>Feature sequence001 956 771 gene locus_tag LOCUS_00010 956 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1102 2559 gene locus_tag LOCUS_00020 1102 2559 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164034966.1 protein_id gnl|my_center|LOCUS_00020 2584 3666 gene locus_tag LOCUS_00030 gene aroC 2584 3666 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766481.1 protein_id gnl|my_center|LOCUS_00030 3679 4992 gene locus_tag LOCUS_00040 3679 4992 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00040 5014 6426 gene locus_tag LOCUS_00050 5014 6426 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_00050 6484 7083 gene locus_tag LOCUS_00060 6484 7083 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_00060 8491 7250 gene locus_tag LOCUS_00070 8491 7250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_00070 9301 8717 gene locus_tag LOCUS_00080 gene gldD 9301 8717 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_00080 10702 9356 gene locus_tag LOCUS_00090 10702 9356 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_00090 11199 10747 gene locus_tag LOCUS_00100 gene ssb 11199 10747 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_00100 12283 11201 gene locus_tag LOCUS_00110 gene mutY 12283 11201 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_00110 12419 12712 gene locus_tag LOCUS_00120 12419 12712 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_00120 13080 14633 gene locus_tag LOCUS_00130 13080 14633 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_00130 14644 15663 gene locus_tag LOCUS_00140 gene gldB 14644 15663 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_00140 16406 15750 gene locus_tag LOCUS_00150 16406 15750 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_00150 17234 16473 gene locus_tag LOCUS_00160 17234 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18041 17349 gene locus_tag LOCUS_00170 18041 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18178 19647 gene locus_tag LOCUS_00180 gene guaB 18178 19647 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_00180 19711 21747 gene locus_tag LOCUS_00190 19711 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21750 22088 gene locus_tag LOCUS_00200 gene rsbV 21750 22088 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721460.1 protein_id gnl|my_center|LOCUS_00200 22085 22504 gene locus_tag LOCUS_00210 22085 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22589 24547 gene locus_tag LOCUS_00220 22589 24547 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_00220 24519 25412 gene locus_tag LOCUS_00230 24519 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25390 26748 gene locus_tag LOCUS_00240 25390 26748 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_00240 26759 27724 gene locus_tag LOCUS_00250 26759 27724 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_00250 28387 27728 gene locus_tag LOCUS_00260 28387 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29350 28484 gene locus_tag LOCUS_00270 29350 28484 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_00270 29881 29357 gene locus_tag LOCUS_00280 29881 29357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30139 30975 gene locus_tag LOCUS_00290 30139 30975 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_00290 31024 31902 gene locus_tag LOCUS_00300 31024 31902 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_00300 33449 32208 gene locus_tag LOCUS_00310 33449 32208 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_00310 36232 33647 gene locus_tag LOCUS_00320 36232 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38335 36299 gene locus_tag LOCUS_00330 38335 36299 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_00330 39760 38384 gene locus_tag LOCUS_00340 39760 38384 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_00340 40213 42810 gene locus_tag LOCUS_00350 40213 42810 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_00350 42852 43916 gene locus_tag LOCUS_00360 42852 43916 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_00360 44347 44126 gene locus_tag LOCUS_00370 44347 44126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44565 45872 gene locus_tag LOCUS_00380 gene serS 44565 45872 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_00380 47257 46034 gene locus_tag LOCUS_00390 gene nrfD 47257 46034 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_00390 48320 47292 gene locus_tag LOCUS_00400 48320 47292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48950 48327 gene locus_tag LOCUS_00410 48950 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51668 49620 gene locus_tag LOCUS_00420 51668 49620 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_00420 52201 51947 gene locus_tag LOCUS_00430 52201 51947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52515 53771 gene locus_tag LOCUS_00440 52515 53771 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_00440 54035 54355 gene locus_tag LOCUS_00450 54035 54355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54465 55901 gene locus_tag LOCUS_00460 gene nrfA 54465 55901 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence002 403 927 gene locus_tag LOCUS_00470 403 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 1157 3496 gene locus_tag LOCUS_00480 1157 3496 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_00480 3499 4425 gene locus_tag LOCUS_00490 3499 4425 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_00490 4914 4468 gene locus_tag LOCUS_00500 4914 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6640 4919 gene locus_tag LOCUS_00510 6640 4919 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_00510 7625 6654 gene locus_tag LOCUS_00520 gene trpS 7625 6654 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_00520 7794 8864 gene locus_tag LOCUS_00530 7794 8864 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_00530 9548 8865 gene locus_tag LOCUS_00540 9548 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 10186 9545 gene locus_tag LOCUS_00550 10186 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10927 10259 gene locus_tag LOCUS_00560 10927 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 12154 10976 gene locus_tag LOCUS_00570 12154 10976 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_00570 12300 14114 gene locus_tag LOCUS_00580 12300 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 14114 15685 gene locus_tag LOCUS_00590 14114 15685 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_00590 15710 16075 gene locus_tag LOCUS_00600 15710 16075 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_00600 16079 17098 gene locus_tag LOCUS_00610 16079 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 17705 17100 gene locus_tag LOCUS_00620 17705 17100 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974856.1 protein_id gnl|my_center|LOCUS_00620 18980 18237 gene locus_tag LOCUS_00630 gene kdsB 18980 18237 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_00630 20312 18996 gene locus_tag LOCUS_00640 20312 18996 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_00640 20690 21799 gene locus_tag LOCUS_00650 20690 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 22561 22190 gene locus_tag LOCUS_00660 22561 22190 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_00660 23238 22558 gene locus_tag LOCUS_00670 23238 22558 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_00670 24303 23257 gene locus_tag LOCUS_00680 24303 23257 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_00680 25123 24284 gene locus_tag LOCUS_00690 25123 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 26051 25164 gene locus_tag LOCUS_00700 26051 25164 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_00700 26133 26426 gene locus_tag LOCUS_00710 26133 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 26434 28803 gene locus_tag LOCUS_00720 26434 28803 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_00720 29169 30881 gene locus_tag LOCUS_00730 29169 30881 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_00730 30906 31205 gene locus_tag LOCUS_00740 30906 31205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence003 3202 1931 gene locus_tag LOCUS_00750 3202 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4236 3199 gene locus_tag LOCUS_00760 4236 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7497 4333 gene locus_tag LOCUS_00770 7497 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10818 7633 gene locus_tag LOCUS_00780 10818 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11593 10907 gene locus_tag LOCUS_00790 11593 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 12139 11630 gene locus_tag LOCUS_00800 12139 11630 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_00800 12243 13706 gene locus_tag LOCUS_00810 gene miaB 12243 13706 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_00810 13703 14974 gene locus_tag LOCUS_00820 13703 14974 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_00820 14967 15479 gene locus_tag LOCUS_00830 14967 15479 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_00830 15519 16355 gene locus_tag LOCUS_00840 15519 16355 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_00840 16352 16699 gene locus_tag LOCUS_00850 16352 16699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 16908 17186 gene locus_tag LOCUS_00860 16908 17186 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_00860 17218 18849 gene locus_tag LOCUS_00870 gene groL 17218 18849 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_00870 20433 18925 gene locus_tag LOCUS_00880 20433 18925 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_00880 20655 22259 gene locus_tag LOCUS_00890 gene pckA 20655 22259 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_00890 22365 23900 gene locus_tag LOCUS_00900 22365 23900 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_00900 24446 23904 gene locus_tag LOCUS_00910 24446 23904 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_00910 25092 24493 gene locus_tag LOCUS_00920 25092 24493 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_00920 26052 25105 gene locus_tag LOCUS_00930 26052 25105 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_00930 26803 26072 gene locus_tag LOCUS_00940 26803 26072 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_00940 26883 27200 gene locus_tag LOCUS_00950 26883 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27260 28615 gene locus_tag LOCUS_00960 27260 28615 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_00960 28617 29423 gene locus_tag LOCUS_00970 28617 29423 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_00970 29500 31107 gene locus_tag LOCUS_00980 29500 31107 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence004 3032 744 gene locus_tag LOCUS_00990 3032 744 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_00990 5513 3051 gene locus_tag LOCUS_01000 5513 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5708 6571 gene locus_tag LOCUS_01010 5708 6571 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_01010 6577 7032 gene locus_tag LOCUS_01020 6577 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7067 7210 gene locus_tag LOCUS_01030 7067 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7224 7577 gene locus_tag LOCUS_01040 7224 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 7647 8681 gene locus_tag LOCUS_01050 gene atpB 7647 8681 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_01050 8718 8960 gene locus_tag LOCUS_01060 8718 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9030 9524 gene locus_tag LOCUS_01070 9030 9524 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_01070 9566 10063 gene locus_tag LOCUS_01080 gene atpH 9566 10063 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_01080 10086 11666 gene locus_tag LOCUS_01090 gene atpA 10086 11666 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_01090 11679 12548 gene locus_tag LOCUS_01100 11679 12548 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_01100 12644 13474 gene locus_tag LOCUS_01110 12644 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 13468 14088 gene locus_tag LOCUS_01120 13468 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15499 14075 gene locus_tag LOCUS_01130 15499 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 15727 18309 gene locus_tag LOCUS_01140 15727 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 18387 18959 gene locus_tag LOCUS_01150 18387 18959 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_01150 20089 18965 gene locus_tag LOCUS_01160 20089 18965 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_01160 21482 20097 gene locus_tag LOCUS_01170 gene glmM 21482 20097 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_01170 21746 21513 gene locus_tag LOCUS_01180 21746 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 21809 22624 gene locus_tag LOCUS_01190 gene mazG 21809 22624 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_01190 23418 22672 gene locus_tag LOCUS_01200 23418 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 24326 23553 gene locus_tag LOCUS_01210 24326 23553 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_01210 26251 24323 gene locus_tag LOCUS_01220 gene dxs 26251 24323 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_01220 26372 27124 gene locus_tag LOCUS_01230 26372 27124 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence005 206 649 gene locus_tag LOCUS_01240 gene tsaE 206 649 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_01240 639 1862 gene locus_tag LOCUS_01250 639 1862 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_01250 1865 2095 gene locus_tag LOCUS_01260 gene yidD 1865 2095 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_01260 2541 2164 gene locus_tag LOCUS_01270 2541 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3862 2657 gene locus_tag LOCUS_01280 3862 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5716 3890 gene locus_tag LOCUS_01290 gene nadE 5716 3890 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_01290 6459 5719 gene locus_tag LOCUS_01300 6459 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7724 6477 gene locus_tag LOCUS_01310 gene fabF 7724 6477 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_01310 7977 7738 gene locus_tag LOCUS_01320 7977 7738 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_01320 8132 8551 gene locus_tag LOCUS_01330 8132 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8571 10019 gene locus_tag LOCUS_01340 gene pyk 8571 10019 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_01340 11536 10016 gene locus_tag LOCUS_01350 11536 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 12300 11536 gene locus_tag LOCUS_01360 12300 11536 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_01360 12572 12297 gene locus_tag LOCUS_01370 12572 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 12945 12574 gene locus_tag LOCUS_01380 12945 12574 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_01380 16499 12942 gene locus_tag LOCUS_01390 16499 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 16596 17504 gene locus_tag LOCUS_01400 gene miaA 16596 17504 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_01400 18921 17950 gene locus_tag LOCUS_01410 gene pfkA 18921 17950 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_01410 19021 20322 gene locus_tag LOCUS_01420 19021 20322 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_01420 20319 21419 gene locus_tag LOCUS_01430 20319 21419 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01430 22875 21403 gene locus_tag LOCUS_01440 22875 21403 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_01440 23627 22878 gene locus_tag LOCUS_01450 23627 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 23694 24911 gene locus_tag LOCUS_01460 23694 24911 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_01460 25943 24951 gene locus_tag LOCUS_01470 gene moaA 25943 24951 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence006 592 236 gene locus_tag LOCUS_01480 592 236 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_01480 1407 688 gene locus_tag LOCUS_01490 1407 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 2489 1914 gene locus_tag LOCUS_01500 2489 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3123 2506 gene locus_tag LOCUS_01510 3123 2506 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_01510 4313 3114 gene locus_tag LOCUS_01520 4313 3114 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_01520 4954 4310 gene locus_tag LOCUS_01530 4954 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5799 4951 gene locus_tag LOCUS_01540 5799 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 7225 6167 gene locus_tag LOCUS_01550 gene wecB 7225 6167 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113418.1 protein_id gnl|my_center|LOCUS_01550 8574 7222 gene locus_tag LOCUS_01560 gene vpsH 8574 7222 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_01560 9614 8613 gene locus_tag LOCUS_01570 9614 8613 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964099.1 protein_id gnl|my_center|LOCUS_01570 10759 9611 gene locus_tag LOCUS_01580 10759 9611 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_01580 11433 10729 gene locus_tag LOCUS_01590 11433 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12427 11435 gene locus_tag LOCUS_01600 12427 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 13986 12508 gene locus_tag LOCUS_01610 13986 12508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15316 13961 gene locus_tag LOCUS_01620 15316 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 16394 15300 gene locus_tag LOCUS_01630 16394 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17118 16408 gene locus_tag LOCUS_01640 17118 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17488 17288 gene locus_tag LOCUS_01650 17488 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 18360 17575 gene locus_tag LOCUS_01660 18360 17575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 19389 18361 gene locus_tag LOCUS_01670 19389 18361 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_01670 20620 19430 gene locus_tag LOCUS_01680 20620 19430 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105217984.1 protein_id gnl|my_center|LOCUS_01680 22038 20617 gene locus_tag LOCUS_01690 22038 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 22858 22028 gene locus_tag LOCUS_01700 22858 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 23835 22858 gene locus_tag LOCUS_01710 23835 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 24572 23832 gene locus_tag LOCUS_01720 24572 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 25542 24574 gene locus_tag LOCUS_01730 25542 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence007 2159 492 gene locus_tag LOCUS_01740 gene paaN 2159 492 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_01740 2706 2194 gene locus_tag LOCUS_01750 2706 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4174 2927 gene locus_tag LOCUS_01760 gene hutI 4174 2927 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_01760 5234 4188 gene locus_tag LOCUS_01770 5234 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7121 5334 gene locus_tag LOCUS_01780 7121 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8674 7148 gene locus_tag LOCUS_01790 gene guaA 8674 7148 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_01790 8710 9969 gene locus_tag LOCUS_01800 gene mnmA 8710 9969 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_01800 10077 10325 gene locus_tag LOCUS_01810 10077 10325 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_01810 10403 11656 gene locus_tag LOCUS_01820 10403 11656 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_01820 11637 12275 gene locus_tag LOCUS_01830 11637 12275 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_01830 12314 13582 gene locus_tag LOCUS_01840 12314 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 13688 14071 gene locus_tag LOCUS_01850 13688 14071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_01850 14544 14068 gene locus_tag LOCUS_01860 14544 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 15743 14631 gene locus_tag LOCUS_01870 15743 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 16352 15810 gene locus_tag LOCUS_01880 16352 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 17407 16637 gene locus_tag LOCUS_01890 17407 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18517 17429 gene locus_tag LOCUS_01900 18517 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18671 19186 gene locus_tag LOCUS_01910 18671 19186 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_01910 19248 20165 gene locus_tag LOCUS_01920 19248 20165 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_01920 20242 22677 gene locus_tag LOCUS_01930 20242 22677 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_01930 22905 23378 gene locus_tag LOCUS_01940 22905 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 23468 24088 gene locus_tag LOCUS_01950 23468 24088 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence008 1737 1048 gene locus_tag LOCUS_01960 1737 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1900 2892 gene locus_tag LOCUS_01970 1900 2892 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_01970 3557 2898 gene locus_tag LOCUS_01980 3557 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4081 3554 gene locus_tag LOCUS_01990 4081 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4766 4098 gene locus_tag LOCUS_02000 4766 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6623 4851 gene locus_tag LOCUS_02010 6623 4851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_02010 7379 6636 gene locus_tag LOCUS_02020 gene truA 7379 6636 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_02020 8581 7382 gene locus_tag LOCUS_02030 gene pcaF 8581 7382 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_02030 8647 9102 gene locus_tag LOCUS_02040 8647 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9893 9099 gene locus_tag LOCUS_02050 9893 9099 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_02050 10573 9899 gene locus_tag LOCUS_02060 gene rsmI 10573 9899 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_02060 11265 10570 gene locus_tag LOCUS_02070 11265 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 11612 11343 gene locus_tag LOCUS_02080 11612 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 13733 11634 gene locus_tag LOCUS_02090 13733 11634 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_02090 15166 13862 gene locus_tag LOCUS_02100 15166 13862 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_02100 15413 15159 gene locus_tag LOCUS_02110 15413 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 15963 15403 gene locus_tag LOCUS_02120 15963 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17276 15966 gene locus_tag LOCUS_02130 17276 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 18563 17292 gene locus_tag LOCUS_02140 18563 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 19305 18550 gene locus_tag LOCUS_02150 19305 18550 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_02150 19450 20934 gene locus_tag LOCUS_02160 19450 20934 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_02160 21011 21274 gene locus_tag LOCUS_02170 21011 21274 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356062.1 protein_id gnl|my_center|LOCUS_02170 21275 23332 gene locus_tag LOCUS_02180 gene feoB 21275 23332 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_02180 24252 23341 gene locus_tag LOCUS_02190 24252 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence009 257 511 gene locus_tag LOCUS_02200 257 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 504 935 gene locus_tag LOCUS_02210 504 935 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_02210 1532 1086 gene locus_tag LOCUS_02220 1532 1086 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376389.1 protein_id gnl|my_center|LOCUS_02220 2307 1681 gene locus_tag LOCUS_02230 2307 1681 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532957.1 protein_id gnl|my_center|LOCUS_02230 3519 2386 gene locus_tag LOCUS_02240 gene bshA 3519 2386 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_02240 4808 3516 gene locus_tag LOCUS_02250 4808 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4876 5229 gene locus_tag LOCUS_02260 4876 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5235 7025 gene locus_tag LOCUS_02270 gene mutL 5235 7025 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_02270 7032 7823 gene locus_tag LOCUS_02280 7032 7823 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_02280 7827 8771 gene locus_tag LOCUS_02290 7827 8771 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_02290 9389 8793 gene locus_tag LOCUS_02300 gene yihA 9389 8793 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_02300 9517 11556 gene locus_tag LOCUS_02310 9517 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11847 12599 gene locus_tag LOCUS_02320 gene ubiE 11847 12599 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_02320 12608 13282 gene locus_tag LOCUS_02330 12608 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 13357 14118 gene locus_tag LOCUS_02340 13357 14118 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444884.1 protein_id gnl|my_center|LOCUS_02340 14558 14115 gene locus_tag LOCUS_02350 14558 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 15480 14566 gene locus_tag LOCUS_02360 15480 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18581 15540 gene locus_tag LOCUS_02370 18581 15540 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_02370 19043 18591 gene locus_tag LOCUS_02380 gene cdd 19043 18591 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_02380 19151 20497 gene locus_tag LOCUS_02390 19151 20497 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_02390 20995 21756 gene locus_tag LOCUS_02400 20995 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02400 21763 22320 gene locus_tag LOCUS_02410 21763 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02410 22388 23323 gene locus_tag LOCUS_02420 gene mdh 22388 23323 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence010 2330 1743 gene locus_tag LOCUS_02430 2330 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2829 2320 gene locus_tag LOCUS_02440 2829 2320 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921996.1 protein_id gnl|my_center|LOCUS_02440 3700 2819 gene locus_tag LOCUS_02450 3700 2819 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_02450 4433 3819 gene locus_tag LOCUS_02460 4433 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5904 4498 gene locus_tag LOCUS_02470 gene fumC 5904 4498 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_02470 6579 6043 gene locus_tag LOCUS_02480 6579 6043 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_02480 6663 9263 gene locus_tag LOCUS_02490 gene mutS 6663 9263 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_02490 9347 10285 gene locus_tag LOCUS_02500 9347 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10392 10465 gene locus_tag LOCUS_t00010 10392 10465 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10503 10587 gene locus_tag LOCUS_t00020 10503 10587 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10911 10702 gene locus_tag LOCUS_02510 10911 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 11075 11845 gene locus_tag LOCUS_02520 11075 11845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_02520 11903 13393 gene locus_tag LOCUS_02530 gene cysS 11903 13393 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_02530 13380 14351 gene locus_tag LOCUS_02540 13380 14351 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_02540 15470 14511 gene locus_tag LOCUS_02550 15470 14511 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_02550 16566 15481 gene locus_tag LOCUS_02560 16566 15481 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_02560 16817 17074 gene locus_tag LOCUS_02570 16817 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18154 17075 gene locus_tag LOCUS_02580 18154 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 19352 18297 gene locus_tag LOCUS_02590 19352 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20670 19375 gene locus_tag LOCUS_02600 20670 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence011 623 159 gene locus_tag LOCUS_02610 623 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4019 672 gene locus_tag LOCUS_02620 gene secA 4019 672 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_02620 4875 4120 gene locus_tag LOCUS_02630 gene dapF 4875 4120 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_02630 4923 5387 gene locus_tag LOCUS_02640 4923 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 5524 5979 gene locus_tag LOCUS_02650 5524 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7481 5976 gene locus_tag LOCUS_02660 7481 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7659 10535 gene locus_tag LOCUS_02670 gene gcvP 7659 10535 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_02670 10906 10577 gene locus_tag LOCUS_02680 10906 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 11468 10917 gene locus_tag LOCUS_02690 11468 10917 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_02690 14643 11653 gene locus_tag LOCUS_02700 gene secDF 14643 11653 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_02700 15072 14725 gene locus_tag LOCUS_02710 15072 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 16167 15160 gene locus_tag LOCUS_02720 16167 15160 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_02720 16860 16255 gene locus_tag LOCUS_02730 16860 16255 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_02730 17734 16988 gene locus_tag LOCUS_02740 gene fabG 17734 16988 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_02740 17889 19283 gene locus_tag LOCUS_02750 gene lpdA 17889 19283 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_02750 22072 19442 gene locus_tag LOCUS_02760 22072 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 22626 22069 gene locus_tag LOCUS_02770 22626 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 23184 22975 gene locus_tag LOCUS_02780 23184 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence012 2789 2445 gene locus_tag LOCUS_02790 gene rplT 2789 2445 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_02790 3063 2869 gene locus_tag LOCUS_02800 gene rpmI 3063 2869 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_02800 3617 3093 gene locus_tag LOCUS_02810 gene infC 3617 3093 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_02810 5680 3740 gene locus_tag LOCUS_02820 gene thrS 5680 3740 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_02820 6441 5833 gene locus_tag LOCUS_02830 6441 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7036 6479 gene locus_tag LOCUS_02840 7036 6479 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_02840 7397 11944 gene locus_tag LOCUS_02850 7397 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 12031 12558 gene locus_tag LOCUS_02860 12031 12558 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_02860 12809 12555 gene locus_tag LOCUS_02870 12809 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13836 13072 gene locus_tag LOCUS_02880 13836 13072 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_02880 14918 13854 gene locus_tag LOCUS_02890 14918 13854 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_02890 15065 16147 gene locus_tag LOCUS_02900 gene lpxK 15065 16147 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_02900 16176 18020 gene locus_tag LOCUS_02910 16176 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 18672 18025 gene locus_tag LOCUS_02920 18672 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 19888 18695 gene locus_tag LOCUS_02930 19888 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 20802 19885 gene locus_tag LOCUS_02940 20802 19885 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_02940 20872 21663 gene locus_tag LOCUS_02950 20872 21663 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_02950 22654 21620 gene locus_tag LOCUS_02960 22654 21620 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence013 1 408 gene locus_tag LOCUS_02970 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 509 2269 gene locus_tag LOCUS_02980 509 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2297 3820 gene locus_tag LOCUS_02990 2297 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5149 3863 gene locus_tag LOCUS_03000 5149 3863 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_03000 5214 6440 gene locus_tag LOCUS_03010 gene lhgO 5214 6440 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839995.1 protein_id gnl|my_center|LOCUS_03010 7707 8783 gene locus_tag LOCUS_03020 7707 8783 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_03020 8795 9751 gene locus_tag LOCUS_03030 8795 9751 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545028.1 protein_id gnl|my_center|LOCUS_03030 9751 9912 gene locus_tag LOCUS_03040 9751 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9976 10515 gene locus_tag LOCUS_03050 9976 10515 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_03050 10548 11018 gene locus_tag LOCUS_03060 10548 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 11040 11597 gene locus_tag LOCUS_03070 11040 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 11634 12677 gene locus_tag LOCUS_03080 11634 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 12710 13942 gene locus_tag LOCUS_03090 gene xseA 12710 13942 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_03090 13939 14142 gene locus_tag LOCUS_03100 13939 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 14201 15973 gene locus_tag LOCUS_03110 14201 15973 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_03110 15975 17981 gene locus_tag LOCUS_03120 gene ligA 15975 17981 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_03120 17978 18481 gene locus_tag LOCUS_03130 17978 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 18481 19350 gene locus_tag LOCUS_03140 gene dapA 18481 19350 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_03140 19600 19424 gene locus_tag LOCUS_03150 19600 19424 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_03150 20955 19708 gene locus_tag LOCUS_03160 20955 19708 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_03160 21141 22637 gene locus_tag LOCUS_03170 gene accC 21141 22637 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence014 <1 553 gene locus_tag LOCUS_03180 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002988881.1:ABC transporter ATP-binding protein 550 1332 gene locus_tag LOCUS_03190 550 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1604 1329 gene locus_tag LOCUS_03200 1604 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2388 1615 gene locus_tag LOCUS_03210 2388 1615 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_03210 2477 3424 gene locus_tag LOCUS_03220 2477 3424 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_03220 3539 5563 gene locus_tag LOCUS_03230 3539 5563 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_03230 5569 6342 gene locus_tag LOCUS_03240 5569 6342 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_03240 6343 8226 gene locus_tag LOCUS_03250 6343 8226 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_03250 8270 8947 gene locus_tag LOCUS_03260 8270 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9040 10233 gene locus_tag LOCUS_03270 9040 10233 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_03270 10273 11493 gene locus_tag LOCUS_03280 10273 11493 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_03280 12403 11498 gene locus_tag LOCUS_03290 12403 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 13618 12494 gene locus_tag LOCUS_03300 gene dnaN 13618 12494 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_03300 14649 13714 gene locus_tag LOCUS_03310 14649 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 16328 14649 gene locus_tag LOCUS_03320 gene gldG 16328 14649 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_03320 17050 16325 gene locus_tag LOCUS_03330 17050 16325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_03330 17966 17043 gene locus_tag LOCUS_03340 gene gldA 17966 17043 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_03340 18671 17973 gene locus_tag LOCUS_03350 18671 17973 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_03350 18765 19817 gene locus_tag LOCUS_03360 18765 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 19814 20542 gene locus_tag LOCUS_03370 19814 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 20877 20650 gene locus_tag LOCUS_03380 20877 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 21362 21045 gene locus_tag LOCUS_03390 21362 21045 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence015 76 1254 gene locus_tag LOCUS_03400 76 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1273 1539 gene locus_tag LOCUS_03410 1273 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1611 2063 gene locus_tag LOCUS_03420 1611 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2207 2590 gene locus_tag LOCUS_03430 2207 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2710 3093 gene locus_tag LOCUS_03440 2710 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3194 7027 gene locus_tag LOCUS_03450 3194 7027 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_03450 7071 8294 gene locus_tag LOCUS_03460 7071 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8332 10152 gene locus_tag LOCUS_03470 8332 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10152 10736 gene locus_tag LOCUS_03480 10152 10736 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_03480 10789 11361 gene locus_tag LOCUS_03490 10789 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11390 13480 gene locus_tag LOCUS_03500 11390 13480 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_03500 13477 14241 gene locus_tag LOCUS_03510 13477 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14306 14854 gene locus_tag LOCUS_03520 14306 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 14874 15326 gene locus_tag LOCUS_03530 14874 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 15384 16151 gene locus_tag LOCUS_03540 15384 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 16163 16690 gene locus_tag LOCUS_03550 16163 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 16745 18049 gene locus_tag LOCUS_03560 16745 18049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_03560 18064 18921 gene locus_tag LOCUS_03570 18064 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 19169 19909 gene locus_tag LOCUS_03580 19169 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 19945 20484 gene locus_tag LOCUS_03590 19945 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 20481 21350 gene locus_tag LOCUS_03600 20481 21350 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence016 1102 362 gene locus_tag LOCUS_03610 1102 362 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_03610 2714 1143 gene locus_tag LOCUS_03620 2714 1143 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_03620 4196 2718 gene locus_tag LOCUS_03630 gene glpK 4196 2718 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_03630 5414 4251 gene locus_tag LOCUS_03640 5414 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6883 5438 gene locus_tag LOCUS_03650 6883 5438 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_03650 7284 6880 gene locus_tag LOCUS_03660 7284 6880 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_03660 8332 7277 gene locus_tag LOCUS_03670 8332 7277 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_03670 8673 8332 gene locus_tag LOCUS_03680 8673 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 10786 8675 gene locus_tag LOCUS_03690 10786 8675 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_03690 11809 10841 gene locus_tag LOCUS_03700 gene mltB 11809 10841 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_03700 17104 11897 gene locus_tag LOCUS_03710 17104 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 17482 18492 gene locus_tag LOCUS_03720 17482 18492 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03720 18531 19778 gene locus_tag LOCUS_03730 18531 19778 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_03730 20818 19775 gene locus_tag LOCUS_03740 20818 19775 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence017 <1 600 gene locus_tag LOCUS_03750 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase 788 1603 gene locus_tag LOCUS_03760 788 1603 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_03760 1612 2400 gene locus_tag LOCUS_03770 gene ispE 1612 2400 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_03770 3912 3334 gene locus_tag LOCUS_03780 3912 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4468 3941 gene locus_tag LOCUS_03790 gene yjjX 4468 3941 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261320.1 protein_id gnl|my_center|LOCUS_03790 4860 4603 gene locus_tag LOCUS_03800 4860 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7477 5030 gene locus_tag LOCUS_03810 7477 5030 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_03810 7685 9022 gene locus_tag LOCUS_03820 7685 9022 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_03820 10072 9029 gene locus_tag LOCUS_03830 10072 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11008 10076 gene locus_tag LOCUS_03840 11008 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 11453 12976 gene locus_tag LOCUS_03850 11453 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12993 13820 gene locus_tag LOCUS_03860 gene mutM 12993 13820 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114546.1 protein_id gnl|my_center|LOCUS_03860 13968 13896 gene locus_tag LOCUS_t00030 13968 13896 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15197 14025 gene locus_tag LOCUS_03870 gene hflX 15197 14025 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_03870 15329 16432 gene locus_tag LOCUS_03880 15329 16432 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_03880 16500 17252 gene locus_tag LOCUS_03890 16500 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17249 19585 gene locus_tag LOCUS_03900 17249 19585 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_03900 19601 20329 gene locus_tag LOCUS_03910 19601 20329 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence018 3263 600 gene locus_tag LOCUS_03920 gene alaS 3263 600 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_03920 3353 4336 gene locus_tag LOCUS_03930 3353 4336 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_03930 4391 5377 gene locus_tag LOCUS_03940 4391 5377 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_03940 5512 5856 gene locus_tag LOCUS_03950 5512 5856 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_03950 5860 6966 gene locus_tag LOCUS_03960 gene dprA 5860 6966 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_03960 6966 8078 gene locus_tag LOCUS_03970 6966 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8970 8101 gene locus_tag LOCUS_03980 8970 8101 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_03980 12220 8960 gene locus_tag LOCUS_03990 12220 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12956 12393 gene locus_tag LOCUS_04000 12956 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13737 13000 gene locus_tag LOCUS_04010 13737 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 14554 13766 gene locus_tag LOCUS_04020 14554 13766 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_04020 15434 14628 gene locus_tag LOCUS_04030 15434 14628 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_04030 15459 16559 gene locus_tag LOCUS_04040 15459 16559 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_04040 16632 17291 gene locus_tag LOCUS_04050 16632 17291 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_04050 17288 18322 gene locus_tag LOCUS_04060 17288 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 18300 19082 gene locus_tag LOCUS_04070 18300 19082 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_04070 19079 20500 gene locus_tag LOCUS_04080 19079 20500 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence019 3847 434 gene locus_tag LOCUS_04090 3847 434 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_04090 4961 3849 gene locus_tag LOCUS_04100 4961 3849 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_04100 6360 5020 gene locus_tag LOCUS_04110 6360 5020 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_04110 6967 6353 gene locus_tag LOCUS_04120 6967 6353 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_04120 9796 7673 gene locus_tag LOCUS_04130 9796 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11476 10235 gene locus_tag LOCUS_04140 11476 10235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_04140 11695 12792 gene locus_tag LOCUS_04150 gene queA 11695 12792 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_04150 12825 13496 gene locus_tag LOCUS_04160 12825 13496 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_04160 13725 13504 gene locus_tag LOCUS_04170 13725 13504 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_04170 13946 15601 gene locus_tag LOCUS_04180 gene ettA 13946 15601 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_04180 15668 16039 gene locus_tag LOCUS_04190 15668 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 16118 17170 gene locus_tag LOCUS_04200 16118 17170 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_04200 17151 18728 gene locus_tag LOCUS_04210 17151 18728 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205325.1 protein_id gnl|my_center|LOCUS_04210 18753 19457 gene locus_tag LOCUS_04220 18753 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 19481 20119 gene locus_tag LOCUS_04230 19481 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence020 813 1847 gene locus_tag LOCUS_04240 813 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2020 3291 gene locus_tag LOCUS_04250 2020 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3390 4607 gene locus_tag LOCUS_04260 3390 4607 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140498.1 protein_id gnl|my_center|LOCUS_04260 4612 5934 gene locus_tag LOCUS_04270 4612 5934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_04270 6037 7467 gene locus_tag LOCUS_04280 6037 7467 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_04280 7464 8840 gene locus_tag LOCUS_04290 7464 8840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_04290 8833 10308 gene locus_tag LOCUS_04300 8833 10308 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_04300 10373 11650 gene locus_tag LOCUS_04310 10373 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11647 13005 gene locus_tag LOCUS_04320 11647 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13669 13061 gene locus_tag LOCUS_04330 13669 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14879 13674 gene locus_tag LOCUS_04340 14879 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 17074 14879 gene locus_tag LOCUS_04350 17074 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 18433 17075 gene locus_tag LOCUS_04360 gene fslC 18433 17075 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_04360 19493 18444 gene locus_tag LOCUS_04370 19493 18444 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965488.1 protein_id gnl|my_center|LOCUS_04370 19731 19483 gene locus_tag LOCUS_04380 19731 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence021 172 2451 gene locus_tag LOCUS_04390 172 2451 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_04390 2458 3093 gene locus_tag LOCUS_04400 2458 3093 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_04400 3090 4397 gene locus_tag LOCUS_04410 gene murA 3090 4397 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_04410 4409 4756 gene locus_tag LOCUS_04420 4409 4756 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_04420 4746 5336 gene locus_tag LOCUS_04430 4746 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6203 5364 gene locus_tag LOCUS_04440 6203 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6669 6346 gene locus_tag LOCUS_04450 6669 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6760 6948 gene locus_tag LOCUS_04460 6760 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7627 6926 gene locus_tag LOCUS_04470 7627 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8711 7695 gene locus_tag LOCUS_04480 8711 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9566 8802 gene locus_tag LOCUS_04490 9566 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10158 9715 gene locus_tag LOCUS_04500 10158 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11822 10359 gene locus_tag LOCUS_04510 11822 10359 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_04510 12029 13525 gene locus_tag LOCUS_04520 12029 13525 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_04520 13527 14687 gene locus_tag LOCUS_04530 13527 14687 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_04530 14687 16003 gene locus_tag LOCUS_04540 gene rseP 14687 16003 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_04540 16015 17040 gene locus_tag LOCUS_04550 16015 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_04550 19305 17020 gene locus_tag LOCUS_04560 19305 17020 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_04560 19467 19898 gene locus_tag LOCUS_04570 19467 19898 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_04570 19895 20191 gene locus_tag LOCUS_04580 19895 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence022 2309 690 gene locus_tag LOCUS_04590 2309 690 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_04590 4062 2392 gene locus_tag LOCUS_04600 4062 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4185 4934 gene locus_tag LOCUS_04610 4185 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5079 5600 gene locus_tag LOCUS_04620 5079 5600 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_04620 5581 6099 gene locus_tag LOCUS_04630 5581 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_04630 6096 6635 gene locus_tag LOCUS_04640 6096 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6670 7173 gene locus_tag LOCUS_04650 6670 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 7245 7736 gene locus_tag LOCUS_04660 7245 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7727 8617 gene locus_tag LOCUS_04670 7727 8617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_04670 8617 9420 gene locus_tag LOCUS_04680 8617 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9550 10425 gene locus_tag LOCUS_04690 9550 10425 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_04690 10425 10949 gene locus_tag LOCUS_04700 10425 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 12803 11418 gene locus_tag LOCUS_04710 12803 11418 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_04710 14238 12832 gene locus_tag LOCUS_04720 14238 12832 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_04720 14909 14277 gene locus_tag LOCUS_04730 gene sdaAB 14909 14277 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228158.1 protein_id gnl|my_center|LOCUS_04730 15818 15024 gene locus_tag LOCUS_04740 15818 15024 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_04740 15977 18694 gene locus_tag LOCUS_04750 15977 18694 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037073.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence023 491 796 gene locus_tag LOCUS_04760 gene rpsJ 491 796 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_04760 1005 1607 gene locus_tag LOCUS_04770 gene rplC 1005 1607 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_04770 1612 2244 gene locus_tag LOCUS_04780 gene rplD 1612 2244 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_04780 2241 2528 gene locus_tag LOCUS_04790 gene rplW 2241 2528 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_04790 2543 3367 gene locus_tag LOCUS_04800 gene rplB 2543 3367 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_04800 3367 3645 gene locus_tag LOCUS_04810 gene rpsS 3367 3645 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_04810 3648 4034 gene locus_tag LOCUS_04820 gene rplV 3648 4034 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_04820 4037 4747 gene locus_tag LOCUS_04830 gene rpsC 4037 4747 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_04830 4790 5212 gene locus_tag LOCUS_04840 gene rplP 4790 5212 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_04840 5215 5418 gene locus_tag LOCUS_04850 gene rpmC 5215 5418 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_04850 5418 5672 gene locus_tag LOCUS_04860 gene rpsQ 5418 5672 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_04860 5675 6043 gene locus_tag LOCUS_04870 gene rplN 5675 6043 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_04870 6046 6384 gene locus_tag LOCUS_04880 gene rplX 6046 6384 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_04880 6388 6936 gene locus_tag LOCUS_04890 gene rplE 6388 6936 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_04890 6946 7215 gene locus_tag LOCUS_04900 gene rpsN 6946 7215 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_04900 7383 7715 gene locus_tag LOCUS_04910 gene rpsH 7383 7715 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_04910 7728 8279 gene locus_tag LOCUS_04920 gene rplF 7728 8279 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_04920 8292 8639 gene locus_tag LOCUS_04930 gene rplR 8292 8639 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_04930 8646 9167 gene locus_tag LOCUS_04940 gene rpsE 8646 9167 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_04940 9173 9352 gene locus_tag LOCUS_04950 gene rpmD 9173 9352 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_04950 9352 9804 gene locus_tag LOCUS_04960 gene rplO 9352 9804 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_04960 9806 11128 gene locus_tag LOCUS_04970 gene secY 9806 11128 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_04970 11137 11910 gene locus_tag LOCUS_04980 gene map 11137 11910 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_04980 11912 12130 gene locus_tag LOCUS_04990 gene infA 11912 12130 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_04990 12252 12626 gene locus_tag LOCUS_05000 gene rpsM 12252 12626 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_05000 12643 13035 gene locus_tag LOCUS_05010 gene rpsK 12643 13035 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_05010 13225 13677 gene locus_tag LOCUS_05020 13225 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 13749 14717 gene locus_tag LOCUS_05030 13749 14717 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_05030 14724 15440 gene locus_tag LOCUS_05040 14724 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 15525 16625 gene locus_tag LOCUS_05050 gene carA 15525 16625 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_05050 16630 17907 gene locus_tag LOCUS_05060 gene eno 16630 17907 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_05060 18018 18314 gene locus_tag LOCUS_05070 18018 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 18301 18822 gene locus_tag LOCUS_05080 18301 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 <19766 18829 gene locus_tag LOCUS_05090 <19766 18829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867978.1:Ldh family oxidoreductase >Feature sequence024 1193 417 gene locus_tag LOCUS_05100 gene rpsB 1193 417 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_05100 1650 1264 gene locus_tag LOCUS_05110 gene rpsI 1650 1264 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_05110 2100 1654 gene locus_tag LOCUS_05120 gene rplM 2100 1654 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_05120 2442 5609 gene locus_tag LOCUS_05130 2442 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8349 5689 gene locus_tag LOCUS_05140 gene clpB 8349 5689 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_05140 9662 8517 gene locus_tag LOCUS_05150 9662 8517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_05150 11041 9752 gene locus_tag LOCUS_05160 11041 9752 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_05160 11202 12209 gene locus_tag LOCUS_05170 gene rlmN 11202 12209 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_05170 12270 13220 gene locus_tag LOCUS_05180 12270 13220 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_05180 13196 14653 gene locus_tag LOCUS_05190 13196 14653 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 protein_id gnl|my_center|LOCUS_05190 14738 15046 gene locus_tag LOCUS_05200 14738 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 15157 15705 gene locus_tag LOCUS_05210 15157 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 15803 16717 gene locus_tag LOCUS_05220 15803 16717 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_05220 16714 16989 gene locus_tag LOCUS_05230 16714 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 17012 17085 gene locus_tag LOCUS_t00040 17012 17085 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17219 17133 gene locus_tag LOCUS_t00050 17219 17133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17335 18372 gene locus_tag LOCUS_05240 17335 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 18506 19276 gene locus_tag LOCUS_05250 18506 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence025 <1 859 gene locus_tag LOCUS_05260 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794948.1:alkaline phosphatase 1815 862 gene locus_tag LOCUS_05270 1815 862 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_05270 2556 1885 gene locus_tag LOCUS_05280 2556 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2717 3928 gene locus_tag LOCUS_05290 gene megL 2717 3928 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674490.1 protein_id gnl|my_center|LOCUS_05290 4012 5106 gene locus_tag LOCUS_05300 4012 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9620 5109 gene locus_tag LOCUS_05310 9620 5109 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_05310 9713 10717 gene locus_tag LOCUS_05320 gene tsaD 9713 10717 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_05320 10743 11180 gene locus_tag LOCUS_05330 10743 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11173 11634 gene locus_tag LOCUS_05340 gene smpB 11173 11634 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_05340 11638 12426 gene locus_tag LOCUS_05350 11638 12426 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_05350 12483 12977 gene locus_tag LOCUS_05360 12483 12977 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_05360 13698 13024 gene locus_tag LOCUS_05370 13698 13024 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_05370 14292 13699 gene locus_tag LOCUS_05380 14292 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 14421 16253 gene locus_tag LOCUS_05390 14421 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 16872 16240 gene locus_tag LOCUS_05400 16872 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 17182 16931 gene locus_tag LOCUS_05410 17182 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 18293 17172 gene locus_tag LOCUS_05420 18293 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence026 572 141 gene locus_tag LOCUS_05430 572 141 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_05430 1152 586 gene locus_tag LOCUS_05440 1152 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1876 1235 gene locus_tag LOCUS_05450 1876 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2045 2728 gene locus_tag LOCUS_05460 2045 2728 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476134.1 protein_id gnl|my_center|LOCUS_05460 2729 3100 gene locus_tag LOCUS_05470 gene folB 2729 3100 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_05470 3456 3160 gene locus_tag LOCUS_05480 3456 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3689 3447 gene locus_tag LOCUS_05490 3689 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4199 3891 gene locus_tag LOCUS_05500 4199 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4309 4830 gene locus_tag LOCUS_05510 4309 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_05510 4850 5263 gene locus_tag LOCUS_05520 4850 5263 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_05520 5273 5932 gene locus_tag LOCUS_05530 5273 5932 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_05530 5962 6372 gene locus_tag LOCUS_05540 gene dtd 5962 6372 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_05540 6372 6698 gene locus_tag LOCUS_05550 6372 6698 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_05550 6840 9233 gene locus_tag LOCUS_05560 6840 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 9478 9549 gene locus_tag LOCUS_t00060 9478 9549 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9784 10323 gene locus_tag LOCUS_05570 gene pyrR 9784 10323 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_05570 10323 11240 gene locus_tag LOCUS_05580 10323 11240 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_05580 11476 11237 gene locus_tag LOCUS_05590 11476 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 11707 14496 gene locus_tag LOCUS_05600 11707 14496 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence027 358 149 gene locus_tag LOCUS_05610 358 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2988 370 gene locus_tag LOCUS_05620 2988 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4268 3027 gene locus_tag LOCUS_05630 gene nusA 4268 3027 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_05630 4747 4277 gene locus_tag LOCUS_05640 4747 4277 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826748.1 protein_id gnl|my_center|LOCUS_05640 7920 4855 gene locus_tag LOCUS_05650 gene ccsA 7920 4855 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_05650 9741 8056 gene locus_tag LOCUS_05660 9741 8056 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_05660 10735 9734 gene locus_tag LOCUS_05670 10735 9734 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_05670 12134 10719 gene locus_tag LOCUS_05680 12134 10719 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_05680 14120 12162 gene locus_tag LOCUS_05690 14120 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14959 14126 gene locus_tag LOCUS_05700 14959 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15784 14960 gene locus_tag LOCUS_05710 15784 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 16944 16324 gene locus_tag LOCUS_05720 16944 16324 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_05720 17252 17659 gene locus_tag LOCUS_05730 17252 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence028 693 1265 gene locus_tag LOCUS_05740 gene ruvC 693 1265 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_05740 2632 1271 gene locus_tag LOCUS_05750 gene accC 2632 1271 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_05750 3123 2644 gene locus_tag LOCUS_05760 gene accB 3123 2644 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_05760 3700 3137 gene locus_tag LOCUS_05770 gene efp 3700 3137 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_05770 4983 3985 gene locus_tag LOCUS_05780 4983 3985 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_05780 5893 4994 gene locus_tag LOCUS_05790 gene plsX 5893 4994 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_05790 6130 5945 gene locus_tag LOCUS_05800 gene rpmF 6130 5945 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_05800 6659 6117 gene locus_tag LOCUS_05810 6659 6117 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_05810 7799 6789 gene locus_tag LOCUS_05820 gene pdxA 7799 6789 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_05820 7884 8654 gene locus_tag LOCUS_05830 gene rsmA 7884 8654 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_05830 8654 10015 gene locus_tag LOCUS_05840 gene mgtE 8654 10015 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_05840 10027 10980 gene locus_tag LOCUS_05850 10027 10980 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_05850 11005 11826 gene locus_tag LOCUS_05860 11005 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 12007 12480 gene locus_tag LOCUS_05870 gene greA 12007 12480 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_05870 12486 12878 gene locus_tag LOCUS_05880 12486 12878 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_05880 15822 12892 gene locus_tag LOCUS_05890 15822 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15976 16884 gene locus_tag LOCUS_05900 15976 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence029 644 1504 gene locus_tag LOCUS_05910 644 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1501 2118 gene locus_tag LOCUS_05920 1501 2118 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_05920 2318 2680 gene locus_tag LOCUS_05930 2318 2680 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_05930 2677 5106 gene locus_tag LOCUS_05940 2677 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5180 5758 gene locus_tag LOCUS_05950 5180 5758 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05950 5755 6441 gene locus_tag LOCUS_05960 5755 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6448 7479 gene locus_tag LOCUS_05970 6448 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7759 7505 gene locus_tag LOCUS_05980 7759 7505 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_05980 8247 7765 gene locus_tag LOCUS_05990 8247 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8361 8939 gene locus_tag LOCUS_06000 8361 8939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_06000 8941 9933 gene locus_tag LOCUS_06010 gene paaA 8941 9933 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_06010 9939 10538 gene locus_tag LOCUS_06020 9939 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10550 11290 gene locus_tag LOCUS_06030 gene paaC 10550 11290 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_06030 11362 12345 gene locus_tag LOCUS_06040 11362 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 13267 12350 gene locus_tag LOCUS_06050 13267 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 14768 13260 gene locus_tag LOCUS_06060 14768 13260 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_06060 15499 14771 gene locus_tag LOCUS_06070 15499 14771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_06070 16450 15530 gene locus_tag LOCUS_06080 16450 15530 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_06080 16724 17209 gene locus_tag LOCUS_06090 gene paaJ 16724 17209 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813291.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence030 2160 1120 gene locus_tag LOCUS_06100 gene murG 2160 1120 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_06100 3404 2241 gene locus_tag LOCUS_06110 3404 2241 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061084.1 protein_id gnl|my_center|LOCUS_06110 4749 3388 gene locus_tag LOCUS_06120 gene murD 4749 3388 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_06120 5960 4749 gene locus_tag LOCUS_06130 gene mraY 5960 4749 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_06130 7425 5962 gene locus_tag LOCUS_06140 7425 5962 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_06140 9515 7425 gene locus_tag LOCUS_06150 9515 7425 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_06150 9874 9512 gene locus_tag LOCUS_06160 9874 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10802 9867 gene locus_tag LOCUS_06170 gene rsmH 10802 9867 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_06170 11241 10792 gene locus_tag LOCUS_06180 gene mraZ 11241 10792 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_06180 12412 11438 gene locus_tag LOCUS_06190 12412 11438 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_06190 12572 13354 gene locus_tag LOCUS_06200 12572 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 13351 15348 gene locus_tag LOCUS_06210 13351 15348 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_06210 15365 16066 gene locus_tag LOCUS_06220 15365 16066 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_06220 17047 16115 gene locus_tag LOCUS_06230 17047 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence031 2 1201 gene locus_tag LOCUS_06240 2 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2192 1242 gene locus_tag LOCUS_06250 2192 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3770 2202 gene locus_tag LOCUS_06260 3770 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4708 3857 gene locus_tag LOCUS_06270 4708 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5795 4794 gene locus_tag LOCUS_06280 5795 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 6997 6041 gene locus_tag LOCUS_06290 6997 6041 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_06290 7889 7107 gene locus_tag LOCUS_06300 7889 7107 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06300 9005 7911 gene locus_tag LOCUS_06310 9005 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 10701 8989 gene locus_tag LOCUS_06320 10701 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10682 11851 gene locus_tag LOCUS_06330 gene hemW 10682 11851 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_06330 11848 12597 gene locus_tag LOCUS_06340 11848 12597 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_06340 12764 13105 gene locus_tag LOCUS_06350 12764 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 14228 13515 gene locus_tag LOCUS_06360 14228 13515 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_06360 15272 14232 gene locus_tag LOCUS_06370 15272 14232 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_06370 15593 15333 gene locus_tag LOCUS_06380 15593 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 <17214 15632 gene locus_tag LOCUS_06390 <17214 15632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788190.1:excinuclease ABC subunit UvrA >Feature sequence032 442 1809 gene locus_tag LOCUS_06400 442 1809 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_06400 2949 1813 gene locus_tag LOCUS_06410 2949 1813 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115005.1 protein_id gnl|my_center|LOCUS_06410 3406 2939 gene locus_tag LOCUS_06420 3406 2939 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972483.1 protein_id gnl|my_center|LOCUS_06420 3478 4251 gene locus_tag LOCUS_06430 3478 4251 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_06430 5333 4299 gene locus_tag LOCUS_06440 5333 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5495 5926 gene locus_tag LOCUS_06450 5495 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5947 6576 gene locus_tag LOCUS_06460 5947 6576 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_06460 6657 7901 gene locus_tag LOCUS_06470 6657 7901 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_06470 7898 8830 gene locus_tag LOCUS_06480 gene rsgA 7898 8830 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_06480 9661 9239 gene locus_tag LOCUS_06490 9661 9239 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_06490 9911 10573 gene locus_tag LOCUS_06500 9911 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10558 11403 gene locus_tag LOCUS_06510 10558 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 12591 12187 gene locus_tag LOCUS_tm00010 12591 12187 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13211 12669 gene locus_tag LOCUS_06520 13211 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 14061 13246 gene locus_tag LOCUS_06530 gene panB 14061 13246 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_06530 14582 14067 gene locus_tag LOCUS_06540 14582 14067 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_06540 15691 14624 gene locus_tag LOCUS_06550 15691 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 16245 15691 gene locus_tag LOCUS_06560 16245 15691 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence033 2819 330 gene locus_tag LOCUS_06570 2819 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_06570 4283 2934 gene locus_tag LOCUS_06580 4283 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7469 4308 gene locus_tag LOCUS_06590 7469 4308 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_06590 8760 7717 gene locus_tag LOCUS_06600 8760 7717 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_06600 9463 8831 gene locus_tag LOCUS_06610 9463 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 9800 12949 gene locus_tag LOCUS_06620 9800 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 13113 13039 gene locus_tag LOCUS_t00070 13113 13039 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13218 13625 gene locus_tag LOCUS_06630 13218 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 14674 13823 gene locus_tag LOCUS_06640 14674 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 15916 14684 gene locus_tag LOCUS_06650 15916 14684 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence034 2405 1566 gene locus_tag LOCUS_06660 gene accD 2405 1566 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_06660 2846 2493 gene locus_tag LOCUS_06670 gene rplS 2846 2493 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_06670 2876 3094 gene locus_tag LOCUS_06680 2876 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4497 3100 gene locus_tag LOCUS_06690 4497 3100 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838467.1 protein_id gnl|my_center|LOCUS_06690 5483 4581 gene locus_tag LOCUS_06700 gene rfbD 5483 4581 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_06700 6310 5480 gene locus_tag LOCUS_06710 6310 5480 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_06710 6923 6318 gene locus_tag LOCUS_06720 6923 6318 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_06720 8053 6920 gene locus_tag LOCUS_06730 8053 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014770990.1 protein_id gnl|my_center|LOCUS_06730 9246 8056 gene locus_tag LOCUS_06740 9246 8056 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_06740 10767 9295 gene locus_tag LOCUS_06750 gene cls 10767 9295 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435010.1 protein_id gnl|my_center|LOCUS_06750 11247 10822 gene locus_tag LOCUS_06760 11247 10822 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_06760 11317 12045 gene locus_tag LOCUS_06770 11317 12045 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_06770 12067 13032 gene locus_tag LOCUS_06780 12067 13032 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_06780 13868 13029 gene locus_tag LOCUS_06790 gene prmA 13868 13029 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_06790 14197 13868 gene locus_tag LOCUS_06800 14197 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 14958 14194 gene locus_tag LOCUS_06810 gene tpiA 14958 14194 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_06810 15543 15034 gene locus_tag LOCUS_06820 15543 15034 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463686.1 protein_id gnl|my_center|LOCUS_06820 15628 16602 gene locus_tag LOCUS_06830 15628 16602 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence035 538 254 gene locus_tag LOCUS_06840 538 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 660 585 gene locus_tag LOCUS_t00080 660 585 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 827 3268 gene locus_tag LOCUS_06850 827 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5584 3617 gene locus_tag LOCUS_06860 5584 3617 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_06860 7185 5734 gene locus_tag LOCUS_06870 7185 5734 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_06870 8000 7188 gene locus_tag LOCUS_06880 8000 7188 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_06880 8110 8625 gene locus_tag LOCUS_06890 8110 8625 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_06890 8622 9644 gene locus_tag LOCUS_06900 8622 9644 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_06900 9758 11059 gene locus_tag LOCUS_06910 gene kynU 9758 11059 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_06910 11056 12393 gene locus_tag LOCUS_06920 11056 12393 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_06920 12523 15084 gene locus_tag LOCUS_06930 12523 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 <16483 15086 gene locus_tag LOCUS_06940 <16483 15086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802904.1:transporter substrate-binding domain-containing protein >Feature sequence036 1938 1213 gene locus_tag LOCUS_06950 1938 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2669 2319 gene locus_tag LOCUS_06960 2669 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5362 2771 gene locus_tag LOCUS_06970 5362 2771 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055271316.1 protein_id gnl|my_center|LOCUS_06970 6044 5466 gene locus_tag LOCUS_06980 gene nadD 6044 5466 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_06980 6625 6050 gene locus_tag LOCUS_06990 gene gmk 6625 6050 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_06990 6906 6625 gene locus_tag LOCUS_07000 6906 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7484 6915 gene locus_tag LOCUS_07010 7484 6915 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_07010 7814 8503 gene locus_tag LOCUS_07020 7814 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 8955 8500 gene locus_tag LOCUS_07030 8955 8500 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_07030 10265 9093 gene locus_tag LOCUS_07040 10265 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11215 10310 gene locus_tag LOCUS_07050 11215 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 11390 11641 gene locus_tag LOCUS_07060 gene rpsT 11390 11641 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_07060 12000 12695 gene locus_tag LOCUS_07070 gene radC 12000 12695 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_07070 12692 13285 gene locus_tag LOCUS_07080 12692 13285 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_07080 13361 15778 gene locus_tag LOCUS_07090 gene pheT 13361 15778 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_07090 15782 16078 gene locus_tag LOCUS_07100 15782 16078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 16103 16387 gene locus_tag LOCUS_07110 16103 16387 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence037 1000 191 gene locus_tag LOCUS_07120 1000 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2027 1002 gene locus_tag LOCUS_07130 2027 1002 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_07130 3667 2144 gene locus_tag LOCUS_07140 gene purH 3667 2144 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_07140 4312 3734 gene locus_tag LOCUS_07150 gene purN 4312 3734 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_07150 5178 4309 gene locus_tag LOCUS_07160 5178 4309 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_07160 5491 5159 gene locus_tag LOCUS_07170 5491 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 5955 5521 gene locus_tag LOCUS_07180 5955 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07180 6083 7147 gene locus_tag LOCUS_07190 6083 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7313 8365 gene locus_tag LOCUS_07200 7313 8365 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_07200 8822 13573 gene locus_tag LOCUS_07210 8822 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13591 14241 gene locus_tag LOCUS_07220 13591 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14287 15177 gene locus_tag LOCUS_07230 gene cas1 14287 15177 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_07230 15174 15515 gene locus_tag LOCUS_07240 gene cas2 15174 15515 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_07240 15622 >15847 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatatcgttcattctcttttgtaatcaaaccacaac >Feature sequence038 712 1083 gene locus_tag LOCUS_07250 712 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1510 1091 gene locus_tag LOCUS_07260 1510 1091 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_07260 3258 1912 gene locus_tag LOCUS_07270 3258 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4395 3325 gene locus_tag LOCUS_07280 gene prfA 4395 3325 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_07280 5084 4560 gene locus_tag LOCUS_07290 5084 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 5742 5098 gene locus_tag LOCUS_07300 gene plsY 5742 5098 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_07300 5983 10824 gene locus_tag LOCUS_07310 5983 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 11568 11041 gene locus_tag LOCUS_07320 11568 11041 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_07320 11809 11618 gene locus_tag LOCUS_07330 11809 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 14094 11815 gene locus_tag LOCUS_07340 14094 11815 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_07340 14349 14561 gene locus_tag LOCUS_07350 14349 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 14643 15266 gene locus_tag LOCUS_07360 14643 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence039 1993 800 gene locus_tag LOCUS_07370 1993 800 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_07370 2141 2428 gene locus_tag LOCUS_07380 2141 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5235 2479 gene locus_tag LOCUS_07390 5235 2479 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_07390 5524 7278 gene locus_tag LOCUS_07400 5524 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7402 8517 gene locus_tag LOCUS_07410 7402 8517 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_07410 9276 8725 gene locus_tag LOCUS_07420 9276 8725 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_07420 9498 9424 gene locus_tag LOCUS_t00090 9498 9424 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9787 9712 gene locus_tag LOCUS_t00100 9787 9712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9988 9897 gene locus_tag LOCUS_t00110 9988 9897 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10132 10884 gene locus_tag LOCUS_07430 10132 10884 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108120.1 protein_id gnl|my_center|LOCUS_07430 10897 12711 gene locus_tag LOCUS_07440 10897 12711 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_07440 14836 13118 gene locus_tag LOCUS_07450 14836 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14972 15454 gene locus_tag LOCUS_07460 14972 15454 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_07460 15630 15484 gene locus_tag LOCUS_07470 15630 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence040 3 1259 gene locus_tag LOCUS_07480 3 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1457 3121 gene locus_tag LOCUS_07490 gene rho 1457 3121 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_07490 4440 3118 gene locus_tag LOCUS_07500 gene argH 4440 3118 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_07500 5518 4424 gene locus_tag LOCUS_07510 5518 4424 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_07510 6288 5515 gene locus_tag LOCUS_07520 gene argB 6288 5515 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_07520 7237 6275 gene locus_tag LOCUS_07530 7237 6275 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_07530 8384 7251 gene locus_tag LOCUS_07540 8384 7251 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_07540 9187 8381 gene locus_tag LOCUS_07550 gene proC 9187 8381 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_07550 10170 9196 gene locus_tag LOCUS_07560 gene argC 10170 9196 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_07560 11359 10157 gene locus_tag LOCUS_07570 11359 10157 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_07570 11963 11346 gene locus_tag LOCUS_07580 11963 11346 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_07580 13216 12329 gene locus_tag LOCUS_07590 13216 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13366 13950 gene locus_tag LOCUS_07600 13366 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 13937 14689 gene locus_tag LOCUS_07610 13937 14689 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence041 <1 1379 gene locus_tag LOCUS_07620 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765859.1:heavy metal translocating P-type ATPase 1512 2348 gene locus_tag LOCUS_07630 1512 2348 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258363.1 protein_id gnl|my_center|LOCUS_07630 2406 4508 gene locus_tag LOCUS_07640 gene pta 2406 4508 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_07640 4505 5713 gene locus_tag LOCUS_07650 4505 5713 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_07650 5736 6476 gene locus_tag LOCUS_07660 5736 6476 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_07660 7473 6526 gene locus_tag LOCUS_07670 gene trxB 7473 6526 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_07670 8403 7534 gene locus_tag LOCUS_07680 8403 7534 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_07680 10485 8554 gene locus_tag LOCUS_07690 10485 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 10970 10485 gene locus_tag LOCUS_07700 10970 10485 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_07700 11826 10960 gene locus_tag LOCUS_07710 11826 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12223 11864 gene locus_tag LOCUS_07720 12223 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12837 12220 gene locus_tag LOCUS_07730 12837 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15097 12968 gene locus_tag LOCUS_07740 gene pnp 15097 12968 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence042 4037 3444 gene locus_tag LOCUS_07750 gene ruvA 4037 3444 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_07750 6343 4034 gene locus_tag LOCUS_07760 6343 4034 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_07760 7374 6409 gene locus_tag LOCUS_07770 7374 6409 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_07770 8901 7561 gene locus_tag LOCUS_07780 8901 7561 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_07780 9358 9155 gene locus_tag LOCUS_07790 9358 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 10609 9431 gene locus_tag LOCUS_07800 10609 9431 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_07800 11390 10620 gene locus_tag LOCUS_07810 11390 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 13134 11365 gene locus_tag LOCUS_07820 13134 11365 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_07820 13625 13182 gene locus_tag LOCUS_07830 gene dut 13625 13182 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_07830 15116 13632 gene locus_tag LOCUS_07840 15116 13632 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence043 96 695 gene locus_tag LOCUS_07850 96 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 688 1293 gene locus_tag LOCUS_07860 688 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2124 1390 gene locus_tag LOCUS_07870 2124 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5068 2258 gene locus_tag LOCUS_07880 5068 2258 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_07880 6662 5364 gene locus_tag LOCUS_07890 6662 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7515 6925 gene locus_tag LOCUS_07900 gene hisIE 7515 6925 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706033.1 protein_id gnl|my_center|LOCUS_07900 8256 7528 gene locus_tag LOCUS_07910 gene hisF 8256 7528 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_07910 8990 8277 gene locus_tag LOCUS_07920 gene hisA 8990 8277 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_07920 9574 8987 gene locus_tag LOCUS_07930 gene hisH 9574 8987 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_07930 10659 9571 gene locus_tag LOCUS_07940 gene hisB 10659 9571 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_07940 11686 10661 gene locus_tag LOCUS_07950 gene hisC 11686 10661 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_07950 12968 11679 gene locus_tag LOCUS_07960 gene hisD 12968 11679 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_07960 13825 12968 gene locus_tag LOCUS_07970 gene hisG 13825 12968 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_07970 <15182 14133 gene locus_tag LOCUS_07980 <15182 14133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918869.1:M14 family metallopeptidase >Feature sequence044 2894 1530 gene locus_tag LOCUS_07990 2894 1530 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_07990 3097 3561 gene locus_tag LOCUS_08000 3097 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3699 4118 gene locus_tag LOCUS_08010 3699 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4566 4129 gene locus_tag LOCUS_08020 4566 4129 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_08020 5510 4707 gene locus_tag LOCUS_08030 5510 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6710 5595 gene locus_tag LOCUS_08040 6710 5595 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_08040 9511 6722 gene locus_tag LOCUS_08050 9511 6722 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_08050 9683 10876 gene locus_tag LOCUS_08060 9683 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11905 10877 gene locus_tag LOCUS_08070 11905 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13806 11902 gene locus_tag LOCUS_08080 13806 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 14171 14046 gene locus_tag LOCUS_08090 14171 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 14326 14571 gene locus_tag LOCUS_08100 14326 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence045 3224 2838 gene locus_tag LOCUS_08110 gene rplL 3224 2838 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_08110 3793 3257 gene locus_tag LOCUS_08120 gene rplJ 3793 3257 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_08120 4494 3796 gene locus_tag LOCUS_08130 gene rplA 4494 3796 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_08130 4950 4504 gene locus_tag LOCUS_08140 gene rplK 4950 4504 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_08140 5517 4963 gene locus_tag LOCUS_08150 gene nusG 5517 4963 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_08150 5721 5530 gene locus_tag LOCUS_08160 gene secE 5721 5530 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_08160 5817 5744 gene locus_tag LOCUS_t00120 5817 5744 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7117 5930 gene locus_tag LOCUS_08170 gene tuf 7117 5930 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_08170 7296 7224 gene locus_tag LOCUS_t00130 7296 7224 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7417 7344 gene locus_tag LOCUS_t00140 7417 7344 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7575 7492 gene locus_tag LOCUS_t00150 7575 7492 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9812 7734 gene locus_tag LOCUS_08180 9812 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12514 9812 gene locus_tag LOCUS_08190 12514 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 14923 12638 gene locus_tag LOCUS_08200 14923 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence046 2142 631 gene locus_tag LOCUS_08210 2142 631 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_08210 3179 2199 gene locus_tag LOCUS_08220 3179 2199 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_08220 4485 3172 gene locus_tag LOCUS_08230 4485 3172 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_08230 4789 6405 gene locus_tag LOCUS_08240 gene nrfD 4789 6405 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_08240 6466 9336 gene locus_tag LOCUS_08250 6466 9336 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_08250 9356 11134 gene locus_tag LOCUS_08260 9356 11134 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_08260 11134 11442 gene locus_tag LOCUS_08270 11134 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11463 12038 gene locus_tag LOCUS_08280 11463 12038 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_08280 12069 12458 gene locus_tag LOCUS_08290 12069 12458 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_08290 13043 12483 gene locus_tag LOCUS_08300 13043 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13417 13052 gene locus_tag LOCUS_08310 13417 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 13622 14599 gene locus_tag LOCUS_08320 13622 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence047 955 2067 gene locus_tag LOCUS_08330 955 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2058 3464 gene locus_tag LOCUS_08340 gene fucP 2058 3464 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_08340 3461 4423 gene locus_tag LOCUS_08350 3461 4423 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_08350 4733 4434 gene locus_tag LOCUS_08360 4733 4434 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_08360 4981 4730 gene locus_tag LOCUS_08370 4981 4730 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_08370 6280 5219 gene locus_tag LOCUS_08380 6280 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6413 8032 gene locus_tag LOCUS_08390 6413 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537094.1 protein_id gnl|my_center|LOCUS_08390 8204 8392 gene locus_tag LOCUS_08400 8204 8392 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_08400 9339 8440 gene locus_tag LOCUS_08410 9339 8440 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_08410 10268 9336 gene locus_tag LOCUS_08420 10268 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 11294 10272 gene locus_tag LOCUS_08430 11294 10272 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_08430 11326 12240 gene locus_tag LOCUS_08440 11326 12240 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_08440 12294 13949 gene locus_tag LOCUS_08450 12294 13949 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence048 1430 237 gene locus_tag LOCUS_08460 1430 237 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_08460 1477 2499 gene locus_tag LOCUS_08470 1477 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3342 2761 gene locus_tag LOCUS_08480 3342 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4308 3412 gene locus_tag LOCUS_08490 4308 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4584 4336 gene locus_tag LOCUS_08500 4584 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6655 4907 gene locus_tag LOCUS_08510 6655 4907 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_08510 9569 7032 gene locus_tag LOCUS_08520 9569 7032 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_08520 10279 9659 gene locus_tag LOCUS_08530 10279 9659 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_08530 10908 10279 gene locus_tag LOCUS_08540 10908 10279 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_08540 11099 12148 gene locus_tag LOCUS_08550 gene mltG 11099 12148 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_08550 12152 12574 gene locus_tag LOCUS_08560 12152 12574 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_08560 12555 13523 gene locus_tag LOCUS_08570 12555 13523 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_08570 13585 13670 gene locus_tag LOCUS_t00160 13585 13670 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 942 460 gene locus_tag LOCUS_08580 942 460 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_08580 1132 1515 gene locus_tag LOCUS_08590 1132 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1555 1854 gene locus_tag LOCUS_08600 1555 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2847 1891 gene locus_tag LOCUS_08610 gene metF 2847 1891 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_08610 3286 2864 gene locus_tag LOCUS_08620 3286 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 5531 3315 gene locus_tag LOCUS_08630 5531 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08630 6535 5528 gene locus_tag LOCUS_08640 6535 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08640 6841 8739 gene locus_tag LOCUS_08650 6841 8739 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_08650 8740 9717 gene locus_tag LOCUS_08660 gene astE 8740 9717 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368506.1 protein_id gnl|my_center|LOCUS_08660 9754 10161 gene locus_tag LOCUS_08670 9754 10161 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_08670 10124 10807 gene locus_tag LOCUS_08680 gene folE 10124 10807 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_08680 10946 13159 gene locus_tag LOCUS_08690 10946 13159 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_08690 13233 13658 gene locus_tag LOCUS_08700 13233 13658 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008612795.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence050 <1 649 gene locus_tag LOCUS_08710 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682348.1:NAD(P)-dependent oxidoreductase 2831 699 gene locus_tag LOCUS_08720 2831 699 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_08720 3563 3009 gene locus_tag LOCUS_08730 3563 3009 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_08730 3647 4369 gene locus_tag LOCUS_08740 3647 4369 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_08740 5435 4341 gene locus_tag LOCUS_08750 5435 4341 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766782.1 protein_id gnl|my_center|LOCUS_08750 5504 6706 gene locus_tag LOCUS_08760 5504 6706 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_08760 6920 9976 gene locus_tag LOCUS_08770 6920 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9989 11449 gene locus_tag LOCUS_08780 9989 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence051 141 434 gene locus_tag LOCUS_08790 141 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 740 1129 gene locus_tag LOCUS_08800 740 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2141 1158 gene locus_tag LOCUS_08810 2141 1158 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_08810 2245 2913 gene locus_tag LOCUS_08820 2245 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5355 2950 gene locus_tag LOCUS_08830 5355 2950 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_08830 5657 6769 gene locus_tag LOCUS_08840 gene ald 5657 6769 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_08840 7278 6820 gene locus_tag LOCUS_08850 7278 6820 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_08850 7359 8132 gene locus_tag LOCUS_08860 7359 8132 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_08860 9468 8146 gene locus_tag LOCUS_08870 9468 8146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_08870 9989 9528 gene locus_tag LOCUS_08880 9989 9528 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_08880 10510 9989 gene locus_tag LOCUS_08890 10510 9989 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_08890 10895 10560 gene locus_tag LOCUS_08900 10895 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 11757 10927 gene locus_tag LOCUS_08910 11757 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11934 11846 gene locus_tag LOCUS_t00170 11934 11846 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13123 12029 gene locus_tag LOCUS_08920 13123 12029 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_08920 <13897 13116 gene locus_tag LOCUS_08930 <13897 13116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478755.1:TatD family hydrolase >Feature sequence052 1832 201 gene locus_tag LOCUS_08940 gene pruA 1832 201 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_08940 2624 1929 gene locus_tag LOCUS_08950 2624 1929 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_08950 2992 2624 gene locus_tag LOCUS_08960 2992 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3083 3718 gene locus_tag LOCUS_08970 3083 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4043 4354 gene locus_tag LOCUS_08980 4043 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4358 4945 gene locus_tag LOCUS_08990 4358 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5147 4986 gene locus_tag LOCUS_09000 5147 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7115 6252 gene locus_tag LOCUS_09010 7115 6252 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_09010 7907 7257 gene locus_tag LOCUS_09020 7907 7257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698413.1 protein_id gnl|my_center|LOCUS_09020 10189 7904 gene locus_tag LOCUS_09030 10189 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10353 12545 gene locus_tag LOCUS_09040 10353 12545 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_09040 12885 12631 gene locus_tag LOCUS_09050 12885 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13119 12898 gene locus_tag LOCUS_09060 13119 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence053 <1 717 gene locus_tag LOCUS_09070 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963835.1:acetyl-CoA C-acyltransferase 732 2522 gene locus_tag LOCUS_09080 732 2522 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_09080 2551 2733 gene locus_tag LOCUS_09090 2551 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3350 3048 gene locus_tag LOCUS_09100 3350 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3405 3331 gene locus_tag LOCUS_t00180 3405 3331 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3512 4240 gene locus_tag LOCUS_09110 3512 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4306 5883 gene locus_tag LOCUS_09120 4306 5883 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_09120 5887 6609 gene locus_tag LOCUS_09130 5887 6609 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09130 6631 7659 gene locus_tag LOCUS_09140 6631 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7659 8297 gene locus_tag LOCUS_09150 7659 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9091 8306 gene locus_tag LOCUS_09160 9091 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9295 9918 gene locus_tag LOCUS_09170 9295 9918 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_09170 10077 10280 gene locus_tag LOCUS_09180 10077 10280 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_09180 10667 10416 gene locus_tag LOCUS_09190 10667 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12178 10670 gene locus_tag LOCUS_09200 gene atpD 12178 10670 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_09200 <13428 12373 gene locus_tag LOCUS_09210 <13428 12373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054367.1:amidohydrolase family protein >Feature sequence054 2982 2437 gene locus_tag LOCUS_09220 2982 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3572 2949 gene locus_tag LOCUS_09230 gene pnuC 3572 2949 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_09230 4581 4021 gene locus_tag LOCUS_09240 gene frr 4581 4021 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_09240 5302 4598 gene locus_tag LOCUS_09250 gene pyrH 5302 4598 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_09250 5876 5379 gene locus_tag LOCUS_09260 5876 5379 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_09260 6928 5915 gene locus_tag LOCUS_09270 gene fbp 6928 5915 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_09270 7055 8317 gene locus_tag LOCUS_09280 7055 8317 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_09280 9191 8310 gene locus_tag LOCUS_09290 gene cdaA 9191 8310 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_09290 10041 9175 gene locus_tag LOCUS_09300 gene folP 10041 9175 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_09300 10078 10632 gene locus_tag LOCUS_09310 10078 10632 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_09310 10619 11728 gene locus_tag LOCUS_09320 10619 11728 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_09320 12870 11797 gene locus_tag LOCUS_09330 12870 11797 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence055 447 1373 gene locus_tag LOCUS_09340 447 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2070 1360 gene locus_tag LOCUS_09350 2070 1360 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_09350 2491 2054 gene locus_tag LOCUS_09360 2491 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2617 3921 gene locus_tag LOCUS_09370 gene rimO 2617 3921 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_09370 3943 5490 gene locus_tag LOCUS_09380 gene bshC 3943 5490 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_09380 6422 5955 gene locus_tag LOCUS_09390 6422 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7398 6724 gene locus_tag LOCUS_09400 gene mnmD 7398 6724 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_09400 7501 8307 gene locus_tag LOCUS_09410 gene bamD 7501 8307 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_09410 8311 8634 gene locus_tag LOCUS_09420 8311 8634 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_09420 8648 9847 gene locus_tag LOCUS_09430 gene coaBC 8648 9847 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_09430 9840 10730 gene locus_tag LOCUS_09440 9840 10730 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_09440 10800 12452 gene locus_tag LOCUS_09450 gene recN 10800 12452 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence056 1911 1063 gene locus_tag LOCUS_09460 1911 1063 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_09460 2728 2297 gene locus_tag LOCUS_09470 2728 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4004 2913 gene locus_tag LOCUS_09480 4004 2913 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_09480 5459 4191 gene locus_tag LOCUS_09490 gene ilvA 5459 4191 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_09490 6502 5456 gene locus_tag LOCUS_09500 gene ilvC 6502 5456 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_09500 7087 6521 gene locus_tag LOCUS_09510 gene ilvN 7087 6521 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_09510 8841 7099 gene locus_tag LOCUS_09520 gene ilvB 8841 7099 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_09520 10507 8834 gene locus_tag LOCUS_09530 gene ilvD 10507 8834 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_09530 11445 10552 gene locus_tag LOCUS_09540 11445 10552 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_09540 12535 11462 gene locus_tag LOCUS_09550 gene leuB 12535 11462 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence057 1036 44 gene locus_tag LOCUS_09560 1036 44 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_09560 2310 1036 gene locus_tag LOCUS_09570 2310 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2983 2303 gene locus_tag LOCUS_09580 2983 2303 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801447.1 protein_id gnl|my_center|LOCUS_09580 3932 2970 gene locus_tag LOCUS_09590 3932 2970 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_09590 3969 4805 gene locus_tag LOCUS_09600 3969 4805 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_09600 4886 4959 gene locus_tag LOCUS_t00190 4886 4959 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5051 5125 gene locus_tag LOCUS_t00200 5051 5125 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5770 6018 gene locus_tag LOCUS_09610 5770 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6032 6274 gene locus_tag LOCUS_09620 6032 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6377 7537 gene locus_tag LOCUS_09630 6377 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 10012 7541 gene locus_tag LOCUS_09640 10012 7541 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_09640 10712 10101 gene locus_tag LOCUS_09650 10712 10101 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_09650 11402 10716 gene locus_tag LOCUS_09660 11402 10716 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_09660 <12948 11402 gene locus_tag LOCUS_09670 <12948 11402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091514757.1:DNA gyrase/topoisomerase IV subunit A >Feature sequence058 1190 489 gene locus_tag LOCUS_09680 1190 489 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_09680 1389 1814 gene locus_tag LOCUS_09690 1389 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_09690 1807 3843 gene locus_tag LOCUS_09700 1807 3843 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09700 3908 5095 gene locus_tag LOCUS_09710 3908 5095 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_09710 7198 5105 gene locus_tag LOCUS_09720 7198 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7567 9405 gene locus_tag LOCUS_09730 7567 9405 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_09730 9407 10426 gene locus_tag LOCUS_09740 9407 10426 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_09740 10431 10781 gene locus_tag LOCUS_09750 10431 10781 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760952.1 protein_id gnl|my_center|LOCUS_09750 10772 11347 gene locus_tag LOCUS_09760 10772 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11344 11805 gene locus_tag LOCUS_09770 11344 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11805 12938 gene locus_tag LOCUS_09780 11805 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 >Feature sequence059 46 504 gene locus_tag LOCUS_09790 46 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 773 1387 gene locus_tag LOCUS_09800 773 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1725 1651 gene locus_tag LOCUS_t00210 1725 1651 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3137 1854 gene locus_tag LOCUS_09810 3137 1854 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_09810 3438 3827 gene locus_tag LOCUS_09820 3438 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4444 5847 gene locus_tag LOCUS_09830 4444 5847 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_09830 6707 8251 gene locus_tag LOCUS_09840 6707 8251 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_09840 8363 8782 gene locus_tag LOCUS_09850 8363 8782 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_09850 10217 8787 gene locus_tag LOCUS_09860 10217 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 11154 10276 gene locus_tag LOCUS_09870 11154 10276 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_09870 11206 12465 gene locus_tag LOCUS_09880 11206 12465 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence060 <1 2758 gene locus_tag LOCUS_09890 <1 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814911.1:phosphoribosylformylglycinamidine synthase 3065 2760 gene locus_tag LOCUS_09900 3065 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3385 4137 gene locus_tag LOCUS_09910 3385 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence061 146 301 gene locus_tag LOCUS_09920 146 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 298 639 gene locus_tag LOCUS_09930 298 639 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_09930 923 2185 gene locus_tag LOCUS_09940 923 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2220 2924 gene locus_tag LOCUS_09950 2220 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2908 3537 gene locus_tag LOCUS_09960 2908 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5110 3566 gene locus_tag LOCUS_09970 5110 3566 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_09970 5066 5326 gene locus_tag LOCUS_09980 5066 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7269 5332 gene locus_tag LOCUS_09990 7269 5332 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_09990 8694 7438 gene locus_tag LOCUS_10000 8694 7438 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_10000 9079 8708 gene locus_tag LOCUS_10010 9079 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9198 9428 gene locus_tag LOCUS_10020 9198 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 9447 9986 gene locus_tag LOCUS_10030 9447 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 10171 11223 gene locus_tag LOCUS_10040 10171 11223 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_10040 12129 12398 gene locus_tag LOCUS_10050 12129 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence062 645 3014 gene locus_tag LOCUS_10060 645 3014 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_10060 5101 3017 gene locus_tag LOCUS_10070 5101 3017 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_10070 5197 5784 gene locus_tag LOCUS_10080 gene lpxF 5197 5784 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_10080 6359 5781 gene locus_tag LOCUS_10090 6359 5781 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_10090 7152 6421 gene locus_tag LOCUS_10100 7152 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 7386 8057 gene locus_tag LOCUS_10110 7386 8057 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_10110 8158 9672 gene locus_tag LOCUS_10120 8158 9672 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_10120 10049 9669 gene locus_tag LOCUS_10130 gene crcB 10049 9669 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_10130 10494 10057 gene locus_tag LOCUS_10140 10494 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 11078 10491 gene locus_tag LOCUS_10150 11078 10491 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_10150 11986 11075 gene locus_tag LOCUS_10160 11986 11075 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence063 821 75 gene locus_tag LOCUS_10170 821 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2208 919 gene locus_tag LOCUS_10180 2208 919 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_10180 2417 3805 gene locus_tag LOCUS_10190 2417 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3881 4099 gene locus_tag LOCUS_10200 3881 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4755 4096 gene locus_tag LOCUS_10210 4755 4096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_10210 6802 4724 gene locus_tag LOCUS_10220 6802 4724 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_10220 7052 9037 gene locus_tag LOCUS_10230 7052 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9540 9193 gene locus_tag LOCUS_10240 9540 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 9632 10483 gene locus_tag LOCUS_10250 gene prmC 9632 10483 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_10250 10547 11932 gene locus_tag LOCUS_10260 10547 11932 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence064 <1 512 gene locus_tag LOCUS_10270 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080503.1:NADP-specific glutamate dehydrogenase 579 1679 gene locus_tag LOCUS_10280 579 1679 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_10280 1780 5055 gene locus_tag LOCUS_10290 1780 5055 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_10290 5077 5478 gene locus_tag LOCUS_10300 5077 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5478 5888 gene locus_tag LOCUS_10310 gene ybeY 5478 5888 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_10310 5965 7827 gene locus_tag LOCUS_10320 gene mnmG 5965 7827 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_10320 7832 8722 gene locus_tag LOCUS_10330 7832 8722 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_10330 8658 10412 gene locus_tag LOCUS_10340 8658 10412 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_10340 10527 10730 gene locus_tag LOCUS_10350 10527 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence065 <1 2058 gene locus_tag LOCUS_10360 <1 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase 2071 5067 gene locus_tag LOCUS_10370 2071 5067 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838102.1 protein_id gnl|my_center|LOCUS_10370 5067 6656 gene locus_tag LOCUS_10380 5067 6656 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_10380 6728 8275 gene locus_tag LOCUS_10390 6728 8275 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_10390 8412 9479 gene locus_tag LOCUS_10400 gene fbaA 8412 9479 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_10400 11706 9592 gene locus_tag LOCUS_10410 11706 9592 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046743078.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence066 1299 223 gene locus_tag LOCUS_10420 1299 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1935 1321 gene locus_tag LOCUS_10430 1935 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2323 3879 gene locus_tag LOCUS_10440 gene dnaB 2323 3879 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_10440 3911 4783 gene locus_tag LOCUS_10450 3911 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4877 6262 gene locus_tag LOCUS_10460 4877 6262 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_10460 6259 6978 gene locus_tag LOCUS_10470 gene ric 6259 6978 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_10470 7023 8015 gene locus_tag LOCUS_10480 7023 8015 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 protein_id gnl|my_center|LOCUS_10480 9126 8254 gene locus_tag LOCUS_10490 9126 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 9289 10059 gene locus_tag LOCUS_10500 9289 10059 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082209.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence067 5476 7116 gene locus_tag LOCUS_10510 5476 7116 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_10510 7131 8933 gene locus_tag LOCUS_10520 gene yidC 7131 8933 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_10520 9046 9723 gene locus_tag LOCUS_10530 9046 9723 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_10530 9734 10498 gene locus_tag LOCUS_10540 9734 10498 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_10540 10503 11402 gene locus_tag LOCUS_10550 10503 11402 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_10550 11420 12040 gene locus_tag LOCUS_10560 11420 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence068 34 489 gene locus_tag LOCUS_10570 34 489 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_10570 2201 486 gene locus_tag LOCUS_10580 2201 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2457 2383 gene locus_tag LOCUS_t00220 2457 2383 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3546 2587 gene locus_tag LOCUS_10590 3546 2587 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_10590 4578 3550 gene locus_tag LOCUS_10600 gene arsS 4578 3550 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_10600 4913 4578 gene locus_tag LOCUS_10610 4913 4578 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941967.1 protein_id gnl|my_center|LOCUS_10610 5051 5548 gene locus_tag LOCUS_10620 5051 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5561 6451 gene locus_tag LOCUS_10630 5561 6451 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_10630 6456 7148 gene locus_tag LOCUS_10640 6456 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7152 8408 gene locus_tag LOCUS_10650 7152 8408 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_10650 8485 9828 gene locus_tag LOCUS_10660 8485 9828 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_10660 11139 9835 gene locus_tag LOCUS_10670 11139 9835 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence069 853 8 gene locus_tag LOCUS_10680 853 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2499 871 gene locus_tag LOCUS_10690 2499 871 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_10690 3463 2504 gene locus_tag LOCUS_10700 3463 2504 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_10700 4218 3475 gene locus_tag LOCUS_10710 4218 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4421 7108 gene locus_tag LOCUS_10720 4421 7108 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_10720 7308 8735 gene locus_tag LOCUS_10730 7308 8735 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_10730 10547 8814 gene locus_tag LOCUS_10740 gene lysS 10547 8814 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_10740 11883 10612 gene locus_tag LOCUS_10750 11883 10612 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence070 <1 1794 gene locus_tag LOCUS_10760 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202911.1:pyruvate, phosphate dikinase 2555 2992 gene locus_tag LOCUS_10770 2555 2992 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_10770 3081 3560 gene locus_tag LOCUS_10780 3081 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4287 3583 gene locus_tag LOCUS_10790 4287 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5378 4341 gene locus_tag LOCUS_10800 gene pdhA 5378 4341 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_10800 5472 6590 gene locus_tag LOCUS_10810 gene recF 5472 6590 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_10810 6580 6897 gene locus_tag LOCUS_10820 6580 6897 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_10820 9589 6890 gene locus_tag LOCUS_10830 9589 6890 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_10830 9882 9685 gene locus_tag LOCUS_10840 9882 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11780 9885 gene locus_tag LOCUS_10850 gene acs 11780 9885 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence071 1140 382 gene locus_tag LOCUS_10860 gene lipB 1140 382 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_10860 3115 1217 gene locus_tag LOCUS_10870 gene htpG 3115 1217 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_10870 6634 3275 gene locus_tag LOCUS_10880 6634 3275 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_10880 7764 6763 gene locus_tag LOCUS_10890 7764 6763 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_10890 8369 7773 gene locus_tag LOCUS_10900 8369 7773 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_10900 9279 8530 gene locus_tag LOCUS_10910 9279 8530 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_10910 10375 9347 gene locus_tag LOCUS_10920 10375 9347 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_10920 11029 10379 gene locus_tag LOCUS_10930 11029 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <11823 11050 gene locus_tag LOCUS_10940 <11823 11050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase >Feature sequence072 203 907 gene locus_tag LOCUS_10950 203 907 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_10950 1990 896 gene locus_tag LOCUS_10960 1990 896 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_10960 3720 1996 gene locus_tag LOCUS_10970 3720 1996 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880726.1 protein_id gnl|my_center|LOCUS_10970 4818 3724 gene locus_tag LOCUS_10980 gene hypD 4818 3724 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_10980 5096 4815 gene locus_tag LOCUS_10990 5096 4815 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_10990 5841 5137 gene locus_tag LOCUS_11000 gene hypB 5841 5137 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_11000 6201 5854 gene locus_tag LOCUS_11010 6201 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7696 6203 gene locus_tag LOCUS_11020 7696 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 7934 7668 gene locus_tag LOCUS_11030 7934 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8248 7934 gene locus_tag LOCUS_11040 8248 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8731 8249 gene locus_tag LOCUS_11050 8731 8249 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021168.1 protein_id gnl|my_center|LOCUS_11050 10397 8802 gene locus_tag LOCUS_11060 10397 8802 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_11060 11336 10425 gene locus_tag LOCUS_11070 11336 10425 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence073 <1 1189 gene locus_tag LOCUS_11080 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963512.1:pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase 1223 2176 gene locus_tag LOCUS_11090 1223 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2271 2813 gene locus_tag LOCUS_11100 gene hslV 2271 2813 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_11100 2819 3157 gene locus_tag LOCUS_11110 gene arsC 2819 3157 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_11110 3686 3198 gene locus_tag LOCUS_11120 gene msrB 3686 3198 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_11120 3805 4395 gene locus_tag LOCUS_11130 3805 4395 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_11130 4404 5627 gene locus_tag LOCUS_11140 4404 5627 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_11140 7015 5687 gene locus_tag LOCUS_11150 7015 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8283 7030 gene locus_tag LOCUS_11160 8283 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9206 8577 gene locus_tag LOCUS_11170 9206 8577 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_11170 9322 10152 gene locus_tag LOCUS_11180 9322 10152 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_11180 10549 10136 gene locus_tag LOCUS_11190 10549 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence074 114 1286 gene locus_tag LOCUS_11200 114 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1283 1759 gene locus_tag LOCUS_11210 gene gldH 1283 1759 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_11210 2124 2840 gene locus_tag LOCUS_11220 2124 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2882 3565 gene locus_tag LOCUS_11230 2882 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3562 4209 gene locus_tag LOCUS_11240 3562 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8254 4247 gene locus_tag LOCUS_11250 8254 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9169 8279 gene locus_tag LOCUS_11260 9169 8279 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_11260 9273 11309 gene locus_tag LOCUS_11270 9273 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 9635 9564 gene locus_tag LOCUS_t00230 9635 9564 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 169 1737 gene locus_tag LOCUS_11280 gene rny 169 1737 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_11280 2178 1873 gene locus_tag LOCUS_11290 2178 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2399 2178 gene locus_tag LOCUS_11300 2399 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3005 2514 gene locus_tag LOCUS_11310 3005 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4087 3080 gene locus_tag LOCUS_11320 4087 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5219 4347 gene locus_tag LOCUS_11330 gene sucD 5219 4347 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_11330 5403 7778 gene locus_tag LOCUS_11340 5403 7778 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_11340 7775 8587 gene locus_tag LOCUS_11350 7775 8587 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_11350 9945 8647 gene locus_tag LOCUS_11360 gene ahcY 9945 8647 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence076 390 2006 gene locus_tag LOCUS_11370 390 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1981 2403 gene locus_tag LOCUS_11380 1981 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2406 2900 gene locus_tag LOCUS_11390 2406 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3946 3029 gene locus_tag LOCUS_11400 3946 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_11400 4095 5102 gene locus_tag LOCUS_11410 4095 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5105 5821 gene locus_tag LOCUS_11420 5105 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5954 7321 gene locus_tag LOCUS_11430 5954 7321 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_11430 7336 8529 gene locus_tag LOCUS_11440 7336 8529 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_11440 8516 9265 gene locus_tag LOCUS_11450 8516 9265 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_11450 9262 9921 gene locus_tag LOCUS_11460 9262 9921 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_11460 9934 10545 gene locus_tag LOCUS_11470 gene nqrE 9934 10545 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368115.1 protein_id gnl|my_center|LOCUS_11470 10942 10616 gene locus_tag LOCUS_11480 10942 10616 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence077 2023 635 gene locus_tag LOCUS_11490 2023 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2047 2736 gene locus_tag LOCUS_11500 2047 2736 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_11500 2792 3343 gene locus_tag LOCUS_11510 2792 3343 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_11510 3446 4021 gene locus_tag LOCUS_11520 3446 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5480 4224 gene locus_tag LOCUS_11530 5480 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6327 5764 gene locus_tag LOCUS_11540 6327 5764 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_11540 6975 6328 gene locus_tag LOCUS_11550 6975 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8166 7051 gene locus_tag LOCUS_11560 8166 7051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_11560 9263 8163 gene locus_tag LOCUS_11570 9263 8163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_11570 10004 9270 gene locus_tag LOCUS_11580 10004 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 10902 9997 gene locus_tag LOCUS_11590 10902 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence078 359 1417 gene locus_tag LOCUS_11600 359 1417 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_11600 1489 2205 gene locus_tag LOCUS_11610 gene bshB1 1489 2205 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_11610 3456 2209 gene locus_tag LOCUS_11620 3456 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4119 3463 gene locus_tag LOCUS_11630 gene pdxH 4119 3463 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_11630 4285 4872 gene locus_tag LOCUS_11640 4285 4872 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_11640 4923 7133 gene locus_tag LOCUS_11650 4923 7133 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_11650 8389 7160 gene locus_tag LOCUS_11660 gene serA 8389 7160 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_11660 9084 8386 gene locus_tag LOCUS_11670 9084 8386 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023286.1 protein_id gnl|my_center|LOCUS_11670 9147 10256 gene locus_tag LOCUS_11680 9147 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 10420 10262 gene locus_tag LOCUS_11690 10420 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence079 1822 404 gene locus_tag LOCUS_11700 1822 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2628 1831 gene locus_tag LOCUS_11710 2628 1831 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_11710 3547 2630 gene locus_tag LOCUS_11720 3547 2630 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_11720 3944 3561 gene locus_tag LOCUS_11730 3944 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 4920 3958 gene locus_tag LOCUS_11740 4920 3958 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_11740 6256 4937 gene locus_tag LOCUS_11750 6256 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 7473 6292 gene locus_tag LOCUS_11760 7473 6292 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_11760 7629 8945 gene locus_tag LOCUS_11770 7629 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9895 8951 gene locus_tag LOCUS_11780 9895 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 10857 9892 gene locus_tag LOCUS_11790 10857 9892 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence080 364 125 gene locus_tag LOCUS_11800 364 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 957 364 gene locus_tag LOCUS_11810 957 364 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_11810 2710 935 gene locus_tag LOCUS_11820 2710 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3495 2713 gene locus_tag LOCUS_11830 3495 2713 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_11830 4942 3575 gene locus_tag LOCUS_11840 4942 3575 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_11840 5406 4975 gene locus_tag LOCUS_11850 gene norC 5406 4975 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_11850 6077 5592 gene locus_tag LOCUS_11860 6077 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6610 6900 gene locus_tag LOCUS_11870 6610 6900 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784184.1 protein_id gnl|my_center|LOCUS_11870 8450 7020 gene locus_tag LOCUS_11880 8450 7020 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_11880 10199 8559 gene locus_tag LOCUS_11890 10199 8559 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence081 3330 409 gene locus_tag LOCUS_11900 3330 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4311 3634 gene locus_tag LOCUS_11910 4311 3634 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_11910 4745 4311 gene locus_tag LOCUS_11920 4745 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6165 4747 gene locus_tag LOCUS_11930 gene ccoG 6165 4747 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_11930 7140 6211 gene locus_tag LOCUS_11940 7140 6211 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_11940 7327 7127 gene locus_tag LOCUS_11950 7327 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9469 7334 gene locus_tag LOCUS_11960 gene ccoN 9469 7334 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_11960 9642 10895 gene locus_tag LOCUS_11970 9642 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence082 684 265 gene locus_tag LOCUS_11980 684 265 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_11980 870 1889 gene locus_tag LOCUS_11990 870 1889 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_11990 1873 2880 gene locus_tag LOCUS_12000 1873 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2877 3362 gene locus_tag LOCUS_12010 2877 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3363 3944 gene locus_tag LOCUS_12020 3363 3944 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_12020 3941 4564 gene locus_tag LOCUS_12030 gene udk 3941 4564 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_12030 6664 4640 gene locus_tag LOCUS_12040 gene uvrB 6664 4640 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_12040 7443 6697 gene locus_tag LOCUS_12050 7443 6697 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_12050 8378 7440 gene locus_tag LOCUS_12060 8378 7440 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_12060 9152 8388 gene locus_tag LOCUS_12070 9152 8388 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_12070 10555 9152 gene locus_tag LOCUS_12080 10555 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence083 <1 3549 gene locus_tag LOCUS_12090 <1 3549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035924.1:serine protease 3542 3790 gene locus_tag LOCUS_12100 3542 3790 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876114.1 protein_id gnl|my_center|LOCUS_12100 3787 4617 gene locus_tag LOCUS_12110 3787 4617 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_12110 5958 5191 gene locus_tag LOCUS_12120 5958 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 6890 6102 gene locus_tag LOCUS_12130 6890 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 8051 6942 gene locus_tag LOCUS_12140 gene paaK 8051 6942 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976332.1 protein_id gnl|my_center|LOCUS_12140 10301 8067 gene locus_tag LOCUS_12150 10301 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence084 4522 2096 gene locus_tag LOCUS_12160 4522 2096 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_12160 5949 4621 gene locus_tag LOCUS_12170 5949 4621 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_12170 6812 6012 gene locus_tag LOCUS_12180 6812 6012 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_12180 9105 6946 gene locus_tag LOCUS_12190 9105 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9891 9106 gene locus_tag LOCUS_12200 9891 9106 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020948.1 protein_id gnl|my_center|LOCUS_12200 10224 9943 gene locus_tag LOCUS_12210 10224 9943 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_12210 10801 10217 gene locus_tag LOCUS_12220 10801 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence085 534 1154 gene locus_tag LOCUS_12230 534 1154 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_12230 1250 2284 gene locus_tag LOCUS_12240 1250 2284 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920726.1 protein_id gnl|my_center|LOCUS_12240 2300 3337 gene locus_tag LOCUS_12250 2300 3337 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_12250 3342 4676 gene locus_tag LOCUS_12260 3342 4676 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_12260 6892 4829 gene locus_tag LOCUS_12270 6892 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7092 8381 gene locus_tag LOCUS_12280 7092 8381 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_12280 8411 8872 gene locus_tag LOCUS_12290 8411 8872 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence086 1561 806 gene locus_tag LOCUS_12300 1561 806 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_12300 2315 1566 gene locus_tag LOCUS_12310 2315 1566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_12310 2716 3420 gene locus_tag LOCUS_12320 2716 3420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932296.1 protein_id gnl|my_center|LOCUS_12320 3613 4311 gene locus_tag LOCUS_12330 3613 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4308 5159 gene locus_tag LOCUS_12340 4308 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5228 5911 gene locus_tag LOCUS_12350 5228 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5970 8726 gene locus_tag LOCUS_12360 gene cas10 5970 8726 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_12360 8739 9158 gene locus_tag LOCUS_12370 8739 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 9179 9811 gene locus_tag LOCUS_12380 gene csm3 9179 9811 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582983.1 protein_id gnl|my_center|LOCUS_12380 9816 10817 gene locus_tag LOCUS_12390 9816 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence087 3017 372 gene locus_tag LOCUS_12400 3017 372 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_12400 3175 3417 gene locus_tag LOCUS_12410 3175 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3417 3683 gene locus_tag LOCUS_12420 3417 3683 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588503.1 protein_id gnl|my_center|LOCUS_12420 4359 5111 gene locus_tag LOCUS_12430 4359 5111 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_12430 5113 6249 gene locus_tag LOCUS_12440 5113 6249 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_12440 6275 6943 gene locus_tag LOCUS_12450 6275 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7364 6978 gene locus_tag LOCUS_12460 7364 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 9840 7459 gene locus_tag LOCUS_12470 9840 7459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_12470 <10730 9929 gene locus_tag LOCUS_12480 <10730 9929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:type IX secretion system sortase PorU >Feature sequence088 290 601 gene locus_tag LOCUS_12490 290 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1166 1594 gene locus_tag LOCUS_12500 1166 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1599 2399 gene locus_tag LOCUS_12510 1599 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2402 3079 gene locus_tag LOCUS_12520 2402 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3797 3213 gene locus_tag LOCUS_12530 3797 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5855 4491 gene locus_tag LOCUS_12540 5855 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6914 5856 gene locus_tag LOCUS_12550 6914 5856 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 protein_id gnl|my_center|LOCUS_12550 7073 7363 gene locus_tag LOCUS_12560 7073 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7360 7863 gene locus_tag LOCUS_12570 7360 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_12570 8628 7903 gene locus_tag LOCUS_12580 8628 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10608 8647 gene locus_tag LOCUS_12590 10608 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence089 1949 1209 gene locus_tag LOCUS_12600 1949 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880214.1 protein_id gnl|my_center|LOCUS_12600 3018 1960 gene locus_tag LOCUS_12610 3018 1960 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_12610 4236 3049 gene locus_tag LOCUS_12620 4236 3049 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_12620 4966 4256 gene locus_tag LOCUS_12630 4966 4256 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_12630 5495 5028 gene locus_tag LOCUS_12640 5495 5028 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_12640 5909 5529 gene locus_tag LOCUS_12650 5909 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6235 5987 gene locus_tag LOCUS_12660 6235 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7301 6207 gene locus_tag LOCUS_12670 7301 6207 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_12670 7834 7322 gene locus_tag LOCUS_12680 7834 7322 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_12680 8085 7846 gene locus_tag LOCUS_12690 gene tusA 8085 7846 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_12690 8425 8111 gene locus_tag LOCUS_12700 8425 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8777 9670 gene locus_tag LOCUS_12710 8777 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <10685 9675 gene locus_tag LOCUS_12720 <10685 9675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800633.1:galactokinase >Feature sequence090 1752 724 gene locus_tag LOCUS_12730 1752 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1850 2926 gene locus_tag LOCUS_12740 1850 2926 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_12740 3516 2932 gene locus_tag LOCUS_12750 3516 2932 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_12750 5579 3579 gene locus_tag LOCUS_12760 5579 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 6522 5638 gene locus_tag LOCUS_12770 gene lipA 6522 5638 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_12770 7247 6552 gene locus_tag LOCUS_12780 7247 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence091 441 1523 gene locus_tag LOCUS_12790 441 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1658 1969 gene locus_tag LOCUS_12800 1658 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3177 2161 gene locus_tag LOCUS_12810 gene rfbB 3177 2161 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_12810 3883 3278 gene locus_tag LOCUS_12820 gene recR 3883 3278 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_12820 4192 3896 gene locus_tag LOCUS_12830 4192 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4258 5697 gene locus_tag LOCUS_12840 4258 5697 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_12840 6037 5702 gene locus_tag LOCUS_12850 6037 5702 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_12850 6178 6780 gene locus_tag LOCUS_12860 6178 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7067 7471 gene locus_tag LOCUS_12870 gene rnpA 7067 7471 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_12870 7452 9104 gene locus_tag LOCUS_12880 7452 9104 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_12880 9115 9786 gene locus_tag LOCUS_12890 gene tsaB 9115 9786 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_12890 9789 10295 gene locus_tag LOCUS_12900 9789 10295 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence092 382 1431 gene locus_tag LOCUS_12910 382 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_12910 2634 1714 gene locus_tag LOCUS_12920 2634 1714 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12920 3021 2701 gene locus_tag LOCUS_12930 gene trxA 3021 2701 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_12930 6656 3099 gene locus_tag LOCUS_12940 gene dnaE 6656 3099 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_12940 6777 7442 gene locus_tag LOCUS_12950 6777 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020790.1 protein_id gnl|my_center|LOCUS_12950 8219 7464 gene locus_tag LOCUS_12960 8219 7464 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_12960 8632 9087 gene locus_tag LOCUS_12970 8632 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence093 1404 121 gene locus_tag LOCUS_12980 1404 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2950 1577 gene locus_tag LOCUS_12990 2950 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4093 2957 gene locus_tag LOCUS_13000 4093 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 <10479 4226 gene locus_tag LOCUS_13010 <10479 4226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104264.1:NHL repeat-containing protein >Feature sequence094 2846 2043 gene locus_tag LOCUS_13020 2846 2043 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_13020 3973 2834 gene locus_tag LOCUS_13030 3973 2834 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_13030 4651 4097 gene locus_tag LOCUS_13040 gene def 4651 4097 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_13040 5070 4648 gene locus_tag LOCUS_13050 gene ruvX 5070 4648 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_13050 5176 6831 gene locus_tag LOCUS_13060 5176 6831 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_13060 7845 6832 gene locus_tag LOCUS_13070 7845 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7921 9234 gene locus_tag LOCUS_13080 7921 9234 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_13080 9218 9592 gene locus_tag LOCUS_13090 9218 9592 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_13090 10276 9650 gene locus_tag LOCUS_13100 10276 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence095 612 1487 gene locus_tag LOCUS_13110 612 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1571 2458 gene locus_tag LOCUS_13120 1571 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2650 3681 gene locus_tag LOCUS_13130 2650 3681 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766159.1 protein_id gnl|my_center|LOCUS_13130 3732 6839 gene locus_tag LOCUS_13140 3732 6839 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_13140 6841 8280 gene locus_tag LOCUS_13150 6841 8280 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_13150 9312 8281 gene locus_tag LOCUS_13160 9312 8281 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_13160 9935 9387 gene locus_tag LOCUS_13170 9935 9387 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence096 1057 629 gene locus_tag LOCUS_13180 1057 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1441 2022 gene locus_tag LOCUS_13190 1441 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2701 2051 gene locus_tag LOCUS_13200 2701 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3131 2799 gene locus_tag LOCUS_13210 3131 2799 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_13210 4327 3143 gene locus_tag LOCUS_13220 4327 3143 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_13220 8770 4397 gene locus_tag LOCUS_13230 8770 4397 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_13230 9165 8866 gene locus_tag LOCUS_13240 9165 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 9294 9917 gene locus_tag LOCUS_13250 9294 9917 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence097 249 548 gene locus_tag LOCUS_13260 249 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1012 539 gene locus_tag LOCUS_13270 1012 539 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_13270 1134 2549 gene locus_tag LOCUS_13280 1134 2549 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_13280 2936 2550 gene locus_tag LOCUS_13290 2936 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3230 6256 gene locus_tag LOCUS_13300 3230 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6313 7305 gene locus_tag LOCUS_13310 6313 7305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_13310 8787 7384 gene locus_tag LOCUS_13320 8787 7384 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_13320 10294 8789 gene locus_tag LOCUS_13330 10294 8789 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence098 <1 1073 gene locus_tag LOCUS_13340 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962581.1:pyridoxal phosphate-dependent aminotransferase 1070 1675 gene locus_tag LOCUS_13350 1070 1675 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_13350 1693 2718 gene locus_tag LOCUS_13360 1693 2718 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 protein_id gnl|my_center|LOCUS_13360 2770 3675 gene locus_tag LOCUS_13370 gene sdaAA 2770 3675 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_13370 4143 3685 gene locus_tag LOCUS_13380 4143 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5102 4152 gene locus_tag LOCUS_13390 5102 4152 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_13390 5761 5111 gene locus_tag LOCUS_13400 gene upp 5761 5111 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_13400 5956 6480 gene locus_tag LOCUS_13410 gene hpt 5956 6480 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_13410 6514 7089 gene locus_tag LOCUS_13420 6514 7089 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_13420 7101 8093 gene locus_tag LOCUS_13430 gene obgE 7101 8093 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_13430 8261 8854 gene locus_tag LOCUS_13440 8261 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8861 9979 gene locus_tag LOCUS_13450 gene dnaJ 8861 9979 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence099 3300 1174 gene locus_tag LOCUS_13460 3300 1174 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_13460 5056 3410 gene locus_tag LOCUS_13470 5056 3410 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_13470 5731 5129 gene locus_tag LOCUS_13480 5731 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6567 5743 gene locus_tag LOCUS_13490 6567 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7621 6638 gene locus_tag LOCUS_13500 7621 6638 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_13500 8370 7618 gene locus_tag LOCUS_13510 8370 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8498 9580 gene locus_tag LOCUS_13520 8498 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence100 1947 322 gene locus_tag LOCUS_13530 1947 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2076 3044 gene locus_tag LOCUS_13540 2076 3044 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_13540 3065 3763 gene locus_tag LOCUS_13550 3065 3763 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_13550 3805 4803 gene locus_tag LOCUS_13560 3805 4803 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_13560 5664 4789 gene locus_tag LOCUS_13570 gene ppk2 5664 4789 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727269.1 protein_id gnl|my_center|LOCUS_13570 6560 5664 gene locus_tag LOCUS_13580 gene ppk2 6560 5664 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_13580 6643 7017 gene locus_tag LOCUS_13590 6643 7017 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_13590 7044 8309 gene locus_tag LOCUS_13600 7044 8309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387517.1 protein_id gnl|my_center|LOCUS_13600 8372 8824 gene locus_tag LOCUS_13610 8372 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 8943 9917 gene locus_tag LOCUS_13620 8943 9917 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666158.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence101 1163 279 gene locus_tag LOCUS_13630 1163 279 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_13630 2083 1169 gene locus_tag LOCUS_13640 gene cbbX 2083 1169 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975098.1 protein_id gnl|my_center|LOCUS_13640 2535 2113 gene locus_tag LOCUS_13650 2535 2113 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085372.1 protein_id gnl|my_center|LOCUS_13650 4024 2576 gene locus_tag LOCUS_13660 4024 2576 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 protein_id gnl|my_center|LOCUS_13660 5112 4054 gene locus_tag LOCUS_13670 gene fba 5112 4054 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388354.1 protein_id gnl|my_center|LOCUS_13670 6155 5133 gene locus_tag LOCUS_13680 gene glpX 6155 5133 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_13680 8166 6157 gene locus_tag LOCUS_13690 gene tkt 8166 6157 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_13690 8885 8163 gene locus_tag LOCUS_13700 8885 8163 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence102 283 2019 gene locus_tag LOCUS_13710 283 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2019 2717 gene locus_tag LOCUS_13720 2019 2717 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_13720 2720 4201 gene locus_tag LOCUS_13730 2720 4201 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_13730 4227 5516 gene locus_tag LOCUS_13740 4227 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7477 5477 gene locus_tag LOCUS_13750 7477 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7794 8366 gene locus_tag LOCUS_13760 7794 8366 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_13760 8408 9034 gene locus_tag LOCUS_13770 8408 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9281 9490 gene locus_tag LOCUS_13780 9281 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence103 677 1516 gene locus_tag LOCUS_13790 677 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1608 3455 gene locus_tag LOCUS_13800 1608 3455 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_13800 3448 4587 gene locus_tag LOCUS_13810 3448 4587 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465532.1 protein_id gnl|my_center|LOCUS_13810 5042 4581 gene locus_tag LOCUS_13820 5042 4581 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_13820 5891 5043 gene locus_tag LOCUS_13830 5891 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6373 5960 gene locus_tag LOCUS_13840 6373 5960 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_13840 6976 6392 gene locus_tag LOCUS_13850 6976 6392 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_13850 7375 8013 gene locus_tag LOCUS_13860 7375 8013 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832147.1 protein_id gnl|my_center|LOCUS_13860 8088 8798 gene locus_tag LOCUS_13870 8088 8798 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_13870 9894 8806 gene locus_tag LOCUS_13880 9894 8806 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence104 2167 377 gene locus_tag LOCUS_13890 2167 377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_13890 2314 3417 gene locus_tag LOCUS_13900 2314 3417 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_13900 3476 4627 gene locus_tag LOCUS_13910 3476 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4636 4947 gene locus_tag LOCUS_13920 4636 4947 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_13920 4960 5481 gene locus_tag LOCUS_13930 4960 5481 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_13930 5511 5828 gene locus_tag LOCUS_13940 gene yajC 5511 5828 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402802.1 protein_id gnl|my_center|LOCUS_13940 5838 6800 gene locus_tag LOCUS_13950 5838 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6793 7392 gene locus_tag LOCUS_13960 gene coaE 6793 7392 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_13960 8771 7401 gene locus_tag LOCUS_13970 8771 7401 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_13970 9496 8807 gene locus_tag LOCUS_13980 gene trmD 9496 8807 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence105 1795 680 gene locus_tag LOCUS_13990 1795 680 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_13990 1967 3910 gene locus_tag LOCUS_14000 gene dnaG 1967 3910 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_14000 3985 5202 gene locus_tag LOCUS_14010 3985 5202 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_14010 5199 5801 gene locus_tag LOCUS_14020 5199 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5807 6577 gene locus_tag LOCUS_14030 gene surE 5807 6577 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_14030 7527 6880 gene locus_tag LOCUS_14040 7527 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8946 7657 gene locus_tag LOCUS_14050 8946 7657 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_14050 9453 8989 gene locus_tag LOCUS_14060 9453 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence106 <1 569 gene locus_tag LOCUS_14070 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073077.1:Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB 1114 566 gene locus_tag LOCUS_14080 gene rfbC 1114 566 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_14080 1971 1111 gene locus_tag LOCUS_14090 gene rfbA 1971 1111 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_14090 2979 2023 gene locus_tag LOCUS_14100 2979 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4151 2976 gene locus_tag LOCUS_14110 4151 2976 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_14110 5213 4179 gene locus_tag LOCUS_14120 5213 4179 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_14120 5726 5214 gene locus_tag LOCUS_14130 5726 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_14130 6337 5846 gene locus_tag LOCUS_14140 6337 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6842 6357 gene locus_tag LOCUS_14150 6842 6357 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_14150 7324 6851 gene locus_tag LOCUS_14160 7324 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8293 7424 gene locus_tag LOCUS_14170 gene nadC 8293 7424 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_14170 8700 8299 gene locus_tag LOCUS_14180 8700 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence107 2392 5271 gene locus_tag LOCUS_14190 2392 5271 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_14190 5599 5372 gene locus_tag LOCUS_14200 5599 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6849 5599 gene locus_tag LOCUS_14210 6849 5599 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_14210 8761 6887 gene locus_tag LOCUS_14220 8761 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 <9694 8829 gene locus_tag LOCUS_14230 <9694 8829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000365065.1:GTP-binding protein >Feature sequence108 1116 553 gene locus_tag LOCUS_14240 1116 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1504 1722 gene locus_tag LOCUS_14250 1504 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1712 2038 gene locus_tag LOCUS_14260 1712 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4938 2167 gene locus_tag LOCUS_14270 gene polA 4938 2167 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_14270 5201 7651 gene locus_tag LOCUS_14280 gene thrA 5201 7651 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_14280 7696 8583 gene locus_tag LOCUS_14290 7696 8583 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence109 93 851 gene locus_tag LOCUS_14300 93 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 972 1763 gene locus_tag LOCUS_14310 972 1763 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_14310 4782 1777 gene locus_tag LOCUS_14320 4782 1777 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_14320 5708 4860 gene locus_tag LOCUS_14330 5708 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8184 5848 gene locus_tag LOCUS_14340 8184 5848 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_14340 8878 8165 gene locus_tag LOCUS_14350 gene pgmB 8878 8165 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 protein_id gnl|my_center|LOCUS_14350 <9502 8862 gene locus_tag LOCUS_14360 <9502 8862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072433.1:MFS transporter >Feature sequence110 494 78 gene locus_tag LOCUS_14370 494 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 648 2021 gene locus_tag LOCUS_14380 gene hisS 648 2021 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_14380 2028 3518 gene locus_tag LOCUS_14390 gene hutH 2028 3518 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_14390 3519 5375 gene locus_tag LOCUS_14400 3519 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5390 5722 gene locus_tag LOCUS_14410 5390 5722 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_14410 5722 6735 gene locus_tag LOCUS_14420 5722 6735 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_14420 6945 6721 gene locus_tag LOCUS_14430 6945 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_14430 7138 8838 gene locus_tag LOCUS_14440 7138 8838 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_14440 9280 8969 gene locus_tag LOCUS_14450 9280 8969 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence111 181 501 gene locus_tag LOCUS_14460 181 501 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_14460 640 885 gene locus_tag LOCUS_14470 640 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2571 1153 gene locus_tag LOCUS_14480 2571 1153 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046312529.1 protein_id gnl|my_center|LOCUS_14480 3374 2622 gene locus_tag LOCUS_14490 3374 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4160 3402 gene locus_tag LOCUS_14500 4160 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4340 5527 gene locus_tag LOCUS_14510 4340 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 7925 6399 gene locus_tag LOCUS_14520 gene gltX 7925 6399 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_14520 8319 7939 gene locus_tag LOCUS_14530 8319 7939 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_14530 8343 9032 gene locus_tag LOCUS_14540 8343 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence112 1032 154 gene locus_tag LOCUS_14550 1032 154 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_14550 1089 1955 gene locus_tag LOCUS_14560 gene panC 1089 1955 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_14560 1936 2283 gene locus_tag LOCUS_14570 1936 2283 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_14570 2286 3311 gene locus_tag LOCUS_14580 2286 3311 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_14580 3313 4008 gene locus_tag LOCUS_14590 3313 4008 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_14590 4039 5178 gene locus_tag LOCUS_14600 4039 5178 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_14600 5301 6221 gene locus_tag LOCUS_14610 5301 6221 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_14610 6932 6204 gene locus_tag LOCUS_14620 6932 6204 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_14620 7299 6925 gene locus_tag LOCUS_14630 7299 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7666 7289 gene locus_tag LOCUS_14640 7666 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8265 8939 gene locus_tag LOCUS_14650 8265 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence113 <1 1091 gene locus_tag LOCUS_14660 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788089.1:translation elongation factor 4 1136 2014 gene locus_tag LOCUS_14670 1136 2014 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_14670 2030 2635 gene locus_tag LOCUS_14680 2030 2635 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_14680 2635 4545 gene locus_tag LOCUS_14690 2635 4545 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_14690 4709 7714 gene locus_tag LOCUS_14700 4709 7714 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_14700 7726 9123 gene locus_tag LOCUS_14710 7726 9123 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence114 2381 1023 gene locus_tag LOCUS_14720 2381 1023 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_14720 4772 2385 gene locus_tag LOCUS_14730 4772 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6038 5028 gene locus_tag LOCUS_14740 6038 5028 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_14740 6499 7950 gene locus_tag LOCUS_14750 6499 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence115 3917 1185 gene locus_tag LOCUS_14760 gene fdhF 3917 1185 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_14760 5576 3924 gene locus_tag LOCUS_14770 5576 3924 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974089.1 protein_id gnl|my_center|LOCUS_14770 5945 5580 gene locus_tag LOCUS_14780 5945 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6787 5957 gene locus_tag LOCUS_14790 gene fdhD 6787 5957 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_14790 8470 6791 gene locus_tag LOCUS_14800 8470 6791 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_14800 8702 8596 gene locus_tag LOCUS_r00010 8702 8596 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence116 599 147 gene locus_tag LOCUS_14810 599 147 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_14810 997 602 gene locus_tag LOCUS_14820 997 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1598 1083 gene locus_tag LOCUS_14830 1598 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2307 1618 gene locus_tag LOCUS_14840 2307 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3148 2381 gene locus_tag LOCUS_14850 3148 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3255 4889 gene locus_tag LOCUS_14860 3255 4889 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113202.1 protein_id gnl|my_center|LOCUS_14860 4898 6634 gene locus_tag LOCUS_14870 4898 6634 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979494.1 protein_id gnl|my_center|LOCUS_14870 7468 8415 gene locus_tag LOCUS_14880 7468 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence117 <1 911 gene locus_tag LOCUS_14890 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706729.1:patatin-like phospholipase family protein 1822 908 gene locus_tag LOCUS_14900 1822 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2371 1883 gene locus_tag LOCUS_14910 2371 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2433 3044 gene locus_tag LOCUS_14920 2433 3044 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_14920 3085 5295 gene locus_tag LOCUS_14930 3085 5295 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_14930 5339 7513 gene locus_tag LOCUS_14940 5339 7513 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence118 350 1258 gene locus_tag LOCUS_14950 350 1258 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_14950 1268 2860 gene locus_tag LOCUS_14960 1268 2860 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_14960 2861 3868 gene locus_tag LOCUS_14970 2861 3868 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_14970 4138 5406 gene locus_tag LOCUS_14980 4138 5406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_14980 5399 6223 gene locus_tag LOCUS_14990 gene cysQ 5399 6223 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 protein_id gnl|my_center|LOCUS_14990 6216 6812 gene locus_tag LOCUS_15000 gene cysC 6216 6812 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_15000 6815 7723 gene locus_tag LOCUS_15010 gene cysD 6815 7723 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence119 3975 2893 gene locus_tag LOCUS_15020 3975 2893 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_15020 8266 3968 gene locus_tag LOCUS_15030 8266 3968 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence120 3626 2964 gene locus_tag LOCUS_15040 3626 2964 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_15040 4275 3631 gene locus_tag LOCUS_15050 4275 3631 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_15050 4333 5382 gene locus_tag LOCUS_15060 4333 5382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_15060 5437 8658 gene locus_tag LOCUS_15070 5437 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence121 1326 3053 gene locus_tag LOCUS_15080 1326 3053 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839088.1 protein_id gnl|my_center|LOCUS_15080 3695 3213 gene locus_tag LOCUS_15090 3695 3213 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946130.1 protein_id gnl|my_center|LOCUS_15090 5082 3697 gene locus_tag LOCUS_15100 gene hslU 5082 3697 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_15100 6060 5095 gene locus_tag LOCUS_15110 6060 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 8533 6086 gene locus_tag LOCUS_15120 gene lon 8533 6086 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence122 191 2458 gene locus_tag LOCUS_15130 191 2458 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_15130 2610 3515 gene locus_tag LOCUS_15140 2610 3515 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_15140 3519 3731 gene locus_tag LOCUS_15150 3519 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3728 4528 gene locus_tag LOCUS_15160 3728 4528 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_15160 4525 5199 gene locus_tag LOCUS_15170 gene truB 4525 5199 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_15170 5196 6119 gene locus_tag LOCUS_15180 5196 6119 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_15180 6147 8108 gene locus_tag LOCUS_15190 6147 8108 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_15190 8156 8491 gene locus_tag LOCUS_15200 gene gldC 8156 8491 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence123 2189 156 gene locus_tag LOCUS_15210 2189 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4273 2255 gene locus_tag LOCUS_15220 4273 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5571 4339 gene locus_tag LOCUS_15230 5571 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5638 5868 gene locus_tag LOCUS_15240 5638 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5927 8638 gene locus_tag LOCUS_15250 5927 8638 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence124 <1 719 gene locus_tag LOCUS_15260 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000916643.1:glucose-6-phosphate isomerase 716 1702 gene locus_tag LOCUS_15270 716 1702 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_15270 1953 1699 gene locus_tag LOCUS_15280 1953 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3404 2220 gene locus_tag LOCUS_15290 3404 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3582 4607 gene locus_tag LOCUS_15300 3582 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4600 5346 gene locus_tag LOCUS_15310 4600 5346 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_15310 6807 5350 gene locus_tag LOCUS_15320 6807 5350 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_15320 8147 6804 gene locus_tag LOCUS_15330 gene trkA 8147 6804 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_15330 8583 8233 gene locus_tag LOCUS_15340 8583 8233 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence125 <1 2481 gene locus_tag LOCUS_15350 <1 2481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107391.1:efflux RND transporter permease subunit 2610 3635 gene locus_tag LOCUS_15360 2610 3635 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_15360 5191 4070 gene locus_tag LOCUS_15370 5191 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5528 5292 gene locus_tag LOCUS_15380 5528 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7085 5739 gene locus_tag LOCUS_15390 7085 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7549 7082 gene locus_tag LOCUS_15400 7549 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence126 1500 1108 gene locus_tag LOCUS_15410 1500 1108 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_15410 1583 4939 gene locus_tag LOCUS_15420 gene mfd 1583 4939 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_15420 4991 5719 gene locus_tag LOCUS_15430 4991 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6093 5716 gene locus_tag LOCUS_15440 6093 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6502 8268 gene locus_tag LOCUS_15450 6502 8268 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence127 1329 3005 gene locus_tag LOCUS_15460 1329 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence128 184 783 gene locus_tag LOCUS_15470 184 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 787 1224 gene locus_tag LOCUS_15480 787 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3082 1253 gene locus_tag LOCUS_15490 3082 1253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_15490 4835 3132 gene locus_tag LOCUS_15500 4835 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5725 5426 gene locus_tag LOCUS_15510 5725 5426 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence129 4427 372 gene locus_tag LOCUS_15520 4427 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5210 4512 gene locus_tag LOCUS_15530 5210 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 6991 5207 gene locus_tag LOCUS_15540 6991 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8181 7216 gene locus_tag LOCUS_15550 gene ftsY 8181 7216 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence130 170 2281 gene locus_tag LOCUS_15560 170 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2370 5183 gene locus_tag LOCUS_15570 gene carB 2370 5183 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_15570 5185 5406 gene locus_tag LOCUS_15580 5185 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6285 5410 gene locus_tag LOCUS_15590 6285 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8171 6336 gene locus_tag LOCUS_15600 gene glmS 8171 6336 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence131 328 1599 gene locus_tag LOCUS_15610 gene dacB 328 1599 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694445.1 protein_id gnl|my_center|LOCUS_15610 1642 2694 gene locus_tag LOCUS_15620 1642 2694 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_15620 2687 3277 gene locus_tag LOCUS_15630 2687 3277 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_15630 3327 4457 gene locus_tag LOCUS_15640 3327 4457 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_15640 5594 4473 gene locus_tag LOCUS_15650 5594 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 <8113 5645 gene locus_tag LOCUS_15660 <8113 5645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208256196.1:exo-alpha-sialidase >Feature sequence132 162 1517 gene locus_tag LOCUS_15670 162 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1624 2697 gene locus_tag LOCUS_15680 1624 2697 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_15680 2837 4825 gene locus_tag LOCUS_15690 2837 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4827 6086 gene locus_tag LOCUS_15700 4827 6086 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_15700 6083 6619 gene locus_tag LOCUS_15710 6083 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 6631 7164 gene locus_tag LOCUS_15720 6631 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence133 2243 1068 gene locus_tag LOCUS_15730 2243 1068 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_15730 3289 2396 gene locus_tag LOCUS_15740 3289 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3528 3983 gene locus_tag LOCUS_15750 gene ribH 3528 3983 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_15750 5246 4254 gene locus_tag LOCUS_15760 gene rhuM 5246 4254 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_15760 5386 6108 gene locus_tag LOCUS_15770 5386 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6224 7843 gene locus_tag LOCUS_15780 6224 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence134 892 143 gene locus_tag LOCUS_15790 892 143 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706132.1 protein_id gnl|my_center|LOCUS_15790 1000 2937 gene locus_tag LOCUS_15800 1000 2937 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_15800 2961 5936 gene locus_tag LOCUS_15810 2961 5936 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_15810 5956 7284 gene locus_tag LOCUS_15820 5956 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence135 3501 646 gene locus_tag LOCUS_15830 3501 646 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_15830 6623 3498 gene locus_tag LOCUS_15840 6623 3498 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_15840 <7974 6687 gene locus_tag LOCUS_15850 <7974 6687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964019.1:exonuclease domain-containing protein >Feature sequence136 <1 2700 gene locus_tag LOCUS_15860 <1 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein 2721 3782 gene locus_tag LOCUS_15870 2721 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3828 5282 gene locus_tag LOCUS_15880 3828 5282 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_15880 5282 5989 gene locus_tag LOCUS_15890 5282 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6068 6613 gene locus_tag LOCUS_15900 6068 6613 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_15900 6616 7137 gene locus_tag LOCUS_15910 6616 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence137 3789 1669 gene locus_tag LOCUS_15920 gene scpA 3789 1669 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_15920 4813 3773 gene locus_tag LOCUS_15930 4813 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5049 6443 gene locus_tag LOCUS_15940 gene dnaA 5049 6443 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_15940 6798 6460 gene locus_tag LOCUS_15950 6798 6460 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_15950 6905 7726 gene locus_tag LOCUS_15960 6905 7726 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence138 2130 43 gene locus_tag LOCUS_15970 gene fusA 2130 43 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_15970 2639 2172 gene locus_tag LOCUS_15980 gene rpsG 2639 2172 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_15980 3037 2663 gene locus_tag LOCUS_15990 gene rpsL 3037 2663 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_15990 3558 3235 gene locus_tag LOCUS_16000 3558 3235 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_16000 7868 3561 gene locus_tag LOCUS_16010 gene rpoC 7868 3561 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence139 1028 300 gene locus_tag LOCUS_16020 1028 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1849 1184 gene locus_tag LOCUS_16030 1849 1184 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_16030 2454 1942 gene locus_tag LOCUS_16040 2454 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2508 3620 gene locus_tag LOCUS_16050 2508 3620 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_16050 3916 5367 gene locus_tag LOCUS_16060 gene nhaC 3916 5367 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_16060 5357 5971 gene locus_tag LOCUS_16070 5357 5971 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_16070 6690 5983 gene locus_tag LOCUS_16080 6690 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6777 7817 gene locus_tag LOCUS_16090 6777 7817 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence140 1401 496 gene locus_tag LOCUS_16100 1401 496 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_16100 1883 1431 gene locus_tag LOCUS_16110 gene bcp 1883 1431 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_16110 3706 1886 gene locus_tag LOCUS_16120 3706 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4373 3765 gene locus_tag LOCUS_16130 4373 3765 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_16130 4526 5308 gene locus_tag LOCUS_16140 4526 5308 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_16140 5954 5328 gene locus_tag LOCUS_16150 5954 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6965 6042 gene locus_tag LOCUS_16160 6965 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7035 7622 gene locus_tag LOCUS_16170 7035 7622 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence141 <1 2600 gene locus_tag LOCUS_16180 <1 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964063.1:T9SS sorting signal type C domain-containing protein 2602 2790 gene locus_tag LOCUS_16190 2602 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2806 4722 gene locus_tag LOCUS_16200 2806 4722 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_16200 <7689 4706 gene locus_tag LOCUS_16210 <7689 4706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence142 807 226 gene locus_tag LOCUS_16220 807 226 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_16220 1725 814 gene locus_tag LOCUS_16230 gene cyoE 1725 814 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_16230 3649 1736 gene locus_tag LOCUS_16240 3649 1736 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_16240 4748 3681 gene locus_tag LOCUS_16250 4748 3681 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_16250 6095 4770 gene locus_tag LOCUS_16260 6095 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6730 6113 gene locus_tag LOCUS_16270 6730 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7271 6750 gene locus_tag LOCUS_16280 7271 6750 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence143 89 1168 gene locus_tag LOCUS_16290 89 1168 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_16290 2518 1154 gene locus_tag LOCUS_16300 gene hemN 2518 1154 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_16300 3555 2515 gene locus_tag LOCUS_16310 gene hemE 3555 2515 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_16310 4850 3555 gene locus_tag LOCUS_16320 gene hemL 4850 3555 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_16320 5799 4843 gene locus_tag LOCUS_16330 gene hemB 5799 4843 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_16330 6526 5789 gene locus_tag LOCUS_16340 6526 5789 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_16340 7446 6523 gene locus_tag LOCUS_16350 gene hemC 7446 6523 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence144 <1 2527 gene locus_tag LOCUS_16360 <1 2527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384833.1:PIG-L family deacetylase 2554 4284 gene locus_tag LOCUS_16370 2554 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6667 4355 gene locus_tag LOCUS_16380 gene pbpC 6667 4355 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_16380 <7581 6709 gene locus_tag LOCUS_16390 <7581 6709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:MG2 domain-containing protein >Feature sequence145 402 1097 gene locus_tag LOCUS_16400 gene deoD 402 1097 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_16400 1205 1405 gene locus_tag LOCUS_16410 1205 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1405 1662 gene locus_tag LOCUS_16420 1405 1662 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_16420 2106 2033 gene locus_tag LOCUS_t00240 2106 2033 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2192 3523 gene locus_tag LOCUS_16430 2192 3523 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_16430 3614 4381 gene locus_tag LOCUS_16440 3614 4381 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_16440 6241 4943 gene locus_tag LOCUS_16450 6241 4943 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405198.1 protein_id gnl|my_center|LOCUS_16450 <7557 6341 gene locus_tag LOCUS_16460 <7557 6341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839831.1:ATP-binding protein >Feature sequence146 455 994 gene locus_tag LOCUS_16470 455 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1067 1969 gene locus_tag LOCUS_16480 1067 1969 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_16480 3147 1966 gene locus_tag LOCUS_16490 3147 1966 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_16490 3915 3235 gene locus_tag LOCUS_16500 3915 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6165 3919 gene locus_tag LOCUS_16510 6165 3919 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_16510 6742 6158 gene locus_tag LOCUS_16520 6742 6158 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence147 390 1148 gene locus_tag LOCUS_16530 390 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1168 2463 gene locus_tag LOCUS_16540 gene ftsA 1168 2463 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_16540 2492 4018 gene locus_tag LOCUS_16550 2492 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 7307 4173 gene locus_tag LOCUS_16560 7307 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence148 1236 4 gene locus_tag LOCUS_16570 1236 4 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_16570 1391 1852 gene locus_tag LOCUS_16580 1391 1852 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_16580 1921 3573 gene locus_tag LOCUS_16590 1921 3573 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_16590 3779 4069 gene locus_tag LOCUS_16600 3779 4069 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_16600 4284 4439 gene locus_tag LOCUS_16610 4284 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4642 5646 gene locus_tag LOCUS_16620 4642 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence149 543 1538 gene locus_tag LOCUS_16630 gene dusB 543 1538 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_16630 1535 2419 gene locus_tag LOCUS_16640 1535 2419 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_16640 2689 3846 gene locus_tag LOCUS_16650 2689 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3936 5852 gene locus_tag LOCUS_16660 3936 5852 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_16660 5830 6807 gene locus_tag LOCUS_16670 5830 6807 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence150 2 328 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccttgttgtaatggatatgggtttctgac 2003 513 gene locus_tag LOCUS_16680 2003 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4100 2016 gene locus_tag LOCUS_16690 4100 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4685 4107 gene locus_tag LOCUS_16700 4685 4107 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081580.1 protein_id gnl|my_center|LOCUS_16700 6792 4678 gene locus_tag LOCUS_16710 6792 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7362 6802 gene locus_tag LOCUS_16720 7362 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence151 1040 2104 gene locus_tag LOCUS_16730 gene ddlA 1040 2104 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053170.1 protein_id gnl|my_center|LOCUS_16730 2150 2938 gene locus_tag LOCUS_16740 2150 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2952 4799 gene locus_tag LOCUS_16750 2952 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 6053 4803 gene locus_tag LOCUS_16760 6053 4803 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_16760 6679 6050 gene locus_tag LOCUS_16770 6679 6050 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_16770 6759 6833 gene locus_tag LOCUS_t00250 6759 6833 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 2345 1056 gene locus_tag LOCUS_16780 2345 1056 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_16780 3262 2420 gene locus_tag LOCUS_16790 gene pyrF 3262 2420 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_16790 3976 3326 gene locus_tag LOCUS_16800 3976 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6468 3988 gene locus_tag LOCUS_16810 6468 3988 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_16810 <7312 6706 gene locus_tag LOCUS_16820 <7312 6706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963929.1:quinone-dependent dihydroorotate dehydrogenase >Feature sequence153 3657 235 gene locus_tag LOCUS_16830 3657 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3689 4153 gene locus_tag LOCUS_16840 3689 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4612 4160 gene locus_tag LOCUS_16850 4612 4160 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_16850 5847 4609 gene locus_tag LOCUS_16860 gene lysA 5847 4609 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_16860 7004 5982 gene locus_tag LOCUS_16870 7004 5982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence154 98 265 gene locus_tag LOCUS_16880 98 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 255 629 gene locus_tag LOCUS_16890 255 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 824 1069 gene locus_tag LOCUS_16900 824 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1537 2763 gene locus_tag LOCUS_16910 1537 2763 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_16910 2887 3462 gene locus_tag LOCUS_16920 2887 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3614 4120 gene locus_tag LOCUS_16930 3614 4120 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_16930 4229 4576 gene locus_tag LOCUS_16940 4229 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5530 4760 gene locus_tag LOCUS_16950 5530 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6502 5534 gene locus_tag LOCUS_16960 gene arsM 6502 5534 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_16960 <7131 6574 gene locus_tag LOCUS_16970 <7131 6574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099895.1:DEAD/DEAH box helicase >Feature sequence155 1876 893 gene locus_tag LOCUS_16980 1876 893 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_16980 2395 1952 gene locus_tag LOCUS_16990 gene rplI 2395 1952 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_16990 2654 2403 gene locus_tag LOCUS_17000 gene rpsR 2654 2403 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_17000 3019 2651 gene locus_tag LOCUS_17010 gene rpsF 3019 2651 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_17010 7016 3093 gene locus_tag LOCUS_17020 7016 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence156 1287 517 gene locus_tag LOCUS_17030 gene vpsK 1287 517 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_17030 2443 1268 gene locus_tag LOCUS_17040 gene vpsj 2443 1268 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_17040 3740 2436 gene locus_tag LOCUS_17050 3740 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 5872 3737 gene locus_tag LOCUS_17060 5872 3737 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_17060 <7103 5940 gene locus_tag LOCUS_17070 <7103 5940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027075.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence157 1249 878 gene locus_tag LOCUS_17080 gene rbfA 1249 878 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_17080 1298 2806 gene locus_tag LOCUS_17090 1298 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2799 3938 gene locus_tag LOCUS_17100 2799 3938 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_17100 3935 4429 gene locus_tag LOCUS_17110 gene purE 3935 4429 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_17110 4456 5448 gene locus_tag LOCUS_17120 4456 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence158 586 1470 gene locus_tag LOCUS_17130 gene wapR 586 1470 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_17130 3496 1451 gene locus_tag LOCUS_17140 3496 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3578 4393 gene locus_tag LOCUS_17150 gene murI 3578 4393 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_17150 4458 6341 gene locus_tag LOCUS_17160 4458 6341 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_17160 6554 6345 gene locus_tag LOCUS_17170 6554 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence159 383 1252 gene locus_tag LOCUS_17180 383 1252 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_17180 1323 2180 gene locus_tag LOCUS_17190 1323 2180 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_17190 2249 2689 gene locus_tag LOCUS_17200 2249 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2864 4723 gene locus_tag LOCUS_17210 2864 4723 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence160 5741 4563 gene locus_tag LOCUS_17220 5741 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6734 5748 gene locus_tag LOCUS_17230 6734 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence161 1017 2465 gene locus_tag LOCUS_17240 1017 2465 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_17240 2488 3075 gene locus_tag LOCUS_17250 2488 3075 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_17250 3131 3787 gene locus_tag LOCUS_17260 3131 3787 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023562.1 protein_id gnl|my_center|LOCUS_17260 3891 4772 gene locus_tag LOCUS_17270 3891 4772 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 protein_id gnl|my_center|LOCUS_17270 6644 4809 gene locus_tag LOCUS_17280 6644 4809 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence162 1375 143 gene locus_tag LOCUS_17290 1375 143 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_17290 2078 1377 gene locus_tag LOCUS_17300 2078 1377 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_17300 2348 2082 gene locus_tag LOCUS_17310 2348 2082 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_17310 3712 2426 gene locus_tag LOCUS_17320 3712 2426 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_17320 4662 3838 gene locus_tag LOCUS_17330 4662 3838 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_17330 5640 4693 gene locus_tag LOCUS_17340 5640 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5735 6160 gene locus_tag LOCUS_17350 5735 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6170 6385 gene locus_tag LOCUS_17360 6170 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence163 2719 1703 gene locus_tag LOCUS_17370 gene holA 2719 1703 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_17370 2848 3687 gene locus_tag LOCUS_17380 2848 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3730 3816 gene locus_tag LOCUS_t00260 3730 3816 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3885 4700 gene locus_tag LOCUS_17390 3885 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4876 6057 gene locus_tag LOCUS_17400 4876 6057 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_17400 <6814 6117 gene locus_tag LOCUS_17410 <6814 6117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924857.1:tetratricopeptide repeat protein >Feature sequence164 1688 327 gene locus_tag LOCUS_17420 1688 327 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_17420 2808 1672 gene locus_tag LOCUS_17430 gene nahK 2808 1672 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_17430 3973 2792 gene locus_tag LOCUS_17440 3973 2792 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_17440 4197 5003 gene locus_tag LOCUS_17450 gene trxA 4197 5003 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932886.1 protein_id gnl|my_center|LOCUS_17450 5010 5231 gene locus_tag LOCUS_17460 5010 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5239 5625 gene locus_tag LOCUS_17470 5239 5625 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence165 <1 2936 gene locus_tag LOCUS_17480 <1 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765759.1:DUF2723 domain-containing protein 3695 2925 gene locus_tag LOCUS_17490 3695 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3898 4986 gene locus_tag LOCUS_17500 3898 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4986 5732 gene locus_tag LOCUS_17510 gene rlmB 4986 5732 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_17510 <6798 5738 gene locus_tag LOCUS_17520 <6798 5738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791384.1:mannose-1-phosphate guanylyltransferase >Feature sequence166 387 1667 gene locus_tag LOCUS_17530 387 1667 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_17530 2784 1672 gene locus_tag LOCUS_17540 2784 1672 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016475.1 protein_id gnl|my_center|LOCUS_17540 4497 2788 gene locus_tag LOCUS_17550 4497 2788 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_17550 4582 5268 gene locus_tag LOCUS_17560 4582 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 <6782 5274 gene locus_tag LOCUS_17570 <6782 5274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956687.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence167 2328 1177 gene locus_tag LOCUS_17580 2328 1177 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_17580 2372 4285 gene locus_tag LOCUS_17590 2372 4285 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_17590 5214 4288 gene locus_tag LOCUS_17600 5214 4288 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_17600 6685 5345 gene locus_tag LOCUS_17610 6685 5345 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence168 1033 458 gene locus_tag LOCUS_17620 1033 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1196 1666 gene locus_tag LOCUS_17630 1196 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1800 2414 gene locus_tag LOCUS_17640 1800 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2463 3467 gene locus_tag LOCUS_17650 2463 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3594 6116 gene locus_tag LOCUS_17660 gene gyrA 3594 6116 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence169 1875 319 gene locus_tag LOCUS_17670 1875 319 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_17670 1986 3209 gene locus_tag LOCUS_17680 1986 3209 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_17680 3222 4250 gene locus_tag LOCUS_17690 gene lpxD 3222 4250 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_17690 4264 5661 gene locus_tag LOCUS_17700 4264 5661 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_17700 5658 6437 gene locus_tag LOCUS_17710 gene lpxA 5658 6437 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence170 257 1510 gene locus_tag LOCUS_17720 257 1510 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_17720 1637 4684 gene locus_tag LOCUS_17730 gene ccsA 1637 4684 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_17730 5338 4991 gene locus_tag LOCUS_17740 5338 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5562 5335 gene locus_tag LOCUS_17750 5562 5335 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_17750 <6687 5832 gene locus_tag LOCUS_17760 <6687 5832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765309.1:type I DNA topoisomerase >Feature sequence171 1191 2207 gene locus_tag LOCUS_17770 1191 2207 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_17770 2278 4410 gene locus_tag LOCUS_17780 2278 4410 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_17780 6439 5387 gene locus_tag LOCUS_17790 6439 5387 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence172 1196 111 gene locus_tag LOCUS_17800 1196 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2442 1318 gene locus_tag LOCUS_17810 2442 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3408 2596 gene locus_tag LOCUS_17820 3408 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 6018 3412 gene locus_tag LOCUS_17830 6018 3412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_17830 <6656 6022 gene locus_tag LOCUS_17840 <6656 6022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765756.1:FecR domain-containing protein >Feature sequence173 291 692 gene locus_tag LOCUS_17850 gene mce 291 692 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_17850 694 1752 gene locus_tag LOCUS_17860 gene thiL 694 1752 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_17860 <6607 1749 gene locus_tag LOCUS_17870 <6607 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein >Feature sequence174 246 1862 gene locus_tag LOCUS_17880 246 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1914 2663 gene locus_tag LOCUS_17890 1914 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3144 2668 gene locus_tag LOCUS_17900 gene ispF 3144 2668 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_17900 4426 3149 gene locus_tag LOCUS_17910 4426 3149 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_17910 4502 6481 gene locus_tag LOCUS_17920 4502 6481 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence175 3573 3010 gene locus_tag LOCUS_17930 3573 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4665 3715 gene locus_tag LOCUS_17940 4665 3715 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence176 <1 506 gene locus_tag LOCUS_17950 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072442.1:DegT/DnrJ/EryC1/StrS family aminotransferase 587 1741 gene locus_tag LOCUS_17960 587 1741 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_17960 1768 2598 gene locus_tag LOCUS_17970 gene kdsA 1768 2598 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_17970 3011 2637 gene locus_tag LOCUS_17980 3011 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 5344 3008 gene locus_tag LOCUS_17990 5344 3008 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_17990 5588 6094 gene locus_tag LOCUS_18000 5588 6094 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence177 5762 5199 gene locus_tag LOCUS_18010 5762 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence178 1667 927 gene locus_tag LOCUS_18020 1667 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1751 2725 gene locus_tag LOCUS_18030 1751 2725 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_18030 3074 3682 gene locus_tag LOCUS_18040 3074 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3679 4188 gene locus_tag LOCUS_18050 3679 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4288 6462 gene locus_tag LOCUS_18060 4288 6462 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence179 253 2127 gene locus_tag LOCUS_18070 253 2127 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_18070 2279 3184 gene locus_tag LOCUS_18080 2279 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3313 4329 gene locus_tag LOCUS_18090 3313 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4643 4341 gene locus_tag LOCUS_18100 4643 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5542 4805 gene locus_tag LOCUS_18110 5542 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 <6478 5621 gene locus_tag LOCUS_18120 <6478 5621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244177.1:MFS transporter >Feature sequence180 808 892 gene locus_tag LOCUS_t00270 808 892 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1132 2598 gene locus_tag LOCUS_18130 1132 2598 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_18130 2670 2909 gene locus_tag LOCUS_18140 2670 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3357 4532 gene locus_tag LOCUS_18150 3357 4532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence181 284 697 gene locus_tag LOCUS_18160 284 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1408 728 gene locus_tag LOCUS_18170 1408 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2042 1485 gene locus_tag LOCUS_18180 2042 1485 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_18180 2431 2054 gene locus_tag LOCUS_18190 2431 2054 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_18190 3018 2428 gene locus_tag LOCUS_18200 3018 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3390 3127 gene locus_tag LOCUS_18210 gene rpmA 3390 3127 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_18210 3709 3395 gene locus_tag LOCUS_18220 3709 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4180 5175 gene locus_tag LOCUS_18230 4180 5175 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence182 <1 720 gene locus_tag LOCUS_18240 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203365.1:VWA domain-containing protein 824 1702 gene locus_tag LOCUS_18250 824 1702 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_18250 1734 2192 gene locus_tag LOCUS_18260 1734 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2430 2849 gene locus_tag LOCUS_18270 2430 2849 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_18270 5262 2860 gene locus_tag LOCUS_18280 gene thrA 5262 2860 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_18280 <6444 5267 gene locus_tag LOCUS_18290 <6444 5267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932292.1:homoserine O-acetyltransferase >Feature sequence183 610 350 gene locus_tag LOCUS_18300 610 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 895 1239 gene locus_tag LOCUS_18310 895 1239 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_18310 2648 1344 gene locus_tag LOCUS_18320 2648 1344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_18320 3555 2641 gene locus_tag LOCUS_18330 3555 2641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_18330 4515 3628 gene locus_tag LOCUS_18340 4515 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <6431 4606 gene locus_tag LOCUS_18350 <6431 4606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein >Feature sequence184 <1 615 gene locus_tag LOCUS_18360 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764236.1:DUF5683 domain-containing protein 618 1334 gene locus_tag LOCUS_18370 gene dapB 618 1334 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_18370 1406 2569 gene locus_tag LOCUS_18380 1406 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3327 2566 gene locus_tag LOCUS_18390 3327 2566 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_18390 4343 3324 gene locus_tag LOCUS_18400 4343 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4861 4406 gene locus_tag LOCUS_18410 4861 4406 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918221.1 protein_id gnl|my_center|LOCUS_18410 <6422 4865 gene locus_tag LOCUS_18420 <6422 4865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor >Feature sequence185 270 1412 gene locus_tag LOCUS_18430 270 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1459 2349 gene locus_tag LOCUS_18440 1459 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2360 2809 gene locus_tag LOCUS_18450 2360 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3010 4080 gene locus_tag LOCUS_18460 3010 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4289 5440 gene locus_tag LOCUS_18470 4289 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5614 5979 gene locus_tag LOCUS_18480 5614 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence186 1524 652 gene locus_tag LOCUS_18490 1524 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1717 1496 gene locus_tag LOCUS_18500 1717 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2183 1722 gene locus_tag LOCUS_18510 2183 1722 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941066.1 protein_id gnl|my_center|LOCUS_18510 2531 3943 gene locus_tag LOCUS_18520 2531 3943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_18520 4017 4271 gene locus_tag LOCUS_18530 4017 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence187 384 899 gene locus_tag LOCUS_18540 384 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2180 903 gene locus_tag LOCUS_18550 gene tyrS 2180 903 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_18550 2360 3334 gene locus_tag LOCUS_18560 2360 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3340 4110 gene locus_tag LOCUS_18570 3340 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4107 5048 gene locus_tag LOCUS_18580 gene miaA 4107 5048 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_18580 5735 5082 gene locus_tag LOCUS_18590 5735 5082 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963065.1 protein_id gnl|my_center|LOCUS_18590 6117 5932 gene locus_tag LOCUS_18600 6117 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence188 259 1233 gene locus_tag LOCUS_18610 259 1233 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_18610 1244 3553 gene locus_tag LOCUS_18620 1244 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3558 4391 gene locus_tag LOCUS_18630 3558 4391 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_18630 4388 5134 gene locus_tag LOCUS_18640 4388 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence189 <1 695 gene locus_tag LOCUS_18650 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963517.1:gliding motility lipoprotein GldJ 2373 1402 gene locus_tag LOCUS_18660 gene queG 2373 1402 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_18660 3411 2380 gene locus_tag LOCUS_18670 gene ruvB 3411 2380 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_18670 3484 4533 gene locus_tag LOCUS_18680 3484 4533 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_18680 4533 5264 gene locus_tag LOCUS_18690 4533 5264 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130094389.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence190 319 681 gene locus_tag LOCUS_18700 319 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 862 1449 gene locus_tag LOCUS_18710 862 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2998 2003 gene locus_tag LOCUS_18720 2998 2003 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_18720 3103 4122 gene locus_tag LOCUS_18730 gene cas1 3103 4122 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259223.1 protein_id gnl|my_center|LOCUS_18730 4159 5229 gene locus_tag LOCUS_18740 4159 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5244 5648 gene locus_tag LOCUS_18750 5244 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5822 >6151 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcagaaacccatatccattacaacaaggattaagac >Feature sequence191 1516 203 gene locus_tag LOCUS_18760 1516 203 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_18760 1641 3758 gene locus_tag LOCUS_18770 1641 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 <6147 3736 gene locus_tag LOCUS_18780 <6147 3736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177543.1:PAS domain S-box protein >Feature sequence192 <1 915 gene locus_tag LOCUS_18790 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964233.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 908 1498 gene locus_tag LOCUS_18800 908 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1960 1502 gene locus_tag LOCUS_18810 1960 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2778 2044 gene locus_tag LOCUS_18820 2778 2044 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_18820 3616 2738 gene locus_tag LOCUS_18830 3616 2738 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_18830 4007 5911 gene locus_tag LOCUS_18840 4007 5911 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence193 338 3172 gene locus_tag LOCUS_18850 338 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3895 3260 gene locus_tag LOCUS_18860 3895 3260 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218470.1 protein_id gnl|my_center|LOCUS_18860 4927 3908 gene locus_tag LOCUS_18870 4927 3908 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_18870 5909 5022 gene locus_tag LOCUS_18880 5909 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence194 2170 785 gene locus_tag LOCUS_18890 2170 785 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_18890 2283 3725 gene locus_tag LOCUS_18900 2283 3725 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_18900 3722 4870 gene locus_tag LOCUS_18910 gene menC 3722 4870 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence195 <1 1433 gene locus_tag LOCUS_18920 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258696.1:pyridoxal-dependent decarboxylase 1525 2817 gene locus_tag LOCUS_18930 1525 2817 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_18930 2819 3685 gene locus_tag LOCUS_18940 gene tatC 2819 3685 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_18940 3675 4109 gene locus_tag LOCUS_18950 gene rpiB 3675 4109 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_18950 4288 5028 gene locus_tag LOCUS_18960 4288 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5041 5583 gene locus_tag LOCUS_18970 gene rimM 5041 5583 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence196 1226 1906 gene locus_tag LOCUS_18980 1226 1906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_18980 1887 2756 gene locus_tag LOCUS_18990 1887 2756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_18990 2801 3547 gene locus_tag LOCUS_19000 2801 3547 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_19000 4608 3622 gene locus_tag LOCUS_19010 gene gap 4608 3622 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_19010 4948 5020 gene locus_tag LOCUS_t00280 4948 5020 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5074 5319 gene locus_tag LOCUS_19020 5074 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence197 689 2245 gene locus_tag LOCUS_19030 689 2245 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_19030 2242 2943 gene locus_tag LOCUS_19040 2242 2943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809261.1 protein_id gnl|my_center|LOCUS_19040 2962 4032 gene locus_tag LOCUS_19050 2962 4032 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_19050 4129 4464 gene locus_tag LOCUS_19060 4129 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 4556 5524 gene locus_tag LOCUS_19070 gene deoC 4556 5524 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391592.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence198 <1 2554 gene locus_tag LOCUS_19080 <1 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100614127.1:cell surface protein SprA 2658 3035 gene locus_tag LOCUS_19090 gene gcvH 2658 3035 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_19090 3025 3423 gene locus_tag LOCUS_19100 3025 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3501 4160 gene locus_tag LOCUS_19110 3501 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4351 5028 gene locus_tag LOCUS_19120 4351 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 <5946 5064 gene locus_tag LOCUS_19130 <5946 5064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962521.1:YicC family protein >Feature sequence199 258 1493 gene locus_tag LOCUS_19140 258 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_19140 1671 4892 gene locus_tag LOCUS_19150 1671 4892 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence200 1166 771 gene locus_tag LOCUS_19160 1166 771 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_19160 1840 1169 gene locus_tag LOCUS_19170 1840 1169 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_19170 2787 1852 gene locus_tag LOCUS_19180 2787 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4504 2879 gene locus_tag LOCUS_19190 4504 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 <5905 4530 gene locus_tag LOCUS_19200 <5905 4530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962684.1:tetratricopeptide repeat protein >Feature sequence201 <1 917 gene locus_tag LOCUS_19210 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338265.1:hydrogenase small subunit 941 2674 gene locus_tag LOCUS_19220 941 2674 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_19220 2692 3396 gene locus_tag LOCUS_19230 gene cybH 2692 3396 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_19230 3400 3930 gene locus_tag LOCUS_19240 3400 3930 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296886.1 protein_id gnl|my_center|LOCUS_19240 4552 4061 gene locus_tag LOCUS_19250 4552 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence202 <1 926 gene locus_tag LOCUS_19260 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404472.1:DUF5103 domain-containing protein 1659 904 gene locus_tag LOCUS_19270 1659 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2980 1883 gene locus_tag LOCUS_19280 gene ychF 2980 1883 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_19280 3439 3092 gene locus_tag LOCUS_19290 3439 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3580 4509 gene locus_tag LOCUS_19300 3580 4509 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_19300 4825 4514 gene locus_tag LOCUS_19310 4825 4514 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence203 2127 961 gene locus_tag LOCUS_19320 2127 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2248 3882 gene locus_tag LOCUS_19330 2248 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4152 3883 gene locus_tag LOCUS_19340 4152 3883 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_19340 <5831 4154 gene locus_tag LOCUS_19350 <5831 4154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061562.1:aldehyde dehydrogenase family protein >Feature sequence204 <1 1815 gene locus_tag LOCUS_19360 <1 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:TonB-dependent receptor 1812 3257 gene locus_tag LOCUS_19370 1812 3257 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_19370 3920 3309 gene locus_tag LOCUS_19380 3920 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4717 4052 gene locus_tag LOCUS_19390 gene ung 4717 4052 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_19390 4978 5262 gene locus_tag LOCUS_19400 4978 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19400 >Feature sequence205 564 2438 gene locus_tag LOCUS_19410 gene dnaK 564 2438 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence206 330 2462 gene locus_tag LOCUS_19420 330 2462 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_19420 2475 5594 gene locus_tag LOCUS_19430 2475 5594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence207 948 280 gene locus_tag LOCUS_19440 gene nth 948 280 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_19440 1179 970 gene locus_tag LOCUS_19450 1179 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1750 1154 gene locus_tag LOCUS_19460 1750 1154 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_19460 1991 4801 gene locus_tag LOCUS_19470 gene uvrA 1991 4801 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence208 1169 408 gene locus_tag LOCUS_19480 1169 408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_19480 1422 3023 gene locus_tag LOCUS_19490 1422 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3023 3880 gene locus_tag LOCUS_19500 3023 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3961 4362 gene locus_tag LOCUS_19510 3961 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 4444 4860 gene locus_tag LOCUS_19520 4444 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence209 1269 475 gene locus_tag LOCUS_19530 1269 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2863 1253 gene locus_tag LOCUS_19540 2863 1253 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_19540 3058 4212 gene locus_tag LOCUS_19550 gene egtB 3058 4212 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921716.1 protein_id gnl|my_center|LOCUS_19550 4257 5153 gene locus_tag LOCUS_19560 gene egtD 4257 5153 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_19560 5177 5458 gene locus_tag LOCUS_19570 5177 5458 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence210 347 694 gene locus_tag LOCUS_19580 347 694 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_19580 744 1853 gene locus_tag LOCUS_19590 744 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1916 3223 gene locus_tag LOCUS_19600 1916 3223 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_19600 3226 4131 gene locus_tag LOCUS_19610 3226 4131 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_19610 4136 5449 gene locus_tag LOCUS_19620 4136 5449 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence211 773 12 gene locus_tag LOCUS_19630 773 12 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_19630 1142 780 gene locus_tag LOCUS_19640 1142 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1187 1876 gene locus_tag LOCUS_19650 1187 1876 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_19650 2240 1926 gene locus_tag LOCUS_19660 2240 1926 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_19660 2544 2245 gene locus_tag LOCUS_19670 2544 2245 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_19670 5318 2763 gene locus_tag LOCUS_19680 5318 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence212 587 1615 gene locus_tag LOCUS_19690 587 1615 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_19690 1695 2381 gene locus_tag LOCUS_19700 1695 2381 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_19700 2378 3421 gene locus_tag LOCUS_19710 2378 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3405 4127 gene locus_tag LOCUS_19720 3405 4127 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_19720 4408 4124 gene locus_tag LOCUS_19730 4408 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 <5591 4523 gene locus_tag LOCUS_19740 <5591 4523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963204.1:adenine deaminase >Feature sequence213 534 1217 gene locus_tag LOCUS_19750 534 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1198 1551 gene locus_tag LOCUS_19760 1198 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1560 1973 gene locus_tag LOCUS_19770 1560 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5137 2012 gene locus_tag LOCUS_19780 5137 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence214 <1 1192 gene locus_tag LOCUS_19790 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase 1227 1817 gene locus_tag LOCUS_19800 1227 1817 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_19800 1826 2920 gene locus_tag LOCUS_19810 1826 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2917 3153 gene locus_tag LOCUS_19820 gene moaD 2917 3153 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 protein_id gnl|my_center|LOCUS_19820 3155 3574 gene locus_tag LOCUS_19830 3155 3574 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_19830 3675 4205 gene locus_tag LOCUS_19840 3675 4205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_19840 4459 4725 gene locus_tag LOCUS_19850 4459 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4680 5294 gene locus_tag LOCUS_19860 4680 5294 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence215 837 1970 gene locus_tag LOCUS_19870 837 1970 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_19870 2042 2236 gene locus_tag LOCUS_19880 gene rpsU 2042 2236 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_19880 2387 3262 gene locus_tag LOCUS_19890 gene xerC 2387 3262 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_19890 3291 3587 gene locus_tag LOCUS_19900 3291 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4945 3692 gene locus_tag LOCUS_19910 gene metK 4945 3692 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_19910 5277 5038 gene locus_tag LOCUS_19920 5277 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence216 1336 617 gene locus_tag LOCUS_19930 1336 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3342 1336 gene locus_tag LOCUS_19940 3342 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4897 3449 gene locus_tag LOCUS_19950 4897 3449 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195154.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence217 689 228 gene locus_tag LOCUS_19960 gene coaD 689 228 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_19960 1573 686 gene locus_tag LOCUS_19970 1573 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2392 1574 gene locus_tag LOCUS_19980 2392 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2931 2458 gene locus_tag LOCUS_19990 2931 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3037 3468 gene locus_tag LOCUS_20000 3037 3468 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_20000 3468 4880 gene locus_tag LOCUS_20010 3468 4880 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_20010 5071 5262 gene locus_tag LOCUS_20020 5071 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence218 1022 813 gene locus_tag LOCUS_20030 1022 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1432 2115 gene locus_tag LOCUS_20040 1432 2115 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_20040 2124 4046 gene locus_tag LOCUS_20050 2124 4046 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_20050 4156 4908 gene locus_tag LOCUS_20060 4156 4908 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence219 185 628 gene locus_tag LOCUS_20070 gene rplM 185 628 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_20070 633 1019 gene locus_tag LOCUS_20080 gene rpsI 633 1019 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_20080 1129 1878 gene locus_tag LOCUS_20090 gene rpsB 1129 1878 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_20090 1981 2817 gene locus_tag LOCUS_20100 gene tsf 1981 2817 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_20100 4632 3358 gene locus_tag LOCUS_20110 4632 3358 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_20110 5111 4647 gene locus_tag LOCUS_20120 5111 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence220 1387 2028 gene locus_tag LOCUS_20130 1387 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2941 2042 gene locus_tag LOCUS_20140 gene xerD 2941 2042 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_20140 3027 3452 gene locus_tag LOCUS_20150 gene aroQ 3027 3452 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_20150 3462 4040 gene locus_tag LOCUS_20160 3462 4040 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_20160 4033 4506 gene locus_tag LOCUS_20170 gene rnhA 4033 4506 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence221 968 165 gene locus_tag LOCUS_20180 968 165 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_20180 3347 981 gene locus_tag LOCUS_20190 3347 981 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_20190 3815 3351 gene locus_tag LOCUS_20200 3815 3351 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_20200 4234 3842 gene locus_tag LOCUS_20210 4234 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence222 310 1467 gene locus_tag LOCUS_20220 310 1467 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_20220 1483 3735 gene locus_tag LOCUS_20230 1483 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5130 3745 gene locus_tag LOCUS_20240 5130 3745 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence223 1318 854 gene locus_tag LOCUS_20250 1318 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2628 1369 gene locus_tag LOCUS_20260 gene fahA 2628 1369 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_20260 3798 2647 gene locus_tag LOCUS_20270 gene hppD 3798 2647 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_20270 4970 3816 gene locus_tag LOCUS_20280 4970 3816 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence224 1318 737 gene locus_tag LOCUS_20290 1318 737 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_20290 1432 2226 gene locus_tag LOCUS_20300 1432 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2248 2898 gene locus_tag LOCUS_20310 2248 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3265 2918 gene locus_tag LOCUS_20320 3265 2918 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_20320 4854 3262 gene locus_tag LOCUS_20330 4854 3262 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_20330 5095 4892 gene locus_tag LOCUS_20340 5095 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence225 275 724 gene locus_tag LOCUS_20350 275 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 752 1468 gene locus_tag LOCUS_20360 752 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1604 2638 gene locus_tag LOCUS_20370 1604 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3472 2708 gene locus_tag LOCUS_20380 3472 2708 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_20380 3609 4865 gene locus_tag LOCUS_20390 3609 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence226 1707 541 gene locus_tag LOCUS_20400 1707 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3000 1828 gene locus_tag LOCUS_20410 3000 1828 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_20410 4754 2997 gene locus_tag LOCUS_20420 gene asnB 4754 2997 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence227 227 1498 gene locus_tag LOCUS_20430 227 1498 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_20430 3812 1470 gene locus_tag LOCUS_20440 3812 1470 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_20440 4479 3820 gene locus_tag LOCUS_20450 gene rpe 4479 3820 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_20450 <5113 4476 gene locus_tag LOCUS_20460 <5113 4476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963873.1:S8 family serine peptidase >Feature sequence228 <1 1111 gene locus_tag LOCUS_20470 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767220.1:methionine--tRNA ligase 1148 1408 gene locus_tag LOCUS_20480 1148 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1423 3306 gene locus_tag LOCUS_20490 1423 3306 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_20490 3314 4513 gene locus_tag LOCUS_20500 3314 4513 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788673.1 protein_id gnl|my_center|LOCUS_20500 <5057 4510 gene locus_tag LOCUS_20510 <5057 4510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785758.1:aminoacyl-tRNA hydrolase >Feature sequence229 189 2612 gene locus_tag LOCUS_20520 189 2612 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_20520 2846 3898 gene locus_tag LOCUS_20530 2846 3898 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_20530 4447 3929 gene locus_tag LOCUS_20540 4447 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5036 4476 gene locus_tag LOCUS_20550 5036 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence230 88 2034 gene locus_tag LOCUS_20560 gene nosZ 88 2034 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_20560 2142 2741 gene locus_tag LOCUS_20570 2142 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_20570 2738 3166 gene locus_tag LOCUS_20580 2738 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3252 4484 gene locus_tag LOCUS_20590 3252 4484 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence231 1655 180 gene locus_tag LOCUS_20600 gene proS 1655 180 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_20600 1776 3071 gene locus_tag LOCUS_20610 1776 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3129 4658 gene locus_tag LOCUS_20620 3129 4658 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence232 2234 762 gene locus_tag LOCUS_20630 gene lpdA 2234 762 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_20630 2435 2247 gene locus_tag LOCUS_20640 2435 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2546 2785 gene locus_tag LOCUS_20650 2546 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2927 3610 gene locus_tag LOCUS_20660 gene fsa 2927 3610 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_20660 3614 3820 gene locus_tag LOCUS_20670 3614 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3817 4515 gene locus_tag LOCUS_20680 3817 4515 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence233 890 351 gene locus_tag LOCUS_20690 890 351 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_20690 1649 1137 gene locus_tag LOCUS_20700 1649 1137 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_20700 2101 1748 gene locus_tag LOCUS_20710 2101 1748 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_20710 2803 2210 gene locus_tag LOCUS_20720 2803 2210 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_20720 4824 2872 gene locus_tag LOCUS_20730 4824 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence234 <1 1068 gene locus_tag LOCUS_20740 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA 1065 1424 gene locus_tag LOCUS_20750 1065 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1616 1428 gene locus_tag LOCUS_20760 1616 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2424 1624 gene locus_tag LOCUS_20770 2424 1624 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_20770 2921 2421 gene locus_tag LOCUS_20780 gene dfrA 2921 2421 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_20780 3916 2978 gene locus_tag LOCUS_20790 gene fmt 3916 2978 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence235 2800 2555 gene locus_tag LOCUS_20800 2800 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3371 2814 gene locus_tag LOCUS_20810 3371 2814 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_20810 3929 3375 gene locus_tag LOCUS_20820 3929 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4311 3979 gene locus_tag LOCUS_20830 4311 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 <4954 4330 gene locus_tag LOCUS_20840 <4954 4330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394318.1:heme-copper oxidase subunit III family protein >Feature sequence236 <1 1208 gene locus_tag LOCUS_20850 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein 1778 1296 gene locus_tag LOCUS_20860 1778 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2498 1806 gene locus_tag LOCUS_20870 2498 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4528 2663 gene locus_tag LOCUS_20880 gene bchD 4528 2663 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932965.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence237 995 513 gene locus_tag LOCUS_20890 995 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2089 1001 gene locus_tag LOCUS_20900 gene gcvT 2089 1001 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_20900 3058 2174 gene locus_tag LOCUS_20910 3058 2174 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 protein_id gnl|my_center|LOCUS_20910 3880 3122 gene locus_tag LOCUS_20920 3880 3122 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence238 568 1968 gene locus_tag LOCUS_20930 568 1968 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_20930 2092 2736 gene locus_tag LOCUS_20940 2092 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2902 4404 gene locus_tag LOCUS_20950 2902 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence239 <1 1903 gene locus_tag LOCUS_20960 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838773.1:lamin tail domain-containing protein 3738 2056 gene locus_tag LOCUS_20970 gene asnB 3738 2056 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_20970 3800 4567 gene locus_tag LOCUS_20980 3800 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence240 1213 224 gene locus_tag LOCUS_20990 1213 224 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_20990 3354 1210 gene locus_tag LOCUS_21000 gene rnr 3354 1210 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_21000 4123 3404 gene locus_tag LOCUS_21010 4123 3404 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence241 <1 2716 gene locus_tag LOCUS_21020 <1 2716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922114.1:hydantoinase B/oxoprolinase family protein 3337 3125 gene locus_tag LOCUS_21030 3337 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4545 3625 gene locus_tag LOCUS_21040 4545 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence242 856 32 gene locus_tag LOCUS_21050 856 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1148 819 gene locus_tag LOCUS_21060 1148 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1235 2059 gene locus_tag LOCUS_21070 1235 2059 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_21070 4191 2071 gene locus_tag LOCUS_21080 4191 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4458 4306 gene locus_tag LOCUS_21090 4458 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence243 77 1579 gene locus_tag LOCUS_21100 77 1579 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_21100 1670 2032 gene locus_tag LOCUS_21110 1670 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3260 2013 gene locus_tag LOCUS_21120 3260 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4456 3260 gene locus_tag LOCUS_21130 gene kbl 4456 3260 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence244 90 1337 gene locus_tag LOCUS_21140 90 1337 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_21140 1387 2100 gene locus_tag LOCUS_21150 1387 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2756 2097 gene locus_tag LOCUS_21160 gene trmB 2756 2097 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_21160 3994 2756 gene locus_tag LOCUS_21170 3994 2756 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence245 479 147 gene locus_tag LOCUS_21180 479 147 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_21180 1390 617 gene locus_tag LOCUS_21190 1390 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2336 1470 gene locus_tag LOCUS_21200 2336 1470 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444000.1 protein_id gnl|my_center|LOCUS_21200 2482 2847 gene locus_tag LOCUS_21210 2482 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2989 3234 gene locus_tag LOCUS_21220 2989 3234 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_21220 <4706 3301 gene locus_tag LOCUS_21230 <4706 3301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943871.1:NapC/NirT family cytochrome c >Feature sequence246 507 1154 gene locus_tag LOCUS_21240 507 1154 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_21240 1161 1691 gene locus_tag LOCUS_21250 1161 1691 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_21250 1684 2136 gene locus_tag LOCUS_21260 1684 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4377 2191 gene locus_tag LOCUS_21270 4377 2191 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence247 <1 1515 gene locus_tag LOCUS_21280 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096463.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1666 2412 gene locus_tag LOCUS_21290 1666 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2381 2854 gene locus_tag LOCUS_21300 2381 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2847 3218 gene locus_tag LOCUS_21310 2847 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence248 1157 2287 gene locus_tag LOCUS_21320 gene tgt 1157 2287 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_21320 2287 3360 gene locus_tag LOCUS_21330 2287 3360 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_21330 3357 4241 gene locus_tag LOCUS_21340 3357 4241 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120520.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence249 >Feature sequence250 2921 3361 gene locus_tag LOCUS_21350 2921 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3410 3484 gene locus_tag LOCUS_t00290 3410 3484 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4373 3681 gene locus_tag LOCUS_21360 4373 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence251 1486 281 gene locus_tag LOCUS_21370 1486 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_21370 2474 1479 gene locus_tag LOCUS_21380 2474 1479 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_21380 2627 3271 gene locus_tag LOCUS_21390 2627 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 <4564 3638 gene locus_tag LOCUS_21400 <4564 3638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404173.1:GntG family PLP-dependent aldolase >Feature sequence252 590 1285 gene locus_tag LOCUS_21410 590 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1404 2063 gene locus_tag LOCUS_21420 1404 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2066 2719 gene locus_tag LOCUS_21430 2066 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2808 3020 gene locus_tag LOCUS_21440 2808 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3024 3347 gene locus_tag LOCUS_21450 3024 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3350 4381 gene locus_tag LOCUS_21460 3350 4381 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence253 432 947 gene locus_tag LOCUS_21470 432 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 944 2761 gene locus_tag LOCUS_21480 gene mrdA 944 2761 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_21480 2761 4032 gene locus_tag LOCUS_21490 gene rodA 2761 4032 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence254 368 3217 gene locus_tag LOCUS_21500 368 3217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_21500 3325 4383 gene locus_tag LOCUS_21510 gene bchI 3325 4383 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932966.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence255 <1 533 gene locus_tag LOCUS_21520 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405413.1:UDP-glucose/GDP-mannose dehydrogenase family protein 523 1518 gene locus_tag LOCUS_21530 523 1518 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_21530 1515 2522 gene locus_tag LOCUS_21540 gene galE 1515 2522 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_21540 2740 3069 gene locus_tag LOCUS_21550 2740 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 <4482 3372 gene locus_tag LOCUS_21560 <4482 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203483.1:Fic family protein >Feature sequence256 2704 3012 gene locus_tag LOCUS_21570 2704 3012 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_21570 4343 3132 gene locus_tag LOCUS_21580 4343 3132 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815235.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence257 4035 2773 gene locus_tag LOCUS_21590 4035 2773 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence258 230 1201 gene locus_tag LOCUS_21600 230 1201 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_21600 1207 2994 gene locus_tag LOCUS_21610 gene argS 1207 2994 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_21610 3026 3574 gene locus_tag LOCUS_21620 3026 3574 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence259 62 1312 gene locus_tag LOCUS_21630 62 1312 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404136.1 protein_id gnl|my_center|LOCUS_21630 1309 1752 gene locus_tag LOCUS_21640 1309 1752 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_21640 1745 2104 gene locus_tag LOCUS_21650 1745 2104 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_21650 2174 2563 gene locus_tag LOCUS_21660 2174 2563 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_21660 2603 3556 gene locus_tag LOCUS_21670 2603 3556 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_21670 4042 3599 gene locus_tag LOCUS_21680 4042 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence260 2582 1779 gene locus_tag LOCUS_21690 2582 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2861 2589 gene locus_tag LOCUS_21700 2861 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 <4376 2950 gene locus_tag LOCUS_21710 <4376 2950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072530.1:long-chain-fatty-acid--CoA ligase FadD >Feature sequence261 2669 519 gene locus_tag LOCUS_21720 gene katG 2669 519 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_21720 2893 3825 gene locus_tag LOCUS_21730 2893 3825 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence262 73 969 gene locus_tag LOCUS_21740 73 969 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_21740 972 2144 gene locus_tag LOCUS_21750 972 2144 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_21750 2710 2135 gene locus_tag LOCUS_21760 2710 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2743 3888 gene locus_tag LOCUS_21770 2743 3888 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence263 478 936 gene locus_tag LOCUS_21780 478 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 <4331 1510 gene locus_tag LOCUS_21790 <4331 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence264 365 1048 gene locus_tag LOCUS_21800 365 1048 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_21800 1437 1045 gene locus_tag LOCUS_21810 1437 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3117 1804 gene locus_tag LOCUS_21820 gene mtaB 3117 1804 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_21820 3866 3270 gene locus_tag LOCUS_21830 3866 3270 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence265 946 638 gene locus_tag LOCUS_21840 946 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1286 939 gene locus_tag LOCUS_21850 1286 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2719 1298 gene locus_tag LOCUS_21860 2719 1298 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_21860 4219 2723 gene locus_tag LOCUS_21870 4219 2723 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence266 1989 1324 gene locus_tag LOCUS_21880 1989 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence267 420 85 gene locus_tag LOCUS_21890 420 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 590 958 gene locus_tag LOCUS_21900 590 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1017 1640 gene locus_tag LOCUS_21910 1017 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1663 1992 gene locus_tag LOCUS_21920 1663 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21920 2002 3651 gene locus_tag LOCUS_21930 gene merA 2002 3651 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_21930 3664 3888 gene locus_tag LOCUS_21940 3664 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence268 149 517 gene locus_tag LOCUS_21950 149 517 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_21950 544 990 gene locus_tag LOCUS_21960 544 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 975 1937 gene locus_tag LOCUS_21970 975 1937 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_21970 1988 3139 gene locus_tag LOCUS_21980 1988 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3147 4235 gene locus_tag LOCUS_21990 3147 4235 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence269 1233 1066 gene locus_tag LOCUS_22000 1233 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1484 1305 gene locus_tag LOCUS_22010 1484 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 <4281 3399 gene locus_tag LOCUS_22020 <4281 3399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404722.1:S46 family peptidase >Feature sequence270 297 1259 gene locus_tag LOCUS_22030 297 1259 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_22030 1266 1778 gene locus_tag LOCUS_22040 1266 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2951 1806 gene locus_tag LOCUS_22050 2951 1806 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_22050 3727 3026 gene locus_tag LOCUS_22060 3727 3026 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence271 922 182 gene locus_tag LOCUS_22070 922 182 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_22070 1026 1409 gene locus_tag LOCUS_22080 1026 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1887 3041 gene locus_tag LOCUS_22090 1887 3041 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_22090 3204 3707 gene locus_tag LOCUS_22100 3204 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence272 1036 1260 gene locus_tag LOCUS_22110 1036 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1250 2269 gene locus_tag LOCUS_22120 1250 2269 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_22120 2278 3411 gene locus_tag LOCUS_22130 2278 3411 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_22130 3404 3982 gene locus_tag LOCUS_22140 3404 3982 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence273 <1 1895 gene locus_tag LOCUS_22150 <1 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:YfhO family protein 1897 2664 gene locus_tag LOCUS_22160 1897 2664 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_22160 3264 2971 gene locus_tag LOCUS_22170 3264 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3530 3264 gene locus_tag LOCUS_22180 3530 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence274 1119 736 gene locus_tag LOCUS_22190 1119 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1277 2215 gene locus_tag LOCUS_22200 1277 2215 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22200 2228 3325 gene locus_tag LOCUS_22210 2228 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence275 22 321 gene locus_tag LOCUS_22220 22 321 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_22220 990 325 gene locus_tag LOCUS_22230 990 325 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_22230 2276 1002 gene locus_tag LOCUS_22240 2276 1002 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_22240 3167 2334 gene locus_tag LOCUS_22250 3167 2334 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_22250 3357 3148 gene locus_tag LOCUS_22260 3357 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 <4166 3332 gene locus_tag LOCUS_22270 <4166 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840143.1:CPBP family intramembrane metalloprotease >Feature sequence276 462 1502 gene locus_tag LOCUS_22280 462 1502 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_22280 1565 2164 gene locus_tag LOCUS_22290 1565 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2299 2171 gene locus_tag LOCUS_22300 2299 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 4034 2673 gene locus_tag LOCUS_22310 gene radA 4034 2673 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence277 129 848 gene locus_tag LOCUS_22320 129 848 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_22320 848 2470 gene locus_tag LOCUS_22330 848 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3105 2488 gene locus_tag LOCUS_22340 3105 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3754 3419 gene locus_tag LOCUS_22350 3754 3419 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_22350 3960 3751 gene locus_tag LOCUS_22360 3960 3751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence278 1788 538 gene locus_tag LOCUS_22370 gene hemA 1788 538 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_22370 1939 2961 gene locus_tag LOCUS_22380 gene hemH 1939 2961 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence279 2189 489 gene locus_tag LOCUS_22390 gene ggt 2189 489 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_22390 2348 2977 gene locus_tag LOCUS_22400 2348 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3637 2981 gene locus_tag LOCUS_22410 3637 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence280 2472 559 gene locus_tag LOCUS_22420 2472 559 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_22420 3571 2504 gene locus_tag LOCUS_22430 3571 2504 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence281 1474 182 gene locus_tag LOCUS_22440 1474 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1600 3555 gene locus_tag LOCUS_22450 gene gyrB 1600 3555 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence282 504 1121 gene locus_tag LOCUS_22460 504 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1158 1757 gene locus_tag LOCUS_22470 1158 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2386 1754 gene locus_tag LOCUS_22480 2386 1754 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence283 1131 49 gene locus_tag LOCUS_22490 1131 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2430 1567 gene locus_tag LOCUS_22500 2430 1567 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_22500 3322 2414 gene locus_tag LOCUS_22510 3322 2414 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence284 1555 275 gene locus_tag LOCUS_22520 1555 275 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_22520 <3948 1600 gene locus_tag LOCUS_22530 <3948 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:amidohydrolase family protein >Feature sequence285 2317 1835 gene locus_tag LOCUS_22540 2317 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2895 2410 gene locus_tag LOCUS_22550 2895 2410 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_22550 <3944 2874 gene locus_tag LOCUS_22560 <3944 2874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964125.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence286 <1 635 gene locus_tag LOCUS_22570 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963857.1:DUF1684 domain-containing protein 645 998 gene locus_tag LOCUS_22580 645 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 <3940 1074 gene locus_tag LOCUS_22590 <3940 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000427085.1:M4 family metallopeptidase >Feature sequence287 1780 1070 gene locus_tag LOCUS_22600 1780 1070 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_22600 2287 1970 gene locus_tag LOCUS_22610 2287 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2456 2959 gene locus_tag LOCUS_22620 gene tpx 2456 2959 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_22620 2975 3388 gene locus_tag LOCUS_22630 2975 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence288 1121 903 gene locus_tag LOCUS_22640 1121 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2062 1253 gene locus_tag LOCUS_22650 2062 1253 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_22650 <3908 2142 gene locus_tag LOCUS_22660 <3908 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880400.1:carbamoyltransferase HypF >Feature sequence289 1132 2538 gene locus_tag LOCUS_22670 gene rlmD 1132 2538 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_22670 2541 2912 gene locus_tag LOCUS_22680 2541 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2916 3863 gene locus_tag LOCUS_22690 2916 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence290 1866 325 gene locus_tag LOCUS_22700 1866 325 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_22700 2221 1868 gene locus_tag LOCUS_22710 2221 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2351 3118 gene locus_tag LOCUS_22720 2351 3118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_22720 3318 3659 gene locus_tag LOCUS_22730 3318 3659 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence291 1659 37 gene locus_tag LOCUS_22740 1659 37 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_22740 2347 1643 gene locus_tag LOCUS_22750 2347 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2438 3004 gene locus_tag LOCUS_22760 2438 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139517245.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence292 1396 2073 gene locus_tag LOCUS_22770 gene cmk 1396 2073 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_22770 2073 2942 gene locus_tag LOCUS_22780 2073 2942 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence293 2911 1532 gene locus_tag LOCUS_22790 2911 1532 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence294 <1 635 gene locus_tag LOCUS_22800 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034099202.1:PorV/PorQ family protein >Feature sequence295 793 2133 gene locus_tag LOCUS_22810 gene nqrF 793 2133 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_22810 2143 3303 gene locus_tag LOCUS_22820 2143 3303 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence296 <1 684 gene locus_tag LOCUS_22830 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:glycoside hydrolase family 3 N-terminal domain-containing protein 2318 1089 gene locus_tag LOCUS_22840 gene aroA 2318 1089 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_22840 2437 2634 gene locus_tag LOCUS_22850 2437 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3679 2627 gene locus_tag LOCUS_22860 gene aroB 3679 2627 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence297 <1 953 gene locus_tag LOCUS_22870 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791866.1:trigger factor 1051 1719 gene locus_tag LOCUS_22880 gene clpP 1051 1719 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_22880 1760 2980 gene locus_tag LOCUS_22890 gene clpX 1760 2980 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_22890 <3752 2986 gene locus_tag LOCUS_22900 <3752 2986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin domain-containing protein >Feature sequence298 181 1284 gene locus_tag LOCUS_22910 gene wecB 181 1284 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_22910 1284 2519 gene locus_tag LOCUS_22920 1284 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2874 3692 gene locus_tag LOCUS_22930 2874 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence299 >Feature sequence300 886 593 gene locus_tag LOCUS_22940 gene trxA 886 593 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_22940 2041 935 gene locus_tag LOCUS_22950 2041 935 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_22950 2952 2038 gene locus_tag LOCUS_22960 2952 2038 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_22960 <3711 2922 gene locus_tag LOCUS_22970 <3711 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962425.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence301 2706 2506 gene locus_tag LOCUS_22980 2706 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence302 270 58 gene locus_tag LOCUS_22990 270 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 154 2385 gene locus_tag LOCUS_23000 154 2385 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_23000 <3674 2990 gene locus_tag LOCUS_23010 <3674 2990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000422110.1:TerC family protein >Feature sequence303 555 3653 gene locus_tag LOCUS_23020 555 3653 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence304 1391 627 gene locus_tag LOCUS_23030 1391 627 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_23030 2101 1388 gene locus_tag LOCUS_23040 2101 1388 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_23040 2164 2619 gene locus_tag LOCUS_23050 2164 2619 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_23050 2616 3146 gene locus_tag LOCUS_23060 2616 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence305 1154 1081 gene locus_tag LOCUS_t00300 1154 1081 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1352 2200 gene locus_tag LOCUS_23070 gene era 1352 2200 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_23070 2204 3508 gene locus_tag LOCUS_23080 gene der 2204 3508 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence306 1389 2045 gene locus_tag LOCUS_23090 1389 2045 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_23090 2042 2962 gene locus_tag LOCUS_23100 2042 2962 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868717.1 protein_id gnl|my_center|LOCUS_23100 3137 3577 gene locus_tag LOCUS_23110 3137 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence307 1372 101 gene locus_tag LOCUS_23120 1372 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1432 2415 gene locus_tag LOCUS_23130 gene meaB 1432 2415 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_23130 2420 3367 gene locus_tag LOCUS_23140 2420 3367 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence308 1480 116 gene locus_tag LOCUS_23150 1480 116 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_23150 2570 1563 gene locus_tag LOCUS_23160 2570 1563 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_23160 3261 2665 gene locus_tag LOCUS_23170 3261 2665 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence309 1353 1 gene locus_tag LOCUS_23180 1353 1 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_23180 2287 1415 gene locus_tag LOCUS_23190 2287 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2732 3211 gene locus_tag LOCUS_23200 2732 3211 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence310 2160 304 gene locus_tag LOCUS_23210 2160 304 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_23210 3554 2310 gene locus_tag LOCUS_23220 3554 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence311 1346 90 gene locus_tag LOCUS_23230 gene sufD 1346 90 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 protein_id gnl|my_center|LOCUS_23230 2107 1346 gene locus_tag LOCUS_23240 gene sufC 2107 1346 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_23240 3565 2120 gene locus_tag LOCUS_23250 gene sufB 3565 2120 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence312 >Feature sequence313 1848 148 gene locus_tag LOCUS_23260 1848 148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_23260 2892 1858 gene locus_tag LOCUS_23270 2892 1858 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_23270 3557 2889 gene locus_tag LOCUS_23280 3557 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence314 201 1166 gene locus_tag LOCUS_23290 201 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2411 1191 gene locus_tag LOCUS_23300 2411 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 <3535 2544 gene locus_tag LOCUS_23310 <3535 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962368.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence315 1875 1351 gene locus_tag LOCUS_23320 1875 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1983 3116 gene locus_tag LOCUS_23330 1983 3116 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence316 141 247 gene locus_tag LOCUS_r00020 141 247 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1684 425 gene locus_tag LOCUS_23340 1684 425 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_23340 2924 1686 gene locus_tag LOCUS_23350 gene porV 2924 1686 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_23350 <3526 2931 gene locus_tag LOCUS_23360 <3526 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:type IX secretion system sortase PorU >Feature sequence317 303 602 gene locus_tag LOCUS_23370 303 602 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_23370 661 1410 gene locus_tag LOCUS_23380 661 1410 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_23380 1446 2441 gene locus_tag LOCUS_23390 1446 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2434 3039 gene locus_tag LOCUS_23400 2434 3039 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence318 854 492 gene locus_tag LOCUS_23410 854 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 983 2329 gene locus_tag LOCUS_23420 983 2329 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_23420 2391 3032 gene locus_tag LOCUS_23430 2391 3032 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence319 159 575 gene locus_tag LOCUS_23440 159 575 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_23440 685 1080 gene locus_tag LOCUS_23450 685 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1137 3038 gene locus_tag LOCUS_23460 1137 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3123 3398 gene locus_tag LOCUS_23470 gene rpsO 3123 3398 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence320 1174 1428 gene locus_tag LOCUS_23480 1174 1428 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_23480 1425 1682 gene locus_tag LOCUS_23490 1425 1682 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_23490 2066 1722 gene locus_tag LOCUS_23500 2066 1722 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_23500 2919 2068 gene locus_tag LOCUS_23510 2919 2068 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence321 1163 144 gene locus_tag LOCUS_23520 gene pheS 1163 144 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_23520 2328 1216 gene locus_tag LOCUS_23530 2328 1216 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_23530 <3471 2318 gene locus_tag LOCUS_23540 <3471 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964563.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence322 38 2917 gene locus_tag LOCUS_23550 38 2917 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence323 <1 1429 gene locus_tag LOCUS_23560 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence324 452 1558 gene locus_tag LOCUS_23570 452 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1640 3199 gene locus_tag LOCUS_23580 1640 3199 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence325 <1 1958 gene locus_tag LOCUS_23590 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962764.1:ATP-dependent zinc metalloprotease FtsH 1979 2764 gene locus_tag LOCUS_23600 1979 2764 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence326 112 366 gene locus_tag LOCUS_23610 112 366 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_23610 356 787 gene locus_tag LOCUS_23620 356 787 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_23620 909 1415 gene locus_tag LOCUS_23630 909 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1504 3048 gene locus_tag LOCUS_23640 1504 3048 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence327 468 806 gene locus_tag LOCUS_23650 468 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1660 836 gene locus_tag LOCUS_23660 gene menB 1660 836 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_23660 <3344 1651 gene locus_tag LOCUS_23670 <3344 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963786.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence328 64 843 gene locus_tag LOCUS_23680 gene trpA 64 843 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_23680 933 2300 gene locus_tag LOCUS_23690 933 2300 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_23690 2396 2881 gene locus_tag LOCUS_23700 2396 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence329 1392 466 gene locus_tag LOCUS_23710 1392 466 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_23710 1556 2119 gene locus_tag LOCUS_23720 gene ftnA 1556 2119 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650594.1 protein_id gnl|my_center|LOCUS_23720 2914 2123 gene locus_tag LOCUS_23730 2914 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence330 221 1606 gene locus_tag LOCUS_23740 221 1606 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_23740 1603 2175 gene locus_tag LOCUS_23750 1603 2175 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_23750 2204 3190 gene locus_tag LOCUS_23760 gene trpD 2204 3190 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence331 769 1290 gene locus_tag LOCUS_23770 769 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1356 2114 gene locus_tag LOCUS_23780 1356 2114 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_23780 2148 2744 gene locus_tag LOCUS_23790 2148 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2738 3175 gene locus_tag LOCUS_23800 2738 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence332 409 29 gene locus_tag LOCUS_23810 409 29 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035435.1 protein_id gnl|my_center|LOCUS_23810 495 1112 gene locus_tag LOCUS_23820 495 1112 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_23820 1167 1682 gene locus_tag LOCUS_23830 1167 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1679 2824 gene locus_tag LOCUS_23840 1679 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_23840 2950 2876 gene locus_tag LOCUS_t00310 2950 2876 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence333 1390 845 gene locus_tag LOCUS_23850 1390 845 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_23850 2119 1400 gene locus_tag LOCUS_23860 2119 1400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence334 3 965 gene locus_tag LOCUS_23870 3 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 962 1693 gene locus_tag LOCUS_23880 gene lptB 962 1693 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_23880 1753 3279 gene locus_tag LOCUS_23890 1753 3279 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence335 533 207 gene locus_tag LOCUS_23900 gene ssb 533 207 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_23900 690 1052 gene locus_tag LOCUS_23910 690 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_23910 1187 3103 gene locus_tag LOCUS_23920 1187 3103 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence336 2998 1670 gene locus_tag LOCUS_23930 2998 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3276 3091 gene locus_tag LOCUS_23940 3276 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence337 2836 1151 gene locus_tag LOCUS_23950 2836 1151 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence338 1058 381 gene locus_tag LOCUS_23960 1058 381 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_23960 2220 1045 gene locus_tag LOCUS_23970 2220 1045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 protein_id gnl|my_center|LOCUS_23970 <3246 2252 gene locus_tag LOCUS_23980 <3246 2252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_117386928.1:peptide chain release factor 2 >Feature sequence339 194 976 gene locus_tag LOCUS_23990 194 976 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_23990 2252 1026 gene locus_tag LOCUS_24000 gene icd 2252 1026 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_24000 2433 2951 gene locus_tag LOCUS_24010 2433 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence340 1644 601 gene locus_tag LOCUS_24020 gene arsB 1644 601 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498585.1 protein_id gnl|my_center|LOCUS_24020 2270 1647 gene locus_tag LOCUS_24030 2270 1647 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_24030 3177 2293 gene locus_tag LOCUS_24040 3177 2293 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence341 <1 1596 gene locus_tag LOCUS_24050 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962449.1:aspartate--tRNA ligase >Feature sequence342 1326 934 gene locus_tag LOCUS_24060 gene rsfS 1326 934 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_24060 1362 2141 gene locus_tag LOCUS_24070 1362 2141 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence343 <1 572 gene locus_tag LOCUS_24080 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108172.1:MoxR family ATPase 556 1923 gene locus_tag LOCUS_24090 556 1923 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_24090 2330 1992 gene locus_tag LOCUS_24100 2330 1992 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_24100 2622 2320 gene locus_tag LOCUS_24110 2622 2320 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence344 >Feature sequence345 737 1279 gene locus_tag LOCUS_24120 737 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1279 1737 gene locus_tag LOCUS_24130 1279 1737 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_24130 3089 2064 gene locus_tag LOCUS_24140 3089 2064 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence346 1495 323 gene locus_tag LOCUS_24150 1495 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2049 1492 gene locus_tag LOCUS_24160 2049 1492 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence347 2142 1192 gene locus_tag LOCUS_24170 2142 1192 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_24170 2897 2139 gene locus_tag LOCUS_24180 2897 2139 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965997.1 protein_id gnl|my_center|LOCUS_24180 3112 2930 gene locus_tag LOCUS_24190 3112 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence348 1921 1559 gene locus_tag LOCUS_24200 1921 1559 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389737.1 protein_id gnl|my_center|LOCUS_24200 2362 1976 gene locus_tag LOCUS_24210 gene trxA 2362 1976 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_24210 2406 2771 gene locus_tag LOCUS_24220 2406 2771 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_24220 3101 2778 gene locus_tag LOCUS_24230 3101 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence349 120 1916 gene locus_tag LOCUS_24240 gene typA 120 1916 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_24240 1929 2468 gene locus_tag LOCUS_24250 1929 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2876 2469 gene locus_tag LOCUS_24260 2876 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence350 171 1076 gene locus_tag LOCUS_24270 171 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence351 <1 932 gene locus_tag LOCUS_24280 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964335.1:recombinase RecA 939 1550 gene locus_tag LOCUS_24290 939 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence352 1227 1529 gene locus_tag LOCUS_24300 1227 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1570 2448 gene locus_tag LOCUS_24310 gene fabD 1570 2448 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_24310 <3056 2445 gene locus_tag LOCUS_24320 <3056 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615998.1:ATP-binding protein >Feature sequence353 817 1749 gene locus_tag LOCUS_24330 gene ghrA 817 1749 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351313.1 protein_id gnl|my_center|LOCUS_24330 1766 2419 gene locus_tag LOCUS_24340 1766 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence354 1655 1035 gene locus_tag LOCUS_24350 1655 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2249 2037 gene locus_tag LOCUS_24360 2249 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 <3038 2311 gene locus_tag LOCUS_24370 <3038 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964439.1:flavin reductase family protein >Feature sequence355 818 1222 gene locus_tag LOCUS_24380 gene hypA 818 1222 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_24380 1230 2024 gene locus_tag LOCUS_24390 gene hypB 1230 2024 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_24390 2029 2277 gene locus_tag LOCUS_24400 2029 2277 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_24400 2585 2989 gene locus_tag LOCUS_24410 2585 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence356 1415 228 gene locus_tag LOCUS_24420 1415 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence357 2494 2114 gene locus_tag LOCUS_24430 gene gldC 2494 2114 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence358 506 432 gene locus_tag LOCUS_t00320 506 432 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1965 640 gene locus_tag LOCUS_24440 1965 640 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence359 1641 2201 gene locus_tag LOCUS_24450 1641 2201 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence360 <1 2537 gene locus_tag LOCUS_24460 <1 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839665.1:S41 family peptidase >Feature sequence361 1394 693 gene locus_tag LOCUS_24470 1394 693 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_24470 2764 1391 gene locus_tag LOCUS_24480 2764 1391 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence362 168 785 gene locus_tag LOCUS_24490 168 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 794 2446 gene locus_tag LOCUS_24500 794 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence363 1928 1179 gene locus_tag LOCUS_24510 1928 1179 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_24510 2698 1985 gene locus_tag LOCUS_24520 2698 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence364 1013 1645 gene locus_tag LOCUS_24530 1013 1645 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946491.1 protein_id gnl|my_center|LOCUS_24530 1699 2568 gene locus_tag LOCUS_24540 1699 2568 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence365 906 1496 gene locus_tag LOCUS_24550 906 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1493 2089 gene locus_tag LOCUS_24560 1493 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence366 1649 1011 gene locus_tag LOCUS_24570 1649 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 <2778 1658 gene locus_tag LOCUS_24580 <2778 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006285466.1:DASS family sodium-coupled anion symporter >Feature sequence367 2331 715 gene locus_tag LOCUS_24590 2331 715 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188658.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence368 1074 508 gene locus_tag LOCUS_24600 1074 508 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_24600 1166 1546 gene locus_tag LOCUS_24610 1166 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2224 1550 gene locus_tag LOCUS_24620 2224 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence369 314 69 gene locus_tag LOCUS_24630 314 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2084 492 gene locus_tag LOCUS_24640 2084 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence370 169 762 gene locus_tag LOCUS_24650 169 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 759 2015 gene locus_tag LOCUS_24660 759 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence371 1210 431 gene locus_tag LOCUS_24670 1210 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence372 74 331 gene locus_tag LOCUS_24680 74 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 677 1699 gene locus_tag LOCUS_24690 677 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence373 >Feature sequence374 1013 282 gene locus_tag LOCUS_24700 1013 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1106 1179 gene locus_tag LOCUS_t00330 1106 1179 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence375 <1 882 gene locus_tag LOCUS_24710 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943974.1:sigma 54-interacting transcriptional regulator 977 1414 gene locus_tag LOCUS_24720 977 1414 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_24720 1449 2615 gene locus_tag LOCUS_24730 1449 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence376 121 2082 gene locus_tag LOCUS_24740 121 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence377 1427 2080 gene locus_tag LOCUS_24750 1427 2080 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201153.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence378 1850 1332 gene locus_tag LOCUS_24760 gene idi 1850 1332 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890634.1 protein_id gnl|my_center|LOCUS_24760 2134 2012 gene locus_tag LOCUS_24770 2134 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2487 2275 gene locus_tag LOCUS_24780 2487 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence379 709 1608 gene locus_tag LOCUS_24790 709 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1605 2069 gene locus_tag LOCUS_24800 1605 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence380 352 933 gene locus_tag LOCUS_24810 352 933 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_24810 943 1608 gene locus_tag LOCUS_24820 943 1608 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_24820 1624 1959 gene locus_tag LOCUS_24830 1624 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2045 2560 gene locus_tag LOCUS_24840 2045 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence381 <1 1154 gene locus_tag LOCUS_24850 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964061.1:urocanate hydratase 1154 1723 gene locus_tag LOCUS_24860 1154 1723 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_24860 1724 2308 gene locus_tag LOCUS_24870 1724 2308 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070530.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence382 838 191 gene locus_tag LOCUS_24880 838 191 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_24880 1807 878 gene locus_tag LOCUS_24890 1807 878 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_24890 1937 1864 gene locus_tag LOCUS_t00340 1937 1864 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence383 <1 958 gene locus_tag LOCUS_24900 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385794.1:M20/M25/M40 family metallo-hydrolase >Feature sequence384 >Feature sequence385 >Feature sequence386 162 545 gene locus_tag LOCUS_24910 162 545 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_24910 538 1830 gene locus_tag LOCUS_24920 538 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1921 2352 gene locus_tag LOCUS_24930 1921 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence387 724 413 gene locus_tag LOCUS_24940 724 413 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_24940 1116 721 gene locus_tag LOCUS_24950 1116 721 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_24950 1767 1165 gene locus_tag LOCUS_24960 gene rsmG 1767 1165 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_24960 2380 1772 gene locus_tag LOCUS_24970 2380 1772 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence388 347 1978 gene locus_tag LOCUS_24980 347 1978 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_24980 2472 1981 gene locus_tag LOCUS_24990 2472 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence389 711 202 gene locus_tag LOCUS_25000 711 202 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence390 <2423 377 gene locus_tag LOCUS_25010 <2423 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence391 92 1276 gene locus_tag LOCUS_25020 92 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_25020 2139 1273 gene locus_tag LOCUS_25030 2139 1273 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence392 2251 161 gene locus_tag LOCUS_25040 2251 161 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840110.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence393 1117 434 gene locus_tag LOCUS_25050 1117 434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_25050 <2340 1121 gene locus_tag LOCUS_25060 <2340 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261736.1:ABC transporter permease >Feature sequence394 1768 401 gene locus_tag LOCUS_25070 gene nrfD 1768 401 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_25070 <2329 1784 gene locus_tag LOCUS_25080 <2329 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962544.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence395 1515 850 gene locus_tag LOCUS_25090 1515 850 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839781.1 protein_id gnl|my_center|LOCUS_25090 2276 1512 gene locus_tag LOCUS_25100 2276 1512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence396 <1 2192 gene locus_tag LOCUS_25110 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787020.1:TonB-dependent receptor >Feature sequence397 1203 2162 gene locus_tag LOCUS_25120 1203 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence398 <1 760 gene locus_tag LOCUS_25130 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765048.1:indole-3-glycerol phosphate synthase TrpC 750 1361 gene locus_tag LOCUS_25140 750 1361 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence399 >Feature sequence400 1181 243 gene locus_tag LOCUS_25150 gene floA 1181 243 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_25150 1716 1237 gene locus_tag LOCUS_25160 1716 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence401 <1 848 gene locus_tag LOCUS_25170 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444186.1:SulP family inorganic anion transporter 876 1490 gene locus_tag LOCUS_25180 876 1490 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_25180 1500 2171 gene locus_tag LOCUS_25190 1500 2171 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence402 637 290 gene locus_tag LOCUS_25200 637 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2092 710 gene locus_tag LOCUS_25210 2092 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence403 <1 1395 gene locus_tag LOCUS_25220 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962393.1:isoleucine--tRNA ligase 1392 2069 gene locus_tag LOCUS_25230 1392 2069 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence404 735 1172 gene locus_tag LOCUS_25240 735 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1156 1866 gene locus_tag LOCUS_25250 1156 1866 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_25250 2233 1853 gene locus_tag LOCUS_25260 2233 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence405 61 792 gene locus_tag LOCUS_25270 61 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 844 993 gene locus_tag LOCUS_25280 844 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1681 968 gene locus_tag LOCUS_25290 1681 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence406 536 1108 gene locus_tag LOCUS_25300 536 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1131 1664 gene locus_tag LOCUS_25310 1131 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 <2228 1665 gene locus_tag LOCUS_25320 <2228 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963845.1:dihydrolipoyl dehydrogenase >Feature sequence407 <1 627 gene locus_tag LOCUS_25330 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072060.1:TIGR00266 family protein 1552 695 gene locus_tag LOCUS_25340 1552 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2093 1554 gene locus_tag LOCUS_25350 2093 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence408 1673 387 gene locus_tag LOCUS_25360 gene purD 1673 387 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence409 >Feature sequence410 1466 93 gene locus_tag LOCUS_25370 gene mnmE 1466 93 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence411 1367 354 gene locus_tag LOCUS_25380 1367 354 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_25380 <2144 1364 gene locus_tag LOCUS_25390 <2144 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194105476.1:AraC family transcriptional regulator >Feature sequence412 <1 723 gene locus_tag LOCUS_25400 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203672.1:RNA polymerase factor sigma-54 723 1346 gene locus_tag LOCUS_25410 723 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1688 1443 gene locus_tag LOCUS_25420 1688 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25420 >Feature sequence413 >Feature sequence414 <2101 402 gene locus_tag LOCUS_25430 <2101 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962626.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence415 <1 1022 gene locus_tag LOCUS_25440 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963958.1:primosomal protein N' 1074 1547 gene locus_tag LOCUS_25450 1074 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence416 1174 443 gene locus_tag LOCUS_25460 1174 443 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence417 831 1964 gene locus_tag LOCUS_25470 831 1964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051287133.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence418 <2079 993 gene locus_tag LOCUS_25480 <2079 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050765261.1:glycosyltransferase family 4 protein >Feature sequence419 >Feature sequence420 <1 1113 gene locus_tag LOCUS_25490 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:NAD(P)-dependent oxidoreductase <2061 1087 gene locus_tag LOCUS_25500 <2061 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783471.1:calcium/sodium antiporter >Feature sequence421 >Feature sequence422 >Feature sequence423 266 135 gene locus_tag LOCUS_25510 266 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1057 284 gene locus_tag LOCUS_25520 gene ygiD 1057 284 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_25520 1920 1219 gene locus_tag LOCUS_25530 1920 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence424 947 210 gene locus_tag LOCUS_25540 947 210 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_25540 <2017 1065 gene locus_tag LOCUS_25550 <2017 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038965.1:TIGR01777 family oxidoreductase >Feature sequence425 1778 603 gene locus_tag LOCUS_25560 1778 603 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence426