_id gnl|my_center|LOCUS_03910 7772 8851 gene locus_tag LOCUS_03920 7772 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9114 9953 gene locus_tag LOCUS_03930 9114 9953 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_03930 11050 10115 gene locus_tag LOCUS_03940 gene rpoD 11050 10115 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_03940 12001 11507 gene locus_tag LOCUS_03950 12001 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence0025 1029 763 gene locus_tag LOCUS_03960 1029 763 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_03960 1632 2180 gene locus_tag LOCUS_03970 1632 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2269 3249 gene locus_tag LOCUS_03980 2269 3249 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_03980 6460 3305 gene locus_tag LOCUS_03990 6460 3305 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928763.1 protein_id gnl|my_center|LOCUS_03990 8121 6844 gene locus_tag LOCUS_04000 gene dprA 8121 6844 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_04000 8812 8225 gene locus_tag LOCUS_04010 8812 8225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_04010 9128 10468 gene locus_tag LOCUS_04020 9128 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10976 10527 gene locus_tag LOCUS_04030 gene queF 10976 10527 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_04030 11207 11953 gene locus_tag LOCUS_04040 11207 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence0026 20 1006 gene locus_tag LOCUS_04050 20 1006 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_04050 2431 1058 gene locus_tag LOCUS_04060 2431 1058 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_04060 2755 2546 gene locus_tag LOCUS_04070 2755 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3691 2894 gene locus_tag LOCUS_04080 gene paaC 3691 2894 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_04080 4080 3754 gene locus_tag LOCUS_04090 4080 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4448 4077 gene locus_tag LOCUS_04100 4448 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5398 4448 gene locus_tag LOCUS_04110 gene paaA 5398 4448 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206395.1 protein_id gnl|my_center|LOCUS_04110 5971 5639 gene locus_tag LOCUS_04120 5971 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6206 8221 gene locus_tag LOCUS_04130 6206 8221 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_04130 8843 8586 gene locus_tag LOCUS_04140 8843 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 8850 8990 gene locus_tag LOCUS_04150 8850 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10048 9524 gene locus_tag LOCUS_04160 10048 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10833 11921 gene locus_tag LOCUS_04170 10833 11921 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence0027 2481 91 gene locus_tag LOCUS_04180 2481 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3264 2722 gene locus_tag LOCUS_04190 3264 2722 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_04190 4096 3380 gene locus_tag LOCUS_04200 4096 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4808 5515 gene locus_tag LOCUS_04210 4808 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5699 6574 gene locus_tag LOCUS_04220 5699 6574 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 protein_id gnl|my_center|LOCUS_04220 6755 7123 gene locus_tag LOCUS_04230 6755 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7816 7589 gene locus_tag LOCUS_04240 7816 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8550 8867 gene locus_tag LOCUS_04250 8550 8867 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_04250 9367 9642 gene locus_tag LOCUS_04260 9367 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11862 9736 gene locus_tag LOCUS_04270 gene uvrC 11862 9736 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence0028 1049 486 gene locus_tag LOCUS_04280 1049 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04280 1372 2739 gene locus_tag LOCUS_04290 1372 2739 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933564.1 protein_id gnl|my_center|LOCUS_04290 3012 3956 gene locus_tag LOCUS_04300 3012 3956 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_04300 4259 4750 gene locus_tag LOCUS_04310 4259 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6021 4747 gene locus_tag LOCUS_04320 6021 4747 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_04320 7478 6018 gene locus_tag LOCUS_04330 7478 6018 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_04330 7776 8528 gene locus_tag LOCUS_04340 7776 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056441.1 protein_id gnl|my_center|LOCUS_04340 8557 10314 gene locus_tag LOCUS_04350 8557 10314 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0029 <1 2077 gene locus_tag LOCUS_04360 <1 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 2308 3606 gene locus_tag LOCUS_04370 2308 3606 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_04370 3620 4456 gene locus_tag LOCUS_04380 3620 4456 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_04380 5920 4496 gene locus_tag LOCUS_04390 5920 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7959 6112 gene locus_tag LOCUS_04400 7959 6112 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_04400 7847 8185 gene locus_tag LOCUS_04410 7847 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9238 8198 gene locus_tag LOCUS_04420 9238 8198 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_04420 9616 10539 gene locus_tag LOCUS_04430 9616 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 10779 11846 gene locus_tag LOCUS_04440 10779 11846 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence0030 573 1226 gene locus_tag LOCUS_04450 gene cobC 573 1226 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_04450 3596 1272 gene locus_tag LOCUS_04460 3596 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5344 3971 gene locus_tag LOCUS_04470 5344 3971 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_04470 6305 5334 gene locus_tag LOCUS_04480 6305 5334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_04480 6657 7661 gene locus_tag LOCUS_04490 6657 7661 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_04490 7701 8528 gene locus_tag LOCUS_04500 7701 8528 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947356.1 protein_id gnl|my_center|LOCUS_04500 8748 9851 gene locus_tag LOCUS_04510 8748 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 9890 10879 gene locus_tag LOCUS_04520 9890 10879 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence0031 627 196 gene locus_tag LOCUS_04530 627 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1361 642 gene locus_tag LOCUS_04540 gene rph 1361 642 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_04540 1496 2260 gene locus_tag LOCUS_04550 1496 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2539 3456 gene locus_tag LOCUS_04560 2539 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3505 4089 gene locus_tag LOCUS_04570 3505 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4686 4312 gene locus_tag LOCUS_04580 4686 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7486 4778 gene locus_tag LOCUS_04590 7486 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8963 7734 gene locus_tag LOCUS_04600 8963 7734 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_04600 9305 10447 gene locus_tag LOCUS_04610 gene sucC 9305 10447 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_04610 10449 11318 gene locus_tag LOCUS_04620 gene sucD 10449 11318 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence0032 21 881 gene locus_tag LOCUS_04630 21 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1764 958 gene locus_tag LOCUS_04640 1764 958 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_04640 2334 1807 gene locus_tag LOCUS_04650 2334 1807 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_04650 4303 2381 gene locus_tag LOCUS_04660 4303 2381 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_04660 4388 5068 gene locus_tag LOCUS_04670 4388 5068 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_04670 5868 5125 gene locus_tag LOCUS_04680 5868 5125 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_04680 6097 7470 gene locus_tag LOCUS_04690 6097 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8180 7968 gene locus_tag LOCUS_04700 8180 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8067 9188 gene locus_tag LOCUS_04710 8067 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9402 10568 gene locus_tag LOCUS_04720 9402 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11733 10660 gene locus_tag LOCUS_04730 11733 10660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence0033 180 2159 gene locus_tag LOCUS_04740 180 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2325 3851 gene locus_tag LOCUS_04750 2325 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4309 3848 gene locus_tag LOCUS_04760 4309 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5876 4419 gene locus_tag LOCUS_04770 5876 4419 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041958803.1 protein_id gnl|my_center|LOCUS_04770 6751 5915 gene locus_tag LOCUS_04780 6751 5915 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_04780 8824 6836 gene locus_tag LOCUS_04790 gene murJ 8824 6836 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_04790 9289 9900 gene locus_tag LOCUS_04800 9289 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence0034 1 384 gene locus_tag LOCUS_04810 1 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 393 1025 gene locus_tag LOCUS_04820 393 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1015 2031 gene locus_tag LOCUS_04830 1015 2031 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_04830 2135 2374 gene locus_tag LOCUS_04840 2135 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2361 2762 gene locus_tag LOCUS_04850 2361 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2920 4101 gene locus_tag LOCUS_04860 2920 4101 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_04860 4424 6871 gene locus_tag LOCUS_04870 4424 6871 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_04870 8951 6858 gene locus_tag LOCUS_04880 8951 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 9979 9170 gene locus_tag LOCUS_04890 9979 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 10227 11138 gene locus_tag LOCUS_04900 10227 11138 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence0035 196 612 gene locus_tag LOCUS_04910 196 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 860 1630 gene locus_tag LOCUS_04920 860 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1639 2802 gene locus_tag LOCUS_04930 1639 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2870 3853 gene locus_tag LOCUS_04940 2870 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4293 5552 gene locus_tag LOCUS_04950 4293 5552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_04950 5681 6430 gene locus_tag LOCUS_04960 5681 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6412 7695 gene locus_tag LOCUS_04970 6412 7695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_04970 7846 7762 gene locus_tag LOCUS_t00050 7846 7762 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8509 7943 gene locus_tag LOCUS_04980 gene hpt 8509 7943 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_04980 9677 8676 gene locus_tag LOCUS_04990 9677 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10136 10840 gene locus_tag LOCUS_05000 gene upp 10136 10840 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence0036 1038 2492 gene locus_tag LOCUS_05010 1038 2492 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_05010 2537 3856 gene locus_tag LOCUS_05020 2537 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5297 3879 gene locus_tag LOCUS_05030 5297 3879 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762937.1 protein_id gnl|my_center|LOCUS_05030 5654 7534 gene locus_tag LOCUS_05040 5654 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7544 8488 gene locus_tag LOCUS_05050 7544 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10716 8563 gene locus_tag LOCUS_05060 gene recG 10716 8563 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence0037 2273 3361 gene locus_tag LOCUS_05070 2273 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3476 3865 gene locus_tag LOCUS_05080 3476 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4178 5500 gene locus_tag LOCUS_05090 gene eno 4178 5500 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_05090 5789 6832 gene locus_tag LOCUS_05100 5789 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7335 7102 gene locus_tag LOCUS_05110 7335 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence0038 2458 575 gene locus_tag LOCUS_05120 gene dnaK 2458 575 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_05120 3310 2630 gene locus_tag LOCUS_05130 3310 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4478 3384 gene locus_tag LOCUS_05140 gene hrcA 4478 3384 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_05140 4748 5626 gene locus_tag LOCUS_05150 4748 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5822 7357 gene locus_tag LOCUS_05160 gene mazG 5822 7357 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_05160 7517 8104 gene locus_tag LOCUS_05170 7517 8104 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_05170 9031 8162 gene locus_tag LOCUS_05180 9031 8162 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533219.1 protein_id gnl|my_center|LOCUS_05180 9789 9343 gene locus_tag LOCUS_05190 9789 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10453 9893 gene locus_tag LOCUS_05200 10453 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence0039 1551 418 gene locus_tag LOCUS_05210 1551 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1884 2936 gene locus_tag LOCUS_05220 1884 2936 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_05220 3070 4407 gene locus_tag LOCUS_05230 3070 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4853 6103 gene locus_tag LOCUS_05240 4853 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6454 6146 gene locus_tag LOCUS_05250 6454 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 7365 6619 gene locus_tag LOCUS_05260 7365 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 7701 8843 gene locus_tag LOCUS_05270 gene gcvT 7701 8843 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_05270 8911 9318 gene locus_tag LOCUS_05280 gene gcvH 8911 9318 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_05280 10321 9359 gene locus_tag LOCUS_05290 10321 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0040 1244 618 gene locus_tag LOCUS_05300 1244 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1550 2014 gene locus_tag LOCUS_05310 1550 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2895 2362 gene locus_tag LOCUS_05320 2895 2362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102671.1 protein_id gnl|my_center|LOCUS_05320 3593 3189 gene locus_tag LOCUS_05330 3593 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05330 6085 4310 gene locus_tag LOCUS_05340 6085 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6456 6088 gene locus_tag LOCUS_05350 6456 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6626 7174 gene locus_tag LOCUS_05360 6626 7174 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_05360 7230 8072 gene locus_tag LOCUS_05370 7230 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 8581 8132 gene locus_tag LOCUS_05380 8581 8132 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_05380 8790 9377 gene locus_tag LOCUS_05390 8790 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9386 9865 gene locus_tag LOCUS_05400 9386 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence0041 1059 34 gene locus_tag LOCUS_05410 gene rfaE1 1059 34 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_05410 1921 1067 gene locus_tag LOCUS_05420 1921 1067 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_05420 4258 2225 gene locus_tag LOCUS_05430 4258 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5410 8691 gene locus_tag LOCUS_05440 5410 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8894 8688 gene locus_tag LOCUS_05450 8894 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8893 10047 gene locus_tag LOCUS_05460 gene yhbH 8893 10047 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence0042 1796 594 gene locus_tag LOCUS_05470 1796 594 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727108.1 protein_id gnl|my_center|LOCUS_05470 2983 1844 gene locus_tag LOCUS_05480 gene ugpC 2983 1844 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_05480 4914 3037 gene locus_tag LOCUS_05490 4914 3037 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256397.1 protein_id gnl|my_center|LOCUS_05490 5165 6667 gene locus_tag LOCUS_05500 gene malQ 5165 6667 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_05500 6820 7242 gene locus_tag LOCUS_05510 6820 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7517 9013 gene locus_tag LOCUS_05520 gene guaB 7517 9013 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256512.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence0043 115 888 gene locus_tag LOCUS_05530 gene cmk 115 888 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_05530 888 1670 gene locus_tag LOCUS_05540 888 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1808 2653 gene locus_tag LOCUS_05550 1808 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3189 2650 gene locus_tag LOCUS_05560 3189 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3903 3211 gene locus_tag LOCUS_05570 gene ybeY 3903 3211 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_05570 5537 4050 gene locus_tag LOCUS_05580 5537 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 7108 5675 gene locus_tag LOCUS_05590 7108 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7711 8289 gene locus_tag LOCUS_05600 7711 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9166 8321 gene locus_tag LOCUS_05610 9166 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 <10304 9699 gene locus_tag LOCUS_05620 <10304 9699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393886.1:CTP synthase >Feature sequence0044 91 969 gene locus_tag LOCUS_05630 91 969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888314.1 protein_id gnl|my_center|LOCUS_05630 2261 981 gene locus_tag LOCUS_05640 2261 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3316 2879 gene locus_tag LOCUS_05650 3316 2879 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_05650 3564 3313 gene locus_tag LOCUS_05660 3564 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4086 4784 gene locus_tag LOCUS_05670 4086 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4781 6358 gene locus_tag LOCUS_05680 4781 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6473 7306 gene locus_tag LOCUS_05690 6473 7306 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258275.1 protein_id gnl|my_center|LOCUS_05690 7330 7461 gene locus_tag LOCUS_05700 7330 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7854 8765 gene locus_tag LOCUS_05710 7854 8765 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_05710 <10266 8832 gene locus_tag LOCUS_05720 <10266 8832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0045 1806 907 gene locus_tag LOCUS_05730 1806 907 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_05730 3353 1803 gene locus_tag LOCUS_05740 gene rny 3353 1803 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_05740 3731 3489 gene locus_tag LOCUS_05750 3731 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3673 4242 gene locus_tag LOCUS_05760 3673 4242 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_05760 4363 4677 gene locus_tag LOCUS_05770 4363 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5720 4674 gene locus_tag LOCUS_05780 5720 4674 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_05780 6864 5803 gene locus_tag LOCUS_05790 6864 5803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_05790 7837 6899 gene locus_tag LOCUS_05800 7837 6899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_05800 8856 7870 gene locus_tag LOCUS_05810 8856 7870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_05810 <10098 9320 gene locus_tag LOCUS_05820 <10098 9320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174519688.1:ABC transporter family substrate-binding protein >Feature sequence0046 580 1587 gene locus_tag LOCUS_05830 580 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1604 1984 gene locus_tag LOCUS_05840 1604 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2461 2000 gene locus_tag LOCUS_05850 2461 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7501 2630 gene locus_tag LOCUS_05860 7501 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 8518 7703 gene locus_tag LOCUS_05870 8518 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 <10066 8532 gene locus_tag LOCUS_05880 <10066 8532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence0047 <1 940 gene locus_tag LOCUS_05890 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583513.1:BMP family ABC transporter substrate-binding protein 1252 2460 gene locus_tag LOCUS_05900 1252 2460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_05900 2457 3389 gene locus_tag LOCUS_05910 2457 3389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_05910 3400 4995 gene locus_tag LOCUS_05920 3400 4995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_05920 5472 6968 gene locus_tag LOCUS_05930 5472 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7342 7599 gene locus_tag LOCUS_05940 7342 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <10011 8169 gene locus_tag LOCUS_05950 <10011 8169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950528.1:LuxR family transcriptional regulator >Feature sequence0048 1864 392 gene locus_tag LOCUS_05960 gene cysS 1864 392 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 protein_id gnl|my_center|LOCUS_05960 2365 3006 gene locus_tag LOCUS_05970 gene coxH3 2365 3006 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_05970 3217 4230 gene locus_tag LOCUS_05980 3217 4230 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_05980 4227 5141 gene locus_tag LOCUS_05990 4227 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5692 5138 gene locus_tag LOCUS_06000 5692 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6281 5850 gene locus_tag LOCUS_06010 6281 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6162 6830 gene locus_tag LOCUS_06020 6162 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6928 7719 gene locus_tag LOCUS_06030 6928 7719 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_06030 7728 8180 gene locus_tag LOCUS_06040 7728 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8201 9562 gene locus_tag LOCUS_06050 8201 9562 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259723.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0049 963 565 gene locus_tag LOCUS_06060 963 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1147 2145 gene locus_tag LOCUS_06070 1147 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3520 2159 gene locus_tag LOCUS_06080 3520 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4550 3798 gene locus_tag LOCUS_06090 4550 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4928 5644 gene locus_tag LOCUS_06100 4928 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5989 6369 gene locus_tag LOCUS_06110 5989 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6394 7227 gene locus_tag LOCUS_06120 6394 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7336 7908 gene locus_tag LOCUS_06130 7336 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7905 8189 gene locus_tag LOCUS_06140 7905 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8192 8389 gene locus_tag LOCUS_06150 8192 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8386 8655 gene locus_tag LOCUS_06160 8386 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8670 8957 gene locus_tag LOCUS_06170 8670 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 8957 9241 gene locus_tag LOCUS_06180 8957 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0050 680 1138 gene locus_tag LOCUS_06190 680 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1242 3530 gene locus_tag LOCUS_06200 1242 3530 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_06200 3739 3476 gene locus_tag LOCUS_06210 3739 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3935 4237 gene locus_tag LOCUS_06220 3935 4237 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_06220 4340 4951 gene locus_tag LOCUS_06230 gene recR 4340 4951 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_06230 5019 5597 gene locus_tag LOCUS_06240 5019 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5852 6937 gene locus_tag LOCUS_06250 gene recA 5852 6937 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_06250 7537 7160 gene locus_tag LOCUS_06260 7537 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <9794 7540 gene locus_tag LOCUS_06270 <9794 7540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228224.1:DNA translocase FtsK >Feature sequence0051 162 1331 gene locus_tag LOCUS_06280 162 1331 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_06280 1842 1342 gene locus_tag LOCUS_06290 1842 1342 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_06290 2134 2673 gene locus_tag LOCUS_06300 2134 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3371 2733 gene locus_tag LOCUS_06310 3371 2733 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_06310 7014 3403 gene locus_tag LOCUS_06320 gene metH 7014 3403 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_06320 7795 7259 gene locus_tag LOCUS_06330 7795 7259 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256097.1 protein_id gnl|my_center|LOCUS_06330 8121 8756 gene locus_tag LOCUS_06340 8121 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9035 8826 gene locus_tag LOCUS_06350 9035 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8922 9674 gene locus_tag LOCUS_06360 8922 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence0052 1 1134 gene locus_tag LOCUS_06370 1 1134 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541187.1 protein_id gnl|my_center|LOCUS_06370 1930 1274 gene locus_tag LOCUS_06380 1930 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2292 2071 gene locus_tag LOCUS_06390 2292 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2362 3639 gene locus_tag LOCUS_06400 gene hutI 2362 3639 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_06400 3776 5545 gene locus_tag LOCUS_06410 3776 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5657 5881 gene locus_tag LOCUS_06420 5657 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5969 7390 gene locus_tag LOCUS_06430 5969 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 8871 7609 gene locus_tag LOCUS_06440 8871 7609 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_06440 <9666 9057 gene locus_tag LOCUS_06450 <9666 9057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001015682.1:HPP family protein >Feature sequence0053 <1 521 gene locus_tag LOCUS_06460 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393958.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 690 1247 gene locus_tag LOCUS_06470 690 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1596 1318 gene locus_tag LOCUS_06480 1596 1318 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_06480 3146 1620 gene locus_tag LOCUS_06490 3146 1620 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_06490 3960 3190 gene locus_tag LOCUS_06500 gene fabG 3960 3190 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_06500 4188 6239 gene locus_tag LOCUS_06510 4188 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6252 7088 gene locus_tag LOCUS_06520 6252 7088 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence0054 395 1549 gene locus_tag LOCUS_06530 gene acdA 395 1549 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_06530 1974 2501 gene locus_tag LOCUS_06540 1974 2501 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_06540 2498 3985 gene locus_tag LOCUS_06550 2498 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4338 5756 gene locus_tag LOCUS_06560 4338 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6350 5772 gene locus_tag LOCUS_06570 6350 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 6519 8084 gene locus_tag LOCUS_06580 gene purF 6519 8084 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_06580 8152 8517 gene locus_tag LOCUS_06590 8152 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence0055 <1 871 gene locus_tag LOCUS_06600 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256673.1:alpha/beta fold hydrolase 1842 895 gene locus_tag LOCUS_06610 1842 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2480 1947 gene locus_tag LOCUS_06620 gene uraD 2480 1947 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_06620 3844 2480 gene locus_tag LOCUS_06630 3844 2480 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_06630 4719 4030 gene locus_tag LOCUS_06640 4719 4030 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776304.1 protein_id gnl|my_center|LOCUS_06640 5205 5292 gene locus_tag LOCUS_t00060 5205 5292 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5845 5411 gene locus_tag LOCUS_06650 5845 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8932 6137 gene locus_tag LOCUS_06660 8932 6137 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909089.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0056 886 1746 gene locus_tag LOCUS_06670 886 1746 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_06670 3189 1807 gene locus_tag LOCUS_06680 3189 1807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_06680 3838 3356 gene locus_tag LOCUS_06690 3838 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4355 3825 gene locus_tag LOCUS_06700 4355 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4480 5310 gene locus_tag LOCUS_06710 4480 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6325 5393 gene locus_tag LOCUS_06720 6325 5393 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_06720 6666 6409 gene locus_tag LOCUS_06730 6666 6409 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_06730 6844 7020 gene locus_tag LOCUS_06740 6844 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7149 8090 gene locus_tag LOCUS_06750 7149 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9429 8344 gene locus_tag LOCUS_06760 9429 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence0057 230 373 gene locus_tag LOCUS_06770 230 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1335 358 gene locus_tag LOCUS_06780 gene galE 1335 358 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_06780 1760 2536 gene locus_tag LOCUS_06790 1760 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4104 2533 gene locus_tag LOCUS_06800 4104 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4913 4170 gene locus_tag LOCUS_06810 4913 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5986 5009 gene locus_tag LOCUS_06820 5986 5009 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_06820 6294 7586 gene locus_tag LOCUS_06830 6294 7586 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_06830 7821 7570 gene locus_tag LOCUS_06840 gene rpmE 7821 7570 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_06840 8991 8173 gene locus_tag LOCUS_06850 8991 8173 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257730.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence0058 38 751 gene locus_tag LOCUS_06860 38 751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_06860 1269 880 gene locus_tag LOCUS_06870 1269 880 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_06870 1409 1266 gene locus_tag LOCUS_06880 1409 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1881 2858 gene locus_tag LOCUS_06890 1881 2858 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200923.1 protein_id gnl|my_center|LOCUS_06890 3461 2958 gene locus_tag LOCUS_06900 3461 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3751 3437 gene locus_tag LOCUS_06910 3751 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4682 4215 gene locus_tag LOCUS_06920 4682 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5536 4826 gene locus_tag LOCUS_06930 5536 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8202 5590 gene locus_tag LOCUS_06940 8202 5590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_06940 8960 8241 gene locus_tag LOCUS_06950 8960 8241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0059 197 994 gene locus_tag LOCUS_06960 197 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1203 1637 gene locus_tag LOCUS_06970 1203 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1923 2801 gene locus_tag LOCUS_06980 1923 2801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_06980 2882 4603 gene locus_tag LOCUS_06990 2882 4603 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_06990 5048 5536 gene locus_tag LOCUS_07000 5048 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence0060 438 217 gene locus_tag LOCUS_07010 438 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2065 512 gene locus_tag LOCUS_07020 2065 512 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_07020 2356 3021 gene locus_tag LOCUS_07030 2356 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3046 3438 gene locus_tag LOCUS_07040 3046 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3414 3986 gene locus_tag LOCUS_07050 3414 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 4004 4456 gene locus_tag LOCUS_07060 4004 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4624 5301 gene locus_tag LOCUS_07070 4624 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6040 5303 gene locus_tag LOCUS_07080 6040 5303 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_07080 7195 6149 gene locus_tag LOCUS_07090 7195 6149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_07090 7955 7284 gene locus_tag LOCUS_07100 gene clpP 7955 7284 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_07100 8256 7990 gene locus_tag LOCUS_07110 8256 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8466 8843 gene locus_tag LOCUS_07120 8466 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0061 1701 286 gene locus_tag LOCUS_07130 1701 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4941 1846 gene locus_tag LOCUS_07140 4941 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6875 5238 gene locus_tag LOCUS_07150 6875 5238 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_07150 7047 8855 gene locus_tag LOCUS_07160 7047 8855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence0062 427 101 gene locus_tag LOCUS_07170 427 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 1041 460 gene locus_tag LOCUS_07180 1041 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07180 1509 3851 gene locus_tag LOCUS_07190 1509 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4607 7630 gene locus_tag LOCUS_07200 4607 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7834 8922 gene locus_tag LOCUS_07210 7834 8922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence0063 <1 758 gene locus_tag LOCUS_07220 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080091.1:twin-arginine translocase subunit TatC 1727 840 gene locus_tag LOCUS_07230 1727 840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458999.1 protein_id gnl|my_center|LOCUS_07230 3017 1803 gene locus_tag LOCUS_07240 3017 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4245 3151 gene locus_tag LOCUS_07250 4245 3151 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 protein_id gnl|my_center|LOCUS_07250 4816 4262 gene locus_tag LOCUS_07260 4816 4262 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039269.1 protein_id gnl|my_center|LOCUS_07260 5199 4900 gene locus_tag LOCUS_07270 5199 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5652 5260 gene locus_tag LOCUS_07280 gene erpA 5652 5260 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_07280 5995 6732 gene locus_tag LOCUS_07290 5995 6732 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_07290 7615 6737 gene locus_tag LOCUS_07300 7615 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8683 8021 gene locus_tag LOCUS_07310 8683 8021 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence0064 968 114 gene locus_tag LOCUS_07320 968 114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_07320 1257 1448 gene locus_tag LOCUS_07330 1257 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1899 2627 gene locus_tag LOCUS_07340 1899 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2993 2649 gene locus_tag LOCUS_07350 2993 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4038 3028 gene locus_tag LOCUS_07360 4038 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4371 4934 gene locus_tag LOCUS_07370 4371 4934 CDS product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226053.1 protein_id gnl|my_center|LOCUS_07370 5875 5012 gene locus_tag LOCUS_07380 5875 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6298 5900 gene locus_tag LOCUS_07390 6298 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6718 6323 gene locus_tag LOCUS_07400 6718 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07400 7039 8037 gene locus_tag LOCUS_07410 7039 8037 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_07410 8618 8268 gene locus_tag LOCUS_07420 8618 8268 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0065 921 268 gene locus_tag LOCUS_07430 921 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_07430 1841 930 gene locus_tag LOCUS_07440 1841 930 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_07440 2254 4353 gene locus_tag LOCUS_07450 2254 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4722 4958 gene locus_tag LOCUS_07460 4722 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6254 5406 gene locus_tag LOCUS_07470 gene otsB 6254 5406 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877362.1 protein_id gnl|my_center|LOCUS_07470 6877 6434 gene locus_tag LOCUS_07480 gene mscL 6877 6434 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_07480 7773 7210 gene locus_tag LOCUS_07490 7773 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8741 7950 gene locus_tag LOCUS_07500 8741 7950 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0066 323 1330 gene locus_tag LOCUS_07510 323 1330 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_07510 1890 1426 gene locus_tag LOCUS_07520 1890 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2354 1938 gene locus_tag LOCUS_07530 2354 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4030 2423 gene locus_tag LOCUS_07540 4030 2423 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525068.1 protein_id gnl|my_center|LOCUS_07540 4591 7665 gene locus_tag LOCUS_07550 4591 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8140 8577 gene locus_tag LOCUS_07560 8140 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0067 1238 1645 gene locus_tag LOCUS_07570 1238 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1848 1642 gene locus_tag LOCUS_07580 1848 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2072 3301 gene locus_tag LOCUS_07590 gene eis2 2072 3301 CDS product amikacin resistance N-acetyltransferase Eis2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079811.1 protein_id gnl|my_center|LOCUS_07590 3494 4207 gene locus_tag LOCUS_07600 3494 4207 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_07600 6972 4333 gene locus_tag LOCUS_07610 6972 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7317 8846 gene locus_tag LOCUS_07620 gene accC 7317 8846 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence0068 825 256 gene locus_tag LOCUS_07630 825 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1266 835 gene locus_tag LOCUS_07640 1266 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2247 2378 gene locus_tag LOCUS_07650 2247 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2550 2478 gene locus_tag LOCUS_t00070 2550 2478 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2880 3950 gene locus_tag LOCUS_07660 2880 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5684 4080 gene locus_tag LOCUS_07670 5684 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6370 5681 gene locus_tag LOCUS_07680 6370 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7821 6511 gene locus_tag LOCUS_07690 7821 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 <8948 7927 gene locus_tag LOCUS_07700 <8948 7927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094318.1:Nif3-like dinuclear metal center hexameric protein >Feature sequence0069 2162 435 gene locus_tag LOCUS_07710 2162 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3144 2386 gene locus_tag LOCUS_07720 3144 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5544 3289 gene locus_tag LOCUS_07730 5544 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6706 5636 gene locus_tag LOCUS_07740 6706 5636 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_07740 7710 6703 gene locus_tag LOCUS_07750 7710 6703 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence0070 760 2661 gene locus_tag LOCUS_07760 760 2661 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_07760 2648 3721 gene locus_tag LOCUS_07770 gene queA 2648 3721 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_07770 3839 4390 gene locus_tag LOCUS_07780 3839 4390 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_07780 5194 4442 gene locus_tag LOCUS_07790 gene rnc 5194 4442 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869841.1 protein_id gnl|my_center|LOCUS_07790 7806 5191 gene locus_tag LOCUS_07800 7806 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8854 8270 gene locus_tag LOCUS_07810 8854 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence0071 <1 1860 gene locus_tag LOCUS_07820 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583753.1:penicillin-binding protein 2 3504 1999 gene locus_tag LOCUS_07830 3504 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3866 4633 gene locus_tag LOCUS_07840 3866 4633 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_07840 4670 6118 gene locus_tag LOCUS_07850 4670 6118 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_07850 7214 6168 gene locus_tag LOCUS_07860 7214 6168 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_07860 8438 7479 gene locus_tag LOCUS_07870 gene rbsK 8438 7479 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_07870 8425 8667 gene locus_tag LOCUS_07880 8425 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence0072 1010 189 gene locus_tag LOCUS_07890 gene coxB 1010 189 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928955.1 protein_id gnl|my_center|LOCUS_07890 1877 1116 gene locus_tag LOCUS_07900 1877 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2888 2169 gene locus_tag LOCUS_07910 2888 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3189 4040 gene locus_tag LOCUS_07920 3189 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258540.1 protein_id gnl|my_center|LOCUS_07920 4269 5552 gene locus_tag LOCUS_07930 gene argJ 4269 5552 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_07930 4575 4504 gene locus_tag LOCUS_t00080 4575 4504 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5562 6797 gene locus_tag LOCUS_07940 5562 6797 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_07940 6831 8309 gene locus_tag LOCUS_07950 6831 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence0073 759 685 gene locus_tag LOCUS_t00090 759 685 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 899 813 gene locus_tag LOCUS_t00100 899 813 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1793 1227 gene locus_tag LOCUS_07960 1793 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2567 1929 gene locus_tag LOCUS_07970 2567 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3920 2964 gene locus_tag LOCUS_07980 3920 2964 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065221.1 protein_id gnl|my_center|LOCUS_07980 5020 4328 gene locus_tag LOCUS_07990 5020 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5607 5056 gene locus_tag LOCUS_08000 5607 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6103 6516 gene locus_tag LOCUS_08010 6103 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7224 8333 gene locus_tag LOCUS_08020 7224 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence0074 1569 2999 gene locus_tag LOCUS_08030 gene lpdA 1569 2999 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_08030 3232 3711 gene locus_tag LOCUS_08040 3232 3711 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846895.1 protein_id gnl|my_center|LOCUS_08040 3818 4117 gene locus_tag LOCUS_08050 3818 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5837 4233 gene locus_tag LOCUS_08060 5837 4233 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_08060 6130 5921 gene locus_tag LOCUS_08070 6130 5921 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194775.1 protein_id gnl|my_center|LOCUS_08070 6463 6846 gene locus_tag LOCUS_08080 6463 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7276 8037 gene locus_tag LOCUS_08090 7276 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 <8753 8107 gene locus_tag LOCUS_08100 <8753 8107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338577.1:FAD-dependent oxidoreductase >Feature sequence0075 834 1085 gene locus_tag LOCUS_08110 834 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1128 1349 gene locus_tag LOCUS_08120 1128 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08120 1378 1890 gene locus_tag LOCUS_08130 1378 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08130 2189 3796 gene locus_tag LOCUS_08140 2189 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3858 6632 gene locus_tag LOCUS_08150 3858 6632 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258514.1 protein_id gnl|my_center|LOCUS_08150 7556 6753 gene locus_tag LOCUS_08160 7556 6753 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_08160 7836 8642 gene locus_tag LOCUS_08170 7836 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence0076 344 730 gene locus_tag LOCUS_08180 344 730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_08180 837 1532 gene locus_tag LOCUS_08190 837 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1792 3729 gene locus_tag LOCUS_08200 1792 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3808 8214 gene locus_tag LOCUS_08210 3808 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 8249 8467 gene locus_tag LOCUS_08220 8249 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence0077 1172 114 gene locus_tag LOCUS_08230 1172 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1408 2415 gene locus_tag LOCUS_08240 gene add 1408 2415 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_08240 3232 2489 gene locus_tag LOCUS_08250 3232 2489 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_08250 3346 3846 gene locus_tag LOCUS_08260 3346 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08260 3856 4239 gene locus_tag LOCUS_08270 3856 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4387 5394 gene locus_tag LOCUS_08280 4387 5394 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889300.1 protein_id gnl|my_center|LOCUS_08280 5476 6048 gene locus_tag LOCUS_08290 5476 6048 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_08290 6178 6750 gene locus_tag LOCUS_08300 6178 6750 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_08300 7930 6782 gene locus_tag LOCUS_08310 7930 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0078 <1 1173 gene locus_tag LOCUS_08320 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964756.1:tetracycline efflux MFS transporter TetA(P) 2092 1220 gene locus_tag LOCUS_08330 2092 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2004 3383 gene locus_tag LOCUS_08340 2004 3383 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_08340 3596 3973 gene locus_tag LOCUS_08350 3596 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4219 5451 gene locus_tag LOCUS_08360 gene dcm 4219 5451 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_08360 6228 5455 gene locus_tag LOCUS_08370 6228 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 6355 6807 gene locus_tag LOCUS_08380 6355 6807 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence0079 378 91 gene locus_tag LOCUS_08390 378 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1067 453 gene locus_tag LOCUS_08400 1067 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2582 1071 gene locus_tag LOCUS_08410 2582 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5002 2579 gene locus_tag LOCUS_08420 5002 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5687 5202 gene locus_tag LOCUS_08430 5687 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5904 5668 gene locus_tag LOCUS_08440 5904 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6161 5847 gene locus_tag LOCUS_08450 6161 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6317 6883 gene locus_tag LOCUS_08460 6317 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7051 7293 gene locus_tag LOCUS_08470 7051 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7796 7419 gene locus_tag LOCUS_08480 7796 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8083 7793 gene locus_tag LOCUS_08490 8083 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8429 8073 gene locus_tag LOCUS_08500 8429 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence0080 2401 902 gene locus_tag LOCUS_08510 2401 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4103 2667 gene locus_tag LOCUS_08520 4103 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4462 4833 gene locus_tag LOCUS_08530 4462 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6250 4874 gene locus_tag LOCUS_08540 6250 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 <8580 6337 gene locus_tag LOCUS_08550 <8580 6337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461496.1:Tex family protein >Feature sequence0081 1616 885 gene locus_tag LOCUS_08560 1616 885 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_08560 1865 2224 gene locus_tag LOCUS_08570 1865 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2408 3259 gene locus_tag LOCUS_08580 2408 3259 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_08580 3513 4118 gene locus_tag LOCUS_08590 3513 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4245 4586 gene locus_tag LOCUS_08600 4245 4586 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903937.1 protein_id gnl|my_center|LOCUS_08600 4684 6132 gene locus_tag LOCUS_08610 gene rpoN 4684 6132 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_08610 7049 6165 gene locus_tag LOCUS_08620 7049 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7672 7112 gene locus_tag LOCUS_08630 7672 7112 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461696.1 protein_id gnl|my_center|LOCUS_08630 <8521 7975 gene locus_tag LOCUS_08640 <8521 7975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867316.1:PLP-dependent aminotransferase family protein >Feature sequence0082 1323 115 gene locus_tag LOCUS_08650 1323 115 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146919646.1 protein_id gnl|my_center|LOCUS_08650 1696 1532 gene locus_tag LOCUS_08660 1696 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3301 1715 gene locus_tag LOCUS_08670 3301 1715 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_08670 3489 4859 gene locus_tag LOCUS_08680 3489 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4872 5237 gene locus_tag LOCUS_08690 gene uraH 4872 5237 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_08690 5258 6514 gene locus_tag LOCUS_08700 5258 6514 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035539.1 protein_id gnl|my_center|LOCUS_08700 6720 6938 gene locus_tag LOCUS_08710 6720 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence0083 254 1015 gene locus_tag LOCUS_08720 254 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2245 1019 gene locus_tag LOCUS_08730 2245 1019 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_08730 2606 3478 gene locus_tag LOCUS_08740 gene pgeF 2606 3478 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_08740 3661 4395 gene locus_tag LOCUS_08750 3661 4395 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_08750 4475 4984 gene locus_tag LOCUS_08760 4475 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5107 5403 gene locus_tag LOCUS_08770 5107 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5731 7314 gene locus_tag LOCUS_08780 5731 7314 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence0084 <1 692 gene locus_tag LOCUS_08790 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958185.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 689 3283 gene locus_tag LOCUS_08800 689 3283 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_08800 4425 3301 gene locus_tag LOCUS_08810 gene rsgA 4425 3301 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_08810 4757 5758 gene locus_tag LOCUS_08820 4757 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5992 5801 gene locus_tag LOCUS_08830 5992 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 7686 6076 gene locus_tag LOCUS_08840 7686 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence0085 3238 2792 gene locus_tag LOCUS_08850 3238 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3513 3737 gene locus_tag LOCUS_08860 3513 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3716 4216 gene locus_tag LOCUS_08870 3716 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5536 4250 gene locus_tag LOCUS_08880 5536 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6088 5633 gene locus_tag LOCUS_08890 6088 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6562 6852 gene locus_tag LOCUS_08900 6562 6852 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_08900 6944 8050 gene locus_tag LOCUS_08910 6944 8050 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence0086 937 290 gene locus_tag LOCUS_08920 gene lepB 937 290 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_08920 1280 2857 gene locus_tag LOCUS_08930 gene gpmI 1280 2857 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_08930 2894 3493 gene locus_tag LOCUS_08940 2894 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3514 4020 gene locus_tag LOCUS_08950 3514 4020 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887321.1 protein_id gnl|my_center|LOCUS_08950 4724 4134 gene locus_tag LOCUS_08960 4724 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7861 4958 gene locus_tag LOCUS_08970 7861 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence0087 1 393 gene locus_tag LOCUS_08980 1 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 607 1581 gene locus_tag LOCUS_08990 gene hemH 607 1581 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_08990 1584 2582 gene locus_tag LOCUS_09000 1584 2582 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_09000 2630 3439 gene locus_tag LOCUS_09010 2630 3439 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_09010 3778 4863 gene locus_tag LOCUS_09020 3778 4863 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804101.1 protein_id gnl|my_center|LOCUS_09020 6126 4873 gene locus_tag LOCUS_09030 6126 4873 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_09030 6888 6187 gene locus_tag LOCUS_09040 6888 6187 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_09040 <8183 7056 gene locus_tag LOCUS_09050 <8183 7056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258936.1:DEAD/DEAH box helicase >Feature sequence0088 1261 395 gene locus_tag LOCUS_09060 1261 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3335 1344 gene locus_tag LOCUS_09070 3335 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4625 3786 gene locus_tag LOCUS_09080 4625 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 5319 6812 gene locus_tag LOCUS_09090 5319 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6915 7379 gene locus_tag LOCUS_09100 6915 7379 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942308.1 protein_id gnl|my_center|LOCUS_09100 8162 7503 gene locus_tag LOCUS_09110 8162 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0089 1006 1923 gene locus_tag LOCUS_09120 gene speB 1006 1923 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_09120 1983 2222 gene locus_tag LOCUS_09130 1983 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2219 2425 gene locus_tag LOCUS_09140 2219 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2785 6198 gene locus_tag LOCUS_09150 2785 6198 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_09150 6218 7135 gene locus_tag LOCUS_09160 6218 7135 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_09160 7263 7505 gene locus_tag LOCUS_09170 7263 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence0090 1613 3415 gene locus_tag LOCUS_09180 1613 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3508 5205 gene locus_tag LOCUS_09190 3508 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6487 5252 gene locus_tag LOCUS_09200 6487 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence0091 696 911 gene locus_tag LOCUS_09210 gene rpmB 696 911 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869653.1 protein_id gnl|my_center|LOCUS_09210 1043 1852 gene locus_tag LOCUS_09220 1043 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228097.1 protein_id gnl|my_center|LOCUS_09220 1849 2913 gene locus_tag LOCUS_09230 1849 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4034 2952 gene locus_tag LOCUS_09240 gene holB 4034 2952 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_09240 4131 3952 gene locus_tag LOCUS_09250 4131 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4225 4887 gene locus_tag LOCUS_09260 4225 4887 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_09260 5340 4912 gene locus_tag LOCUS_09270 5340 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence0092 1747 68 gene locus_tag LOCUS_09280 1747 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2472 2173 gene locus_tag LOCUS_09290 2472 2173 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_09290 2966 3361 gene locus_tag LOCUS_09300 2966 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3406 4047 gene locus_tag LOCUS_09310 3406 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4264 5550 gene locus_tag LOCUS_09320 4264 5550 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_09320 5666 5547 gene locus_tag LOCUS_09330 5666 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5702 7741 gene locus_tag LOCUS_09340 gene fusA 5702 7741 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence0093 586 311 gene locus_tag LOCUS_09350 586 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 849 1829 gene locus_tag LOCUS_09360 gene deoC 849 1829 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385062.1 protein_id gnl|my_center|LOCUS_09360 2080 2487 gene locus_tag LOCUS_09370 2080 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2578 5052 gene locus_tag LOCUS_09380 2578 5052 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975661.1 protein_id gnl|my_center|LOCUS_09380 5333 5704 gene locus_tag LOCUS_09390 5333 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6423 5821 gene locus_tag LOCUS_09400 6423 5821 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 protein_id gnl|my_center|LOCUS_09400 7215 6496 gene locus_tag LOCUS_09410 7215 6496 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_09410 7442 7245 gene locus_tag LOCUS_09420 7442 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0094 202 44 gene locus_tag LOCUS_09430 202 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 341 192 gene locus_tag LOCUS_09440 341 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 360 692 gene locus_tag LOCUS_09450 360 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1008 2519 gene locus_tag LOCUS_09460 gene glpK 1008 2519 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_09460 2731 3096 gene locus_tag LOCUS_09470 2731 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3093 3536 gene locus_tag LOCUS_09480 3093 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 3529 5148 gene locus_tag LOCUS_09490 3529 5148 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222413.1 protein_id gnl|my_center|LOCUS_09490 5264 6493 gene locus_tag LOCUS_09500 gene cruC 5264 6493 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_09500 6483 7520 gene locus_tag LOCUS_09510 6483 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0095 128 205 gene locus_tag LOCUS_t00110 128 205 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1307 792 gene locus_tag LOCUS_09520 1307 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2569 2291 gene locus_tag LOCUS_09530 2569 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3428 2487 gene locus_tag LOCUS_09540 3428 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3738 3496 gene locus_tag LOCUS_09550 3738 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4236 5312 gene locus_tag LOCUS_09560 4236 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 6554 5412 gene locus_tag LOCUS_09570 gene acdA 6554 5412 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_09570 7348 6677 gene locus_tag LOCUS_09580 7348 6677 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080568.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence0096 1194 97 gene locus_tag LOCUS_09590 gene prfA 1194 97 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_09590 1520 1392 gene locus_tag LOCUS_09600 1520 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1928 2470 gene locus_tag LOCUS_09610 1928 2470 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_09610 2631 2819 gene locus_tag LOCUS_09620 2631 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3102 4349 gene locus_tag LOCUS_09630 3102 4349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_09630 4881 5330 gene locus_tag LOCUS_09640 4881 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5814 6113 gene locus_tag LOCUS_09650 5814 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0097 <1 928 gene locus_tag LOCUS_09660 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917137.1:two-component system sensor histidine kinase MtrB 965 1963 gene locus_tag LOCUS_09670 965 1963 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_09670 2368 2150 gene locus_tag LOCUS_09680 2368 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 2443 2946 gene locus_tag LOCUS_09690 2443 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3311 2970 gene locus_tag LOCUS_09700 3311 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5636 3345 gene locus_tag LOCUS_09710 5636 3345 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_09710 5859 6755 gene locus_tag LOCUS_09720 5859 6755 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 protein_id gnl|my_center|LOCUS_09720 6927 7385 gene locus_tag LOCUS_09730 6927 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 <7897 7366 gene locus_tag LOCUS_09740 <7897 7366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392638.1:deoxyribonuclease IV >Feature sequence0098 710 2191 gene locus_tag LOCUS_09750 710 2191 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_09750 3908 2355 gene locus_tag LOCUS_09760 3908 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4847 4086 gene locus_tag LOCUS_09770 4847 4086 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_09770 5537 5869 gene locus_tag LOCUS_09780 5537 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5870 6250 gene locus_tag LOCUS_09790 5870 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 6463 7749 gene locus_tag LOCUS_09800 6463 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence0099 1780 2256 gene locus_tag LOCUS_09810 1780 2256 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_09810 3047 2403 gene locus_tag LOCUS_09820 3047 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3528 4886 gene locus_tag LOCUS_09830 3528 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4952 5836 gene locus_tag LOCUS_09840 4952 5836 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_09840 7409 5931 gene locus_tag LOCUS_09850 gene glgA 7409 5931 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence0100 649 320 gene locus_tag LOCUS_09860 649 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 531 1334 gene locus_tag LOCUS_09870 531 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1439 2335 gene locus_tag LOCUS_09880 1439 2335 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_09880 2374 2763 gene locus_tag LOCUS_09890 2374 2763 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_09890 2820 3716 gene locus_tag LOCUS_09900 2820 3716 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_09900 4016 4690 gene locus_tag LOCUS_09910 4016 4690 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222581.1 protein_id gnl|my_center|LOCUS_09910 4712 5605 gene locus_tag LOCUS_09920 4712 5605 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_09920 5794 6564 gene locus_tag LOCUS_09930 5794 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 <7765 6587 gene locus_tag LOCUS_09940 <7765 6587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224279.1:DUF4139 domain-containing protein >Feature sequence0101 <1 727 gene locus_tag LOCUS_09950 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357324.1:tyrosine--tRNA ligase 934 4182 gene locus_tag LOCUS_09960 gene fdh 934 4182 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:1492..1494,aa:Sec) note codon on position 187 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_09960 4211 5080 gene locus_tag LOCUS_09970 4211 5080 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225066.1 protein_id gnl|my_center|LOCUS_09970 5133 6284 gene locus_tag LOCUS_09980 gene nrfD 5133 6284 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225065.1 protein_id gnl|my_center|LOCUS_09980 7373 6468 gene locus_tag LOCUS_09990 7373 6468 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948181.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence0102 <1 834 gene locus_tag LOCUS_10000 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816474.1:molecular chaperone DnaJ 1601 840 gene locus_tag LOCUS_10010 1601 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2023 2385 gene locus_tag LOCUS_10020 2023 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3264 2479 gene locus_tag LOCUS_10030 3264 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3603 4895 gene locus_tag LOCUS_10040 3603 4895 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_10040 5021 5899 gene locus_tag LOCUS_10050 gene galU 5021 5899 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_10050 6026 6799 gene locus_tag LOCUS_10060 gene fabG 6026 6799 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_10060 7139 7666 gene locus_tag LOCUS_10070 7139 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence0103 291 1649 gene locus_tag LOCUS_10080 291 1649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_10080 2818 1691 gene locus_tag LOCUS_10090 2818 1691 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_10090 4843 2966 gene locus_tag LOCUS_10100 4843 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5633 4986 gene locus_tag LOCUS_10110 5633 4986 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256712.1 protein_id gnl|my_center|LOCUS_10110 6188 6760 gene locus_tag LOCUS_10120 6188 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6811 7218 gene locus_tag LOCUS_10130 6811 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0104 1014 160 gene locus_tag LOCUS_10140 1014 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1185 1988 gene locus_tag LOCUS_10150 1185 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2769 2011 gene locus_tag LOCUS_10160 2769 2011 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_10160 4562 2865 gene locus_tag LOCUS_10170 4562 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 5315 4965 gene locus_tag LOCUS_10180 5315 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7445 5619 gene locus_tag LOCUS_10190 gene mutL 7445 5619 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0105 73 1683 gene locus_tag LOCUS_10200 73 1683 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_10200 1811 2275 gene locus_tag LOCUS_10210 gene ripB 1811 2275 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_10210 2272 3438 gene locus_tag LOCUS_10220 gene atuD 2272 3438 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_10220 3488 4852 gene locus_tag LOCUS_10230 3488 4852 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_10230 4857 5219 gene locus_tag LOCUS_10240 4857 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_10240 5408 5881 gene locus_tag LOCUS_10250 5408 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 5898 6242 gene locus_tag LOCUS_10260 5898 6242 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_10260 6261 7064 gene locus_tag LOCUS_10270 6261 7064 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence0106 1482 109 gene locus_tag LOCUS_10280 gene carA 1482 109 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_10280 2975 1575 gene locus_tag LOCUS_10290 2975 1575 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257761.1 protein_id gnl|my_center|LOCUS_10290 4040 3051 gene locus_tag LOCUS_10300 4040 3051 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_10300 4686 4114 gene locus_tag LOCUS_10310 gene pyrR 4686 4114 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_10310 6444 5248 gene locus_tag LOCUS_10320 6444 5248 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_10320 7208 6558 gene locus_tag LOCUS_10330 7208 6558 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0107 <1 1136 gene locus_tag LOCUS_10340 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583974.1:SMC family ATPase 2386 1283 gene locus_tag LOCUS_10350 gene mqnC 2386 1283 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_10350 2982 2557 gene locus_tag LOCUS_10360 2982 2557 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_10360 4387 3062 gene locus_tag LOCUS_10370 4387 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_10370 5225 4389 gene locus_tag LOCUS_10380 5225 4389 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_10380 5983 5336 gene locus_tag LOCUS_10390 5983 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence0108 522 1295 gene locus_tag LOCUS_10400 522 1295 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_10400 1629 2516 gene locus_tag LOCUS_10410 1629 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2699 3589 gene locus_tag LOCUS_10420 2699 3589 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726715.1 protein_id gnl|my_center|LOCUS_10420 3649 4449 gene locus_tag LOCUS_10430 3649 4449 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_10430 4523 4993 gene locus_tag LOCUS_10440 4523 4993 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887487.1 protein_id gnl|my_center|LOCUS_10440 5132 5518 gene locus_tag LOCUS_10450 5132 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 5521 5868 gene locus_tag LOCUS_10460 5521 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 6718 6116 gene locus_tag LOCUS_10470 6718 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10470 7353 6715 gene locus_tag LOCUS_10480 7353 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 >Feature sequence0109 3 179 gene locus_tag LOCUS_10490 3 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 145 339 gene locus_tag LOCUS_10500 145 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 341 2260 gene locus_tag LOCUS_10510 341 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2764 3681 gene locus_tag LOCUS_10520 2764 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4542 3748 gene locus_tag LOCUS_10530 4542 3748 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_10530 5470 4715 gene locus_tag LOCUS_10540 5470 4715 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_10540 6420 5623 gene locus_tag LOCUS_10550 6420 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 <7479 6588 gene locus_tag LOCUS_10560 <7479 6588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207790654.1:pentapeptide repeat-containing protein >Feature sequence0110 1140 712 gene locus_tag LOCUS_10570 1140 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3212 1506 gene locus_tag LOCUS_10580 3212 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3486 4370 gene locus_tag LOCUS_10590 3486 4370 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_10590 4408 5016 gene locus_tag LOCUS_10600 4408 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5315 6379 gene locus_tag LOCUS_10610 gene coxB 5315 6379 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence0111 340 1743 gene locus_tag LOCUS_10620 340 1743 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_10620 2343 2573 gene locus_tag LOCUS_10630 2343 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2570 2842 gene locus_tag LOCUS_10640 2570 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_10640 2858 3016 gene locus_tag LOCUS_10650 2858 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3891 3499 gene locus_tag LOCUS_10660 3891 3499 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531183.1 protein_id gnl|my_center|LOCUS_10660 3986 4864 gene locus_tag LOCUS_10670 gene sigJ 3986 4864 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_10670 5550 5954 gene locus_tag LOCUS_10680 gene aroH 5550 5954 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_10680 5951 7060 gene locus_tag LOCUS_10690 gene aroF 5951 7060 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence0112 1256 159 gene locus_tag LOCUS_10700 gene hemC 1256 159 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_10700 1849 2544 gene locus_tag LOCUS_10710 1849 2544 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258487.1 protein_id gnl|my_center|LOCUS_10710 2567 3118 gene locus_tag LOCUS_10720 2567 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3099 3275 gene locus_tag LOCUS_10730 3099 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3909 4529 gene locus_tag LOCUS_10740 3909 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4539 5225 gene locus_tag LOCUS_10750 4539 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5218 6537 gene locus_tag LOCUS_10760 5218 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence0113 1270 3810 gene locus_tag LOCUS_10770 1270 3810 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_10770 3927 3700 gene locus_tag LOCUS_10780 3927 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4018 5400 gene locus_tag LOCUS_10790 gene radA 4018 5400 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_10790 5640 6854 gene locus_tag LOCUS_10800 5640 6854 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0114 435 1031 gene locus_tag LOCUS_10810 gene tsf 435 1031 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_10810 1143 1889 gene locus_tag LOCUS_10820 gene pyrH 1143 1889 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_10820 1950 2507 gene locus_tag LOCUS_10830 gene frr 1950 2507 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_10830 2545 3438 gene locus_tag LOCUS_10840 2545 3438 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_10840 3642 4472 gene locus_tag LOCUS_10850 3642 4472 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_10850 5789 4512 gene locus_tag LOCUS_10860 5789 4512 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_10860 6180 7184 gene locus_tag LOCUS_10870 6180 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0115 547 819 gene locus_tag LOCUS_10880 547 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1333 2805 gene locus_tag LOCUS_10890 1333 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 2893 3066 gene locus_tag LOCUS_10900 2893 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3467 3081 gene locus_tag LOCUS_10910 3467 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 4572 3601 gene locus_tag LOCUS_10920 4572 3601 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_10920 5755 4766 gene locus_tag LOCUS_10930 5755 4766 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_10930 6000 6929 gene locus_tag LOCUS_10940 6000 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence0116 720 1508 gene locus_tag LOCUS_10950 720 1508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421595.1 protein_id gnl|my_center|LOCUS_10950 1653 2084 gene locus_tag LOCUS_10960 1653 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2286 3341 gene locus_tag LOCUS_10970 gene ruvB 2286 3341 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_10970 3869 5293 gene locus_tag LOCUS_10980 3869 5293 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_10980 6596 5370 gene locus_tag LOCUS_10990 6596 5370 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730427.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence0117 493 693 gene locus_tag LOCUS_11000 gene rpmF 493 693 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258267.1 protein_id gnl|my_center|LOCUS_11000 816 1826 gene locus_tag LOCUS_11010 gene fabD 816 1826 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_11010 1879 2301 gene locus_tag LOCUS_11020 1879 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2276 2749 gene locus_tag LOCUS_11030 gene nusB 2276 2749 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_11030 2752 3003 gene locus_tag LOCUS_11040 gene acpP 2752 3003 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774381.1 protein_id gnl|my_center|LOCUS_11040 4147 3269 gene locus_tag LOCUS_11050 4147 3269 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256393.1 protein_id gnl|my_center|LOCUS_11050 4702 5907 gene locus_tag LOCUS_11060 4702 5907 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 protein_id gnl|my_center|LOCUS_11060 6110 7069 gene locus_tag LOCUS_11070 6110 7069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0118 3868 4203 gene locus_tag LOCUS_11080 3868 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4321 5016 gene locus_tag LOCUS_11090 4321 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <7213 5163 gene locus_tag LOCUS_11100 <7213 5163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727975.1:preprotein translocase subunit SecA >Feature sequence0119 1947 1300 gene locus_tag LOCUS_11110 1947 1300 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_11110 3574 2186 gene locus_tag LOCUS_11120 3574 2186 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_11120 4592 3591 gene locus_tag LOCUS_11130 4592 3591 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_11130 5911 4679 gene locus_tag LOCUS_11140 gene pdhA 5911 4679 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_11140 6090 6335 gene locus_tag LOCUS_11150 6090 6335 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_11150 6857 6612 gene locus_tag LOCUS_11160 6857 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence0120 969 661 gene locus_tag LOCUS_11170 969 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 968 1792 gene locus_tag LOCUS_11180 968 1792 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_11180 1872 3869 gene locus_tag LOCUS_11190 1872 3869 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_11190 4373 5797 gene locus_tag LOCUS_11200 4373 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5810 7099 gene locus_tag LOCUS_11210 5810 7099 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762720.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence0121 781 272 gene locus_tag LOCUS_11220 781 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2384 1083 gene locus_tag LOCUS_11230 gene odhB 2384 1083 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259557.1 protein_id gnl|my_center|LOCUS_11230 5310 2392 gene locus_tag LOCUS_11240 5310 2392 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259558.1 protein_id gnl|my_center|LOCUS_11240 5656 6768 gene locus_tag LOCUS_11250 5656 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence0122 1678 212 gene locus_tag LOCUS_11260 1678 212 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_11260 2695 1892 gene locus_tag LOCUS_11270 2695 1892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_11270 3669 2692 gene locus_tag LOCUS_11280 3669 2692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_11280 3935 4750 gene locus_tag LOCUS_11290 3935 4750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_11290 4856 5890 gene locus_tag LOCUS_11300 4856 5890 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence0123 2907 1741 gene locus_tag LOCUS_11310 2907 1741 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905137.1 protein_id gnl|my_center|LOCUS_11310 3164 5020 gene locus_tag LOCUS_11320 gene pepF 3164 5020 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_11320 5209 5451 gene locus_tag LOCUS_11330 5209 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6826 5672 gene locus_tag LOCUS_11340 6826 5672 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909198.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0124 166 663 gene locus_tag LOCUS_11350 166 663 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_11350 560 877 gene locus_tag LOCUS_11360 560 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 862 1737 gene locus_tag LOCUS_11370 gene couO 862 1737 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_11370 1900 2436 gene locus_tag LOCUS_11380 1900 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3996 2689 gene locus_tag LOCUS_11390 gene hemL 3996 2689 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_11390 5036 4023 gene locus_tag LOCUS_11400 5036 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5256 5041 gene locus_tag LOCUS_11410 5256 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5794 5468 gene locus_tag LOCUS_11420 5794 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5742 6269 gene locus_tag LOCUS_11430 5742 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6323 6760 gene locus_tag LOCUS_11440 6323 6760 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0125 716 375 gene locus_tag LOCUS_11450 716 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1993 914 gene locus_tag LOCUS_11460 1993 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3011 2124 gene locus_tag LOCUS_11470 3011 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3678 3058 gene locus_tag LOCUS_11480 3678 3058 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_11480 4111 5052 gene locus_tag LOCUS_11490 4111 5052 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence0126 772 1374 gene locus_tag LOCUS_11500 772 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1539 1763 gene locus_tag LOCUS_11510 1539 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2236 2442 gene locus_tag LOCUS_11520 2236 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4089 2671 gene locus_tag LOCUS_11530 4089 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5500 4319 gene locus_tag LOCUS_11540 5500 4319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775843.1 protein_id gnl|my_center|LOCUS_11540 6432 5617 gene locus_tag LOCUS_11550 6432 5617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903162.1 protein_id gnl|my_center|LOCUS_11550 <7080 6527 gene locus_tag LOCUS_11560 <7080 6527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903163.1:extracellular solute-binding protein >Feature sequence0127 280 876 gene locus_tag LOCUS_11570 280 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 873 1601 gene locus_tag LOCUS_11580 873 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2428 1655 gene locus_tag LOCUS_11590 2428 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4418 2808 gene locus_tag LOCUS_11600 4418 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6040 4529 gene locus_tag LOCUS_11610 6040 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7029 6250 gene locus_tag LOCUS_11620 7029 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0128 1961 792 gene locus_tag LOCUS_11630 1961 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2158 2376 gene locus_tag LOCUS_11640 2158 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3866 2373 gene locus_tag LOCUS_11650 gene gcvPB 3866 2373 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_11650 5218 3863 gene locus_tag LOCUS_11660 gene gcvPA 5218 3863 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_11660 5605 6375 gene locus_tag LOCUS_11670 5605 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6547 6783 gene locus_tag LOCUS_11680 6547 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0129 4685 1971 gene locus_tag LOCUS_11690 4685 1971 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_11690 6895 5060 gene locus_tag LOCUS_11700 6895 5060 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0130 543 1769 gene locus_tag LOCUS_11710 543 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3127 1775 gene locus_tag LOCUS_11720 3127 1775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932623.1 protein_id gnl|my_center|LOCUS_11720 4267 3137 gene locus_tag LOCUS_11730 4267 3137 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_11730 5442 4459 gene locus_tag LOCUS_11740 5442 4459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_11740 6391 5984 gene locus_tag LOCUS_11750 6391 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6709 6410 gene locus_tag LOCUS_11760 6709 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0131 355 74 gene locus_tag LOCUS_11770 355 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 562 975 gene locus_tag LOCUS_11780 562 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1262 882 gene locus_tag LOCUS_11790 1262 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1422 1928 gene locus_tag LOCUS_11800 1422 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2196 2924 gene locus_tag LOCUS_11810 2196 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3849 3367 gene locus_tag LOCUS_11820 3849 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4420 4022 gene locus_tag LOCUS_11830 4420 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4624 5055 gene locus_tag LOCUS_11840 4624 5055 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_11840 5246 5761 gene locus_tag LOCUS_11850 5246 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5953 6702 gene locus_tag LOCUS_11860 5953 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0132 1606 791 gene locus_tag LOCUS_11870 1606 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2761 1805 gene locus_tag LOCUS_11880 2761 1805 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438854.1 protein_id gnl|my_center|LOCUS_11880 4438 2774 gene locus_tag LOCUS_11890 4438 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6154 4490 gene locus_tag LOCUS_11900 6154 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6874 6326 gene locus_tag LOCUS_11910 6874 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence0133 1133 1570 gene locus_tag LOCUS_11920 1133 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1594 1887 gene locus_tag LOCUS_11930 1594 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3921 1912 gene locus_tag LOCUS_11940 3921 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 4658 4410 gene locus_tag LOCUS_11950 4658 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4876 4803 gene locus_tag LOCUS_t00120 4876 4803 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5673 4930 gene locus_tag LOCUS_11960 gene rnc 5673 4930 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_11960 6659 5670 gene locus_tag LOCUS_11970 gene selD 6659 5670 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence0134 362 643 gene locus_tag LOCUS_11980 362 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1021 794 gene locus_tag LOCUS_11990 1021 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1812 1018 gene locus_tag LOCUS_12000 1812 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2056 3204 gene locus_tag LOCUS_12010 2056 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3423 4775 gene locus_tag LOCUS_12020 3423 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5586 4858 gene locus_tag LOCUS_12030 5586 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5935 5594 gene locus_tag LOCUS_12040 5935 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6309 5938 gene locus_tag LOCUS_12050 6309 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6608 6306 gene locus_tag LOCUS_12060 6608 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence0135 2 469 gene locus_tag LOCUS_12070 2 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 565 1566 gene locus_tag LOCUS_12080 565 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2318 1563 gene locus_tag LOCUS_12090 2318 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3020 2325 gene locus_tag LOCUS_12100 3020 2325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_12100 3811 3281 gene locus_tag LOCUS_12110 3811 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 5021 3921 gene locus_tag LOCUS_12120 5021 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6392 5202 gene locus_tag LOCUS_12130 6392 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence0136 1142 2269 gene locus_tag LOCUS_12140 gene dinB 1142 2269 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968218.1 protein_id gnl|my_center|LOCUS_12140 2749 2339 gene locus_tag LOCUS_12150 2749 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4258 3044 gene locus_tag LOCUS_12160 4258 3044 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_12160 4544 4963 gene locus_tag LOCUS_12170 4544 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5144 5554 gene locus_tag LOCUS_12180 5144 5554 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878176.1 protein_id gnl|my_center|LOCUS_12180 5625 6569 gene locus_tag LOCUS_12190 5625 6569 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0137 1904 501 gene locus_tag LOCUS_12200 1904 501 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_12200 2757 4334 gene locus_tag LOCUS_12210 2757 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5514 4456 gene locus_tag LOCUS_12220 5514 4456 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0138 1103 231 gene locus_tag LOCUS_12230 1103 231 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_12230 2374 1226 gene locus_tag LOCUS_12240 2374 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2981 4381 gene locus_tag LOCUS_12250 2981 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4393 5124 gene locus_tag LOCUS_12260 4393 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6639 5266 gene locus_tag LOCUS_12270 6639 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence0139 1453 1659 gene locus_tag LOCUS_12280 1453 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2133 2762 gene locus_tag LOCUS_12290 2133 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2866 3054 gene locus_tag LOCUS_12300 2866 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3236 5743 gene locus_tag LOCUS_12310 3236 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6165 5875 gene locus_tag LOCUS_12320 6165 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence0140 100 507 gene locus_tag LOCUS_12330 100 507 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_12330 1016 663 gene locus_tag LOCUS_12340 1016 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2286 1582 gene locus_tag LOCUS_12350 2286 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2775 2422 gene locus_tag LOCUS_12360 gene rplS 2775 2422 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 protein_id gnl|my_center|LOCUS_12360 3168 4298 gene locus_tag LOCUS_12370 3168 4298 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_12370 4395 6071 gene locus_tag LOCUS_12380 gene serA 4395 6071 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_12380 6251 6461 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatccccacgcccgtgggggtgaaccg >Feature sequence0141 <1 2264 gene locus_tag LOCUS_12390 <1 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142062.1:ATP-dependent Clp protease ATP-binding subunit 2750 2277 gene locus_tag LOCUS_12400 2750 2277 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_12400 3634 2747 gene locus_tag LOCUS_12410 3634 2747 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064656.1 protein_id gnl|my_center|LOCUS_12410 4542 3679 gene locus_tag LOCUS_12420 4542 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5226 4654 gene locus_tag LOCUS_12430 5226 4654 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_12430 6436 5312 gene locus_tag LOCUS_12440 6436 5312 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence0142 2428 1640 gene locus_tag LOCUS_12450 2428 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3543 2425 gene locus_tag LOCUS_12460 3543 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5087 3789 gene locus_tag LOCUS_12470 5087 3789 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_12470 5992 5084 gene locus_tag LOCUS_12480 5992 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6439 6155 gene locus_tag LOCUS_12490 6439 6155 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0143 1088 111 gene locus_tag LOCUS_12500 1088 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1531 1088 gene locus_tag LOCUS_12510 1531 1088 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_12510 1843 2718 gene locus_tag LOCUS_12520 1843 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3034 3642 gene locus_tag LOCUS_12530 3034 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3645 3914 gene locus_tag LOCUS_12540 3645 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3988 4656 gene locus_tag LOCUS_12550 3988 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4653 5114 gene locus_tag LOCUS_12560 4653 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5840 5178 gene locus_tag LOCUS_12570 5840 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 <6608 5960 gene locus_tag LOCUS_12580 <6608 5960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256646.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence0144 3440 1407 gene locus_tag LOCUS_12590 3440 1407 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_12590 3880 3446 gene locus_tag LOCUS_12600 3880 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5119 4091 gene locus_tag LOCUS_12610 5119 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5773 5297 gene locus_tag LOCUS_12620 5773 5297 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404625.1 protein_id gnl|my_center|LOCUS_12620 6163 5978 gene locus_tag LOCUS_12630 6163 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence0145 <1 892 gene locus_tag LOCUS_12640 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259564.1:flippase 941 1915 gene locus_tag LOCUS_12650 941 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2051 3325 gene locus_tag LOCUS_12660 2051 3325 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_12660 4049 3372 gene locus_tag LOCUS_12670 4049 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4369 4145 gene locus_tag LOCUS_12680 4369 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5725 4526 gene locus_tag LOCUS_12690 5725 4526 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_12690 6418 5867 gene locus_tag LOCUS_12700 6418 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0146 221 1504 gene locus_tag LOCUS_12710 221 1504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_12710 1565 1780 gene locus_tag LOCUS_12720 1565 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1808 2299 gene locus_tag LOCUS_12730 1808 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2520 2347 gene locus_tag LOCUS_12740 2520 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2456 2875 gene locus_tag LOCUS_12750 2456 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3392 4939 gene locus_tag LOCUS_12760 3392 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence0147 1439 2215 gene locus_tag LOCUS_12770 1439 2215 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_12770 3025 2246 gene locus_tag LOCUS_12780 gene tpiA 3025 2246 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_12780 4423 3230 gene locus_tag LOCUS_12790 4423 3230 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_12790 5451 4426 gene locus_tag LOCUS_12800 gene gap 5451 4426 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_12800 5788 6063 gene locus_tag LOCUS_12810 5788 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0148 367 1122 gene locus_tag LOCUS_12820 367 1122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_12820 1273 2958 gene locus_tag LOCUS_12830 1273 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3408 4760 gene locus_tag LOCUS_12840 3408 4760 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_12840 6497 4818 gene locus_tag LOCUS_12850 6497 4818 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0149 587 1750 gene locus_tag LOCUS_12860 587 1750 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_12860 1802 2596 gene locus_tag LOCUS_12870 1802 2596 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_12870 2804 3394 gene locus_tag LOCUS_12880 gene folE 2804 3394 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_12880 4829 3426 gene locus_tag LOCUS_12890 4829 3426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080938.1 protein_id gnl|my_center|LOCUS_12890 <6579 5062 gene locus_tag LOCUS_12900 <6579 5062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943996.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence0150 1 1200 gene locus_tag LOCUS_12910 1 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1197 1754 gene locus_tag LOCUS_12920 1197 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1754 2173 gene locus_tag LOCUS_12930 1754 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2175 3572 gene locus_tag LOCUS_12940 2175 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3569 4369 gene locus_tag LOCUS_12950 3569 4369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_12950 4366 5043 gene locus_tag LOCUS_12960 4366 5043 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_12960 5056 5910 gene locus_tag LOCUS_12970 5056 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5922 6089 gene locus_tag LOCUS_12980 5922 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence0151 3079 266 gene locus_tag LOCUS_12990 gene mutS 3079 266 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258806.1 protein_id gnl|my_center|LOCUS_12990 3490 4404 gene locus_tag LOCUS_13000 gene rsmA 3490 4404 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_13000 4622 5695 gene locus_tag LOCUS_13010 4622 5695 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173480.1 protein_id gnl|my_center|LOCUS_13010 6103 6411 gene locus_tag LOCUS_13020 6103 6411 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256560.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence0152 177 872 gene locus_tag LOCUS_13030 177 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1009 2310 gene locus_tag LOCUS_13040 1009 2310 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_13040 2769 4289 gene locus_tag LOCUS_13050 gene proS 2769 4289 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_13050 4480 4983 gene locus_tag LOCUS_13060 4480 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5042 5719 gene locus_tag LOCUS_13070 5042 5719 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_13070 <6550 5763 gene locus_tag LOCUS_13080 <6550 5763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393548.1:adenylosuccinate lyase >Feature sequence0153 1800 277 gene locus_tag LOCUS_13090 1800 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2741 2028 gene locus_tag LOCUS_13100 gene tcrA 2741 2028 CDS product two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403148.1 protein_id gnl|my_center|LOCUS_13100 3064 4320 gene locus_tag LOCUS_13110 3064 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4453 5256 gene locus_tag LOCUS_13120 4453 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5681 6406 gene locus_tag LOCUS_13130 5681 6406 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184583.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence0154 <1 620 gene locus_tag LOCUS_13140 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257601.1:aminodeoxychorismate/anthranilate synthase component II 790 1476 gene locus_tag LOCUS_13150 790 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 1504 1830 gene locus_tag LOCUS_13160 1504 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 1976 3544 gene locus_tag LOCUS_13170 gene trpCF 1976 3544 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 protein_id gnl|my_center|LOCUS_13170 3560 4828 gene locus_tag LOCUS_13180 gene trpB 3560 4828 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_13180 4914 5756 gene locus_tag LOCUS_13190 gene trpA 4914 5756 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_13190 6025 6429 gene locus_tag LOCUS_13200 6025 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0155 2831 3409 gene locus_tag LOCUS_13210 2831 3409 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408493.1 protein_id gnl|my_center|LOCUS_13210 4000 3521 gene locus_tag LOCUS_13220 4000 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4404 4478 gene locus_tag LOCUS_t00130 4404 4478 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5154 4582 gene locus_tag LOCUS_13230 5154 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5556 6266 gene locus_tag LOCUS_13240 5556 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0156 873 1577 gene locus_tag LOCUS_13250 873 1577 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_13250 1586 3226 gene locus_tag LOCUS_13260 1586 3226 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807737.1 protein_id gnl|my_center|LOCUS_13260 3506 4480 gene locus_tag LOCUS_13270 3506 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5674 4547 gene locus_tag LOCUS_13280 5674 4547 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_13280 <6485 5675 gene locus_tag LOCUS_13290 <6485 5675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110054.1:MMPL family transporter >Feature sequence0157 181 14 gene locus_tag LOCUS_13300 181 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1120 545 gene locus_tag LOCUS_13310 1120 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1010 1234 gene locus_tag LOCUS_13320 1010 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3931 1562 gene locus_tag LOCUS_13330 3931 1562 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_13330 4262 4714 gene locus_tag LOCUS_13340 4262 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4922 5215 gene locus_tag LOCUS_13350 4922 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5569 5871 gene locus_tag LOCUS_13360 gene groES 5569 5871 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence0158 368 168 gene locus_tag LOCUS_13370 368 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 592 2241 gene locus_tag LOCUS_13380 592 2241 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_13380 2970 2539 gene locus_tag LOCUS_13390 2970 2539 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728874.1 protein_id gnl|my_center|LOCUS_13390 3154 3516 gene locus_tag LOCUS_13400 3154 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5320 3848 gene locus_tag LOCUS_13410 5320 3848 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_13410 5867 5328 gene locus_tag LOCUS_13420 5867 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence0159 2310 1135 gene locus_tag LOCUS_13430 2310 1135 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258790.1 protein_id gnl|my_center|LOCUS_13430 2714 3775 gene locus_tag LOCUS_13440 2714 3775 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_13440 3987 5063 gene locus_tag LOCUS_13450 3987 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5225 5542 gene locus_tag LOCUS_13460 5225 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5743 5967 gene locus_tag LOCUS_13470 5743 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5912 6424 gene locus_tag LOCUS_13480 5912 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0160 490 1644 gene locus_tag LOCUS_13490 490 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1790 3511 gene locus_tag LOCUS_13500 1790 3511 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_13500 3512 4411 gene locus_tag LOCUS_13510 3512 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4424 5314 gene locus_tag LOCUS_13520 4424 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 <6442 5292 gene locus_tag LOCUS_13530 <6442 5292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815086.1:class I SAM-dependent methyltransferase >Feature sequence0161 <1 2223 gene locus_tag LOCUS_13540 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256179.1:GAF domain-containing protein 2724 2245 gene locus_tag LOCUS_13550 2724 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2899 4344 gene locus_tag LOCUS_13560 2899 4344 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_13560 4485 4297 gene locus_tag LOCUS_13570 4485 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4438 4977 gene locus_tag LOCUS_13580 4438 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0162 146 72 gene locus_tag LOCUS_t00140 146 72 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 337 885 gene locus_tag LOCUS_13590 337 885 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_13590 1922 1005 gene locus_tag LOCUS_13600 1922 1005 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_13600 2896 2006 gene locus_tag LOCUS_13610 2896 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 4239 2899 gene locus_tag LOCUS_13620 4239 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4664 4359 gene locus_tag LOCUS_13630 4664 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5111 4674 gene locus_tag LOCUS_13640 5111 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6187 5576 gene locus_tag LOCUS_13650 6187 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence0163 2636 1239 gene locus_tag LOCUS_13660 2636 1239 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_13660 3345 2752 gene locus_tag LOCUS_13670 3345 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3781 4413 gene locus_tag LOCUS_13680 3781 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4687 5664 gene locus_tag LOCUS_13690 4687 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0164 4207 2699 gene locus_tag LOCUS_13700 4207 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5400 4243 gene locus_tag LOCUS_13710 5400 4243 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_13710 <6284 5771 gene locus_tag LOCUS_13720 <6284 5771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229036.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence0165 3 1661 gene locus_tag LOCUS_13730 gene nuoL 3 1661 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_13730 1750 3390 gene locus_tag LOCUS_13740 1750 3390 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_13740 3421 5115 gene locus_tag LOCUS_13750 3421 5115 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence0166 621 430 gene locus_tag LOCUS_13760 621 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1461 1231 gene locus_tag LOCUS_13770 1461 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1345 2265 gene locus_tag LOCUS_13780 1345 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3656 2370 gene locus_tag LOCUS_13790 3656 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4756 5646 gene locus_tag LOCUS_13800 4756 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6209 5715 gene locus_tag LOCUS_13810 6209 5715 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190192.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence0167 520 702 gene locus_tag LOCUS_13820 520 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2540 684 gene locus_tag LOCUS_13830 2540 684 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705871.1 protein_id gnl|my_center|LOCUS_13830 2874 4178 gene locus_tag LOCUS_13840 2874 4178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193455.1 protein_id gnl|my_center|LOCUS_13840 4466 4182 gene locus_tag LOCUS_13850 4466 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5192 4725 gene locus_tag LOCUS_13860 5192 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6153 5338 gene locus_tag LOCUS_13870 6153 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0168 755 982 gene locus_tag LOCUS_13880 755 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1944 934 gene locus_tag LOCUS_13890 1944 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2686 1991 gene locus_tag LOCUS_13900 2686 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3313 2756 gene locus_tag LOCUS_13910 3313 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4211 3399 gene locus_tag LOCUS_13920 gene qcrB 4211 3399 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 protein_id gnl|my_center|LOCUS_13920 4802 5044 gene locus_tag LOCUS_13930 4802 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 <6179 5132 gene locus_tag LOCUS_13940 <6179 5132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877359.1:glycosyltransferase family 20 protein >Feature sequence0169 <1 2418 gene locus_tag LOCUS_13950 <1 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022224.1:tetratricopeptide repeat protein 3011 2631 gene locus_tag LOCUS_13960 3011 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3247 4950 gene locus_tag LOCUS_13970 3247 4950 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870224.1 protein_id gnl|my_center|LOCUS_13970 6162 5050 gene locus_tag LOCUS_13980 6162 5050 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence0170 1110 607 gene locus_tag LOCUS_13990 1110 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1507 2253 gene locus_tag LOCUS_14000 1507 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2990 2268 gene locus_tag LOCUS_14010 2990 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3815 3051 gene locus_tag LOCUS_14020 3815 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4842 4504 gene locus_tag LOCUS_14030 4842 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4726 5136 gene locus_tag LOCUS_14040 4726 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <6161 5058 gene locus_tag LOCUS_14050 <6161 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein >Feature sequence0171 3356 1020 gene locus_tag LOCUS_14060 gene nuoG 3356 1020 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_14060 4916 3543 gene locus_tag LOCUS_14070 gene nuoF 4916 3543 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_14070 5577 4921 gene locus_tag LOCUS_14080 5577 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 <6149 5577 gene locus_tag LOCUS_14090 <6149 5577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258751.1:NADH dehydrogenase (quinone) subunit D >Feature sequence0172 1027 260 gene locus_tag LOCUS_14100 1027 260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_14100 1520 1774 gene locus_tag LOCUS_14110 1520 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1824 2324 gene locus_tag LOCUS_14120 1824 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3336 3656 gene locus_tag LOCUS_14130 3336 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence0173 1462 1139 gene locus_tag LOCUS_14140 gene nuoK 1462 1139 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_14140 2006 1467 gene locus_tag LOCUS_14150 2006 1467 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_14150 2447 3559 gene locus_tag LOCUS_14160 2447 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4070 4423 gene locus_tag LOCUS_14170 4070 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence0174 3 689 gene locus_tag LOCUS_14180 3 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 783 2267 gene locus_tag LOCUS_14190 783 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence0175 322 789 gene locus_tag LOCUS_14200 322 789 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101282.1 protein_id gnl|my_center|LOCUS_14200 1251 1730 gene locus_tag LOCUS_14210 1251 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1818 2273 gene locus_tag LOCUS_14220 1818 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3233 2310 gene locus_tag LOCUS_14230 3233 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3417 3695 gene locus_tag LOCUS_14240 3417 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3757 4866 gene locus_tag LOCUS_14250 3757 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0176 1395 1102 gene locus_tag LOCUS_14260 gene gatC 1395 1102 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_14260 1744 1454 gene locus_tag LOCUS_14270 1744 1454 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 protein_id gnl|my_center|LOCUS_14270 2060 1887 gene locus_tag LOCUS_14280 2060 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2751 2257 gene locus_tag LOCUS_14290 2751 2257 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_14290 4195 2852 gene locus_tag LOCUS_14300 4195 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5317 4301 gene locus_tag LOCUS_14310 5317 4301 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888924.1 protein_id gnl|my_center|LOCUS_14310 5427 5696 gene locus_tag LOCUS_14320 5427 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence0177 <1 1871 gene locus_tag LOCUS_14330 <1 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055986.1:ATP-dependent zinc metalloprotease FtsH3 2081 3457 gene locus_tag LOCUS_14340 2081 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3595 4188 gene locus_tag LOCUS_14350 gene aac(6') 3595 4188 CDS product aminoglycoside N-acetyltransferase AAC(6')-Ii inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289795.1 protein_id gnl|my_center|LOCUS_14350 4369 6048 gene locus_tag LOCUS_14360 4369 6048 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0178 3164 1356 gene locus_tag LOCUS_14370 3164 1356 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_14370 3540 3833 gene locus_tag LOCUS_14380 3540 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4926 3946 gene locus_tag LOCUS_14390 4926 3946 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_14390 5891 5019 gene locus_tag LOCUS_14400 gene accD 5891 5019 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence0179 498 1733 gene locus_tag LOCUS_14410 498 1733 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 protein_id gnl|my_center|LOCUS_14410 2073 1867 gene locus_tag LOCUS_14420 2073 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1961 3247 gene locus_tag LOCUS_14430 1961 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3267 4178 gene locus_tag LOCUS_14440 3267 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4697 4263 gene locus_tag LOCUS_14450 4697 4263 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_14450 5106 4744 gene locus_tag LOCUS_14460 5106 4744 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140928.1 protein_id gnl|my_center|LOCUS_14460 5375 5638 gene locus_tag LOCUS_14470 5375 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5652 5789 gene locus_tag LOCUS_14480 5652 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0180 694 2580 gene locus_tag LOCUS_14490 694 2580 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969672.1 protein_id gnl|my_center|LOCUS_14490 2665 3768 gene locus_tag LOCUS_14500 2665 3768 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548064.1 protein_id gnl|my_center|LOCUS_14500 3934 4899 gene locus_tag LOCUS_14510 3934 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4938 5780 gene locus_tag LOCUS_14520 4938 5780 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936452.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0181 442 1656 gene locus_tag LOCUS_14530 442 1656 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214329.1 protein_id gnl|my_center|LOCUS_14530 2995 1736 gene locus_tag LOCUS_14540 2995 1736 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_14540 4730 3045 gene locus_tag LOCUS_14550 4730 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 5938 4724 gene locus_tag LOCUS_14560 5938 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence0182 49 507 gene locus_tag LOCUS_14570 49 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 676 921 gene locus_tag LOCUS_14580 676 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1074 1604 gene locus_tag LOCUS_14590 1074 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1961 1752 gene locus_tag LOCUS_14600 1961 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2185 3171 gene locus_tag LOCUS_14610 2185 3171 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_14610 3604 5349 gene locus_tag LOCUS_14620 3604 5349 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_14620 <5995 5445 gene locus_tag LOCUS_14630 <5995 5445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392865.1:pseudouridine synthase >Feature sequence0183 1349 891 gene locus_tag LOCUS_14640 1349 891 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_14640 1997 1377 gene locus_tag LOCUS_14650 1997 1377 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257512.1 protein_id gnl|my_center|LOCUS_14650 3895 2066 gene locus_tag LOCUS_14660 3895 2066 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257351.1 protein_id gnl|my_center|LOCUS_14660 4928 4041 gene locus_tag LOCUS_14670 gene lipA 4928 4041 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0184 510 1046 gene locus_tag LOCUS_14680 510 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1096 3180 gene locus_tag LOCUS_14690 1096 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3244 3319 gene locus_tag LOCUS_t00150 3244 3319 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3701 4141 gene locus_tag LOCUS_14700 3701 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4184 4471 gene locus_tag LOCUS_14710 4184 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 <5960 5165 gene locus_tag LOCUS_14720 <5960 5165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase >Feature sequence0185 1294 1890 gene locus_tag LOCUS_14730 gene lepB 1294 1890 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_14730 2355 1960 gene locus_tag LOCUS_14740 2355 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2625 2362 gene locus_tag LOCUS_14750 2625 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3571 2753 gene locus_tag LOCUS_14760 3571 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3927 3625 gene locus_tag LOCUS_14770 3927 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4083 4562 gene locus_tag LOCUS_14780 4083 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <5928 5221 gene locus_tag LOCUS_14790 <5928 5221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494437.1:nucleotidyltransferase domain-containing protein >Feature sequence0186 163 981 gene locus_tag LOCUS_14800 163 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 897 2363 gene locus_tag LOCUS_14810 897 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2353 3090 gene locus_tag LOCUS_14820 2353 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3087 3797 gene locus_tag LOCUS_14830 3087 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3790 4551 gene locus_tag LOCUS_14840 3790 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4791 5213 gene locus_tag LOCUS_14850 4791 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5368 5871 gene locus_tag LOCUS_14860 5368 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence0187 184 576 gene locus_tag LOCUS_14870 184 576 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_14870 3280 620 gene locus_tag LOCUS_14880 gene priA 3280 620 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_14880 4360 3368 gene locus_tag LOCUS_14890 4360 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4721 4485 gene locus_tag LOCUS_14900 4721 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4644 5741 gene locus_tag LOCUS_14910 4644 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence0188 15 1124 gene locus_tag LOCUS_14920 15 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1138 1431 gene locus_tag LOCUS_14930 1138 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1433 1861 gene locus_tag LOCUS_14940 1433 1861 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660557.1 protein_id gnl|my_center|LOCUS_14940 4169 1890 gene locus_tag LOCUS_14950 4169 1890 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_14950 5836 4283 gene locus_tag LOCUS_14960 5836 4283 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0189 1378 707 gene locus_tag LOCUS_14970 gene fsa 1378 707 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424855.1 protein_id gnl|my_center|LOCUS_14970 1647 2081 gene locus_tag LOCUS_14980 1647 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2981 2196 gene locus_tag LOCUS_14990 2981 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4144 3005 gene locus_tag LOCUS_15000 4144 3005 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_15000 4579 5661 gene locus_tag LOCUS_15010 gene nusA 4579 5661 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258863.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0190 19 243 gene locus_tag LOCUS_15020 19 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 426 1691 gene locus_tag LOCUS_15030 gene tgt 426 1691 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_15030 2268 1771 gene locus_tag LOCUS_15040 2268 1771 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_15040 3656 2439 gene locus_tag LOCUS_15050 3656 2439 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258510.1 protein_id gnl|my_center|LOCUS_15050 5451 3838 gene locus_tag LOCUS_15060 5451 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence0191 <1 652 gene locus_tag LOCUS_15070 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258124.1:ABC transporter ATP-binding protein 782 1843 gene locus_tag LOCUS_15080 782 1843 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_15080 2068 2250 gene locus_tag LOCUS_15090 2068 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4488 2485 gene locus_tag LOCUS_15100 4488 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4783 5298 gene locus_tag LOCUS_15110 4783 5298 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0192 <1 719 gene locus_tag LOCUS_15120 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257666.1:alanine racemase 999 2243 gene locus_tag LOCUS_15130 999 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2421 3452 gene locus_tag LOCUS_15140 2421 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3449 4711 gene locus_tag LOCUS_15150 3449 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0193 3197 1605 gene locus_tag LOCUS_15160 gene tilS 3197 1605 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_15160 3393 4295 gene locus_tag LOCUS_15170 3393 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 <5776 4582 gene locus_tag LOCUS_15180 <5776 4582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002382784.1:ATP-dependent DNA helicase DinG >Feature sequence0194 1488 241 gene locus_tag LOCUS_15190 1488 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1945 1733 gene locus_tag LOCUS_15200 1945 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2496 5081 gene locus_tag LOCUS_15210 gene lon 2496 5081 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_15210 <5759 5142 gene locus_tag LOCUS_15220 <5759 5142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001018377.1:FAD-binding oxidoreductase >Feature sequence0195 <1 1609 gene locus_tag LOCUS_15230 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223825.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 1602 2114 gene locus_tag LOCUS_15240 1602 2114 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_15240 2131 3270 gene locus_tag LOCUS_15250 2131 3270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257513.1 protein_id gnl|my_center|LOCUS_15250 4682 3387 gene locus_tag LOCUS_15260 4682 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 4982 4758 gene locus_tag LOCUS_15270 4982 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0196 423 2033 gene locus_tag LOCUS_15280 423 2033 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_15280 2092 2832 gene locus_tag LOCUS_15290 2092 2832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_15290 2847 3638 gene locus_tag LOCUS_15300 2847 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0197 1 2322 gene locus_tag LOCUS_15310 1 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2489 3931 gene locus_tag LOCUS_15320 2489 3931 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_15320 4120 4974 gene locus_tag LOCUS_15330 4120 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence0198 2244 820 gene locus_tag LOCUS_15340 2244 820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 protein_id gnl|my_center|LOCUS_15340 2582 2959 gene locus_tag LOCUS_15350 2582 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3506 2895 gene locus_tag LOCUS_15360 gene ispF 3506 2895 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266985.1 protein_id gnl|my_center|LOCUS_15360 3864 5387 gene locus_tag LOCUS_15370 3864 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0199 1059 118 gene locus_tag LOCUS_15380 1059 118 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971120.1 protein_id gnl|my_center|LOCUS_15380 1019 1246 gene locus_tag LOCUS_15390 1019 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1406 2278 gene locus_tag LOCUS_15400 1406 2278 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525137.1 protein_id gnl|my_center|LOCUS_15400 3474 2305 gene locus_tag LOCUS_15410 3474 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4392 3550 gene locus_tag LOCUS_15420 4392 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 <5717 4382 gene locus_tag LOCUS_15430 <5717 4382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003907117.1:radical SAM protein note possible pseudo, frameshifted >Feature sequence0200 <1 678 gene locus_tag LOCUS_15440 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256378.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 1004 1591 gene locus_tag LOCUS_15450 1004 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2142 4256 gene locus_tag LOCUS_15460 2142 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5548 4616 gene locus_tag LOCUS_15470 5548 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0201 3 728 gene locus_tag LOCUS_15480 3 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 813 992 gene locus_tag LOCUS_15490 813 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1480 941 gene locus_tag LOCUS_15500 1480 941 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_15500 1861 1785 gene locus_tag LOCUS_t00160 1861 1785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3644 2118 gene locus_tag LOCUS_15510 3644 2118 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_15510 <5694 3689 gene locus_tag LOCUS_15520 <5694 3689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792370.1:ATP-binding protein >Feature sequence0202 1106 504 gene locus_tag LOCUS_15530 gene satP 1106 504 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368353.1 protein_id gnl|my_center|LOCUS_15530 1464 3446 gene locus_tag LOCUS_15540 gene acs 1464 3446 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_15540 4022 5182 gene locus_tag LOCUS_15550 4022 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0203 3345 61 gene locus_tag LOCUS_15560 3345 61 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_15560 4389 3544 gene locus_tag LOCUS_15570 4389 3544 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_15570 5370 4408 gene locus_tag LOCUS_15580 5370 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0204 642 19 gene locus_tag LOCUS_15590 642 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1900 989 gene locus_tag LOCUS_15600 1900 989 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_15600 2099 3127 gene locus_tag LOCUS_15610 2099 3127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_15610 3732 5510 gene locus_tag LOCUS_15620 3732 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence0205 <1 1997 gene locus_tag LOCUS_15630 <1 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' 2173 2583 gene locus_tag LOCUS_15640 gene rpsL 2173 2583 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_15640 2920 3393 gene locus_tag LOCUS_15650 gene rpsG 2920 3393 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_15650 3412 5502 gene locus_tag LOCUS_15660 gene fusA 3412 5502 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence0206 671 330 gene locus_tag LOCUS_15670 671 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 592 771 gene locus_tag LOCUS_15680 592 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 946 1407 gene locus_tag LOCUS_15690 946 1407 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204517.1 protein_id gnl|my_center|LOCUS_15690 2280 1447 gene locus_tag LOCUS_15700 2280 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2798 4783 gene locus_tag LOCUS_15710 2798 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <5632 4833 gene locus_tag LOCUS_15720 <5632 4833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258096.1:AAA family ATPase >Feature sequence0207 <1 601 gene locus_tag LOCUS_15730 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203476.1:heavy metal translocating P-type ATPase 598 912 gene locus_tag LOCUS_15740 gene nuoK 598 912 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_15740 909 2834 gene locus_tag LOCUS_15750 909 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2865 4433 gene locus_tag LOCUS_15760 2865 4433 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0208 <1 1583 gene locus_tag LOCUS_15770 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258812.1:mannose-1-phosphate guanyltransferase 5443 1745 gene locus_tag LOCUS_15780 5443 1745 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459833.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence0209 1078 212 gene locus_tag LOCUS_15790 1078 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1692 1255 gene locus_tag LOCUS_15800 1692 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2005 1712 gene locus_tag LOCUS_15810 2005 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2330 1896 gene locus_tag LOCUS_15820 2330 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3533 3129 gene locus_tag LOCUS_15830 3533 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4794 3946 gene locus_tag LOCUS_15840 4794 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 <5616 4863 gene locus_tag LOCUS_15850 <5616 4863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057430.1:glycosyltransferase family 4 protein >Feature sequence0210 1569 790 gene locus_tag LOCUS_15860 1569 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3221 1812 gene locus_tag LOCUS_15870 3221 1812 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_15870 3600 4232 gene locus_tag LOCUS_15880 3600 4232 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485035.1 protein_id gnl|my_center|LOCUS_15880 4546 4621 gene locus_tag LOCUS_t00170 4546 4621 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4820 5188 gene locus_tag LOCUS_15890 4820 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0211 116 499 gene locus_tag LOCUS_15900 116 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1586 714 gene locus_tag LOCUS_15910 1586 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2217 2759 gene locus_tag LOCUS_15920 2217 2759 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_15920 2756 4549 gene locus_tag LOCUS_15930 2756 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5264 4749 gene locus_tag LOCUS_15940 gene purE 5264 4749 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258176.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0212 20 295 gene locus_tag LOCUS_15950 20 295 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531402.1 protein_id gnl|my_center|LOCUS_15950 647 859 gene locus_tag LOCUS_15960 647 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 849 1583 gene locus_tag LOCUS_15970 849 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1594 2202 gene locus_tag LOCUS_15980 1594 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2211 3323 gene locus_tag LOCUS_15990 2211 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3517 4977 gene locus_tag LOCUS_16000 3517 4977 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805055.1 protein_id gnl|my_center|LOCUS_16000 5284 5457 gene locus_tag LOCUS_16010 5284 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16010 >Feature sequence0213 170 245 gene locus_tag LOCUS_t00180 170 245 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 276 353 gene locus_tag LOCUS_t00190 276 353 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 560 1825 gene locus_tag LOCUS_16020 gene coaBC 560 1825 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_16020 2354 1902 gene locus_tag LOCUS_16030 2354 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2819 5329 gene locus_tag LOCUS_16040 2819 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0214 3256 2831 gene locus_tag LOCUS_16050 3256 2831 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_16050 4136 3270 gene locus_tag LOCUS_16060 4136 3270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 protein_id gnl|my_center|LOCUS_16060 5498 4257 gene locus_tag LOCUS_16070 5498 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0215 58 327 gene locus_tag LOCUS_16080 58 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 657 989 gene locus_tag LOCUS_16090 657 989 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_16090 1092 1319 gene locus_tag LOCUS_16100 1092 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1423 2661 gene locus_tag LOCUS_16110 1423 2661 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_16110 4267 2672 gene locus_tag LOCUS_16120 4267 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5367 4315 gene locus_tag LOCUS_16130 5367 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence0216 <1 1331 gene locus_tag LOCUS_16140 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111158892.1:chloride channel protein 1573 2775 gene locus_tag LOCUS_16150 gene cax 1573 2775 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_16150 2895 4274 gene locus_tag LOCUS_16160 2895 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence0217 96 1058 gene locus_tag LOCUS_16170 gene pip 96 1058 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_16170 1168 1698 gene locus_tag LOCUS_16180 1168 1698 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_16180 2372 3829 gene locus_tag LOCUS_16190 2372 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4456 3995 gene locus_tag LOCUS_16200 4456 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0218 398 472 gene locus_tag LOCUS_t00200 398 472 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1092 1994 gene locus_tag LOCUS_16210 1092 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2109 2891 gene locus_tag LOCUS_16220 2109 2891 CDS product aminotransferase class I and II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530009.1 protein_id gnl|my_center|LOCUS_16220 2869 3381 gene locus_tag LOCUS_16230 2869 3381 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142760.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence0219 297 1262 gene locus_tag LOCUS_16240 297 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2240 1290 gene locus_tag LOCUS_16250 2240 1290 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_16250 3041 2343 gene locus_tag LOCUS_16260 3041 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4432 3506 gene locus_tag LOCUS_16270 4432 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5403 4432 gene locus_tag LOCUS_16280 5403 4432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence0220 <1 893 gene locus_tag LOCUS_16290 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401873.1:XdhC family protein 1571 1125 gene locus_tag LOCUS_16300 1571 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2235 1852 gene locus_tag LOCUS_16310 2235 1852 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946743.1 protein_id gnl|my_center|LOCUS_16310 2880 2452 gene locus_tag LOCUS_16320 2880 2452 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_16320 3207 2959 gene locus_tag LOCUS_16330 3207 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence0221 <1 1174 gene locus_tag LOCUS_16340 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225960.1:phospholipase D-like domain-containing protein 3859 1253 gene locus_tag LOCUS_16350 3859 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4118 5047 gene locus_tag LOCUS_16360 4118 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence0222 137 1912 gene locus_tag LOCUS_16370 gene murJ 137 1912 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_16370 2404 2015 gene locus_tag LOCUS_16380 2404 2015 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_16380 4365 2653 gene locus_tag LOCUS_16390 4365 2653 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence0223 702 1454 gene locus_tag LOCUS_16400 702 1454 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_16400 1525 2958 gene locus_tag LOCUS_16410 1525 2958 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_16410 2993 4522 gene locus_tag LOCUS_16420 2993 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0224 1336 989 gene locus_tag LOCUS_16430 1336 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2521 1538 gene locus_tag LOCUS_16440 2521 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3672 2740 gene locus_tag LOCUS_16450 3672 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5405 3969 gene locus_tag LOCUS_16460 5405 3969 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence0225 910 131 gene locus_tag LOCUS_16470 910 131 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_16470 1563 1099 gene locus_tag LOCUS_16480 1563 1099 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_16480 1853 2356 gene locus_tag LOCUS_16490 1853 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2655 3848 gene locus_tag LOCUS_16500 2655 3848 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_16500 3910 5004 gene locus_tag LOCUS_16510 gene rseP 3910 5004 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0226 838 1656 gene locus_tag LOCUS_16520 838 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1649 2452 gene locus_tag LOCUS_16530 1649 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2798 4927 gene locus_tag LOCUS_16540 2798 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence0227 <1 567 gene locus_tag LOCUS_16550 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003727947.1:sulfite exporter TauE/SafE family protein 1361 660 gene locus_tag LOCUS_16560 1361 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2033 1833 gene locus_tag LOCUS_16570 2033 1833 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_16570 3147 2254 gene locus_tag LOCUS_16580 3147 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 <5469 3137 gene locus_tag LOCUS_16590 <5469 3137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141493.1:ATP-binding protein >Feature sequence0228 240 1217 gene locus_tag LOCUS_16600 240 1217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889397.1 protein_id gnl|my_center|LOCUS_16600 1267 1926 gene locus_tag LOCUS_16610 1267 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1993 2715 gene locus_tag LOCUS_16620 1993 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2758 3834 gene locus_tag LOCUS_16630 2758 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4052 5080 gene locus_tag LOCUS_16640 4052 5080 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0229 449 1669 gene locus_tag LOCUS_16650 449 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1692 1922 gene locus_tag LOCUS_16660 1692 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4462 1940 gene locus_tag LOCUS_16670 gene leuS 4462 1940 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_16670 5419 4703 gene locus_tag LOCUS_16680 5419 4703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0230 508 1683 gene locus_tag LOCUS_16690 508 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1996 2952 gene locus_tag LOCUS_16700 1996 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3031 4221 gene locus_tag LOCUS_16710 3031 4221 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_16710 4271 4861 gene locus_tag LOCUS_16720 4271 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4981 5232 gene locus_tag LOCUS_16730 4981 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0231 194 511 gene locus_tag LOCUS_16740 194 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 495 1160 gene locus_tag LOCUS_16750 495 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2508 1288 gene locus_tag LOCUS_16760 2508 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3097 2681 gene locus_tag LOCUS_16770 3097 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3251 3436 gene locus_tag LOCUS_16780 3251 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence0232 865 1050 gene locus_tag LOCUS_16790 865 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2848 3588 gene locus_tag LOCUS_16800 2848 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0233 3027 2275 gene locus_tag LOCUS_16810 3027 2275 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373626.1 protein_id gnl|my_center|LOCUS_16810 3613 3152 gene locus_tag LOCUS_16820 3613 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4542 3781 gene locus_tag LOCUS_16830 4542 3781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_16830 <5349 4660 gene locus_tag LOCUS_16840 <5349 4660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966466.1:cytochrome P450 >Feature sequence0234 539 2131 gene locus_tag LOCUS_16850 539 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2803 2207 gene locus_tag LOCUS_16860 2803 2207 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705143.1 protein_id gnl|my_center|LOCUS_16860 3059 3889 gene locus_tag LOCUS_16870 3059 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4002 5051 gene locus_tag LOCUS_16880 4002 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0235 472 1443 gene locus_tag LOCUS_16890 gene galT 472 1443 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_16890 1430 2710 gene locus_tag LOCUS_16900 gene galK 1430 2710 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_16900 3126 3710 gene locus_tag LOCUS_16910 gene greA 3126 3710 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_16910 3964 4746 gene locus_tag LOCUS_16920 3964 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0236 138 980 gene locus_tag LOCUS_16930 138 980 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256539.1 protein_id gnl|my_center|LOCUS_16930 2535 1165 gene locus_tag LOCUS_16940 2535 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4846 2771 gene locus_tag LOCUS_16950 4846 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0237 368 1114 gene locus_tag LOCUS_16960 368 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4252 1229 gene locus_tag LOCUS_16970 4252 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4808 4440 gene locus_tag LOCUS_16980 4808 4440 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242740.1 protein_id gnl|my_center|LOCUS_16980 4889 4963 gene locus_tag LOCUS_t00210 4889 4963 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0238 1362 13 gene locus_tag LOCUS_16990 1362 13 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_16990 2428 1451 gene locus_tag LOCUS_17000 2428 1451 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730029.1 protein_id gnl|my_center|LOCUS_17000 3540 2425 gene locus_tag LOCUS_17010 gene pdhA 3540 2425 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112796.1 protein_id gnl|my_center|LOCUS_17010 4838 3630 gene locus_tag LOCUS_17020 4838 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence0239 361 1047 gene locus_tag LOCUS_17030 361 1047 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_17030 1143 1394 gene locus_tag LOCUS_17040 1143 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2143 3018 gene locus_tag LOCUS_17050 2143 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3143 3832 gene locus_tag LOCUS_17060 3143 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4239 3853 gene locus_tag LOCUS_17070 4239 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0240 1327 656 gene locus_tag LOCUS_17080 1327 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2057 1383 gene locus_tag LOCUS_17090 2057 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2407 2048 gene locus_tag LOCUS_17100 gene ndhC 2407 2048 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_17100 2783 2708 gene locus_tag LOCUS_t00220 2783 2708 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3076 3954 gene locus_tag LOCUS_17110 3076 3954 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_17110 4053 5045 gene locus_tag LOCUS_17120 4053 5045 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909335.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0241 200 1444 gene locus_tag LOCUS_17130 200 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2149 1721 gene locus_tag LOCUS_17140 2149 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3635 3015 gene locus_tag LOCUS_17150 3635 3015 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_17150 4688 3900 gene locus_tag LOCUS_17160 4688 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence0242 <1 1443 gene locus_tag LOCUS_17170 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880077.1:NYN domain-containing protein 1486 2022 gene locus_tag LOCUS_17180 1486 2022 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389411.1 protein_id gnl|my_center|LOCUS_17180 2229 2041 gene locus_tag LOCUS_17190 2229 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2377 2931 gene locus_tag LOCUS_17200 gene coaD 2377 2931 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_17200 4627 3002 gene locus_tag LOCUS_17210 4627 3002 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence0243 <1 869 gene locus_tag LOCUS_17220 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021650.1:PAS domain S-box protein 860 2041 gene locus_tag LOCUS_17230 860 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2038 3246 gene locus_tag LOCUS_17240 2038 3246 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085770.1 protein_id gnl|my_center|LOCUS_17240 3512 4648 gene locus_tag LOCUS_17250 3512 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence0244 698 219 gene locus_tag LOCUS_17260 698 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1697 750 gene locus_tag LOCUS_17270 1697 750 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_17270 4729 2075 gene locus_tag LOCUS_17280 4729 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0245 2484 1852 gene locus_tag LOCUS_17290 gene rdgB 2484 1852 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_17290 2768 3046 gene locus_tag LOCUS_17300 2768 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3601 4044 gene locus_tag LOCUS_17310 3601 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 <5133 4132 gene locus_tag LOCUS_17320 <5133 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259233.1:type I glutamate--ammonia ligase >Feature sequence0246 791 399 gene locus_tag LOCUS_17330 791 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2317 977 gene locus_tag LOCUS_17340 2317 977 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_17340 2821 3258 gene locus_tag LOCUS_17350 2821 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3568 4701 gene locus_tag LOCUS_17360 3568 4701 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213815.1 protein_id gnl|my_center|LOCUS_17360 4976 4725 gene locus_tag LOCUS_17370 4976 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0247 1752 895 gene locus_tag LOCUS_17380 1752 895 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_17380 4524 1882 gene locus_tag LOCUS_17390 gene lon 4524 1882 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_17390 <5120 4524 gene locus_tag LOCUS_17400 <5120 4524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941206.1:Hsp20/alpha crystallin family protein >Feature sequence0248 524 991 gene locus_tag LOCUS_17410 524 991 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 protein_id gnl|my_center|LOCUS_17410 1468 2337 gene locus_tag LOCUS_17420 gene murI 1468 2337 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466071.1 protein_id gnl|my_center|LOCUS_17420 2565 3797 gene locus_tag LOCUS_17430 2565 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4811 3876 gene locus_tag LOCUS_17440 gene truB 4811 3876 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence0249 1251 1742 gene locus_tag LOCUS_17450 1251 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2033 2752 gene locus_tag LOCUS_17460 2033 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence0250 540 464 gene locus_tag LOCUS_t00230 540 464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1998 667 gene locus_tag LOCUS_17470 1998 667 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_17470 2941 2231 gene locus_tag LOCUS_17480 2941 2231 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_17480 3313 4065 gene locus_tag LOCUS_17490 3313 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 <5108 4273 gene locus_tag LOCUS_17500 <5108 4273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257019.1:DNA mismatch repair endonuclease MutL >Feature sequence0251 1296 196 gene locus_tag LOCUS_17510 1296 196 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 protein_id gnl|my_center|LOCUS_17510 2146 1313 gene locus_tag LOCUS_17520 2146 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2221 2517 gene locus_tag LOCUS_17530 2221 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2543 3223 gene locus_tag LOCUS_17540 2543 3223 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_17540 3274 4104 gene locus_tag LOCUS_17550 3274 4104 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0252 503 1219 gene locus_tag LOCUS_17560 503 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1384 2088 gene locus_tag LOCUS_17570 1384 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2289 2729 gene locus_tag LOCUS_17580 2289 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4753 2930 gene locus_tag LOCUS_17590 4753 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0253 48 473 gene locus_tag LOCUS_17600 48 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 505 828 gene locus_tag LOCUS_17610 505 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1144 1866 gene locus_tag LOCUS_17620 1144 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1932 2543 gene locus_tag LOCUS_17630 1932 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2587 3210 gene locus_tag LOCUS_17640 2587 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3265 3924 gene locus_tag LOCUS_17650 3265 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 <5070 4015 gene locus_tag LOCUS_17660 <5070 4015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258001.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence0254 142 465 gene locus_tag LOCUS_17670 142 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 635 1594 gene locus_tag LOCUS_17680 gene pyrF 635 1594 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_17680 1759 2397 gene locus_tag LOCUS_17690 1759 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3593 3339 gene locus_tag LOCUS_17700 3593 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3556 3984 gene locus_tag LOCUS_17710 3556 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4721 4215 gene locus_tag LOCUS_17720 4721 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0255 <1 1539 gene locus_tag LOCUS_17730 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534221.1:GMC family oxidoreductase 1675 2883 gene locus_tag LOCUS_17740 1675 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0256 628 470 gene locus_tag LOCUS_17750 628 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1655 795 gene locus_tag LOCUS_17760 1655 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1813 2655 gene locus_tag LOCUS_17770 1813 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3713 2784 gene locus_tag LOCUS_17780 3713 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4669 3773 gene locus_tag LOCUS_17790 4669 3773 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0257 <1 990 gene locus_tag LOCUS_17800 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 1374 2102 gene locus_tag LOCUS_17810 1374 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17810 2136 3668 gene locus_tag LOCUS_17820 2136 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3983 4477 gene locus_tag LOCUS_17830 3983 4477 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence0258 1417 2454 gene locus_tag LOCUS_17840 1417 2454 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_17840 2631 3794 gene locus_tag LOCUS_17850 2631 3794 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0259 623 1216 gene locus_tag LOCUS_17860 623 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1824 1297 gene locus_tag LOCUS_17870 1824 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2095 3363 gene locus_tag LOCUS_17880 gene serS 2095 3363 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence0260 1114 2859 gene locus_tag LOCUS_17890 1114 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3138 2965 gene locus_tag LOCUS_17900 3138 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3726 3373 gene locus_tag LOCUS_17910 3726 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 <4963 4070 gene locus_tag LOCUS_17920 <4963 4070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618783.1:MFS transporter >Feature sequence0261 1136 759 gene locus_tag LOCUS_17930 1136 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1551 1318 gene locus_tag LOCUS_17940 1551 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2620 2036 gene locus_tag LOCUS_17950 2620 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3606 2617 gene locus_tag LOCUS_17960 3606 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4249 3872 gene locus_tag LOCUS_17970 4249 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4664 4431 gene locus_tag LOCUS_17980 4664 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence0262 537 461 gene locus_tag LOCUS_t00240 537 461 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1186 704 gene locus_tag LOCUS_17990 1186 704 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_17990 1502 1221 gene locus_tag LOCUS_18000 1502 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3092 2250 gene locus_tag LOCUS_18010 3092 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3860 3342 gene locus_tag LOCUS_18020 3860 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4144 4755 gene locus_tag LOCUS_18030 4144 4755 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence0263 1011 265 gene locus_tag LOCUS_18040 1011 265 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_18040 2051 1236 gene locus_tag LOCUS_18050 2051 1236 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_18050 2845 2069 gene locus_tag LOCUS_18060 2845 2069 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_18060 4238 2997 gene locus_tag LOCUS_18070 4238 2997 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence0264 911 639 gene locus_tag LOCUS_18080 911 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1077 1724 gene locus_tag LOCUS_18090 1077 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1913 3715 gene locus_tag LOCUS_18100 gene argS 1913 3715 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_18100 4405 3887 gene locus_tag LOCUS_18110 4405 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0265 609 118 gene locus_tag LOCUS_18120 gene folK 609 118 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_18120 942 2339 gene locus_tag LOCUS_18130 gene hemA 942 2339 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258452.1 protein_id gnl|my_center|LOCUS_18130 2345 3013 gene locus_tag LOCUS_18140 2345 3013 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_18140 3163 3684 gene locus_tag LOCUS_18150 3163 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 <4935 3743 gene locus_tag LOCUS_18160 <4935 3743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256150.1:NAD-dependent DNA ligase LigA >Feature sequence0266 80 898 gene locus_tag LOCUS_18170 80 898 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257125.1 protein_id gnl|my_center|LOCUS_18170 2059 1502 gene locus_tag LOCUS_18180 2059 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2318 3217 gene locus_tag LOCUS_18190 2318 3217 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_18190 3640 3257 gene locus_tag LOCUS_18200 3640 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 <4909 4170 gene locus_tag LOCUS_18210 <4909 4170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258498.1:DNA polymerase III subunit beta >Feature sequence0267 2984 1188 gene locus_tag LOCUS_18220 gene pepF 2984 1188 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_18220 3139 3786 gene locus_tag LOCUS_18230 3139 3786 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087248.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0268 4096 2909 gene locus_tag LOCUS_18240 4096 2909 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0269 40 1065 gene locus_tag LOCUS_18250 40 1065 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_18250 1433 2023 gene locus_tag LOCUS_18260 1433 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2390 2548 gene locus_tag LOCUS_18270 2390 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2686 4764 gene locus_tag LOCUS_18280 gene dnaX 2686 4764 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence0270 1175 174 gene locus_tag LOCUS_18290 1175 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2119 1406 gene locus_tag LOCUS_18300 2119 1406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530046.1 protein_id gnl|my_center|LOCUS_18300 2875 2351 gene locus_tag LOCUS_18310 gene cueR 2875 2351 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_18310 4161 3148 gene locus_tag LOCUS_18320 4161 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 <4867 4290 gene locus_tag LOCUS_18330 <4867 4290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143730.1:trypsin-like peptidase domain-containing protein >Feature sequence0271 1069 239 gene locus_tag LOCUS_18340 1069 239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_18340 1535 2743 gene locus_tag LOCUS_18350 1535 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3343 2834 gene locus_tag LOCUS_18360 3343 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3911 3330 gene locus_tag LOCUS_18370 gene rsmD 3911 3330 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0272 799 1218 gene locus_tag LOCUS_18380 gene mraZ 799 1218 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_18380 1338 2318 gene locus_tag LOCUS_18390 gene rsmH 1338 2318 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_18390 2430 2858 gene locus_tag LOCUS_18400 2430 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2970 3857 gene locus_tag LOCUS_18410 2970 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4030 4638 gene locus_tag LOCUS_18420 4030 4638 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence0273 1275 406 gene locus_tag LOCUS_18430 gene cas1c 1275 406 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18430 1961 1275 gene locus_tag LOCUS_18440 gene cas4 1961 1275 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_18440 3200 2235 gene locus_tag LOCUS_18450 gene cas7c 3200 2235 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392032.1 protein_id gnl|my_center|LOCUS_18450 <4811 3288 gene locus_tag LOCUS_18460 <4811 3288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392033.1:type I-C CRISPR-associated protein Cas8c/Csd1 >Feature sequence0274 <1 1043 gene locus_tag LOCUS_18470 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390650.1:DMT family transporter 1060 1356 gene locus_tag LOCUS_18480 1060 1356 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941818.1 protein_id gnl|my_center|LOCUS_18480 2642 1383 gene locus_tag LOCUS_18490 gene rho 2642 1383 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_18490 3196 4752 gene locus_tag LOCUS_18500 3196 4752 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence0275 532 723 gene locus_tag LOCUS_18510 532 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1400 2029 gene locus_tag LOCUS_18520 1400 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2685 2071 gene locus_tag LOCUS_18530 2685 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3058 2744 gene locus_tag LOCUS_18540 3058 2744 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_18540 4563 3316 gene locus_tag LOCUS_18550 4563 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence0276 248 1036 gene locus_tag LOCUS_18560 gene map 248 1036 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233851.1 protein_id gnl|my_center|LOCUS_18560 2482 1298 gene locus_tag LOCUS_18570 2482 1298 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_18570 2854 4626 gene locus_tag LOCUS_18580 2854 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0277 2472 2879 gene locus_tag LOCUS_18590 2472 2879 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722102.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence0278 <1 846 gene locus_tag LOCUS_18600 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259547.1:N-methyl-L-tryptophan oxidase 1031 1900 gene locus_tag LOCUS_18610 1031 1900 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_18610 1901 3787 gene locus_tag LOCUS_18620 gene recN 1901 3787 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_18620 4159 4434 gene locus_tag LOCUS_18630 gene rsfS 4159 4434 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_18630 4458 4643 gene locus_tag LOCUS_18640 4458 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence0279 664 1008 gene locus_tag LOCUS_18650 664 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1553 1155 gene locus_tag LOCUS_18660 1553 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2436 1573 gene locus_tag LOCUS_18670 2436 1573 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_18670 3017 2541 gene locus_tag LOCUS_18680 3017 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 <4778 3186 gene locus_tag LOCUS_18690 <4778 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980092.1:glycoside hydrolase family 15 protein >Feature sequence0280 901 95 gene locus_tag LOCUS_18700 901 95 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_18700 1793 891 gene locus_tag LOCUS_18710 1793 891 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_18710 2728 1790 gene locus_tag LOCUS_18720 2728 1790 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393906.1 protein_id gnl|my_center|LOCUS_18720 3732 2725 gene locus_tag LOCUS_18730 3732 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 <4762 3725 gene locus_tag LOCUS_18740 <4762 3725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530062.1:AarF/ABC1/UbiB kinase family protein >Feature sequence0281 2151 3188 gene locus_tag LOCUS_18750 2151 3188 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_18750 3353 4321 gene locus_tag LOCUS_18760 3353 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18760 >Feature sequence0282 175 786 gene locus_tag LOCUS_18770 175 786 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219999.1 protein_id gnl|my_center|LOCUS_18770 3723 859 gene locus_tag LOCUS_18780 3723 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 <4744 3988 gene locus_tag LOCUS_18790 <4744 3988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257644.1:ABC transporter ATP-binding protein >Feature sequence0283 <1 2199 gene locus_tag LOCUS_18800 <1 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256716.1:ATP-dependent RecD-like DNA helicase 2404 3303 gene locus_tag LOCUS_18810 2404 3303 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_18810 3566 4024 gene locus_tag LOCUS_18820 3566 4024 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330765.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence0284 344 2014 gene locus_tag LOCUS_18830 344 2014 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_18830 2665 2069 gene locus_tag LOCUS_18840 2665 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4024 2903 gene locus_tag LOCUS_18850 4024 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_18850 <4711 4133 gene locus_tag LOCUS_18860 <4711 4133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860977.1:glycogen synthase GlgA >Feature sequence0285 1178 345 gene locus_tag LOCUS_18870 1178 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1493 1780 gene locus_tag LOCUS_18880 1493 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2479 2027 gene locus_tag LOCUS_18890 gene ndk 2479 2027 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140712.1 protein_id gnl|my_center|LOCUS_18890 2894 2547 gene locus_tag LOCUS_18900 2894 2547 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256591.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0286 1544 1469 gene locus_tag LOCUS_t00250 1544 1469 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2236 1745 gene locus_tag LOCUS_18910 2236 1745 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_18910 3034 2294 gene locus_tag LOCUS_18920 3034 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4641 3397 gene locus_tag LOCUS_18930 4641 3397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence0287 >Feature sequence0288 290 1267 gene locus_tag LOCUS_18940 290 1267 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257415.1 protein_id gnl|my_center|LOCUS_18940 1906 2865 gene locus_tag LOCUS_18950 1906 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3013 3843 gene locus_tag LOCUS_18960 3013 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence0289 1834 1121 gene locus_tag LOCUS_18970 gene radC 1834 1121 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_18970 2336 2860 gene locus_tag LOCUS_18980 2336 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2941 3231 gene locus_tag LOCUS_18990 gene rpmA 2941 3231 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_18990 3652 4572 gene locus_tag LOCUS_19000 3652 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0290 559 780 gene locus_tag LOCUS_19010 559 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1062 1853 gene locus_tag LOCUS_19020 1062 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3544 1946 gene locus_tag LOCUS_19030 3544 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0291 144 1451 gene locus_tag LOCUS_19040 144 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1512 1751 gene locus_tag LOCUS_19050 1512 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1996 3999 gene locus_tag LOCUS_19060 1996 3999 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_19060 <4661 4110 gene locus_tag LOCUS_19070 <4661 4110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222459.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence0292 2815 1202 gene locus_tag LOCUS_19080 2815 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4529 3234 gene locus_tag LOCUS_19090 4529 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0293 2038 2601 gene locus_tag LOCUS_19100 gene pth 2038 2601 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence0294 1696 602 gene locus_tag LOCUS_19110 1696 602 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_19110 3704 1725 gene locus_tag LOCUS_19120 3704 1725 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_19120 <4642 3841 gene locus_tag LOCUS_19130 <4642 3841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941287.1:glycosyltransferase family 4 protein >Feature sequence0295 <1 1172 gene locus_tag LOCUS_19140 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393418.1:helicase-associated domain-containing protein 1383 2333 gene locus_tag LOCUS_19150 1383 2333 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 protein_id gnl|my_center|LOCUS_19150 2735 3544 gene locus_tag LOCUS_19160 2735 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3963 3643 gene locus_tag LOCUS_19170 3963 3643 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229318.1 protein_id gnl|my_center|LOCUS_19170 <4611 4046 gene locus_tag LOCUS_19180 <4611 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173864.1:Fe-S cluster assembly protein SufD >Feature sequence0296 152 2083 gene locus_tag LOCUS_19190 152 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2232 3389 gene locus_tag LOCUS_19200 gene ychF 2232 3389 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0297 628 1647 gene locus_tag LOCUS_19210 gene thiL 628 1647 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_19210 1774 2451 gene locus_tag LOCUS_19220 1774 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2988 2497 gene locus_tag LOCUS_19230 2988 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3839 2985 gene locus_tag LOCUS_19240 3839 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0298 1263 1910 gene locus_tag LOCUS_19250 1263 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2215 2139 gene locus_tag LOCUS_t00260 2215 2139 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4249 2276 gene locus_tag LOCUS_19260 gene selB 4249 2276 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence0299 1757 30 gene locus_tag LOCUS_19270 1757 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2003 2638 gene locus_tag LOCUS_19280 2003 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 3221 2670 gene locus_tag LOCUS_19290 3221 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 <4535 3208 gene locus_tag LOCUS_19300 <4535 3208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385472.1:ParA family protein >Feature sequence0300 188 1546 gene locus_tag LOCUS_19310 gene waaF 188 1546 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_19310 1521 2711 gene locus_tag LOCUS_19320 gene waaF 1521 2711 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_19320 3948 2626 gene locus_tag LOCUS_19330 3948 2626 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_19330 4247 3948 gene locus_tag LOCUS_19340 4247 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0301 309 1001 gene locus_tag LOCUS_19350 309 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1634 1152 gene locus_tag LOCUS_19360 1634 1152 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_19360 2872 1946 gene locus_tag LOCUS_19370 2872 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3519 2977 gene locus_tag LOCUS_19380 3519 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3903 3586 gene locus_tag LOCUS_19390 3903 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0302 365 162 gene locus_tag LOCUS_19400 365 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 802 728 gene locus_tag LOCUS_t00270 802 728 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1051 2106 gene locus_tag LOCUS_19410 1051 2106 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582559.1 protein_id gnl|my_center|LOCUS_19410 3317 2148 gene locus_tag LOCUS_19420 3317 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 <4485 3325 gene locus_tag LOCUS_19430 <4485 3325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768344.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0303 656 1591 gene locus_tag LOCUS_19440 656 1591 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_19440 3996 1588 gene locus_tag LOCUS_19450 3996 1588 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0304 1364 99 gene locus_tag LOCUS_19460 1364 99 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_19460 2111 1557 gene locus_tag LOCUS_19470 2111 1557 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_19470 2680 2946 gene locus_tag LOCUS_19480 2680 2946 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919553.1 protein_id gnl|my_center|LOCUS_19480 <4430 3095 gene locus_tag LOCUS_19490 <4430 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228459.1:M20/M25/M40 family metallo-hydrolase >Feature sequence0305 681 3665 gene locus_tag LOCUS_19500 681 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3833 4267 gene locus_tag LOCUS_19510 3833 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0306 407 63 gene locus_tag LOCUS_19520 407 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1494 1336 gene locus_tag LOCUS_19530 1494 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2854 4101 gene locus_tag LOCUS_19540 2854 4101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence0307 56 634 gene locus_tag LOCUS_19550 56 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2108 588 gene locus_tag LOCUS_19560 2108 588 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_19560 2801 2418 gene locus_tag LOCUS_19570 2801 2418 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496859.1 protein_id gnl|my_center|LOCUS_19570 3215 4390 gene locus_tag LOCUS_19580 3215 4390 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0308 1879 173 gene locus_tag LOCUS_19590 1879 173 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_19590 2108 4288 gene locus_tag LOCUS_19600 2108 4288 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence0309 475 2676 gene locus_tag LOCUS_19610 475 2676 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_19610 2975 3238 gene locus_tag LOCUS_19620 2975 3238 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence0310 <1 2362 gene locus_tag LOCUS_19630 <1 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence0311 793 879 gene locus_tag LOCUS_t00280 793 879 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 883 975 gene locus_tag LOCUS_t00290 883 975 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1428 1111 gene locus_tag LOCUS_19640 1428 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1735 1415 gene locus_tag LOCUS_19650 1735 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1977 2270 gene locus_tag LOCUS_19660 1977 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence0312 172 702 gene locus_tag LOCUS_19670 172 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 807 1625 gene locus_tag LOCUS_19680 807 1625 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_19680 1629 2369 gene locus_tag LOCUS_19690 1629 2369 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143928.1 protein_id gnl|my_center|LOCUS_19690 3040 2444 gene locus_tag LOCUS_19700 3040 2444 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0313 1424 3949 gene locus_tag LOCUS_19710 gene leuS 1424 3949 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence0314 <1 625 gene locus_tag LOCUS_19720 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007140.1:DedA family protein 3744 775 gene locus_tag LOCUS_19730 gene polA 3744 775 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence0315 2139 2963 gene locus_tag LOCUS_19740 gene alaXM 2139 2963 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence0316 <1 961 gene locus_tag LOCUS_19750 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000254941.1:gluconokinase 1120 2283 gene locus_tag LOCUS_19760 1120 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2562 2951 gene locus_tag LOCUS_19770 2562 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2976 4154 gene locus_tag LOCUS_19780 2976 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0317 1696 917 gene locus_tag LOCUS_19790 1696 917 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_19790 2857 1853 gene locus_tag LOCUS_19800 2857 1853 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_19800 3429 2935 gene locus_tag LOCUS_19810 3429 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3640 3825 gene locus_tag LOCUS_19820 3640 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence0318 120 1202 gene locus_tag LOCUS_19830 120 1202 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220194564.1 protein_id gnl|my_center|LOCUS_19830 2980 1265 gene locus_tag LOCUS_19840 2980 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence0319 3052 32 gene locus_tag LOCUS_19850 3052 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence0320 373 1143 gene locus_tag LOCUS_19860 gene pgl 373 1143 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_19860 1284 1940 gene locus_tag LOCUS_19870 gene rpe 1284 1940 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_19870 2149 2517 gene locus_tag LOCUS_19880 2149 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2551 3648 gene locus_tag LOCUS_19890 gene plsX 2551 3648 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_19890 4209 3745 gene locus_tag LOCUS_19900 4209 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence0321 <1 1741 gene locus_tag LOCUS_19910 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027969.1:glycoside hydrolase family 15 protein 1939 2727 gene locus_tag LOCUS_19920 1939 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 <4227 2737 gene locus_tag LOCUS_19930 <4227 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258188.1:CCA tRNA nucleotidyltransferase >Feature sequence0322 1199 564 gene locus_tag LOCUS_19940 1199 564 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_19940 2608 1403 gene locus_tag LOCUS_19950 2608 1403 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 protein_id gnl|my_center|LOCUS_19950 3500 2646 gene locus_tag LOCUS_19960 3500 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 <4221 3702 gene locus_tag LOCUS_19970 <4221 3702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227145.1:phosphatidylinositol mannoside acyltransferase >Feature sequence0323 81 899 gene locus_tag LOCUS_19980 81 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 896 1111 gene locus_tag LOCUS_19990 896 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1329 1574 gene locus_tag LOCUS_20000 1329 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2054 1704 gene locus_tag LOCUS_20010 2054 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2388 3527 gene locus_tag LOCUS_20020 2388 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0324 1025 2002 gene locus_tag LOCUS_20030 gene ispH 1025 2002 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence0325 <1 785 gene locus_tag LOCUS_20040 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037402005.1:homoserine dehydrogenase 944 3559 gene locus_tag LOCUS_20050 gene pheT 944 3559 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0326 <1 649 gene locus_tag LOCUS_20060 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545962.1:glycerol-3-phosphate 1-O-acyltransferase PlsY 649 1833 gene locus_tag LOCUS_20070 649 1833 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_20070 867 954 gene locus_tag LOCUS_t00300 867 954 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2838 1834 gene locus_tag LOCUS_20080 2838 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3992 2910 gene locus_tag LOCUS_20090 3992 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3961 4110 gene locus_tag LOCUS_20100 3961 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence0327 5 292 gene locus_tag LOCUS_20110 5 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 418 942 gene locus_tag LOCUS_20120 418 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1242 1039 gene locus_tag LOCUS_20130 1242 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2124 1708 gene locus_tag LOCUS_20140 2124 1708 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762487.1 protein_id gnl|my_center|LOCUS_20140 3712 2201 gene locus_tag LOCUS_20150 3712 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence0328 1807 1028 gene locus_tag LOCUS_20160 1807 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 3350 2184 gene locus_tag LOCUS_20170 3350 2184 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 protein_id gnl|my_center|LOCUS_20170 3697 3347 gene locus_tag LOCUS_20180 3697 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4011 3769 gene locus_tag LOCUS_20190 4011 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence0329 276 791 gene locus_tag LOCUS_20200 276 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 815 1402 gene locus_tag LOCUS_20210 815 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1446 1844 gene locus_tag LOCUS_20220 1446 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2334 2119 gene locus_tag LOCUS_20230 2334 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3517 2465 gene locus_tag LOCUS_20240 3517 2465 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225980.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence0330 1335 2348 gene locus_tag LOCUS_20250 1335 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0331 1006 101 gene locus_tag LOCUS_20260 1006 101 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897361.1 protein_id gnl|my_center|LOCUS_20260 2305 1019 gene locus_tag LOCUS_20270 2305 1019 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_20270 4044 2332 gene locus_tag LOCUS_20280 4044 2332 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence0332 548 1606 gene locus_tag LOCUS_20290 548 1606 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_20290 1610 1915 gene locus_tag LOCUS_20300 1610 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2051 3361 gene locus_tag LOCUS_20310 2051 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence0333 <1 705 gene locus_tag LOCUS_20320 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943979.1:2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 1621 749 gene locus_tag LOCUS_20330 1621 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2099 3571 gene locus_tag LOCUS_20340 2099 3571 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_20340 3688 3764 gene locus_tag LOCUS_t00310 3688 3764 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0334 2033 1599 gene locus_tag LOCUS_20350 2033 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2609 2079 gene locus_tag LOCUS_20360 2609 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence0335 2746 692 gene locus_tag LOCUS_20370 2746 692 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618845.1 protein_id gnl|my_center|LOCUS_20370 3186 3521 gene locus_tag LOCUS_20380 3186 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0336 <1 3791 gene locus_tag LOCUS_20390 <1 3791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084790.1:SbcC/MukB-like Walker B domain-containing protein >Feature sequence0337 352 2343 gene locus_tag LOCUS_20400 352 2343 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence0338 <1 1054 gene locus_tag LOCUS_20410 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546515.1:glycosyltransferase family 4 protein 2780 1095 gene locus_tag LOCUS_20420 2780 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 <4075 2952 gene locus_tag LOCUS_20430 <4075 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158842832.1:glycoside hydrolase family 44 protein >Feature sequence0339 293 730 gene locus_tag LOCUS_20440 293 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 727 2112 gene locus_tag LOCUS_20450 727 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2149 3774 gene locus_tag LOCUS_20460 2149 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence0340 152 388 gene locus_tag LOCUS_20470 152 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 549 1163 gene locus_tag LOCUS_20480 549 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1300 1740 gene locus_tag LOCUS_20490 1300 1740 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971972.1 protein_id gnl|my_center|LOCUS_20490 3668 1917 gene locus_tag LOCUS_20500 3668 1917 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079800.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0341 2 991 gene locus_tag LOCUS_20510 2 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1112 2353 gene locus_tag LOCUS_20520 1112 2353 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_20520 2412 2768 gene locus_tag LOCUS_20530 2412 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3008 4003 gene locus_tag LOCUS_20540 3008 4003 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence0342 315 1718 gene locus_tag LOCUS_20550 315 1718 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_20550 1728 2858 gene locus_tag LOCUS_20560 1728 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 <4020 2966 gene locus_tag LOCUS_20570 <4020 2966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393156.1:Mrp/NBP35 family ATP-binding protein >Feature sequence0343 119 1006 gene locus_tag LOCUS_20580 gene pdxS 119 1006 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_20580 1313 1385 gene locus_tag LOCUS_t00320 1313 1385 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1487 3016 gene locus_tag LOCUS_20590 gene glmU 1487 3016 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence0344 1160 198 gene locus_tag LOCUS_20600 1160 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1688 1179 gene locus_tag LOCUS_20610 1688 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3192 2200 gene locus_tag LOCUS_20620 3192 2200 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392260.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0345 631 191 gene locus_tag LOCUS_20630 631 191 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530634.1 protein_id gnl|my_center|LOCUS_20630 762 1151 gene locus_tag LOCUS_20640 762 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1216 1461 gene locus_tag LOCUS_20650 1216 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1733 1425 gene locus_tag LOCUS_20660 1733 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence0346 1133 144 gene locus_tag LOCUS_20670 1133 144 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_20670 2221 1130 gene locus_tag LOCUS_20680 2221 1130 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082966.1 protein_id gnl|my_center|LOCUS_20680 3205 2246 gene locus_tag LOCUS_20690 3205 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 <3995 3255 gene locus_tag LOCUS_20700 <3995 3255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048655409.1:squalene--hopene cyclase >Feature sequence0347 1335 586 gene locus_tag LOCUS_20710 1335 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2615 1539 gene locus_tag LOCUS_20720 2615 1539 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence0348 249 1190 gene locus_tag LOCUS_20730 249 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1999 1313 gene locus_tag LOCUS_20740 1999 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence0349 1650 3080 gene locus_tag LOCUS_20750 1650 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345468.1 protein_id gnl|my_center|LOCUS_20750 3213 3860 gene locus_tag LOCUS_20760 3213 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0350 180 1076 gene locus_tag LOCUS_20770 180 1076 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_20770 1302 3164 gene locus_tag LOCUS_20780 1302 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_20780 3548 3198 gene locus_tag LOCUS_20790 3548 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0351 85 867 gene locus_tag LOCUS_20800 85 867 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_20800 2148 973 gene locus_tag LOCUS_20810 gene tsaD 2148 973 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_20810 2826 2191 gene locus_tag LOCUS_20820 gene rimI 2826 2191 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_20820 3574 2810 gene locus_tag LOCUS_20830 gene tsaB 3574 2810 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence0352 1570 659 gene locus_tag LOCUS_20840 1570 659 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_20840 3378 1831 gene locus_tag LOCUS_20850 3378 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0353 98 1744 gene locus_tag LOCUS_20860 98 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2148 3239 gene locus_tag LOCUS_20870 2148 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence0354 73 840 gene locus_tag LOCUS_20880 73 840 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_20880 1548 871 gene locus_tag LOCUS_20890 1548 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2872 3243 gene locus_tag LOCUS_20900 2872 3243 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151756315.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence0355 246 428 gene locus_tag LOCUS_20910 246 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 445 1245 gene locus_tag LOCUS_20920 445 1245 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973509.1 protein_id gnl|my_center|LOCUS_20920 1307 1675 gene locus_tag LOCUS_20930 1307 1675 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 protein_id gnl|my_center|LOCUS_20930 2991 1768 gene locus_tag LOCUS_20940 2991 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 <3887 3321 gene locus_tag LOCUS_20950 <3887 3321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228156.1:sigma-70 family RNA polymerase sigma factor >Feature sequence0356 981 1505 gene locus_tag LOCUS_20960 981 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1577 2041 gene locus_tag LOCUS_20970 1577 2041 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_20970 2101 3357 gene locus_tag LOCUS_20980 2101 3357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence0357 2 910 gene locus_tag LOCUS_20990 2 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2327 987 gene locus_tag LOCUS_21000 2327 987 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_21000 3779 2415 gene locus_tag LOCUS_21010 3779 2415 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence0358 <1 608 gene locus_tag LOCUS_21020 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257633.1:LIM domain-containing protein 791 1288 gene locus_tag LOCUS_21030 791 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1848 1384 gene locus_tag LOCUS_21040 gene smpB 1848 1384 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence0359 2068 689 gene locus_tag LOCUS_21050 2068 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3311 2400 gene locus_tag LOCUS_21060 3311 2400 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence0360 50 1429 gene locus_tag LOCUS_21070 50 1429 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_21070 1490 1921 gene locus_tag LOCUS_21080 1490 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2409 1927 gene locus_tag LOCUS_21090 2409 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2788 3270 gene locus_tag LOCUS_21100 2788 3270 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence0361 16 1320 gene locus_tag LOCUS_21110 16 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1480 1995 gene locus_tag LOCUS_21120 1480 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2182 3228 gene locus_tag LOCUS_21130 2182 3228 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_21130 3409 3732 gene locus_tag LOCUS_21140 3409 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence0362 276 1883 gene locus_tag LOCUS_21150 276 1883 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_21150 3008 1971 gene locus_tag LOCUS_21160 3008 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 <3811 3145 gene locus_tag LOCUS_21170 <3811 3145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228116.1:class I SAM-dependent methyltransferase >Feature sequence0363 22 1269 gene locus_tag LOCUS_21180 22 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2048 1317 gene locus_tag LOCUS_21190 2048 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3347 2553 gene locus_tag LOCUS_21200 3347 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0364 82 489 gene locus_tag LOCUS_21210 82 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1621 554 gene locus_tag LOCUS_21220 1621 554 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966374.1 protein_id gnl|my_center|LOCUS_21220 2234 1614 gene locus_tag LOCUS_21230 2234 1614 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_21230 2944 2516 gene locus_tag LOCUS_21240 2944 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0365 1229 432 gene locus_tag LOCUS_21250 gene ubiE 1229 432 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_21250 2222 1236 gene locus_tag LOCUS_21260 2222 1236 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_21260 3434 2487 gene locus_tag LOCUS_21270 3434 2487 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence0366 85 255 gene locus_tag LOCUS_21280 85 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 683 1648 gene locus_tag LOCUS_21290 683 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1645 2529 gene locus_tag LOCUS_21300 1645 2529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846403.1 protein_id gnl|my_center|LOCUS_21300 2803 3309 gene locus_tag LOCUS_21310 2803 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence0367 <3772 394 gene locus_tag LOCUS_21320 <3772 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967237.1:AAA family ATPase >Feature sequence0368 2005 1055 gene locus_tag LOCUS_21330 2005 1055 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_21330 3323 2196 gene locus_tag LOCUS_21340 gene mtnA 3323 2196 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence0369 2180 540 gene locus_tag LOCUS_21350 2180 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 <3754 2236 gene locus_tag LOCUS_21360 <3754 2236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979670.1:DUF790 family protein >Feature sequence0370 1109 960 gene locus_tag LOCUS_21370 1109 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2406 1132 gene locus_tag LOCUS_21380 2406 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3441 2578 gene locus_tag LOCUS_21390 3441 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence0371 824 1750 gene locus_tag LOCUS_21400 gene mdh 824 1750 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_21400 2797 1883 gene locus_tag LOCUS_21410 2797 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 <3713 2959 gene locus_tag LOCUS_21420 <3713 2959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106275831.1:GNAT family N-acetyltransferase >Feature sequence0372 <1 1582 gene locus_tag LOCUS_21430 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205128.1:DUF1800 domain-containing protein 1593 2879 gene locus_tag LOCUS_21440 1593 2879 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_21440 <3704 3000 gene locus_tag LOCUS_21450 <3704 3000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017872038.1:M3 family oligoendopeptidase >Feature sequence0373 1504 320 gene locus_tag LOCUS_21460 1504 320 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_21460 1941 1537 gene locus_tag LOCUS_21470 1941 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2959 3444 gene locus_tag LOCUS_21480 2959 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence0374 890 96 gene locus_tag LOCUS_21490 890 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2318 1035 gene locus_tag LOCUS_21500 2318 1035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_21500 3692 2703 gene locus_tag LOCUS_21510 gene prmC 3692 2703 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0375 570 1598 gene locus_tag LOCUS_21520 570 1598 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_21520 2885 1692 gene locus_tag LOCUS_21530 2885 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0376 208 1383 gene locus_tag LOCUS_21540 208 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1380 3116 gene locus_tag LOCUS_21550 1380 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3237 3312 gene locus_tag LOCUS_t00330 3237 3312 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0377 461 1012 gene locus_tag LOCUS_21560 461 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1017 1781 gene locus_tag LOCUS_21570 1017 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2024 2860 gene locus_tag LOCUS_21580 2024 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2857 3360 gene locus_tag LOCUS_21590 2857 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3437 3586 gene locus_tag LOCUS_21600 3437 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence0378 430 182 gene locus_tag LOCUS_21610 430 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1744 491 gene locus_tag LOCUS_21620 1744 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3155 2058 gene locus_tag LOCUS_21630 3155 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0379 <1 1787 gene locus_tag LOCUS_21640 <1 1787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142160.1:cytochrome c oxidase subunit I 1919 2524 gene locus_tag LOCUS_21650 1919 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2696 3592 gene locus_tag LOCUS_21660 2696 3592 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence0380 1201 395 gene locus_tag LOCUS_21670 1201 395 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_21670 1866 1192 gene locus_tag LOCUS_21680 1866 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2210 2818 gene locus_tag LOCUS_21690 2210 2818 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258667.1 protein_id gnl|my_center|LOCUS_21690 2921 3346 gene locus_tag LOCUS_21700 2921 3346 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence0381 1216 92 gene locus_tag LOCUS_21710 1216 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1495 2409 gene locus_tag LOCUS_21720 1495 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21720 2425 2952 gene locus_tag LOCUS_21730 2425 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21730 >Feature sequence0382 103 1353 gene locus_tag LOCUS_21740 103 1353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_21740 1434 1823 gene locus_tag LOCUS_21750 1434 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2055 1825 gene locus_tag LOCUS_21760 2055 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2021 3358 gene locus_tag LOCUS_21770 2021 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence0383 203 2782 gene locus_tag LOCUS_21780 203 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2961 3395 gene locus_tag LOCUS_21790 2961 3395 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence0384 1245 3032 gene locus_tag LOCUS_21800 gene infB 1245 3032 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21800 >Feature sequence0385 1853 399 gene locus_tag LOCUS_21810 1853 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2942 1929 gene locus_tag LOCUS_21820 2942 1929 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence0386 247 726 gene locus_tag LOCUS_21830 247 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1477 2562 gene locus_tag LOCUS_21840 1477 2562 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522282.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21840 2818 3189 gene locus_tag LOCUS_21850 2818 3189 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence0387 <1 1112 gene locus_tag LOCUS_21860 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243042.1:catalase KatX >Feature sequence0388 789 52 gene locus_tag LOCUS_21870 789 52 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_21870 1774 1013 gene locus_tag LOCUS_21880 1774 1013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_21880 <3592 1990 gene locus_tag LOCUS_21890 <3592 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:NAD(P)-binding protein >Feature sequence0389 1440 2324 gene locus_tag LOCUS_21900 1440 2324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_21900 2556 3017 gene locus_tag LOCUS_21910 2556 3017 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence0390 402 1493 gene locus_tag LOCUS_21920 gene ltaE 402 1493 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_21920 1980 1666 gene locus_tag LOCUS_21930 1980 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2225 3163 gene locus_tag LOCUS_21940 2225 3163 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence0391 151 978 gene locus_tag LOCUS_21950 151 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1094 2434 gene locus_tag LOCUS_21960 1094 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2503 2847 gene locus_tag LOCUS_21970 2503 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2927 3220 gene locus_tag LOCUS_21980 gene purS 2927 3220 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence0392 819 298 gene locus_tag LOCUS_21990 819 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1853 822 gene locus_tag LOCUS_22000 1853 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2492 2022 gene locus_tag LOCUS_22010 2492 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2802 3401 gene locus_tag LOCUS_22020 gene pdxT 2802 3401 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence0393 1530 214 gene locus_tag LOCUS_22030 1530 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2533 1790 gene locus_tag LOCUS_22040 2533 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2771 2995 gene locus_tag LOCUS_22050 2771 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0394 180 707 gene locus_tag LOCUS_22060 180 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2075 771 gene locus_tag LOCUS_22070 2075 771 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905496.1 protein_id gnl|my_center|LOCUS_22070 2259 3305 gene locus_tag LOCUS_22080 2259 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0395 577 873 gene locus_tag LOCUS_22090 577 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1693 944 gene locus_tag LOCUS_22100 1693 944 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence0396 571 1356 gene locus_tag LOCUS_22110 gene thyX 571 1356 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_22110 1406 2110 gene locus_tag LOCUS_22120 gene tmk 1406 2110 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence0397 556 161 gene locus_tag LOCUS_22130 556 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1327 557 gene locus_tag LOCUS_22140 1327 557 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 protein_id gnl|my_center|LOCUS_22140 2110 3459 gene locus_tag LOCUS_22150 2110 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence0398 91 474 gene locus_tag LOCUS_22160 91 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1960 767 gene locus_tag LOCUS_22170 gene queG 1960 767 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968507.1 protein_id gnl|my_center|LOCUS_22170 2178 2765 gene locus_tag LOCUS_22180 2178 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2920 3450 gene locus_tag LOCUS_22190 2920 3450 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence0399 1326 2294 gene locus_tag LOCUS_22200 1326 2294 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_22200 3344 2259 gene locus_tag LOCUS_22210 3344 2259 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence0400 956 441 gene locus_tag LOCUS_22220 956 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1891 1223 gene locus_tag LOCUS_22230 1891 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2380 1907 gene locus_tag LOCUS_22240 2380 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 <3480 2686 gene locus_tag LOCUS_22250 <3480 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460386.1:pitrilysin family protein >Feature sequence0401 290 1462 gene locus_tag LOCUS_22260 290 1462 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_22260 1459 2391 gene locus_tag LOCUS_22270 1459 2391 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553741.1 protein_id gnl|my_center|LOCUS_22270 2500 2964 gene locus_tag LOCUS_22280 2500 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22280 >Feature sequence0402 592 3144 gene locus_tag LOCUS_22290 592 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence0403 2230 932 gene locus_tag LOCUS_22300 2230 932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_22300 3190 2591 gene locus_tag LOCUS_22310 3190 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence0404 3341 2274 gene locus_tag LOCUS_22320 3341 2274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence0405 <1 934 gene locus_tag LOCUS_22330 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258873.1:adenosylhomocysteinase 1186 2442 gene locus_tag LOCUS_22340 gene metK 1186 2442 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 protein_id gnl|my_center|LOCUS_22340 2949 2734 gene locus_tag LOCUS_22350 2949 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0406 1151 135 gene locus_tag LOCUS_22360 1151 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22360 1887 1219 gene locus_tag LOCUS_22370 1887 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0407 1476 109 gene locus_tag LOCUS_22380 1476 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2107 2490 gene locus_tag LOCUS_22390 gene yciH 2107 2490 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210612.1 protein_id gnl|my_center|LOCUS_22390 2548 2931 gene locus_tag LOCUS_22400 2548 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0408 2536 1751 gene locus_tag LOCUS_22410 2536 1751 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence0409 >Feature sequence0410 984 1331 gene locus_tag LOCUS_22420 984 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2480 1647 gene locus_tag LOCUS_22430 2480 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence0411 254 1645 gene locus_tag LOCUS_22440 254 1645 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_22440 1645 3021 gene locus_tag LOCUS_22450 1645 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0412 286 786 gene locus_tag LOCUS_22460 gene rplI 286 786 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_22460 2105 981 gene locus_tag LOCUS_22470 2105 981 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_22470 3303 2185 gene locus_tag LOCUS_22480 3303 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0413 151 1857 gene locus_tag LOCUS_22490 gene metG 151 1857 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_22490 1854 2591 gene locus_tag LOCUS_22500 1854 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence0414 2040 2324 gene locus_tag LOCUS_22510 2040 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 <3396 2455 gene locus_tag LOCUS_22520 <3396 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970308.1:DEAD/DEAH box helicase family protein >Feature sequence0415 203 39 gene locus_tag LOCUS_22530 203 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1347 346 gene locus_tag LOCUS_22540 1347 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2293 1847 gene locus_tag LOCUS_22550 2293 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 <3394 2290 gene locus_tag LOCUS_22560 <3394 2290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:ATP-binding protein >Feature sequence0416 840 91 gene locus_tag LOCUS_22570 840 91 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 protein_id gnl|my_center|LOCUS_22570 2737 1154 gene locus_tag LOCUS_22580 2737 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence0417 336 605 gene locus_tag LOCUS_22590 gene rpsO 336 605 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_22590 884 3244 gene locus_tag LOCUS_22600 gene pnp 884 3244 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence0418 4 921 gene locus_tag LOCUS_22610 4 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1219 1797 gene locus_tag LOCUS_22620 1219 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3308 1842 gene locus_tag LOCUS_22630 3308 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence0419 162 1262 gene locus_tag LOCUS_22640 162 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1433 2011 gene locus_tag LOCUS_22650 1433 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2627 2022 gene locus_tag LOCUS_22660 2627 2022 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_22660 <3361 2819 gene locus_tag LOCUS_22670 <3361 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392054.1:3-oxoadipate enol-lactonase >Feature sequence0420 1687 83 gene locus_tag LOCUS_22680 gene aceB 1687 83 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_22680 3152 1878 gene locus_tag LOCUS_22690 gene aceA 3152 1878 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0421 1425 730 gene locus_tag LOCUS_22700 1425 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1807 2199 gene locus_tag LOCUS_22710 1807 2199 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107963.1 protein_id gnl|my_center|LOCUS_22710 2243 2980 gene locus_tag LOCUS_22720 2243 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence0422 2232 1312 gene locus_tag LOCUS_22730 2232 1312 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_22730 <3308 2236 gene locus_tag LOCUS_22740 <3308 2236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267704.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence0423 520 927 gene locus_tag LOCUS_22750 520 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1441 938 gene locus_tag LOCUS_22760 1441 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2316 1504 gene locus_tag LOCUS_22770 2316 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0424 1783 677 gene locus_tag LOCUS_22780 1783 677 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_22780 2982 1906 gene locus_tag LOCUS_22790 2982 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence0425 584 1393 gene locus_tag LOCUS_22800 gene pstB 584 1393 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_22800 1636 2289 gene locus_tag LOCUS_22810 gene phoU 1636 2289 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_22810 2292 3026 gene locus_tag LOCUS_22820 2292 3026 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence0426 <1 932 gene locus_tag LOCUS_22830 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888818.1:class I SAM-dependent methyltransferase 1167 1970 gene locus_tag LOCUS_22840 1167 1970 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392812.1 protein_id gnl|my_center|LOCUS_22840 3142 2015 gene locus_tag LOCUS_22850 3142 2015 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence0427 238 1278 gene locus_tag LOCUS_22860 238 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0428 <1 905 gene locus_tag LOCUS_22870 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287377.1:Stk1 family PASTA domain-containing Ser/Thr kinase 942 1901 gene locus_tag LOCUS_22880 942 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1996 3231 gene locus_tag LOCUS_22890 1996 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0429 465 390 gene locus_tag LOCUS_t00340 465 390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 625 1206 gene locus_tag LOCUS_22900 625 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1530 2714 gene locus_tag LOCUS_22910 1530 2714 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0430 199 534 gene locus_tag LOCUS_22920 gene gsiB 199 534 CDS product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 protein_id gnl|my_center|LOCUS_22920 769 1191 gene locus_tag LOCUS_22930 gene gsiB 769 1191 CDS product glucose starvation-inducible protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246542.1 protein_id gnl|my_center|LOCUS_22930 1647 2744 gene locus_tag LOCUS_22940 1647 2744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0431 795 46 gene locus_tag LOCUS_22950 795 46 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_22950 2671 1028 gene locus_tag LOCUS_22960 2671 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 <3223 2668 gene locus_tag LOCUS_22970 <3223 2668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091085.1:alpha/beta fold hydrolase >Feature sequence0432 <1 2147 gene locus_tag LOCUS_22980 <1 2147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390326.1:1,4-alpha-glucan branching protein GlgB >Feature sequence0433 1 813 gene locus_tag LOCUS_22990 1 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1944 1174 gene locus_tag LOCUS_23000 1944 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <3180 1990 gene locus_tag LOCUS_23010 <3180 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967784.1:alanine--glyoxylate aminotransferase family protein >Feature sequence0434 <1 1679 gene locus_tag LOCUS_23020 <1 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258948.1:transcription-repair coupling factor 2109 3062 gene locus_tag LOCUS_23030 2109 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence0435 531 752 gene locus_tag LOCUS_23040 531 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 749 2122 gene locus_tag LOCUS_23050 749 2122 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_23050 <3175 2496 gene locus_tag LOCUS_23060 <3175 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362481.1:rhomboid family intramembrane serine protease >Feature sequence0436 105 1721 gene locus_tag LOCUS_23070 105 1721 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence0437 1913 489 gene locus_tag LOCUS_23080 1913 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2872 2000 gene locus_tag LOCUS_23090 2872 2000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence0438 1235 51 gene locus_tag LOCUS_23100 1235 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 <3160 1232 gene locus_tag LOCUS_23110 <3160 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965347.1:DUF87 domain-containing protein >Feature sequence0439 603 1169 gene locus_tag LOCUS_23120 603 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1820 1269 gene locus_tag LOCUS_23130 1820 1269 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_23130 2075 2395 gene locus_tag LOCUS_23140 2075 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530988.1 protein_id gnl|my_center|LOCUS_23140 <3152 2507 gene locus_tag LOCUS_23150 <3152 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256652.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence0440 3 428 gene locus_tag LOCUS_23160 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1020 610 gene locus_tag LOCUS_23170 1020 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0441 1674 2672 gene locus_tag LOCUS_23180 gene glk 1674 2672 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_23180 2947 2687 gene locus_tag LOCUS_23190 2947 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0442 <1 1785 gene locus_tag LOCUS_23200 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226763.1:VWA domain-containing protein 1775 2533 gene locus_tag LOCUS_23210 gene rsmG 1775 2533 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence0443 1764 928 gene locus_tag LOCUS_23220 1764 928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_23220 2797 2069 gene locus_tag LOCUS_23230 2797 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence0444 <1 647 gene locus_tag LOCUS_23240 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000552083.1:acetyl-CoA C-acyltransferase 756 1112 gene locus_tag LOCUS_23250 756 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688088.1 protein_id gnl|my_center|LOCUS_23250 1274 2371 gene locus_tag LOCUS_23260 1274 2371 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_23260 2499 3035 gene locus_tag LOCUS_23270 2499 3035 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0445 751 581 gene locus_tag LOCUS_23280 751 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2621 879 gene locus_tag LOCUS_23290 2621 879 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257623.1 protein_id gnl|my_center|LOCUS_23290 3003 2614 gene locus_tag LOCUS_23300 3003 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence0446 1175 630 gene locus_tag LOCUS_23310 1175 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2352 1444 gene locus_tag LOCUS_23320 2352 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2746 2955 gene locus_tag LOCUS_23330 2746 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence0447 5 1942 gene locus_tag LOCUS_23340 5 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 <3116 1989 gene locus_tag LOCUS_23350 <3116 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyltransferase family 4 protein >Feature sequence0448 144 70 gene locus_tag LOCUS_t00350 144 70 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1728 313 gene locus_tag LOCUS_23360 1728 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 <3106 1732 gene locus_tag LOCUS_23370 <3106 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258879.1:protein translocase subunit SecD >Feature sequence0449 1096 440 gene locus_tag LOCUS_23380 gene udk 1096 440 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_23380 1367 2317 gene locus_tag LOCUS_23390 1367 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0450 1299 70 gene locus_tag LOCUS_23400 1299 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2204 2968 gene locus_tag LOCUS_23410 2204 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence0451 <1 687 gene locus_tag LOCUS_23420 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041170006.1:sulfite oxidase 908 2329 gene locus_tag LOCUS_23430 908 2329 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_23430 3075 2482 gene locus_tag LOCUS_23440 3075 2482 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0452 965 225 gene locus_tag LOCUS_23450 965 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2187 1123 gene locus_tag LOCUS_23460 2187 1123 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_23460 3022 2180 gene locus_tag LOCUS_23470 3022 2180 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence0453 1559 2263 gene locus_tag LOCUS_23480 1559 2263 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence0454 632 252 gene locus_tag LOCUS_23490 632 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1102 629 gene locus_tag LOCUS_23500 1102 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 <3069 1074 gene locus_tag LOCUS_23510 <3069 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889506.1:MDR family MFS transporter >Feature sequence0455 55 768 gene locus_tag LOCUS_23520 55 768 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_23520 953 2011 gene locus_tag LOCUS_23530 953 2011 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_23530 1998 2351 gene locus_tag LOCUS_23540 1998 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2496 2714 gene locus_tag LOCUS_23550 2496 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence0456 256 1047 gene locus_tag LOCUS_23560 256 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1437 1183 gene locus_tag LOCUS_23570 1437 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1656 2369 gene locus_tag LOCUS_23580 1656 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2612 2695 gene locus_tag LOCUS_t00360 2612 2695 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2736 2810 gene locus_tag LOCUS_t00370 2736 2810 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0457 97 1890 gene locus_tag LOCUS_23590 97 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence0458 2063 1371 gene locus_tag LOCUS_23600 2063 1371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence0459 1955 729 gene locus_tag LOCUS_23610 gene aruH 1955 729 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0460 950 69 gene locus_tag LOCUS_23620 950 69 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_23620 2109 1174 gene locus_tag LOCUS_23630 2109 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2448 2906 gene locus_tag LOCUS_23640 2448 2906 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0461 2153 900 gene locus_tag LOCUS_23650 2153 900 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0462 188 1615 gene locus_tag LOCUS_23660 188 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1612 2514 gene locus_tag LOCUS_23670 1612 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence0463 15 983 gene locus_tag LOCUS_23680 gene cofD 15 983 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_23680 980 1678 gene locus_tag LOCUS_23690 980 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1662 2480 gene locus_tag LOCUS_23700 gene cofE 1662 2480 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence0464 876 211 gene locus_tag LOCUS_23710 876 211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_23710 2075 876 gene locus_tag LOCUS_23720 2075 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence0465 <1 1099 gene locus_tag LOCUS_23730 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022500.1:PLP-dependent aspartate aminotransferase family protein 1099 1761 gene locus_tag LOCUS_23740 1099 1761 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_23740 2394 1882 gene locus_tag LOCUS_23750 2394 1882 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_23750 2609 2522 gene locus_tag LOCUS_t00380 2609 2522 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2746 2656 gene locus_tag LOCUS_t00390 2746 2656 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0466 >Feature sequence0467 <2981 1137 gene locus_tag LOCUS_23760 <2981 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258511.1:serine/threonine-protein kinase >Feature sequence0468 627 2123 gene locus_tag LOCUS_23770 gene murC 627 2123 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence0469 697 149 gene locus_tag LOCUS_23780 697 149 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966693.1 protein_id gnl|my_center|LOCUS_23780 1422 1045 gene locus_tag LOCUS_23790 1422 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence0470 1009 473 gene locus_tag LOCUS_23800 1009 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1691 975 gene locus_tag LOCUS_23810 1691 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2572 1718 gene locus_tag LOCUS_23820 2572 1718 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence0471 225 46 gene locus_tag LOCUS_23830 225 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 160 447 gene locus_tag LOCUS_23840 160 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 565 1608 gene locus_tag LOCUS_23850 565 1608 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence0472 <1 1802 gene locus_tag LOCUS_23860 <1 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941337.1:ABC transporter permease <2952 2036 gene locus_tag LOCUS_23870 <2952 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257131.1:ribosome small subunit-dependent GTPase A >Feature sequence0473 200 1651 gene locus_tag LOCUS_23880 200 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1648 2607 gene locus_tag LOCUS_23890 gene nuoH 1648 2607 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence0474 15 224 gene locus_tag LOCUS_23900 15 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 638 2320 gene locus_tag LOCUS_23910 638 2320 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_23910 2450 2812 gene locus_tag LOCUS_23920 2450 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0475 1606 437 gene locus_tag LOCUS_23930 1606 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2751 1603 gene locus_tag LOCUS_23940 2751 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence0476 31 456 gene locus_tag LOCUS_23950 31 456 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_23950 1026 553 gene locus_tag LOCUS_23960 1026 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1444 2316 gene locus_tag LOCUS_23970 1444 2316 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_23970 <2940 2362 gene locus_tag LOCUS_23980 <2940 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392401.1:carbamoyl-phosphate synthase large subunit >Feature sequence0477 264 2297 gene locus_tag LOCUS_23990 264 2297 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_23990 2851 2354 gene locus_tag LOCUS_24000 2851 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence0478 <1 1915 gene locus_tag LOCUS_24010 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142782.1:M1 family aminopeptidase >Feature sequence0479 190 1014 gene locus_tag LOCUS_24020 190 1014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195272.1 protein_id gnl|my_center|LOCUS_24020 1098 1994 gene locus_tag LOCUS_24030 1098 1994 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_24030 2093 2851 gene locus_tag LOCUS_24040 2093 2851 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence0480 394 56 gene locus_tag LOCUS_24050 394 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 706 536 gene locus_tag LOCUS_24060 706 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1815 2147 gene locus_tag LOCUS_24070 1815 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2154 2513 gene locus_tag LOCUS_24080 2154 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence0481 <1 599 gene locus_tag LOCUS_24090 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393995.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 810 1493 gene locus_tag LOCUS_24100 810 1493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_24100 1500 2891 gene locus_tag LOCUS_24110 1500 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence0482 1279 323 gene locus_tag LOCUS_24120 1279 323 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_24120 1445 1975 gene locus_tag LOCUS_24130 1445 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2044 2526 gene locus_tag LOCUS_24140 2044 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence0483 1353 145 gene locus_tag LOCUS_24150 1353 145 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_24150 2475 1570 gene locus_tag LOCUS_24160 2475 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence0484 <1 551 gene locus_tag LOCUS_24170 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041271989.1:heterodisulfide reductase-related iron-sulfur binding cluster 1093 704 gene locus_tag LOCUS_24180 1093 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2197 1343 gene locus_tag LOCUS_24190 2197 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0485 2200 1250 gene locus_tag LOCUS_24200 2200 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence0486 112 187 gene locus_tag LOCUS_t00400 112 187 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1479 298 gene locus_tag LOCUS_24210 1479 298 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_24210 2140 1901 gene locus_tag LOCUS_24220 2140 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2291 2617 gene locus_tag LOCUS_24230 2291 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence0487 <1 644 gene locus_tag LOCUS_24240 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413869.1:chlorite dismutase family protein 1583 738 gene locus_tag LOCUS_24250 1583 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2373 1993 gene locus_tag LOCUS_24260 2373 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence0488 654 1025 gene locus_tag LOCUS_24270 654 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1440 2387 gene locus_tag LOCUS_24280 1440 2387 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence0489 <1 984 gene locus_tag LOCUS_24290 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391805.1:RNA polymerase factor sigma-54 >Feature sequence0490 373 80 gene locus_tag LOCUS_24300 373 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 790 1185 gene locus_tag LOCUS_24310 790 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1237 1971 gene locus_tag LOCUS_24320 gene rpiA 1237 1971 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence0491 425 96 gene locus_tag LOCUS_24330 gene rplW 425 96 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_24330 1247 429 gene locus_tag LOCUS_24340 1247 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2090 1269 gene locus_tag LOCUS_24350 2090 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2618 2301 gene locus_tag LOCUS_24360 gene rpsJ 2618 2301 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence0492 1469 150 gene locus_tag LOCUS_24370 1469 150 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_24370 1927 2667 gene locus_tag LOCUS_24380 1927 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence0493 386 1537 gene locus_tag LOCUS_24390 386 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0494 2456 1536 gene locus_tag LOCUS_24400 2456 1536 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401112.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence0495 <1 892 gene locus_tag LOCUS_24410 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256439.1:NAD(P)/FAD-dependent oxidoreductase 2187 919 gene locus_tag LOCUS_24420 2187 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2792 2451 gene locus_tag LOCUS_24430 2792 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence0496 287 108 gene locus_tag LOCUS_24440 287 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 700 287 gene locus_tag LOCUS_24450 700 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1294 773 gene locus_tag LOCUS_24460 1294 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1608 1333 gene locus_tag LOCUS_24470 1608 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1819 2256 gene locus_tag LOCUS_24480 1819 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2446 2784 gene locus_tag LOCUS_24490 2446 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence0497 825 73 gene locus_tag LOCUS_24500 825 73 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_24500 1086 1814 gene locus_tag LOCUS_24510 1086 1814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence0498 416 1510 gene locus_tag LOCUS_24520 416 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2330 1560 gene locus_tag LOCUS_24530 2330 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence0499 1409 1161 gene locus_tag LOCUS_24540 1409 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1780 1406 gene locus_tag LOCUS_24550 1780 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence0500 87 431 gene locus_tag LOCUS_24560 87 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 703 1644 gene locus_tag LOCUS_24570 gene htpX 703 1644 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_24570 1732 2316 gene locus_tag LOCUS_24580 1732 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence0501 660 1451 gene locus_tag LOCUS_24590 660 1451 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_24590 2383 1496 gene locus_tag LOCUS_24600 gene argB 2383 1496 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence0502 99 965 gene locus_tag LOCUS_24610 99 965 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_24610 1448 2497 gene locus_tag LOCUS_24620 gene pheS 1448 2497 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence0503 1064 1372 gene locus_tag LOCUS_24630 1064 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence0504 2657 801 gene locus_tag LOCUS_24640 2657 801 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence0505 1590 460 gene locus_tag LOCUS_24650 1590 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2472 1702 gene locus_tag LOCUS_24660 gene fabG 2472 1702 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence0506 500 201 gene locus_tag LOCUS_24670 500 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24670 1059 2294 gene locus_tag LOCUS_24680 1059 2294 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence0507 140 856 gene locus_tag LOCUS_24690 140 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1529 1005 gene locus_tag LOCUS_24700 1529 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1883 2623 gene locus_tag LOCUS_24710 1883 2623 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence0508 695 970 gene locus_tag LOCUS_24720 695 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1948 1130 gene locus_tag LOCUS_24730 1948 1130 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_24730 2231 2067 gene locus_tag LOCUS_24740 2231 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2410 2670 gene locus_tag LOCUS_24750 2410 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence0509 2526 1183 gene locus_tag LOCUS_24760 2526 1183 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence0510 <1 1530 gene locus_tag LOCUS_24770 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136208946.1:NAD+ synthase 1650 2627 gene locus_tag LOCUS_24780 1650 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence0511 140 1102 gene locus_tag LOCUS_24790 140 1102 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 protein_id gnl|my_center|LOCUS_24790 1560 2555 gene locus_tag LOCUS_24800 1560 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence0512 561 1085 gene locus_tag LOCUS_24810 561 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1167 1487 gene locus_tag LOCUS_24820 1167 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2684 1554 gene locus_tag LOCUS_24830 2684 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence0513 82 513 gene locus_tag LOCUS_24840 82 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 510 1235 gene locus_tag LOCUS_24850 510 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1330 1405 gene locus_tag LOCUS_t00410 1330 1405 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1442 1515 gene locus_tag LOCUS_t00420 1442 1515 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2476 1829 gene locus_tag LOCUS_24860 2476 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence0514 548 1831 gene locus_tag LOCUS_24870 548 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 <2661 2064 gene locus_tag LOCUS_24880 <2661 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942670.1:chorismate synthase >Feature sequence0515 2241 1501 gene locus_tag LOCUS_24890 2241 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence0516 827 2140 gene locus_tag LOCUS_24900 827 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0517 1365 490 gene locus_tag LOCUS_24910 1365 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2054 1563 gene locus_tag LOCUS_24920 2054 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence0518 2120 405 gene locus_tag LOCUS_24930 2120 405 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228748.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence0519 336 2171 gene locus_tag LOCUS_24940 336 2171 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_24940 2268 2634 gene locus_tag LOCUS_tm00010 2268 2634 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0520 >Feature sequence0521 352 1374 gene locus_tag LOCUS_24950 gene pstC 352 1374 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_24950 1371 2267 gene locus_tag LOCUS_24960 gene pstA 1371 2267 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0522 880 2112 gene locus_tag LOCUS_24970 880 2112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_24970 2149 2556 gene locus_tag LOCUS_24980 2149 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence0523 1614 658 gene locus_tag LOCUS_24990 1614 658 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_24990 2202 1621 gene locus_tag LOCUS_25000 2202 1621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence0524 323 934 gene locus_tag LOCUS_25010 323 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2096 1074 gene locus_tag LOCUS_25020 2096 1074 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence0525 362 1348 gene locus_tag LOCUS_25030 362 1348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_25030 1490 2569 gene locus_tag LOCUS_25040 1490 2569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence0526 <1 1195 gene locus_tag LOCUS_25050 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256905.1:molybdopterin oxidoreductase family protein 1322 1915 gene locus_tag LOCUS_25060 1322 1915 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence0527 <1 565 gene locus_tag LOCUS_25070 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950807.1:IS607 family transposase 965 1759 gene locus_tag LOCUS_25080 965 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 >Feature sequence0528 1153 569 gene locus_tag LOCUS_25090 gene thpR 1153 569 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_25090 2415 1156 gene locus_tag LOCUS_25100 2415 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0529 953 2458 gene locus_tag LOCUS_25110 953 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence0530 942 100 gene locus_tag LOCUS_25120 gene istB 942 100 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_25120 2453 939 gene locus_tag LOCUS_25130 gene istA 2453 939 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence0531 <1 1035 gene locus_tag LOCUS_25140 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257709.1:class I mannose-6-phosphate isomerase 1655 1011 gene locus_tag LOCUS_25150 1655 1011 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence0532 2304 181 gene locus_tag LOCUS_25160 2304 181 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144035.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence0533 947 279 gene locus_tag LOCUS_25170 947 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 <2554 1139 gene locus_tag LOCUS_25180 <2554 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein >Feature sequence0534 2247 691 gene locus_tag LOCUS_25190 2247 691 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence0535 31 1164 gene locus_tag LOCUS_25200 31 1164 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256780.1 protein_id gnl|my_center|LOCUS_25200 1161 2393 gene locus_tag LOCUS_25210 1161 2393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256779.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence0536 593 1555 gene locus_tag LOCUS_25220 593 1555 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_25220 1598 2359 gene locus_tag LOCUS_25230 1598 2359 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence0537 178 828 gene locus_tag LOCUS_25240 178 828 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259156.1 protein_id gnl|my_center|LOCUS_25240 1318 842 gene locus_tag LOCUS_25250 1318 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 <2536 1387 gene locus_tag LOCUS_25260 <2536 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460903.1:aspartate ammonia-lyase >Feature sequence0538 2506 1175 gene locus_tag LOCUS_25270 gene aspS 2506 1175 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0539 1148 1369 gene locus_tag LOCUS_25280 1148 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1366 1581 gene locus_tag LOCUS_25290 1366 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence0540 106 1314 gene locus_tag LOCUS_25300 106 1314 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_25300 1473 2117 gene locus_tag LOCUS_25310 1473 2117 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence0541 2261 906 gene locus_tag LOCUS_25320 gene accC 2261 906 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142010.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence0542 1620 142 gene locus_tag LOCUS_25330 gene pyk 1620 142 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_25330 2270 1617 gene locus_tag LOCUS_25340 gene coaE 2270 1617 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0543 24 344 gene locus_tag LOCUS_25350 24 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 403 1446 gene locus_tag LOCUS_25360 403 1446 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence0544 405 139 gene locus_tag LOCUS_25370 405 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1717 560 gene locus_tag LOCUS_25380 1717 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0545 1208 63 gene locus_tag LOCUS_25390 1208 63 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_25390 <2478 1239 gene locus_tag LOCUS_25400 <2478 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957611.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence0546 1794 772 gene locus_tag LOCUS_25410 1794 772 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence0547 799 1389 gene locus_tag LOCUS_25420 799 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2258 1464 gene locus_tag LOCUS_25430 2258 1464 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence0548 1705 1019 gene locus_tag LOCUS_25440 1705 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence0549 >Feature sequence0550 <1 1699 gene locus_tag LOCUS_25450 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101481.1:DAK2 domain-containing protein >Feature sequence0551 1396 137 gene locus_tag LOCUS_25460 1396 137 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25460 >Feature sequence0552 2323 848 gene locus_tag LOCUS_25470 gene lysS 2323 848 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257111.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence0553 212 481 gene locus_tag LOCUS_25480 212 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 478 1104 gene locus_tag LOCUS_25490 478 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence0554 <1 862 gene locus_tag LOCUS_25500 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950166.1:heavy metal-binding domain-containing protein 1161 2417 gene locus_tag LOCUS_25510 1161 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0555 715 1056 gene locus_tag LOCUS_25520 715 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence0556 <1 974 gene locus_tag LOCUS_25530 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392848.1:3-deoxy-7-phosphoheptulonate synthase 1201 2136 gene locus_tag LOCUS_25540 1201 2136 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102146.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence0557 253 1326 gene locus_tag LOCUS_25550 253 1326 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259753.1 protein_id gnl|my_center|LOCUS_25550 1341 2366 gene locus_tag LOCUS_25560 1341 2366 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence0558 490 1707 gene locus_tag LOCUS_25570 gene larC 490 1707 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_25570 2295 1696 gene locus_tag LOCUS_25580 2295 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence0559 <1 1028 gene locus_tag LOCUS_25590 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190110.1:bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada 1552 968 gene locus_tag LOCUS_25600 1552 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 1753 1562 gene locus_tag LOCUS_25610 1753 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2181 1765 gene locus_tag LOCUS_25620 2181 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence0560 <1 1222 gene locus_tag LOCUS_25630 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224259.1:valine--tRNA ligase <2420 1485 gene locus_tag LOCUS_25640 <2420 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947221.1:aminoglycoside O-phosphotransferase APH(9)-Ia >Feature sequence0561 252 902 gene locus_tag LOCUS_25650 252 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1072 1929 gene locus_tag LOCUS_25660 1072 1929 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence0562 1500 64 gene locus_tag LOCUS_25670 1500 64 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence0563 <1 823 gene locus_tag LOCUS_25680 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070553.1:class I SAM-dependent methyltransferase 1512 958 gene locus_tag LOCUS_25690 1512 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0564 1245 2069 gene locus_tag LOCUS_25700 1245 2069 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331313.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence0565 1356 670 gene locus_tag LOCUS_25710 1356 670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence0566 799 449 gene locus_tag LOCUS_25720 799 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1708 929 gene locus_tag LOCUS_25730 1708 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2345 1698 gene locus_tag LOCUS_25740 2345 1698 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence0567 >Feature sequence0568 75 1214 gene locus_tag LOCUS_25750 75 1214 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_25750 1309 2367 gene locus_tag LOCUS_25760 gene rfbB 1309 2367 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence0569 357 680 gene locus_tag LOCUS_25770 357 680 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_25770 677 2083 gene locus_tag LOCUS_25780 677 2083 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence0570 1266 82 gene locus_tag LOCUS_25790 gene nifS 1266 82 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_25790 1553 1891 gene locus_tag LOCUS_25800 gene trxA 1553 1891 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_25800 1967 2236 gene locus_tag LOCUS_25810 1967 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence0571 <2373 1026 gene locus_tag LOCUS_25820 <2373 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894509.1:Fe-S cluster assembly protein SufB >Feature sequence0572 465 1985 gene locus_tag LOCUS_25830 465 1985 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence0573 501 46 gene locus_tag LOCUS_25840 501 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 739 506 gene locus_tag LOCUS_25850 739 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1008 736 gene locus_tag LOCUS_25860 1008 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1352 1011 gene locus_tag LOCUS_25870 1352 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2280 1357 gene locus_tag LOCUS_25880 2280 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence0574 >Feature sequence0575 >Feature sequence0576 2240 768 gene locus_tag LOCUS_25890 2240 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence0577 >Feature sequence0578 1277 804 gene locus_tag LOCUS_25900 1277 804 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_25900 1760 1296 gene locus_tag LOCUS_25910 1760 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 <2335 1788 gene locus_tag LOCUS_25920 <2335 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393330.1:cytochrome c biogenesis protein CcdA >Feature sequence0579 1784 1245 gene locus_tag LOCUS_25930 1784 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence0580 1815 736 gene locus_tag LOCUS_25940 1815 736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0581 1430 225 gene locus_tag LOCUS_25950 gene speY 1430 225 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence0582 131 1147 gene locus_tag LOCUS_25960 131 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence0583 1295 918 gene locus_tag LOCUS_25970 gene rplV 1295 918 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_25970 1533 1309 gene locus_tag LOCUS_25980 1533 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 <2313 1618 gene locus_tag LOCUS_25990 <2313 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258234.1:50S ribosomal protein L2 >Feature sequence0584 <1 920 gene locus_tag LOCUS_26000 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228379.1:glycine--tRNA ligase 1003 1398 gene locus_tag LOCUS_26010 1003 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0585 108 383 gene locus_tag LOCUS_26020 108 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 462 725 gene locus_tag LOCUS_26030 462 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1892 1506 gene locus_tag LOCUS_26040 1892 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence0586 344 2155 gene locus_tag LOCUS_26050 344 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0587 1251 1898 gene locus_tag LOCUS_26060 1251 1898 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0588 1 657 gene locus_tag LOCUS_26070 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1136 654 gene locus_tag LOCUS_26080 1136 654 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405173.1 protein_id gnl|my_center|LOCUS_26080 2092 1319 gene locus_tag LOCUS_26090 2092 1319 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence0589 393 1688 gene locus_tag LOCUS_26100 393 1688 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence0590 689 1060 gene locus_tag LOCUS_26110 689 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1149 2162 gene locus_tag LOCUS_26120 1149 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0591 2017 413 gene locus_tag LOCUS_26130 2017 413 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402899.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence0592 1969 1115 gene locus_tag LOCUS_26140 1969 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence0593 411 584 gene locus_tag LOCUS_26150 411 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 604 810 gene locus_tag LOCUS_26160 604 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 <2222 1062 gene locus_tag LOCUS_26170 <2222 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257936.1:Glu/Leu/Phe/Val dehydrogenase >Feature sequence0594 <2213 380 gene locus_tag LOCUS_26180 <2213 380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228054.1:DUF3488 and transglutaminase-like domain-containing protein >Feature sequence0595 <1 1080 gene locus_tag LOCUS_26190 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989870.1:alpha-mannosidase <2213 1096 gene locus_tag LOCUS_26200 <2213 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222413.1:molybdopterin-dependent oxidoreductase >Feature sequence0596 >Feature sequence0597 <1 619 gene locus_tag LOCUS_26210 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902437.1:cyclodeaminase/cyclohydrolase family protein 616 1509 gene locus_tag LOCUS_26220 616 1509 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence0598 1727 501 gene locus_tag LOCUS_26230 1727 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2177 1731 gene locus_tag LOCUS_26240 2177 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0599 61 543 gene locus_tag LOCUS_26250 61 543 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence0600 <2196 924 gene locus_tag LOCUS_26260 <2196 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028721.1:phosphomannomutase/phosphoglucomutase >Feature sequence0601 <1 1482 gene locus_tag LOCUS_26270 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256344.1:GTPase HflX 1882 1589 gene locus_tag LOCUS_26280 1882 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence0602 785 2050 gene locus_tag LOCUS_26290 785 2050 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence0603 2097 1423 gene locus_tag LOCUS_26300 2097 1423 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence0604 450 85 gene locus_tag LOCUS_26310 450 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1250 621 gene locus_tag LOCUS_26320 1250 621 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence0605 373 1569 gene locus_tag LOCUS_26330 373 1569 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence0606 <1 851 gene locus_tag LOCUS_26340 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256782.1:carboxylating nicotinate-nucleotide diphosphorylase 877 2145 gene locus_tag LOCUS_26350 gene nadA 877 2145 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence0607 <1 1501 gene locus_tag LOCUS_26360 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222212.1:LuxR family transcriptional regulator >Feature sequence0608 1429 503 gene locus_tag LOCUS_26370 gene ubiA 1429 503 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence0609 1005 586 gene locus_tag LOCUS_26380 1005 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1905 1192 gene locus_tag LOCUS_26390 1905 1192 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence0610 474 1328 gene locus_tag LOCUS_26400 474 1328 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0611 <1 757 gene locus_tag LOCUS_26410 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124586.1:NAD(P)H-quinone oxidoreductase subunit N 2017 845 gene locus_tag LOCUS_26420 2017 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence0612 <1 886 gene locus_tag LOCUS_26430 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256861.1:glutamine-hydrolyzing GMP synthase 1014 1805 gene locus_tag LOCUS_26440 1014 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence0613 >Feature sequence0614 <1 1960 gene locus_tag LOCUS_26450 <1 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256479.1:heavy metal translocating P-type ATPase >Feature sequence0615 1208 237 gene locus_tag LOCUS_26460 gene rpoD 1208 237 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_26460 1260 1463 gene locus_tag LOCUS_26470 1260 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence0616 644 186 gene locus_tag LOCUS_26480 gene dtd 644 186 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887535.1 protein_id gnl|my_center|LOCUS_26480 995 648 gene locus_tag LOCUS_26490 995 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence0617 289 957 gene locus_tag LOCUS_26500 289 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence0618 253 492 gene locus_tag LOCUS_26510 253 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 756 1424 gene locus_tag LOCUS_26520 gene coxH3 756 1424 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence0619 <1 794 gene locus_tag LOCUS_26530 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256332.1:ABC transporter permease 801 1922 gene locus_tag LOCUS_26540 801 1922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence0620 218 754 gene locus_tag LOCUS_26550 218 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1024 2073 gene locus_tag LOCUS_26560 1024 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence0621 76 1035 gene locus_tag LOCUS_26570 76 1035 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence0622 726 385 gene locus_tag LOCUS_26580 726 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1196 726 gene locus_tag LOCUS_26590 1196 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1506 1198 gene locus_tag LOCUS_26600 1506 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1688 1506 gene locus_tag LOCUS_26610 1688 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2019 1819 gene locus_tag LOCUS_26620 2019 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0623 <1 589 gene locus_tag LOCUS_26630 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein 740 1381 gene locus_tag LOCUS_26640 740 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0624 328 1389 gene locus_tag LOCUS_26650 328 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence0625 1526 732 gene locus_tag LOCUS_26660 1526 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1507 1830 gene locus_tag LOCUS_26670 1507 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence0626 65 1651 gene locus_tag LOCUS_26680 65 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence0627 >Feature sequence0628 1153 416 gene locus_tag LOCUS_26690 1153 416 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_26690 1412 1771 gene locus_tag LOCUS_26700 1412 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence0629 1163 198 gene locus_tag LOCUS_26710 1163 198 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_26710 1671 1219 gene locus_tag LOCUS_26720 1671 1219 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0630 <2001 750 gene locus_tag LOCUS_26730 <2001 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence0631 960 1607 gene locus_tag LOCUS_26740 960 1607 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142665.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence0632 682 1956 gene locus_tag LOCUS_26750 682 1956 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence0633 201 776 gene locus_tag LOCUS_26760 201 776 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257926.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence0634 1145 753 gene locus_tag LOCUS_26770 1145 753 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence0635 <1 937 gene locus_tag LOCUS_26780 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016475763.1:BRO family protein 1196 1513 gene locus_tag LOCUS_26790 1196 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1510 1905 gene locus_tag LOCUS_26800 1510 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0636 >Feature sequence0637 259 1314 gene locus_tag LOCUS_26810 gene wecB 259 1314 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence0638 524 1486 gene locus_tag LOCUS_26820 524 1486 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938962.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0639 1124 336 gene locus_tag LOCUS_26830 1124 336 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_26830 1528 1337 gene locus_tag LOCUS_26840 1528 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0640 1146 676 gene locus_tag LOCUS_26850 1146 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1876 1334 gene locus_tag LOCUS_26860 1876 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence0641 >Feature sequence0642 315 1748 gene locus_tag LOCUS_26870 315 1748 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence0643 438 1784 gene locus_tag LOCUS_26880 438 1784 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence0644 334 699 gene locus_tag LOCUS_26890 334 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence0645 <1930 1063 gene locus_tag LOCUS_26900 <1930 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975441.1:NADH-quinone oxidoreductase subunit D >Feature sequence0646 1837 1004 gene locus_tag LOCUS_26910 gene yidA 1837 1004 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0647 1897 485 gene locus_tag LOCUS_26920 1897 485 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence0648 242 1444 gene locus_tag LOCUS_26930 242 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence0649 44 571 gene locus_tag LOCUS_26940 44 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26940 575 1489 gene locus_tag LOCUS_26950 575 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26950 1562 1849 gene locus_tag LOCUS_26960 1562 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0650 >Feature sequence0651 <1 1183 gene locus_tag LOCUS_26970 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256569.1:long-chain fatty acid--CoA ligase >Feature sequence0652 1251 931 gene locus_tag LOCUS_26980 1251 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence0653 537 100 gene locus_tag LOCUS_26990 537 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 718 1704 gene locus_tag LOCUS_27000 gene fmt 718 1704 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence0654 1226 1723 gene locus_tag LOCUS_27010 1226 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence0655 211 1299 gene locus_tag LOCUS_27020 211 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence0656 >Feature sequence0657 >Feature sequence0658 >Feature sequence0659 109 1188 gene locus_tag LOCUS_27030 109 1188 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259620.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence0660 >Feature sequence0661 153 632 gene locus_tag LOCUS_27040 153 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 730 1167 gene locus_tag LOCUS_27050 730 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1451 1807 gene locus_tag LOCUS_27060 1451 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence0662 <1 962 gene locus_tag LOCUS_27070 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257057.1:ATP-binding protein 1113 1550 gene locus_tag LOCUS_27080 1113 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0663 9 1616 gene locus_tag LOCUS_27090 9 1616 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence0664 244 603 gene locus_tag LOCUS_27100 244 603 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence0665 1726 41 gene locus_tag LOCUS_27110 1726 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence0666 <1 1505 gene locus_tag LOCUS_27120 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965497.1:HAD family hydrolase 1502 1744 gene locus_tag LOCUS_27130 1502 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0667 1125 727 gene locus_tag LOCUS_27140 1125 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1777 1376 gene locus_tag LOCUS_27150 1777 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0668 606 391 gene locus_tag LOCUS_27160 606 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 494 1561 gene locus_tag LOCUS_27170 gene trpS 494 1561 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence0669 >Feature sequence0670 >Feature sequence0671 >Feature sequence0672 68 643 gene locus_tag LOCUS_27180 68 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 672 1028 gene locus_tag LOCUS_27190 672 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0673 1501 254 gene locus_tag LOCUS_27200 1501 254 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence0674 >Feature sequence0675 <1 840 gene locus_tag LOCUS_27210 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640987.1:APC family permease 1081 917 gene locus_tag LOCUS_27220 1081 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence0676 >Feature sequence0677 <1840 1288 gene locus_tag LOCUS_27230 <1840 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191283.1:cytochrome c oxidase assembly protein >Feature sequence0678 689 378 gene locus_tag LOCUS_27240 689 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0679 484 705 gene locus_tag LOCUS_27250 484 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 865 1761 gene locus_tag LOCUS_27260 865 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence0680 364 1029 gene locus_tag LOCUS_27270 364 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1500 1724 gene locus_tag LOCUS_27280 1500 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0681 <1 981 gene locus_tag LOCUS_27290 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259102.1:5'-nucleotidase C-terminal domain-containing protein 1363 1581 gene locus_tag LOCUS_27300 1363 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence0682 1279 920 gene locus_tag LOCUS_27310 1279 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1496 1654 gene locus_tag LOCUS_27320 1496 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence0683 1246 1773 gene locus_tag LOCUS_27330 1246 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence0684 >Feature sequence0685 789 532 gene locus_tag LOCUS_27340 789 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1064 1345 gene locus_tag LOCUS_27350 1064 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence0686 <1819 767 gene locus_tag LOCUS_27360 <1819 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000526322.1:DEAD/DEAH box helicase family protein >Feature sequence0687 1627 461 gene locus_tag LOCUS_27370 gene nuoD 1627 461 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0688 >Feature sequence0689 1228 734 gene locus_tag LOCUS_27380 gene msrA 1228 734 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence0690 1696 209 gene locus_tag LOCUS_27390 gene gatB 1696 209 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence0691 483 1616 gene locus_tag LOCUS_27400 483 1616 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257396.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0692 <1 665 gene locus_tag LOCUS_27410 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909312.1:amylo-alpha-1,6-glucosidase 775 1488 gene locus_tag LOCUS_27420 775 1488 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_27420 1493 1777 gene locus_tag LOCUS_27430 1493 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence0693 131 1450 gene locus_tag LOCUS_27440 131 1450 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence0694 715 1233 gene locus_tag LOCUS_27450 715 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence0695 652 1785 gene locus_tag LOCUS_27460 652 1785 CDS product ISAs1-like element ISEc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421020.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence0696 >Feature sequence0697 >Feature sequence0698 <1 661 gene locus_tag LOCUS_27470 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036929.1:glycoside hydrolase family 31 protein >Feature sequence0699 1595 132 gene locus_tag LOCUS_27480 1595 132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867388.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence0700 169 1404 gene locus_tag LOCUS_27490 169 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence0701 <1778 1028 gene locus_tag LOCUS_27500 <1778 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272788.1:ATP synthase F1 subunit gamma >Feature sequence0702 632 177 gene locus_tag LOCUS_27510 632 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence0703 1378 305 gene locus_tag LOCUS_27520 1378 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0704 1553 765 gene locus_tag LOCUS_27530 1553 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence0705 >Feature sequence0706 1666 38 gene locus_tag LOCUS_27540 1666 38 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029096096.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence0707 1000 131 gene locus_tag LOCUS_27550 1000 131 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765220.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence0708 >Feature sequence0709 1 897 gene locus_tag LOCUS_27560 1 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 <1747 952 gene locus_tag LOCUS_27570 <1747 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815423.1:ornithine cyclodeaminase family protein >Feature sequence0710 >Feature sequence0711 >Feature sequence0712 <1 1126 gene locus_tag LOCUS_27580 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243831.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence0713 <1 572 gene locus_tag LOCUS_27590 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402863.1:mercuric reductase 1503 718 gene locus_tag LOCUS_27600 1503 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence0714 99 410 gene locus_tag LOCUS_27610 99 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 <1736 551 gene locus_tag LOCUS_27620 <1736 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256641.1:cysteine--tRNA ligase >Feature sequence0715 329 1048 gene locus_tag LOCUS_27630 329 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence0716 547 155 gene locus_tag LOCUS_27640 547 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 942 1442 gene locus_tag LOCUS_27650 942 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence0717 >Feature sequence0718 225 512 gene locus_tag LOCUS_27660 225 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence0719 1709 549 gene locus_tag LOCUS_27670 1709 549 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence0720 356 1381 gene locus_tag LOCUS_27680 356 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence0721 >Feature sequence0722 >Feature sequence0723 >Feature sequence0724 >Feature sequence0725 <1 626 gene locus_tag LOCUS_27690 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404923.1:D-alanine--D-alanine ligase family protein 684 1460 gene locus_tag LOCUS_27700 684 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence0726 >Feature sequence0727 305 1066 gene locus_tag LOCUS_27710 305 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0728 <1 1541 gene locus_tag LOCUS_27720 <1 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838098.1:IGHMBP2 family helicase >Feature sequence0729 >Feature sequence0730 906 1301 gene locus_tag LOCUS_27730 906 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence0731 931 281 gene locus_tag LOCUS_27740 gene cas5c 931 281 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_27740 <1664 959 gene locus_tag LOCUS_27750 <1664 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392035.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence0732 >Feature sequence0733 98 790 gene locus_tag LOCUS_27760 gene nadD 98 790 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404800.1 protein_id gnl|my_center|LOCUS_27760 790 1017 gene locus_tag LOCUS_27770 790 1017 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence0734 >Feature sequence0735 1181 1504 gene locus_tag LOCUS_27780 1181 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0736 >Feature sequence0737 63 1193 gene locus_tag LOCUS_27790 63 1193 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence0738 994 1296 gene locus_tag LOCUS_27800 994 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence0739 665 84 gene locus_tag LOCUS_27810 665 84 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256712.1 protein_id gnl|my_center|LOCUS_27810 1458 976 gene locus_tag LOCUS_27820 1458 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0740 >Feature sequence0741 1626 874 gene locus_tag LOCUS_27830 1626 874 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence0742 >Feature sequence0743 >Feature sequence0744 721 437 gene locus_tag LOCUS_27840 721 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence0745 281 919 gene locus_tag LOCUS_27850 281 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 916 1587 gene locus_tag LOCUS_27860 916 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0746 1523 81 gene locus_tag LOCUS_27870 1523 81 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253183.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence0747 662 435 gene locus_tag LOCUS_27880 662 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence0748 544 161 gene locus_tag LOCUS_27890 gene rplS 544 161 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence0749 2 694 gene locus_tag LOCUS_27900 2 694 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650958.1 protein_id gnl|my_center|LOCUS_27900 802 1251 gene locus_tag LOCUS_27910 802 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1248 1616 gene locus_tag LOCUS_27920 1248 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence0750 >Feature sequence0751 78 440 gene locus_tag LOCUS_27930 78 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 406 1605 gene locus_tag LOCUS_27940 406 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence0752 <1 992 gene locus_tag LOCUS_27950 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein 1461 1006 gene locus_tag LOCUS_27960 1461 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0753 >Feature sequence0754 1507 227 gene locus_tag LOCUS_27970 1507 227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence0755 810 49 gene locus_tag LOCUS_27980 810 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1608 895 gene locus_tag LOCUS_27990 1608 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence0756 <1600 472 gene locus_tag LOCUS_28000 <1600 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686815.1:patatin-like phospholipase family protein >Feature sequence0757 1258 662 gene locus_tag LOCUS_28010 gene ruvA 1258 662 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence0758 >Feature sequence0759 450 139 gene locus_tag LOCUS_28020 450 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1204 839 gene locus_tag LOCUS_28030 1204 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence0760 173 778 gene locus_tag LOCUS_28040 173 778 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_28040 912 1322 gene locus_tag LOCUS_28050 912 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence0761 1577 408 gene locus_tag LOCUS_28060 gene lapB 1577 408 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence0762 >Feature sequence0763 1573 182 gene locus_tag LOCUS_28070 1573 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0764 >Feature sequence0765 86 1009 gene locus_tag LOCUS_28080 86 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence0766 >Feature sequence0767 1 195 gene locus_tag LOCUS_28090 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 295 1188 gene locus_tag LOCUS_28100 295 1188 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence0768 <1561 61 gene locus_tag LOCUS_28110 <1561 61 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257959.1:ABC transporter ATP-binding protein >Feature sequence0769 <1 680 gene locus_tag LOCUS_28120 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014332683.1:ABC transporter permease 673 1560 gene locus_tag LOCUS_28130 673 1560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence0770 <1 947 gene locus_tag LOCUS_28140 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029787.1:MFS transporter >Feature sequence0771 173 1489 gene locus_tag LOCUS_28150 173 1489 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence0772 >Feature sequence0773 >Feature sequence0774 648 1076 gene locus_tag LOCUS_28160 648 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1546 1220 gene locus_tag LOCUS_28170 1546 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence0775 397 1230 gene locus_tag LOCUS_28180 397 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0776 913 662 gene locus_tag LOCUS_28190 913 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence0777 81 569 gene locus_tag LOCUS_28200 81 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1534 644 gene locus_tag LOCUS_28210 1534 644 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence0778 <1 896 gene locus_tag LOCUS_28220 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotaxis signal transduction system protein ChpA 1167 1361 gene locus_tag LOCUS_28230 1167 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence0779 <1 759 gene locus_tag LOCUS_28240 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727789.1:error-prone DNA polymerase >Feature sequence0780 57 1520 gene locus_tag LOCUS_28250 57 1520 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence0781 >Feature sequence0782 <1 1444 gene locus_tag LOCUS_28260 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169153932.1:aldehyde dehydrogenase family protein >Feature sequence0783 <1526 221 gene locus_tag LOCUS_28270 <1526 221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073740.1:DEAD/DEAH box helicase >Feature sequence0784 238 1020 gene locus_tag LOCUS_28280 238 1020 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence0785 >Feature sequence0786 390 112 gene locus_tag LOCUS_28290 390 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 542 390 gene locus_tag LOCUS_28300 542 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 747 547 gene locus_tag LOCUS_28310 747 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 883 1236 gene locus_tag LOCUS_28320 883 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence0787 554 1375 gene locus_tag LOCUS_28330 554 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence0788 <1517 184 gene locus_tag LOCUS_28340 <1517 184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0789 1386 856 gene locus_tag LOCUS_28350 1386 856 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence0790 >Feature sequence0791 >Feature sequence0792 27 1343 gene locus_tag LOCUS_28360 27 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 1419 367 gene locus_tag LOCUS_28370 1419 367 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0796 1308 295 gene locus_tag LOCUS_28380 1308 295 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence0797 3 455 gene locus_tag LOCUS_28390 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence0798 >Feature sequence0799 <1496 475 gene locus_tag LOCUS_28400 <1496 475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392306.1:APC family permease >Feature sequence0800 844 695 gene locus_tag LOCUS_28410 844 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1238 834 gene locus_tag LOCUS_28420 1238 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence0801 >Feature sequence0802 <1 860 gene locus_tag LOCUS_28430 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349507.1:NAD(P)/FAD-dependent oxidoreductase 1394 1089 gene locus_tag LOCUS_28440 1394 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence0803 214 118 gene locus_tag LOCUS_t00430 214 118 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 467 543 gene locus_tag LOCUS_t00440 467 543 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 713 1303 gene locus_tag LOCUS_28450 713 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence0804 1022 483 gene locus_tag LOCUS_28460 1022 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0805 >Feature sequence0806 1480 1067 gene locus_tag LOCUS_28470 1480 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence0807 <1 1265 gene locus_tag LOCUS_28480 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550348.1:potassium transporter Kup >Feature sequence0808 1212 688 gene locus_tag LOCUS_28490 1212 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence0809 <1 1383 gene locus_tag LOCUS_28500 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256679.1:tetratricopeptide repeat protein >Feature sequence0810 >Feature sequence0811 384 58 gene locus_tag LOCUS_28510 384 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 266 1177 gene locus_tag LOCUS_28520 266 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0812 158 709 gene locus_tag LOCUS_28530 gene folK 158 709 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence0813 331 1320 gene locus_tag LOCUS_28540 331 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence0814 1205 306 gene locus_tag LOCUS_28550 1205 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence0815 174 674 gene locus_tag LOCUS_28560 gene secB 174 674 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_28560 1081 797 gene locus_tag LOCUS_28570 1081 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence0816 1342 785 gene locus_tag LOCUS_28580 1342 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence0817 >Feature sequence0818 216 43 gene locus_tag LOCUS_28590 216 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 488 895 gene locus_tag LOCUS_28600 488 895 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence0819 1073 621 gene locus_tag LOCUS_28610 1073 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence0820 >Feature sequence0821 839 462 gene locus_tag LOCUS_28620 839 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1088 840 gene locus_tag LOCUS_28630 1088 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence0822 <1440 412 gene locus_tag LOCUS_28640 <1440 412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257882.1:S41 family peptidase >Feature sequence0823 465 1100 gene locus_tag LOCUS_28650 465 1100 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086475.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence0824 >Feature sequence0825 67 852 gene locus_tag LOCUS_28660 67 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 983 1144 gene locus_tag LOCUS_28670 983 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence0826 >Feature sequence0827 670 293 gene locus_tag LOCUS_28680 670 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1326 952 gene locus_tag LOCUS_28690 1326 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence0828 >Feature sequence0829 >Feature sequence0830 1111 335 gene locus_tag LOCUS_28700 1111 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence0831 >Feature sequence0832 >Feature sequence0833 >Feature sequence0834 551 93 gene locus_tag LOCUS_28710 551 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence0835 >Feature sequence0836 1031 126 gene locus_tag LOCUS_28720 1031 126 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257844.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence0837 181 1248 gene locus_tag LOCUS_28730 181 1248 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0838 >Feature sequence0839 <1 1159 gene locus_tag LOCUS_28740 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227326.1:response regulator transcription factor >Feature sequence0840 110 883 gene locus_tag LOCUS_28750 110 883 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence0841 1038 787 gene locus_tag LOCUS_28760 1038 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence0842 <1378 311 gene locus_tag LOCUS_28770 <1378 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393146.1:alanine--tRNA ligase >Feature sequence0843 >Feature sequence0844 1376 6 gene locus_tag LOCUS_28780 gene glnA4 1376 6 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence0845 >Feature sequence0846 1366 107 gene locus_tag LOCUS_28790 1366 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence0847 >Feature sequence0848 38 913 gene locus_tag LOCUS_28800 38 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0849 >Feature sequence0850 1210 296 gene locus_tag LOCUS_28810 1210 296 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence0851 2 649 gene locus_tag LOCUS_28820 2 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 <1349 716 gene locus_tag LOCUS_28830 <1349 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976898.1:cysteine desulfurase >Feature sequence0852 >Feature sequence0853 708 1037 gene locus_tag LOCUS_28840 708 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0854 17 223 gene locus_tag LOCUS_28850 17 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence0855 >Feature sequence0856 >Feature sequence0857 >Feature sequence0858 >Feature sequence0859 <1334 702 gene locus_tag LOCUS_28860 <1334 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583225.1:ABC transporter permease >Feature sequence0860 1023 130 gene locus_tag LOCUS_28870 gene rocF 1023 130 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence0861 <1 1129 gene locus_tag LOCUS_28880 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024078840.1:IS256 family transposase >Feature sequence0862 >Feature sequence0863 1243 1028 gene locus_tag LOCUS_28890 1243 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence0864 113 616 gene locus_tag LOCUS_28900 113 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 613 1248 gene locus_tag LOCUS_28910 613 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28910 >Feature sequence0865 >Feature sequence0866 <1 555 gene locus_tag LOCUS_28920 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258113.1:molecular chaperone DnaK >Feature sequence0867 792 211 gene locus_tag LOCUS_28930 792 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence0868 452 108 gene locus_tag LOCUS_28940 452 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0869 >Feature sequence0870 >Feature sequence0871 599 246 gene locus_tag LOCUS_28950 599 246 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence0872 >Feature sequence0873 <1 1214 gene locus_tag LOCUS_28960 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031326.1:glycoside hydrolase family 15 protein >Feature sequence0874 >Feature sequence0875 2 1081 gene locus_tag LOCUS_28970 2 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence0876 241 792 gene locus_tag LOCUS_28980 gene bcrC 241 792 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence0877 1 735 gene locus_tag LOCUS_28990 1 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence0878 >Feature sequence0879 >Feature sequence0880 509 36 gene locus_tag LOCUS_29000 509 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 789 1238 gene locus_tag LOCUS_29010 789 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence0881 <1 831 gene locus_tag LOCUS_29020 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258346.1:tyrosine recombinase >Feature sequence0882 722 1273 gene locus_tag LOCUS_29030 722 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence0883 621 463 gene locus_tag LOCUS_29040 621 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence0884 <1283 727 gene locus_tag LOCUS_29050 <1283 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392485.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD >Feature sequence0885 >Feature sequence0886 102 1196 gene locus_tag LOCUS_29060 102 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0887 >Feature sequence0888 1 642 gene locus_tag LOCUS_29070 1 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence0889 1265 678 gene locus_tag LOCUS_29080 1265 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence0890 <1266 92 gene locus_tag LOCUS_29090 <1266 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819774.1:FAD-dependent 2-octaprenylphenol hydroxylase >Feature sequence0891 1134 322 gene locus_tag LOCUS_29100 1134 322 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence0892 <1263 225 gene locus_tag LOCUS_29110 <1263 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054935954.1:RNA polymerase sigma factor RpoD >Feature sequence0893 1222 287 gene locus_tag LOCUS_29120 1222 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence0894 1071 286 gene locus_tag LOCUS_29130 1071 286 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence0895 >Feature sequence0896 147 761 gene locus_tag LOCUS_29140 147 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence0897 >Feature sequence0898 612 1169 gene locus_tag LOCUS_29150 612 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064789.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0899 >Feature sequence0900 339 647 gene locus_tag LOCUS_29160 339 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence0901 >Feature sequence0902 >Feature sequence0903 <1 614 gene locus_tag LOCUS_29170 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888997.1:DUF4126 domain-containing protein >Feature sequence0904 >Feature sequence0905 <1 568 gene locus_tag LOCUS_29180 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932457.1:NADH-quinone oxidoreductase subunit M note possible pseudo, internal stop codon >Feature sequence0906 84 503 gene locus_tag LOCUS_29190 84 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0907 443 790 gene locus_tag LOCUS_29200 443 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence0908 >Feature sequence0909 >Feature sequence0910 >Feature sequence0911 847 524 gene locus_tag LOCUS_29210 847 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0912 880 422 gene locus_tag LOCUS_29220 880 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence0913 >Feature sequence0914 >Feature sequence0915 <1217 371 gene locus_tag LOCUS_29230 <1217 371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005575582.1:alkaline phosphatase family protein >Feature sequence0916 387 983 gene locus_tag LOCUS_29240 387 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence0917 480 767 gene locus_tag LOCUS_29250 480 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1192 917 gene locus_tag LOCUS_29260 1192 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0918 204 737 gene locus_tag LOCUS_29270 204 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 2 1207 gene locus_tag LOCUS_29280 gene tuf 2 1207 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence0922 >Feature sequence0923 168 695 gene locus_tag LOCUS_29290 168 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence0924 912 340 gene locus_tag LOCUS_29300 912 340 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence0925 >Feature sequence0926 583 843 gene locus_tag LOCUS_29310 583 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29310 >Feature sequence0927 307 609 gene locus_tag LOCUS_29320 307 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 606 1160 gene locus_tag LOCUS_29330 606 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence0928 >Feature sequence0929 197 829 gene locus_tag LOCUS_29340 197 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0930 837 1190 gene locus_tag LOCUS_29350 837 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence0931 >Feature sequence0932 1190 699 gene locus_tag LOCUS_29360 1190 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence0933 >Feature sequence0934 <1 905 gene locus_tag LOCUS_29370 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086843344.1:BTAD domain-containing putative transcriptional regulator >Feature sequence0935 974 138 gene locus_tag LOCUS_29380 974 138 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460804.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 862 116 gene locus_tag LOCUS_29390 862 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0939 <1 924 gene locus_tag LOCUS_29400 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228420.1:dihydropyrimidinase >Feature sequence0940 >Feature sequence0941 <1176 505 gene locus_tag LOCUS_29410 <1176 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029643.1:serine/threonine-protein kinase >Feature sequence0942 710 138 gene locus_tag LOCUS_29420 710 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence0943 <1 1094 gene locus_tag LOCUS_29430 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929086.1:ABC transporter ATP-binding protein >Feature sequence0944 >Feature sequence0945 94 339 gene locus_tag LOCUS_29440 94 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 578 336 gene locus_tag LOCUS_29450 578 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence0946 >Feature sequence0947 >Feature sequence0948 356 691 gene locus_tag LOCUS_29460 356 691 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence0949 >Feature sequence0950 311 721 gene locus_tag LOCUS_29470 311 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence0951 >Feature sequence0952 <1164 605 gene locus_tag LOCUS_29480 <1164 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090936.1:IS21-like element ISFK1 family transposase note possible pseudo, frameshifted >Feature sequence0953 >Feature sequence0954 395 57 gene locus_tag LOCUS_29490 395 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 667 476 gene locus_tag LOCUS_29500 667 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 783 1028 gene locus_tag LOCUS_29510 783 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence0955 684 232 gene locus_tag LOCUS_29520 684 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 991 895 gene locus_tag LOCUS_t00450 991 895 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0956 <1 792 gene locus_tag LOCUS_29530 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902477.1:protein translocase subunit SecD >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 <1 999 gene locus_tag LOCUS_29540 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143540.1:3-isopropylmalate dehydrogenase >Feature sequence0960 864 652 gene locus_tag LOCUS_29550 gene yidD 864 652 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence0961 >Feature sequence0962 601 404 gene locus_tag LOCUS_29560 601 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0963 >Feature sequence0964 >Feature sequence0965 713 387 gene locus_tag LOCUS_29570 713 387 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence0966 >Feature sequence0967 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 754 233 gene locus_tag LOCUS_29580 754 233 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_29580 1019 822 gene locus_tag LOCUS_29590 1019 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0973 173 748 gene locus_tag LOCUS_29600 173 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0974 >Feature sequence0975 938 750 gene locus_tag LOCUS_29610 938 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence0976 >Feature sequence0977 3 764 gene locus_tag LOCUS_29620 3 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence0978 >Feature sequence0979 666 277 gene locus_tag LOCUS_29630 666 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 981 271 gene locus_tag LOCUS_29640 gene purN 981 271 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence0987 184 576 gene locus_tag LOCUS_29650 184 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0988 948 667 gene locus_tag LOCUS_29660 948 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence0989 583 314 gene locus_tag LOCUS_29670 583 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 880 1029 gene locus_tag LOCUS_29680 880 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence0990 390 830 gene locus_tag LOCUS_29690 390 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence0991 3 773 gene locus_tag LOCUS_29700 3 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29700 >Feature sequence0992 >Feature sequence0993 >Feature sequence0994 >Feature sequence0995 726 298 gene locus_tag LOCUS_29710 726 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0996 1026 604 gene locus_tag LOCUS_29720 1026 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence0997 >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 709 260 gene locus_tag LOCUS_29730 709 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence1001 109 1083 gene locus_tag LOCUS_29740 gene meaB 109 1083 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence1002 <1099 402 gene locus_tag LOCUS_29750 <1099 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391594.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence1003 <1 944 gene locus_tag LOCUS_29760 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255932.1:HAMP domain-containing protein >Feature sequence1004 >Feature sequence1005 786 995 gene locus_tag LOCUS_29770 786 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence1006 >Feature sequence1007 <1 535 gene locus_tag LOCUS_29780 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660412.1:ABC transporter permease subunit >Feature sequence1008 >Feature sequence1009 273 1043 gene locus_tag LOCUS_29790 273 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 148 327 gene locus_tag LOCUS_29800 148 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence1016 290 754 gene locus_tag LOCUS_29810 290 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 881 1081 gene locus_tag LOCUS_29820 881 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence1017 >Feature sequence1018 <1 986 gene locus_tag LOCUS_29830 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942532.1:RNA polymerase factor sigma-54 >Feature sequence1019 <1 715 gene locus_tag LOCUS_29840 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395936.1:alpha/beta hydrolase >Feature sequence1020 >Feature sequence1021 361 41 gene locus_tag LOCUS_29850 361 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 499 1059 gene locus_tag LOCUS_29860 499 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence1022 >Feature sequence1023 966 73 gene locus_tag LOCUS_29870 966 73 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence1024 >Feature sequence1025 >Feature sequence1026 >Feature sequence1027 41 454 gene locus_tag LOCUS_29880 41 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence1028 78 1013 gene locus_tag LOCUS_29890 78 1013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence1029 <1065 76 gene locus_tag LOCUS_29900 <1065 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941984.1:TolC family protein >Feature sequence1030 86 913 gene locus_tag LOCUS_29910 86 913 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence1031 <1 809 gene locus_tag LOCUS_29920 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813988.1:CaiB/BaiF CoA-transferase family protein >Feature sequence1032 1 765 gene locus_tag LOCUS_29930 1 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence1033 201 440 gene locus_tag LOCUS_29940 201 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1055 447 gene locus_tag LOCUS_29950 1055 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence1034 >Feature sequence1035 81 557 gene locus_tag LOCUS_29960 81 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403166.1 protein_id gnl|my_center|LOCUS_29960 732 1004 gene locus_tag LOCUS_29970 732 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence1036 >Feature sequence1037 103 1050 gene locus_tag LOCUS_29980 103 1050 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061177.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence1038 <1 684 gene locus_tag LOCUS_29990 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257743.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 752 922 gene locus_tag LOCUS_30000 752 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence1042 577 335 gene locus_tag LOCUS_30010 577 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence1043 >Feature sequence1044 118 897 gene locus_tag LOCUS_30020 118 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence1045 214 396 gene locus_tag LOCUS_30030 214 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 696 475 gene locus_tag LOCUS_30040 696 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence1046 74 586 gene locus_tag LOCUS_30050 74 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence1047 >Feature sequence1048 450 758 gene locus_tag LOCUS_30060 450 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence1049 <1 888 gene locus_tag LOCUS_30070 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393441.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence1050 >Feature sequence1051 >Feature sequence1052 425 673 gene locus_tag LOCUS_30080 425 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence1053 >Feature sequence1054 >Feature sequence1055 >Feature sequence1056 29 847 gene locus_tag LOCUS_30090 29 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 301 59 gene locus_tag LOCUS_30100 301 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence1060 660 1016 gene locus_tag LOCUS_30110 660 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence1061 >Feature sequence1062 >Feature sequence1063 <1 947 gene locus_tag LOCUS_30120 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114846.1:MFS transporter >Feature sequence1064 635 219 gene locus_tag LOCUS_30130 635 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 <1023 244 gene locus_tag LOCUS_30140 <1023 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080372.1:histidine--tRNA ligase >Feature sequence1068 725 567 gene locus_tag LOCUS_30150 725 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence1069 <1020 238 gene locus_tag LOCUS_30160 <1020 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258346.1:tyrosine recombinase >Feature sequence1070 649 975 gene locus_tag LOCUS_30170 649 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence1071 714 256 gene locus_tag LOCUS_30180 714 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence1072 255 506 gene locus_tag LOCUS_30190 255 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 960 538 gene locus_tag LOCUS_30200 960 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence1073 59 976 gene locus_tag LOCUS_30210 59 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence1074 >Feature sequence1075 795 79 gene locus_tag LOCUS_30220 795 79 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064267.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence1076 <1016 67 gene locus_tag LOCUS_30230 <1016 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258096.1:AAA family ATPase >Feature sequence1077 >Feature sequence1078 637 236 gene locus_tag LOCUS_30240 637 236 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_30240 965 666 gene locus_tag LOCUS_30250 965 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence1079 >Feature sequence1080 116 625 gene locus_tag LOCUS_30260 116 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence1081 1011 196 gene locus_tag LOCUS_30270 gene lgt 1011 196 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence1082 >Feature sequence1083 <1 587 gene locus_tag LOCUS_30280 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043921634.1:ferritin-like domain-containing protein >Feature sequence1084 >Feature sequence1085 511 125 gene locus_tag LOCUS_30290 511 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence1086 >Feature sequence1087 >Feature sequence1088 627 785 gene locus_tag LOCUS_30300 627 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence1089 2 421 gene locus_tag LOCUS_30310 2 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 >Feature sequence1094 >Feature sequence1095 87 524 gene locus_tag LOCUS_30320 87 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence1096 >Feature sequence1097 <1001 408 gene locus_tag LOCUS_30330 <1001 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461688.1:phosphoenolpyruvate synthase