>Feature sequence001 590 378 gene locus_tag LOCUS_00010 590 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1433 1044 gene locus_tag LOCUS_00020 1433 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1942 2880 gene locus_tag LOCUS_00030 1942 2880 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_00030 3331 2909 gene locus_tag LOCUS_00040 3331 2909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117780.1 protein_id gnl|my_center|LOCUS_00040 4521 3616 gene locus_tag LOCUS_00050 gene speE 4521 3616 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424716.1 protein_id gnl|my_center|LOCUS_00050 5400 6044 gene locus_tag LOCUS_00060 5400 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6256 6714 gene locus_tag LOCUS_00070 gene dtd 6256 6714 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_00070 6791 7300 gene locus_tag LOCUS_00080 6791 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7728 7384 gene locus_tag LOCUS_00090 7728 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8003 7725 gene locus_tag LOCUS_00100 8003 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9413 8052 gene locus_tag LOCUS_00110 gene secY 9413 8052 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_00110 10012 9509 gene locus_tag LOCUS_00120 gene rplO 10012 9509 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_00120 10530 10024 gene locus_tag LOCUS_00130 gene rpsE 10530 10024 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_00130 10920 10564 gene locus_tag LOCUS_00140 gene rplR 10920 10564 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_00140 11479 10943 gene locus_tag LOCUS_00150 gene rplF 11479 10943 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_00150 11912 11517 gene locus_tag LOCUS_00160 gene rpsH 11912 11517 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_00160 12136 11951 gene locus_tag LOCUS_00170 12136 11951 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723684.1 protein_id gnl|my_center|LOCUS_00170 12699 12163 gene locus_tag LOCUS_00180 gene rplE 12699 12163 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869917.1 protein_id gnl|my_center|LOCUS_00180 13000 12692 gene locus_tag LOCUS_00190 13000 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13365 13000 gene locus_tag LOCUS_00200 gene rplN 13365 13000 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_00200 13673 13362 gene locus_tag LOCUS_00210 gene rpsQ 13673 13362 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727674.1 protein_id gnl|my_center|LOCUS_00210 13885 13682 gene locus_tag LOCUS_00220 gene rpmC 13885 13682 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_00220 14318 13905 gene locus_tag LOCUS_00230 gene rplP 14318 13905 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_00230 14958 14269 gene locus_tag LOCUS_00240 gene rpsC 14958 14269 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_00240 15328 14990 gene locus_tag LOCUS_00250 gene rplV 15328 14990 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_00250 16153 15359 gene locus_tag LOCUS_00260 16153 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 16407 18329 gene locus_tag LOCUS_00270 gene htpG 16407 18329 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_00270 18619 19671 gene locus_tag LOCUS_00280 18619 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 19671 20465 gene locus_tag LOCUS_00290 gene tsf 19671 20465 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 protein_id gnl|my_center|LOCUS_00290 20526 22982 gene locus_tag LOCUS_00300 gene leuS 20526 22982 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_00300 23681 23869 gene locus_tag LOCUS_00310 23681 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 23866 24345 gene locus_tag LOCUS_00320 23866 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26267 24531 gene locus_tag LOCUS_00330 26267 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 26592 27635 gene locus_tag LOCUS_00340 gene wlbA 26592 27635 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_00340 27635 29419 gene locus_tag LOCUS_00350 27635 29419 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_00350 29596 30531 gene locus_tag LOCUS_00360 29596 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30636 31712 gene locus_tag LOCUS_00370 30636 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 31750 33828 gene locus_tag LOCUS_00380 31750 33828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33825 34757 gene locus_tag LOCUS_00390 33825 34757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_00390 34754 36406 gene locus_tag LOCUS_00400 34754 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36894 36415 gene locus_tag LOCUS_00410 36894 36415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39236 37119 gene locus_tag LOCUS_00420 39236 37119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 39667 39398 gene locus_tag LOCUS_00430 39667 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40319 40645 gene locus_tag LOCUS_00440 40319 40645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41492 40815 gene locus_tag LOCUS_00450 41492 40815 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_00450 41938 41489 gene locus_tag LOCUS_00460 41938 41489 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 protein_id gnl|my_center|LOCUS_00460 42867 42154 gene locus_tag LOCUS_00470 42867 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 43103 42933 gene locus_tag LOCUS_00480 43103 42933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 43546 43106 gene locus_tag LOCUS_00490 43546 43106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 45194 43539 gene locus_tag LOCUS_00500 45194 43539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 45702 45547 gene locus_tag LOCUS_00510 45702 45547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 47225 45774 gene locus_tag LOCUS_00520 gene rpoN 47225 45774 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_00520 47444 47893 gene locus_tag LOCUS_00530 47444 47893 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_00530 48486 47899 gene locus_tag LOCUS_00540 48486 47899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 49079 48483 gene locus_tag LOCUS_00550 49079 48483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 50839 49076 gene locus_tag LOCUS_00560 50839 49076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 51416 50862 gene locus_tag LOCUS_00570 51416 50862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 52879 51422 gene locus_tag LOCUS_00580 52879 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 53335 52892 gene locus_tag LOCUS_00590 53335 52892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 53788 53375 gene locus_tag LOCUS_00600 53788 53375 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_00600 54637 53837 gene locus_tag LOCUS_00610 54637 53837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 55851 54700 gene locus_tag LOCUS_00620 55851 54700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 58664 55848 gene locus_tag LOCUS_00630 58664 55848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59005 59634 gene locus_tag LOCUS_00640 59005 59634 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_00640 59631 60959 gene locus_tag LOCUS_00650 59631 60959 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880142.1 protein_id gnl|my_center|LOCUS_00650 60967 64176 gene locus_tag LOCUS_00660 60967 64176 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_00660 64670 64377 gene locus_tag LOCUS_00670 64670 64377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 65296 64928 gene locus_tag LOCUS_00680 65296 64928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence002 207 1343 gene locus_tag LOCUS_00690 207 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1340 2314 gene locus_tag LOCUS_00700 1340 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2388 3146 gene locus_tag LOCUS_00710 gene truA 2388 3146 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891981.1 protein_id gnl|my_center|LOCUS_00710 5505 3211 gene locus_tag LOCUS_00720 gene feoB 5505 3211 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_00720 5788 5558 gene locus_tag LOCUS_00730 5788 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7890 6607 gene locus_tag LOCUS_00740 gene murC 7890 6607 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_00740 9026 7887 gene locus_tag LOCUS_00750 9026 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9247 9675 gene locus_tag LOCUS_00760 9247 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9717 10238 gene locus_tag LOCUS_00770 gene lspA 9717 10238 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_00770 10235 10798 gene locus_tag LOCUS_00780 10235 10798 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_00780 10902 11633 gene locus_tag LOCUS_00790 10902 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13401 11728 gene locus_tag LOCUS_00800 13401 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 13700 14395 gene locus_tag LOCUS_00810 13700 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 14477 15631 gene locus_tag LOCUS_00820 14477 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 15693 16442 gene locus_tag LOCUS_00830 gene panB 15693 16442 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_00830 18043 16556 gene locus_tag LOCUS_00840 gene tilS 18043 16556 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_00840 19435 18461 gene locus_tag LOCUS_00850 19435 18461 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 protein_id gnl|my_center|LOCUS_00850 20971 19538 gene locus_tag LOCUS_00860 20971 19538 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_00860 22133 21003 gene locus_tag LOCUS_00870 22133 21003 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_00870 22953 22318 gene locus_tag LOCUS_00880 22953 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 23095 23454 gene locus_tag LOCUS_00890 gene raiA 23095 23454 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_00890 23470 23964 gene locus_tag LOCUS_00900 23470 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 24069 24362 gene locus_tag LOCUS_00910 24069 24362 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_00910 24359 26380 gene locus_tag LOCUS_00920 24359 26380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 26996 26454 gene locus_tag LOCUS_00930 gene folE 26996 26454 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346200.1 protein_id gnl|my_center|LOCUS_00930 27204 27449 gene locus_tag LOCUS_00940 27204 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 27446 28234 gene locus_tag LOCUS_00950 gene trpC 27446 28234 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_00950 29269 28259 gene locus_tag LOCUS_00960 29269 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 29523 31517 gene locus_tag LOCUS_00970 29523 31517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 31560 32498 gene locus_tag LOCUS_00980 31560 32498 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_00980 32495 33589 gene locus_tag LOCUS_00990 32495 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 33591 36359 gene locus_tag LOCUS_01000 33591 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 35025 34932 gene locus_tag LOCUS_t00010 35025 34932 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 36715 37689 gene locus_tag LOCUS_01010 gene galE 36715 37689 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_01010 37899 38588 gene locus_tag LOCUS_01020 37899 38588 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01020 38690 39937 gene locus_tag LOCUS_01030 gene fabB 38690 39937 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382947.1 protein_id gnl|my_center|LOCUS_01030 40031 40615 gene locus_tag LOCUS_01040 40031 40615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 40889 43558 gene locus_tag LOCUS_01050 40889 43558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 43533 44642 gene locus_tag LOCUS_01060 43533 44642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_01060 47219 44883 gene locus_tag LOCUS_01070 47219 44883 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_01070 47856 49163 gene locus_tag LOCUS_01080 47856 49163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 49160 50002 gene locus_tag LOCUS_01090 49160 50002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 50681 50403 gene locus_tag LOCUS_01100 50681 50403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 51026 52426 gene locus_tag LOCUS_01110 51026 52426 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_01110 52473 53732 gene locus_tag LOCUS_01120 52473 53732 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_01120 53986 54750 gene locus_tag LOCUS_01130 53986 54750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 54889 55299 gene locus_tag LOCUS_01140 54889 55299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 55417 56388 gene locus_tag LOCUS_01150 55417 56388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 57083 56652 gene locus_tag LOCUS_01160 57083 56652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 58720 57338 gene locus_tag LOCUS_01170 58720 57338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence003 890 177 gene locus_tag LOCUS_01180 890 177 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_01180 2120 1008 gene locus_tag LOCUS_01190 2120 1008 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_01190 2260 2185 gene locus_tag LOCUS_t00020 2260 2185 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2446 3966 gene locus_tag LOCUS_01200 2446 3966 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_01200 4147 5025 gene locus_tag LOCUS_01210 4147 5025 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_01210 5049 5879 gene locus_tag LOCUS_01220 5049 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6056 6325 gene locus_tag LOCUS_01230 6056 6325 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205409681.1 protein_id gnl|my_center|LOCUS_01230 7671 6328 gene locus_tag LOCUS_01240 7671 6328 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_01240 9446 7668 gene locus_tag LOCUS_01250 9446 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10513 9443 gene locus_tag LOCUS_01260 gene hisC 10513 9443 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_01260 11261 10758 gene locus_tag LOCUS_01270 11261 10758 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_01270 11489 11307 gene locus_tag LOCUS_01280 11489 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 11644 12078 gene locus_tag LOCUS_01290 gene aroQ 11644 12078 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_01290 12140 12598 gene locus_tag LOCUS_01300 gene accB 12140 12598 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_01300 12608 13966 gene locus_tag LOCUS_01310 gene accC 12608 13966 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_01310 13993 14409 gene locus_tag LOCUS_01320 13993 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14462 14938 gene locus_tag LOCUS_01330 14462 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15433 14978 gene locus_tag LOCUS_01340 15433 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 16287 15430 gene locus_tag LOCUS_01350 16287 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 17003 16284 gene locus_tag LOCUS_01360 17003 16284 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_01360 17616 16990 gene locus_tag LOCUS_01370 17616 16990 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_01370 18059 17691 gene locus_tag LOCUS_01380 18059 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 18744 18052 gene locus_tag LOCUS_01390 18744 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 18851 20146 gene locus_tag LOCUS_01400 gene rsmB 18851 20146 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932290.1 protein_id gnl|my_center|LOCUS_01400 20292 21245 gene locus_tag LOCUS_01410 20292 21245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 21475 21212 gene locus_tag LOCUS_01420 21475 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 22820 21513 gene locus_tag LOCUS_01430 22820 21513 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_01430 23704 22817 gene locus_tag LOCUS_01440 23704 22817 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_01440 24192 23701 gene locus_tag LOCUS_01450 24192 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 25337 24483 gene locus_tag LOCUS_01460 25337 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 26830 25334 gene locus_tag LOCUS_01470 26830 25334 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_01470 27312 26863 gene locus_tag LOCUS_01480 27312 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 28491 27328 gene locus_tag LOCUS_01490 gene lpxB 28491 27328 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01490 29674 28697 gene locus_tag LOCUS_01500 29674 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 31073 29895 gene locus_tag LOCUS_01510 31073 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 31324 31770 gene locus_tag LOCUS_01520 31324 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 32134 32679 gene locus_tag LOCUS_01530 32134 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 32687 33427 gene locus_tag LOCUS_01540 32687 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 34333 33503 gene locus_tag LOCUS_01550 34333 33503 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_01550 38801 34863 gene locus_tag LOCUS_01560 38801 34863 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_01560 40770 38860 gene locus_tag LOCUS_01570 40770 38860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 42522 40966 gene locus_tag LOCUS_01580 42522 40966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 42888 43937 gene locus_tag LOCUS_01590 42888 43937 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123336.1 protein_id gnl|my_center|LOCUS_01590 44117 45166 gene locus_tag LOCUS_01600 44117 45166 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_01600 45169 46329 gene locus_tag LOCUS_01610 45169 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 46347 47429 gene locus_tag LOCUS_01620 46347 47429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 47426 47797 gene locus_tag LOCUS_01630 47426 47797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 47794 48270 gene locus_tag LOCUS_01640 47794 48270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 48267 48479 gene locus_tag LOCUS_01650 48267 48479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 50934 48937 gene locus_tag LOCUS_01660 50934 48937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 52433 51093 gene locus_tag LOCUS_01670 52433 51093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 52419 52628 gene locus_tag LOCUS_01680 52419 52628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 53007 53249 gene locus_tag LOCUS_01690 53007 53249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence004 290 727 gene locus_tag LOCUS_01700 290 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 816 1823 gene locus_tag LOCUS_01710 816 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1880 2074 gene locus_tag LOCUS_01720 1880 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2941 2177 gene locus_tag LOCUS_01730 2941 2177 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_01730 3132 2938 gene locus_tag LOCUS_01740 3132 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3471 4520 gene locus_tag LOCUS_01750 gene recA 3471 4520 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_01750 4687 6573 gene locus_tag LOCUS_01760 4687 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 7275 6631 gene locus_tag LOCUS_01770 7275 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 8914 7292 gene locus_tag LOCUS_01780 8914 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9900 9127 gene locus_tag LOCUS_01790 9900 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10897 9905 gene locus_tag LOCUS_01800 10897 9905 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_01800 11781 10894 gene locus_tag LOCUS_01810 11781 10894 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932610.1 protein_id gnl|my_center|LOCUS_01810 12275 11778 gene locus_tag LOCUS_01820 12275 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 13034 12282 gene locus_tag LOCUS_01830 13034 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14033 13119 gene locus_tag LOCUS_01840 14033 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 14730 14590 gene locus_tag LOCUS_01850 14730 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 14687 15373 gene locus_tag LOCUS_01860 gene fetB 14687 15373 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 protein_id gnl|my_center|LOCUS_01860 16531 15395 gene locus_tag LOCUS_01870 16531 15395 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020676.1 protein_id gnl|my_center|LOCUS_01870 16746 17591 gene locus_tag LOCUS_01880 16746 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 18037 18285 gene locus_tag LOCUS_01890 18037 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 19032 20102 gene locus_tag LOCUS_01900 gene mnmA 19032 20102 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_01900 20482 20727 gene locus_tag LOCUS_01910 20482 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 21917 20760 gene locus_tag LOCUS_01920 21917 20760 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_01920 22731 22207 gene locus_tag LOCUS_01930 22731 22207 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_01930 23607 24773 gene locus_tag LOCUS_01940 gene nifS 23607 24773 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_01940 24770 25522 gene locus_tag LOCUS_01950 24770 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 25537 27402 gene locus_tag LOCUS_01960 25537 27402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_01960 27399 29420 gene locus_tag LOCUS_01970 27399 29420 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675225.1 protein_id gnl|my_center|LOCUS_01970 29417 30553 gene locus_tag LOCUS_01980 29417 30553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 31509 30814 gene locus_tag LOCUS_01990 gene nth 31509 30814 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_01990 31857 31513 gene locus_tag LOCUS_02000 31857 31513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 32072 33478 gene locus_tag LOCUS_02010 gene ahcY 32072 33478 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_02010 33576 33502 gene locus_tag LOCUS_t00030 33576 33502 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33773 35488 gene locus_tag LOCUS_02020 33773 35488 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_02020 35524 37218 gene locus_tag LOCUS_02030 35524 37218 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_02030 37289 38353 gene locus_tag LOCUS_02040 37289 38353 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_02040 38375 39658 gene locus_tag LOCUS_02050 38375 39658 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02050 39662 40756 gene locus_tag LOCUS_02060 39662 40756 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_02060 40753 41175 gene locus_tag LOCUS_02070 gene ruvX 40753 41175 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_02070 41244 41888 gene locus_tag LOCUS_02080 41244 41888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 43039 41885 gene locus_tag LOCUS_02090 43039 41885 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_02090 44024 43467 gene locus_tag LOCUS_02100 44024 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 44740 44192 gene locus_tag LOCUS_02110 44740 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 45251 44694 gene locus_tag LOCUS_02120 45251 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 45903 45367 gene locus_tag LOCUS_02130 45903 45367 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_02130 46985 45999 gene locus_tag LOCUS_02140 46985 45999 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_02140 47274 47750 gene locus_tag LOCUS_02150 gene ispF 47274 47750 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_02150 47827 47754 gene locus_tag LOCUS_t00040 47827 47754 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 48115 48282 gene locus_tag LOCUS_02160 48115 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence005 1221 457 gene locus_tag LOCUS_02170 1221 457 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_02170 2236 1280 gene locus_tag LOCUS_02180 gene fmt 2236 1280 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_02180 2634 2233 gene locus_tag LOCUS_02190 2634 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3147 2638 gene locus_tag LOCUS_02200 3147 2638 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_02200 3853 3248 gene locus_tag LOCUS_02210 3853 3248 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_02210 4249 3872 gene locus_tag LOCUS_02220 4249 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4441 5367 gene locus_tag LOCUS_02230 4441 5367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_02230 6744 5416 gene locus_tag LOCUS_02240 6744 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7015 6758 gene locus_tag LOCUS_02250 7015 6758 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_02250 7768 7031 gene locus_tag LOCUS_02260 gene lptB 7768 7031 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_02260 8427 7765 gene locus_tag LOCUS_02270 8427 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9148 8453 gene locus_tag LOCUS_02280 9148 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10109 9294 gene locus_tag LOCUS_02290 gene kdsA 10109 9294 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_02290 10861 10094 gene locus_tag LOCUS_02300 gene kdsB 10861 10094 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_02300 11967 10933 gene locus_tag LOCUS_02310 11967 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 13028 11964 gene locus_tag LOCUS_02320 13028 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 14052 13069 gene locus_tag LOCUS_02330 gene ilvC 14052 13069 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_02330 14384 14460 gene locus_tag LOCUS_t00050 14384 14460 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14485 14560 gene locus_tag LOCUS_t00060 14485 14560 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16181 14733 gene locus_tag LOCUS_02340 gene gatA 16181 14733 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_02340 16505 16200 gene locus_tag LOCUS_02350 gene gatC 16505 16200 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_02350 16749 16549 gene locus_tag LOCUS_02360 16749 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18525 16798 gene locus_tag LOCUS_02370 18525 16798 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_02370 19597 18575 gene locus_tag LOCUS_02380 19597 18575 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_02380 20526 19630 gene locus_tag LOCUS_02390 20526 19630 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_02390 20798 22183 gene locus_tag LOCUS_02400 20798 22183 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_02400 22191 23729 gene locus_tag LOCUS_02410 22191 23729 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 protein_id gnl|my_center|LOCUS_02410 24245 24517 gene locus_tag LOCUS_02420 24245 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 24596 25033 gene locus_tag LOCUS_02430 24596 25033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 25885 26340 gene locus_tag LOCUS_02440 25885 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 26526 27068 gene locus_tag LOCUS_02450 26526 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 27153 27512 gene locus_tag LOCUS_02460 27153 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 27589 28050 gene locus_tag LOCUS_02470 27589 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 28820 29275 gene locus_tag LOCUS_02480 28820 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 30024 31067 gene locus_tag LOCUS_02490 30024 31067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 31105 33894 gene locus_tag LOCUS_02500 31105 33894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 34916 34122 gene locus_tag LOCUS_02510 34916 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 36150 35044 gene locus_tag LOCUS_02520 36150 35044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 37436 36198 gene locus_tag LOCUS_02530 37436 36198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 38827 37433 gene locus_tag LOCUS_02540 38827 37433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 39005 39751 gene locus_tag LOCUS_02550 gene rph 39005 39751 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688342.1 protein_id gnl|my_center|LOCUS_02550 39809 40672 gene locus_tag LOCUS_02560 39809 40672 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_02560 40697 43270 gene locus_tag LOCUS_02570 40697 43270 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065180.1 protein_id gnl|my_center|LOCUS_02570 43349 44845 gene locus_tag LOCUS_02580 43349 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 44852 45994 gene locus_tag LOCUS_02590 44852 45994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 46488 47087 gene locus_tag LOCUS_02600 46488 47087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 47118 47549 gene locus_tag LOCUS_02610 47118 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence006 758 513 gene locus_tag LOCUS_02620 758 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1010 3325 gene locus_tag LOCUS_02630 1010 3325 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_02630 4474 3446 gene locus_tag LOCUS_02640 4474 3446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_02640 5659 4544 gene locus_tag LOCUS_02650 5659 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 6004 5723 gene locus_tag LOCUS_02660 6004 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7263 6004 gene locus_tag LOCUS_02670 7263 6004 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_02670 7985 7266 gene locus_tag LOCUS_02680 7985 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 9601 8213 gene locus_tag LOCUS_02690 9601 8213 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791400.1 protein_id gnl|my_center|LOCUS_02690 10888 9782 gene locus_tag LOCUS_02700 gene wecB 10888 9782 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_02700 11367 10891 gene locus_tag LOCUS_02710 gene smpB 11367 10891 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 protein_id gnl|my_center|LOCUS_02710 11591 11716 gene locus_tag LOCUS_02720 11591 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12662 11709 gene locus_tag LOCUS_02730 12662 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13545 12907 gene locus_tag LOCUS_02740 13545 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13905 16895 gene locus_tag LOCUS_02750 13905 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02750 18740 17286 gene locus_tag LOCUS_02760 18740 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 20238 18853 gene locus_tag LOCUS_02770 gene mnmE 20238 18853 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_02770 20351 21757 gene locus_tag LOCUS_02780 20351 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 21830 22717 gene locus_tag LOCUS_02790 21830 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 22788 24077 gene locus_tag LOCUS_02800 22788 24077 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_02800 24110 24412 gene locus_tag LOCUS_02810 24110 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 24405 25514 gene locus_tag LOCUS_02820 gene tgt 24405 25514 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_02820 25471 25635 gene locus_tag LOCUS_02830 25471 25635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 25685 26257 gene locus_tag LOCUS_02840 25685 26257 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_02840 26312 26836 gene locus_tag LOCUS_02850 26312 26836 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_02850 26957 27751 gene locus_tag LOCUS_02860 26957 27751 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_02860 27755 28687 gene locus_tag LOCUS_02870 27755 28687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 28718 30247 gene locus_tag LOCUS_02880 gene lysS 28718 30247 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_02880 30404 31183 gene locus_tag LOCUS_02890 30404 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 31207 31527 gene locus_tag LOCUS_02900 31207 31527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 31556 32038 gene locus_tag LOCUS_02910 31556 32038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 32035 32586 gene locus_tag LOCUS_02920 32035 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 32583 34778 gene locus_tag LOCUS_02930 32583 34778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 34780 35637 gene locus_tag LOCUS_02940 34780 35637 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_02940 35663 37078 gene locus_tag LOCUS_02950 gene atpD 35663 37078 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_02950 37075 37323 gene locus_tag LOCUS_02960 37075 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 37418 38443 gene locus_tag LOCUS_02970 37418 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 41353 38468 gene locus_tag LOCUS_02980 41353 38468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 42390 41785 gene locus_tag LOCUS_02990 42390 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence007 <1 1375 gene locus_tag LOCUS_03000 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202548.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1547 1471 gene locus_tag LOCUS_t00070 1547 1471 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4160 1590 gene locus_tag LOCUS_03010 4160 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6198 4207 gene locus_tag LOCUS_03020 gene tkt 6198 4207 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_03020 6240 7331 gene locus_tag LOCUS_03030 gene ruvB 6240 7331 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403900.1 protein_id gnl|my_center|LOCUS_03030 7342 8025 gene locus_tag LOCUS_03040 gene cmk 7342 8025 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_03040 8022 8423 gene locus_tag LOCUS_03050 8022 8423 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_03050 8609 9124 gene locus_tag LOCUS_03060 8609 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9710 11425 gene locus_tag LOCUS_03070 9710 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 11437 13245 gene locus_tag LOCUS_03080 11437 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13898 13305 gene locus_tag LOCUS_03090 13898 13305 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_03090 14179 16119 gene locus_tag LOCUS_03100 14179 16119 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_03100 16181 17359 gene locus_tag LOCUS_03110 16181 17359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 17405 18388 gene locus_tag LOCUS_03120 17405 18388 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_03120 18414 18920 gene locus_tag LOCUS_03130 18414 18920 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_03130 19955 19311 gene locus_tag LOCUS_03140 gene deoC 19955 19311 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 protein_id gnl|my_center|LOCUS_03140 20306 20109 gene locus_tag LOCUS_03150 20306 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 20725 20516 gene locus_tag LOCUS_03160 20725 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 21407 20739 gene locus_tag LOCUS_03170 21407 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 22210 21404 gene locus_tag LOCUS_03180 22210 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 22377 23417 gene locus_tag LOCUS_03190 gene ribD 22377 23417 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_03190 23436 25130 gene locus_tag LOCUS_03200 23436 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 25247 25465 gene locus_tag LOCUS_03210 25247 25465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 25455 25709 gene locus_tag LOCUS_03220 25455 25709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 26017 26262 gene locus_tag LOCUS_03230 26017 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 26249 26605 gene locus_tag LOCUS_03240 26249 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 26680 27021 gene locus_tag LOCUS_03250 26680 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 27606 28097 gene locus_tag LOCUS_03260 27606 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 28298 30784 gene locus_tag LOCUS_03270 28298 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 30925 31149 gene locus_tag LOCUS_03280 30925 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 31252 33531 gene locus_tag LOCUS_03290 31252 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 33677 34723 gene locus_tag LOCUS_03300 33677 34723 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_03300 34766 37060 gene locus_tag LOCUS_03310 34766 37060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 37087 38343 gene locus_tag LOCUS_03320 37087 38343 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_03320 38328 38999 gene locus_tag LOCUS_03330 38328 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 39069 41021 gene locus_tag LOCUS_03340 gene metG 39069 41021 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_03340 41160 42341 gene locus_tag LOCUS_03350 41160 42341 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_03350 43137 42436 gene locus_tag LOCUS_03360 43137 42436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 43323 43138 gene locus_tag LOCUS_03370 43323 43138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence008 661 1137 gene locus_tag LOCUS_03380 661 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1130 1300 gene locus_tag LOCUS_03390 1130 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2557 1523 gene locus_tag LOCUS_03400 gene selD 2557 1523 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103287.1 protein_id gnl|my_center|LOCUS_03400 3668 2574 gene locus_tag LOCUS_03410 3668 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4637 3762 gene locus_tag LOCUS_03420 4637 3762 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_03420 5200 4703 gene locus_tag LOCUS_03430 5200 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5502 7520 gene locus_tag LOCUS_03440 5502 7520 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_03440 7601 7753 gene locus_tag LOCUS_03450 7601 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 7999 8586 gene locus_tag LOCUS_03460 7999 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8646 12578 gene locus_tag LOCUS_03470 8646 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12838 12608 gene locus_tag LOCUS_03480 12838 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 13645 12857 gene locus_tag LOCUS_03490 13645 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 15196 13760 gene locus_tag LOCUS_03500 15196 13760 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_03500 16838 15267 gene locus_tag LOCUS_03510 16838 15267 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389142.1 protein_id gnl|my_center|LOCUS_03510 17486 18820 gene locus_tag LOCUS_03520 17486 18820 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_03520 18918 19259 gene locus_tag LOCUS_03530 18918 19259 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_03530 21880 19406 gene locus_tag LOCUS_03540 21880 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 22309 22124 gene locus_tag LOCUS_03550 22309 22124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 22337 23749 gene locus_tag LOCUS_03560 22337 23749 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_03560 23799 24290 gene locus_tag LOCUS_03570 23799 24290 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_03570 24278 25822 gene locus_tag LOCUS_03580 gene rny 24278 25822 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_03580 26098 26781 gene locus_tag LOCUS_03590 gene larB 26098 26781 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_03590 27096 26818 gene locus_tag LOCUS_03600 27096 26818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 27172 28011 gene locus_tag LOCUS_03610 27172 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 28194 29345 gene locus_tag LOCUS_03620 28194 29345 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_03620 30587 29433 gene locus_tag LOCUS_03630 30587 29433 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_03630 31152 31796 gene locus_tag LOCUS_03640 31152 31796 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365189.1 protein_id gnl|my_center|LOCUS_03640 31827 32300 gene locus_tag LOCUS_03650 gene nuoE 31827 32300 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_03650 32297 34246 gene locus_tag LOCUS_03660 gene nuoF 32297 34246 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_03660 34273 35994 gene locus_tag LOCUS_03670 34273 35994 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_03670 36014 38074 gene locus_tag LOCUS_03680 36014 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 38064 38474 gene locus_tag LOCUS_03690 38064 38474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 38542 39699 gene locus_tag LOCUS_03700 38542 39699 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_03700 39696 41105 gene locus_tag LOCUS_03710 gene hydG 39696 41105 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_03710 41102 42190 gene locus_tag LOCUS_03720 gene hydE 41102 42190 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence009 1565 336 gene locus_tag LOCUS_03730 gene larA 1565 336 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_03730 2458 1589 gene locus_tag LOCUS_03740 2458 1589 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 protein_id gnl|my_center|LOCUS_03740 3012 2458 gene locus_tag LOCUS_03750 gene cobO 3012 2458 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_03750 4840 3098 gene locus_tag LOCUS_03760 4840 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_03760 6558 4837 gene locus_tag LOCUS_03770 6558 4837 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_03770 7904 6651 gene locus_tag LOCUS_03780 gene bioA 7904 6651 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957950.1 protein_id gnl|my_center|LOCUS_03780 8221 9528 gene locus_tag LOCUS_03790 gene hisD 8221 9528 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391986.1 protein_id gnl|my_center|LOCUS_03790 9997 9626 gene locus_tag LOCUS_03800 9997 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10974 10015 gene locus_tag LOCUS_03810 10974 10015 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461739.1 protein_id gnl|my_center|LOCUS_03810 12163 11051 gene locus_tag LOCUS_03820 12163 11051 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_03820 13597 12248 gene locus_tag LOCUS_03830 13597 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 14588 13689 gene locus_tag LOCUS_03840 14588 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 15943 14654 gene locus_tag LOCUS_03850 15943 14654 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_03850 16998 15940 gene locus_tag LOCUS_03860 16998 15940 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_03860 17290 18417 gene locus_tag LOCUS_03870 17290 18417 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_03870 18449 19459 gene locus_tag LOCUS_03880 gene sppA 18449 19459 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_03880 19562 20563 gene locus_tag LOCUS_03890 gene hflK 19562 20563 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_03890 20560 21522 gene locus_tag LOCUS_03900 20560 21522 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_03900 22837 21752 gene locus_tag LOCUS_03910 22837 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 24111 22834 gene locus_tag LOCUS_03920 24111 22834 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_03920 25256 24414 gene locus_tag LOCUS_03930 gene nifU 25256 24414 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_03930 26759 25524 gene locus_tag LOCUS_03940 26759 25524 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_03940 27860 26940 gene locus_tag LOCUS_03950 27860 26940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 28306 29427 gene locus_tag LOCUS_03960 28306 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_03960 30835 29420 gene locus_tag LOCUS_03970 30835 29420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_03970 31755 30832 gene locus_tag LOCUS_03980 31755 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 33152 31818 gene locus_tag LOCUS_03990 gene rsxC 33152 31818 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_03990 34152 33157 gene locus_tag LOCUS_04000 34152 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 35006 34149 gene locus_tag LOCUS_04010 gene cdaA 35006 34149 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_04010 35117 35031 gene locus_tag LOCUS_t00080 35117 35031 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 36129 35203 gene locus_tag LOCUS_04020 36129 35203 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_04020 36565 36131 gene locus_tag LOCUS_04030 36565 36131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 36738 36662 gene locus_tag LOCUS_t00090 36738 36662 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 37357 36908 gene locus_tag LOCUS_04040 37357 36908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 38122 37382 gene locus_tag LOCUS_04050 38122 37382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 <39065 38254 gene locus_tag LOCUS_04060 <39065 38254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875814.1:MnmC family methyltransferase >Feature sequence010 436 86 gene locus_tag LOCUS_04070 436 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1010 717 gene locus_tag LOCUS_04080 1010 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1240 1007 gene locus_tag LOCUS_04090 1240 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1933 1376 gene locus_tag LOCUS_04100 1933 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3912 2020 gene locus_tag LOCUS_04110 gene asnB 3912 2020 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_04110 4666 4004 gene locus_tag LOCUS_04120 4666 4004 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_04120 5734 6753 gene locus_tag LOCUS_04130 5734 6753 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_04130 6842 7345 gene locus_tag LOCUS_04140 6842 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7518 8684 gene locus_tag LOCUS_04150 7518 8684 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_04150 8904 9551 gene locus_tag LOCUS_04160 gene tmk 8904 9551 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_04160 9511 10719 gene locus_tag LOCUS_04170 9511 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 10712 11371 gene locus_tag LOCUS_04180 10712 11371 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_04180 14323 11774 gene locus_tag LOCUS_04190 gene mutS 14323 11774 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04190 14491 16008 gene locus_tag LOCUS_04200 14491 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 16149 17642 gene locus_tag LOCUS_04210 16149 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 17822 19033 gene locus_tag LOCUS_04220 gene metK 17822 19033 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_04220 19030 20013 gene locus_tag LOCUS_04230 19030 20013 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_04230 20049 20849 gene locus_tag LOCUS_04240 20049 20849 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_04240 20846 21388 gene locus_tag LOCUS_04250 gene hpt 20846 21388 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_04250 22026 21685 gene locus_tag LOCUS_04260 22026 21685 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_04260 23380 22040 gene locus_tag LOCUS_04270 23380 22040 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941878.1 protein_id gnl|my_center|LOCUS_04270 26258 24000 gene locus_tag LOCUS_04280 26258 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 26720 27145 gene locus_tag LOCUS_04290 26720 27145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 27635 28372 gene locus_tag LOCUS_04300 27635 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 28369 28863 gene locus_tag LOCUS_04310 28369 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 30296 29343 gene locus_tag LOCUS_04320 30296 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 31216 30293 gene locus_tag LOCUS_04330 gene nadA 31216 30293 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_04330 32307 31261 gene locus_tag LOCUS_04340 32307 31261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 33009 33779 gene locus_tag LOCUS_04350 33009 33779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 35125 33989 gene locus_tag LOCUS_04360 35125 33989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 35691 35176 gene locus_tag LOCUS_04370 35691 35176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 36767 36177 gene locus_tag LOCUS_04380 36767 36177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 37510 36821 gene locus_tag LOCUS_04390 37510 36821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 38038 37628 gene locus_tag LOCUS_04400 38038 37628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 38313 38170 gene locus_tag LOCUS_04410 38313 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence011 <1 837 gene locus_tag LOCUS_04420 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080214.1:cell division protein FtsZ 1650 1216 gene locus_tag LOCUS_04430 1650 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1838 1638 gene locus_tag LOCUS_04440 1838 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2333 4918 gene locus_tag LOCUS_04450 2333 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5257 4943 gene locus_tag LOCUS_04460 5257 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5498 5319 gene locus_tag LOCUS_04470 5498 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7044 5530 gene locus_tag LOCUS_04480 gene rho 7044 5530 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_04480 7798 7079 gene locus_tag LOCUS_04490 7798 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8171 9184 gene locus_tag LOCUS_04500 gene pta 8171 9184 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_04500 9199 9972 gene locus_tag LOCUS_04510 9199 9972 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_04510 11776 9995 gene locus_tag LOCUS_04520 gene argS 11776 9995 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_04520 11862 13025 gene locus_tag LOCUS_04530 11862 13025 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964099.1 protein_id gnl|my_center|LOCUS_04530 13022 13843 gene locus_tag LOCUS_04540 13022 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 13922 14488 gene locus_tag LOCUS_04550 13922 14488 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_04550 14824 16083 gene locus_tag LOCUS_04560 14824 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 16115 16375 gene locus_tag LOCUS_04570 16115 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 16470 17630 gene locus_tag LOCUS_04580 16470 17630 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_04580 19451 17640 gene locus_tag LOCUS_04590 19451 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 21452 19608 gene locus_tag LOCUS_04600 21452 19608 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_04600 21685 23046 gene locus_tag LOCUS_04610 21685 23046 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_04610 23419 25596 gene locus_tag LOCUS_04620 23419 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 27941 25983 gene locus_tag LOCUS_04630 27941 25983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 28133 29095 gene locus_tag LOCUS_04640 28133 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 30830 29142 gene locus_tag LOCUS_04650 30830 29142 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_04650 31962 30811 gene locus_tag LOCUS_04660 31962 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 32563 31937 gene locus_tag LOCUS_04670 32563 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 33480 32584 gene locus_tag LOCUS_04680 33480 32584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 34427 33477 gene locus_tag LOCUS_04690 34427 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 34958 35563 gene locus_tag LOCUS_04700 34958 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 35556 35924 gene locus_tag LOCUS_04710 35556 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 35937 37061 gene locus_tag LOCUS_04720 35937 37061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 37058 37495 gene locus_tag LOCUS_04730 37058 37495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence012 144 2048 gene locus_tag LOCUS_04740 144 2048 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_04740 2820 2134 gene locus_tag LOCUS_04750 2820 2134 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_04750 4854 3166 gene locus_tag LOCUS_04760 4854 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 6181 4925 gene locus_tag LOCUS_04770 6181 4925 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_04770 6990 6178 gene locus_tag LOCUS_04780 6990 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6989 7150 gene locus_tag LOCUS_04790 6989 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 7317 7235 gene locus_tag LOCUS_t00100 7317 7235 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8843 7344 gene locus_tag LOCUS_04800 8843 7344 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_04800 9500 8871 gene locus_tag LOCUS_04810 9500 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 11826 9688 gene locus_tag LOCUS_04820 11826 9688 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_04820 12358 13119 gene locus_tag LOCUS_04830 12358 13119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_04830 15094 15822 gene locus_tag LOCUS_04840 15094 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 16361 20893 gene locus_tag LOCUS_04850 gene gltB 16361 20893 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_04850 20908 22344 gene locus_tag LOCUS_04860 20908 22344 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_04860 22387 22908 gene locus_tag LOCUS_04870 gene cobU 22387 22908 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_04870 22913 23971 gene locus_tag LOCUS_04880 gene queA 22913 23971 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_04880 24181 24318 gene locus_tag LOCUS_04890 24181 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 24315 25127 gene locus_tag LOCUS_04900 24315 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 25124 26932 gene locus_tag LOCUS_04910 gene mutL 25124 26932 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_04910 26929 27981 gene locus_tag LOCUS_04920 26929 27981 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_04920 28847 28020 gene locus_tag LOCUS_04930 28847 28020 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_04930 31114 28850 gene locus_tag LOCUS_04940 31114 28850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 34848 31228 gene locus_tag LOCUS_04950 gene metH 34848 31228 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 protein_id gnl|my_center|LOCUS_04950 35337 35600 gene locus_tag LOCUS_04960 35337 35600 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_04960 35848 35615 gene locus_tag LOCUS_04970 35848 35615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 36528 35761 gene locus_tag LOCUS_04980 36528 35761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 37286 36747 gene locus_tag LOCUS_04990 37286 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence013 512 1432 gene locus_tag LOCUS_05000 512 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1832 1443 gene locus_tag LOCUS_05010 gene acpS 1832 1443 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_05010 2343 3206 gene locus_tag LOCUS_05020 2343 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3208 5628 gene locus_tag LOCUS_05030 3208 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6218 5661 gene locus_tag LOCUS_05040 6218 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7356 6280 gene locus_tag LOCUS_05050 7356 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 8627 7593 gene locus_tag LOCUS_05060 8627 7593 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_05060 9654 8620 gene locus_tag LOCUS_05070 9654 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10552 9674 gene locus_tag LOCUS_05080 10552 9674 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_05080 11615 10593 gene locus_tag LOCUS_05090 11615 10593 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_05090 12964 11954 gene locus_tag LOCUS_05100 gene rfaE1 12964 11954 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 protein_id gnl|my_center|LOCUS_05100 13439 12921 gene locus_tag LOCUS_05110 13439 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14193 14609 gene locus_tag LOCUS_05120 gene nikR 14193 14609 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_05120 14725 14889 gene locus_tag LOCUS_05130 14725 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14982 15749 gene locus_tag LOCUS_05140 14982 15749 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391248.1 protein_id gnl|my_center|LOCUS_05140 15781 16410 gene locus_tag LOCUS_05150 gene cbiM 15781 16410 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391247.1 protein_id gnl|my_center|LOCUS_05150 16959 17564 gene locus_tag LOCUS_05160 16959 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 18006 18773 gene locus_tag LOCUS_05170 gene cbiQ 18006 18773 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_05170 18758 19435 gene locus_tag LOCUS_05180 18758 19435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_05180 19744 19484 gene locus_tag LOCUS_05190 19744 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 20542 21306 gene locus_tag LOCUS_05200 20542 21306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 21303 22040 gene locus_tag LOCUS_05210 21303 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22051 23226 gene locus_tag LOCUS_05220 22051 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 23542 24234 gene locus_tag LOCUS_05230 23542 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24283 25854 gene locus_tag LOCUS_05240 24283 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 25884 26624 gene locus_tag LOCUS_05250 25884 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 28122 29279 gene locus_tag LOCUS_05260 28122 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 29310 30230 gene locus_tag LOCUS_05270 29310 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 30235 32181 gene locus_tag LOCUS_05280 30235 32181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 32471 33373 gene locus_tag LOCUS_05290 32471 33373 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937858.1 protein_id gnl|my_center|LOCUS_05290 33507 34481 gene locus_tag LOCUS_05300 33507 34481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941294.1 protein_id gnl|my_center|LOCUS_05300 36340 34484 gene locus_tag LOCUS_05310 gene asnB 36340 34484 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence014 1401 1021 gene locus_tag LOCUS_05320 1401 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3362 1479 gene locus_tag LOCUS_05330 3362 1479 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_05330 4373 3492 gene locus_tag LOCUS_05340 4373 3492 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_05340 6425 5043 gene locus_tag LOCUS_05350 6425 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8343 6619 gene locus_tag LOCUS_05360 8343 6619 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081418.1 protein_id gnl|my_center|LOCUS_05360 9468 8434 gene locus_tag LOCUS_05370 9468 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 10709 9459 gene locus_tag LOCUS_05380 10709 9459 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_05380 10952 11998 gene locus_tag LOCUS_05390 10952 11998 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_05390 12108 12680 gene locus_tag LOCUS_05400 gene pyrE 12108 12680 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_05400 12710 14071 gene locus_tag LOCUS_05410 12710 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14076 14888 gene locus_tag LOCUS_05420 14076 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 14982 15800 gene locus_tag LOCUS_05430 14982 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 16269 15916 gene locus_tag LOCUS_05440 16269 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 17513 16293 gene locus_tag LOCUS_05450 17513 16293 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_05450 17967 17515 gene locus_tag LOCUS_05460 17967 17515 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882710.1 protein_id gnl|my_center|LOCUS_05460 19101 18094 gene locus_tag LOCUS_05470 gene hypE 19101 18094 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_05470 19406 19627 gene locus_tag LOCUS_05480 19406 19627 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_05480 19653 20096 gene locus_tag LOCUS_05490 19653 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 20145 20618 gene locus_tag LOCUS_05500 gene nusB 20145 20618 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_05500 20652 21359 gene locus_tag LOCUS_05510 20652 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 22091 21465 gene locus_tag LOCUS_05520 22091 21465 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881116.1 protein_id gnl|my_center|LOCUS_05520 22858 22088 gene locus_tag LOCUS_05530 22858 22088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 24233 22902 gene locus_tag LOCUS_05540 24233 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 24362 24592 gene locus_tag LOCUS_05550 24362 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 24730 25515 gene locus_tag LOCUS_05560 24730 25515 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_05560 25554 26120 gene locus_tag LOCUS_05570 gene def 25554 26120 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_05570 26117 27097 gene locus_tag LOCUS_05580 26117 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 27807 28379 gene locus_tag LOCUS_05590 27807 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 30151 28874 gene locus_tag LOCUS_05600 30151 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 30627 30148 gene locus_tag LOCUS_05610 30627 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 31721 30624 gene locus_tag LOCUS_05620 gene dctP 31721 30624 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 protein_id gnl|my_center|LOCUS_05620 31942 33123 gene locus_tag LOCUS_05630 31942 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 33213 33461 gene locus_tag LOCUS_05640 33213 33461 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140099.1 protein_id gnl|my_center|LOCUS_05640 33462 33797 gene locus_tag LOCUS_05650 33462 33797 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 protein_id gnl|my_center|LOCUS_05650 34279 34746 gene locus_tag LOCUS_05660 34279 34746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 34834 36030 gene locus_tag LOCUS_05670 gene bamB 34834 36030 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356919.1 protein_id gnl|my_center|LOCUS_05670 36615 36061 gene locus_tag LOCUS_05680 36615 36061 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669823.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence015 91 843 gene locus_tag LOCUS_05690 gene hisA 91 843 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_05690 1296 1907 gene locus_tag LOCUS_05700 1296 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2290 3084 gene locus_tag LOCUS_05710 2290 3084 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_05710 3163 5466 gene locus_tag LOCUS_05720 3163 5466 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_05720 5789 6151 gene locus_tag LOCUS_05730 5789 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6354 7706 gene locus_tag LOCUS_05740 6354 7706 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062320.1 protein_id gnl|my_center|LOCUS_05740 8142 9593 gene locus_tag LOCUS_05750 gene gnd 8142 9593 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263332.1 protein_id gnl|my_center|LOCUS_05750 9630 12062 gene locus_tag LOCUS_05760 gene hypF 9630 12062 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_05760 12218 12412 gene locus_tag LOCUS_05770 12218 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 14243 12492 gene locus_tag LOCUS_05780 14243 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14470 14240 gene locus_tag LOCUS_05790 14470 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 17217 15196 gene locus_tag LOCUS_05800 17217 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 20437 17342 gene locus_tag LOCUS_05810 20437 17342 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05810 21675 20434 gene locus_tag LOCUS_05820 21675 20434 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192886.1 protein_id gnl|my_center|LOCUS_05820 22122 21748 gene locus_tag LOCUS_05830 22122 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 23436 22222 gene locus_tag LOCUS_05840 23436 22222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 23931 23458 gene locus_tag LOCUS_05850 23931 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 24778 23987 gene locus_tag LOCUS_05860 24778 23987 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906392.1 protein_id gnl|my_center|LOCUS_05860 25297 24827 gene locus_tag LOCUS_05870 25297 24827 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256100.1 protein_id gnl|my_center|LOCUS_05870 25995 25411 gene locus_tag LOCUS_05880 25995 25411 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_05880 26273 26043 gene locus_tag LOCUS_05890 26273 26043 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_05890 27492 26293 gene locus_tag LOCUS_05900 gene arsB 27492 26293 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_05900 27986 27510 gene locus_tag LOCUS_05910 27986 27510 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_05910 29575 28259 gene locus_tag LOCUS_05920 29575 28259 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_05920 29973 29692 gene locus_tag LOCUS_05930 29973 29692 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_05930 30333 30791 gene locus_tag LOCUS_05940 30333 30791 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417894.1 protein_id gnl|my_center|LOCUS_05940 31327 32067 gene locus_tag LOCUS_05950 gene lmtA 31327 32067 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_05950 32101 32835 gene locus_tag LOCUS_05960 32101 32835 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_05960 33129 33797 gene locus_tag LOCUS_05970 33129 33797 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_05970 34873 35448 gene locus_tag LOCUS_05980 34873 35448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 35555 35944 gene locus_tag LOCUS_05990 35555 35944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence016 191 1351 gene locus_tag LOCUS_06000 191 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1348 2520 gene locus_tag LOCUS_06010 1348 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2608 4431 gene locus_tag LOCUS_06020 2608 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4434 5159 gene locus_tag LOCUS_06030 4434 5159 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582813.1 protein_id gnl|my_center|LOCUS_06030 7138 5522 gene locus_tag LOCUS_06040 7138 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7840 7151 gene locus_tag LOCUS_06050 7840 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8364 7837 gene locus_tag LOCUS_06060 8364 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9307 8405 gene locus_tag LOCUS_06070 gene cysD 9307 8405 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 protein_id gnl|my_center|LOCUS_06070 9915 9304 gene locus_tag LOCUS_06080 gene cysC 9915 9304 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_06080 11551 9944 gene locus_tag LOCUS_06090 11551 9944 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_06090 13062 11668 gene locus_tag LOCUS_06100 13062 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13578 13662 gene locus_tag LOCUS_t00110 13578 13662 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14009 14084 gene locus_tag LOCUS_t00120 14009 14084 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14158 15351 gene locus_tag LOCUS_06110 gene tuf 14158 15351 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_06110 15370 15639 gene locus_tag LOCUS_06120 15370 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 15696 15772 gene locus_tag LOCUS_t00130 15696 15772 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15830 16027 gene locus_tag LOCUS_06130 15830 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 16073 16747 gene locus_tag LOCUS_06140 gene nusG 16073 16747 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_06140 16825 17247 gene locus_tag LOCUS_06150 gene rplK 16825 17247 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832298.1 protein_id gnl|my_center|LOCUS_06150 17244 17951 gene locus_tag LOCUS_06160 gene rplA 17244 17951 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_06160 17948 18469 gene locus_tag LOCUS_06170 gene rplJ 17948 18469 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_06170 18523 18930 gene locus_tag LOCUS_06180 gene rplL 18523 18930 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_06180 19052 22819 gene locus_tag LOCUS_06190 gene rpoB 19052 22819 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725157.1 protein_id gnl|my_center|LOCUS_06190 22870 27060 gene locus_tag LOCUS_06200 gene rpoC 22870 27060 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_06200 27139 27546 gene locus_tag LOCUS_06210 gene rpsL 27139 27546 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_06210 27593 28063 gene locus_tag LOCUS_06220 gene rpsG 27593 28063 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_06220 28225 30342 gene locus_tag LOCUS_06230 gene fusA 28225 30342 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_06230 30339 30662 gene locus_tag LOCUS_06240 gene rpsJ 30339 30662 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_06240 30719 31354 gene locus_tag LOCUS_06250 gene rplC 30719 31354 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_06250 31364 31996 gene locus_tag LOCUS_06260 gene rplD 31364 31996 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_06260 31993 32277 gene locus_tag LOCUS_06270 gene rplW 31993 32277 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_06270 32297 33124 gene locus_tag LOCUS_06280 gene rplB 32297 33124 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_06280 33121 33396 gene locus_tag LOCUS_06290 gene rpsS 33121 33396 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 protein_id gnl|my_center|LOCUS_06290 34346 33714 gene locus_tag LOCUS_06300 34346 33714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 35246 34401 gene locus_tag LOCUS_06310 gene nfo 35246 34401 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 protein_id gnl|my_center|LOCUS_06310 35820 35281 gene locus_tag LOCUS_06320 35820 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence017 2929 1046 gene locus_tag LOCUS_06330 2929 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3669 3172 gene locus_tag LOCUS_06340 3669 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5217 3835 gene locus_tag LOCUS_06350 gene purF 5217 3835 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_06350 6020 5217 gene locus_tag LOCUS_06360 6020 5217 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_06360 7111 6017 gene locus_tag LOCUS_06370 7111 6017 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_06370 8085 7186 gene locus_tag LOCUS_06380 8085 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9206 8112 gene locus_tag LOCUS_06390 gene dnaN 9206 8112 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970806.1 protein_id gnl|my_center|LOCUS_06390 9570 9872 gene locus_tag LOCUS_06400 9570 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 10443 9865 gene locus_tag LOCUS_06410 10443 9865 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_06410 12406 10607 gene locus_tag LOCUS_06420 gene lepA 12406 10607 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_06420 13316 12510 gene locus_tag LOCUS_06430 13316 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14982 13318 gene locus_tag LOCUS_06440 14982 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15905 14985 gene locus_tag LOCUS_06450 15905 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16750 15902 gene locus_tag LOCUS_06460 16750 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 18924 16771 gene locus_tag LOCUS_06470 18924 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 20286 19129 gene locus_tag LOCUS_06480 gene galK 20286 19129 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_06480 20785 20483 gene locus_tag LOCUS_06490 20785 20483 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_06490 21062 20775 gene locus_tag LOCUS_06500 21062 20775 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_06500 23041 21599 gene locus_tag LOCUS_06510 23041 21599 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_06510 23928 24656 gene locus_tag LOCUS_06520 23928 24656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 24709 27399 gene locus_tag LOCUS_06530 24709 27399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 27443 28606 gene locus_tag LOCUS_06540 27443 28606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 29892 28609 gene locus_tag LOCUS_06550 29892 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 30798 30019 gene locus_tag LOCUS_06560 30798 30019 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_06560 31219 30782 gene locus_tag LOCUS_06570 31219 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 33517 31301 gene locus_tag LOCUS_06580 33517 31301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 33937 33521 gene locus_tag LOCUS_06590 33937 33521 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_06590 34157 35701 gene locus_tag LOCUS_06600 34157 35701 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence018 1085 39 gene locus_tag LOCUS_06610 1085 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3116 1206 gene locus_tag LOCUS_06620 gene cysN 3116 1206 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_06620 4392 3139 gene locus_tag LOCUS_06630 gene ftsA 4392 3139 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 protein_id gnl|my_center|LOCUS_06630 5847 4414 gene locus_tag LOCUS_06640 5847 4414 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_06640 6158 8404 gene locus_tag LOCUS_06650 6158 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 8401 9933 gene locus_tag LOCUS_06660 8401 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 10624 10154 gene locus_tag LOCUS_06670 10624 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 11021 10764 gene locus_tag LOCUS_06680 11021 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12507 10984 gene locus_tag LOCUS_06690 12507 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13797 12532 gene locus_tag LOCUS_06700 gene icd 13797 12532 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444484.1 protein_id gnl|my_center|LOCUS_06700 15198 14179 gene locus_tag LOCUS_06710 gene argC 15198 14179 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_06710 15684 15283 gene locus_tag LOCUS_06720 gene rpsI 15684 15283 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_06720 16150 15725 gene locus_tag LOCUS_06730 gene rplM 16150 15725 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_06730 18302 16332 gene locus_tag LOCUS_06740 gene uvrB 18302 16332 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_06740 19219 18401 gene locus_tag LOCUS_06750 19219 18401 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280345.1 protein_id gnl|my_center|LOCUS_06750 19394 20698 gene locus_tag LOCUS_06760 19394 20698 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_06760 20695 21141 gene locus_tag LOCUS_06770 20695 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21144 22304 gene locus_tag LOCUS_06780 21144 22304 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_06780 22437 23231 gene locus_tag LOCUS_06790 22437 23231 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_06790 23228 24076 gene locus_tag LOCUS_06800 23228 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 24073 25038 gene locus_tag LOCUS_06810 gene xerC 24073 25038 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_06810 26275 25697 gene locus_tag LOCUS_06820 26275 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 26436 26284 gene locus_tag LOCUS_06830 26436 26284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 27818 26436 gene locus_tag LOCUS_06840 27818 26436 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889443.1 protein_id gnl|my_center|LOCUS_06840 28926 27850 gene locus_tag LOCUS_06850 28926 27850 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141176.1 protein_id gnl|my_center|LOCUS_06850 29835 29068 gene locus_tag LOCUS_06860 29835 29068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 29962 31329 gene locus_tag LOCUS_06870 gene murD 29962 31329 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545218.1 protein_id gnl|my_center|LOCUS_06870 31391 32521 gene locus_tag LOCUS_06880 31391 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 32544 33107 gene locus_tag LOCUS_06890 32544 33107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 33211 33696 gene locus_tag LOCUS_06900 33211 33696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 33706 34269 gene locus_tag LOCUS_06910 33706 34269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence019 2055 220 gene locus_tag LOCUS_06920 gene mrdA 2055 220 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06920 2576 2052 gene locus_tag LOCUS_06930 2576 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3509 4309 gene locus_tag LOCUS_06940 3509 4309 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 protein_id gnl|my_center|LOCUS_06940 4516 6195 gene locus_tag LOCUS_06950 4516 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8625 6349 gene locus_tag LOCUS_06960 8625 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 10166 8757 gene locus_tag LOCUS_06970 10166 8757 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_06970 10445 11101 gene locus_tag LOCUS_06980 10445 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11168 12925 gene locus_tag LOCUS_06990 11168 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12935 14101 gene locus_tag LOCUS_07000 12935 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 14103 15434 gene locus_tag LOCUS_07010 14103 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 15515 17989 gene locus_tag LOCUS_07020 15515 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18042 20615 gene locus_tag LOCUS_07030 18042 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20702 22576 gene locus_tag LOCUS_07040 20702 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 22577 23401 gene locus_tag LOCUS_07050 22577 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 23607 23819 gene locus_tag LOCUS_07060 23607 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 24888 23854 gene locus_tag LOCUS_07070 24888 23854 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_07070 26015 24885 gene locus_tag LOCUS_07080 26015 24885 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_07080 26179 27855 gene locus_tag LOCUS_07090 26179 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 27920 28828 gene locus_tag LOCUS_07100 27920 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 28825 30114 gene locus_tag LOCUS_07110 gene tyrS 28825 30114 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07110 30185 31333 gene locus_tag LOCUS_07120 30185 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 31336 33045 gene locus_tag LOCUS_07130 31336 33045 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence020 1431 205 gene locus_tag LOCUS_07140 gene argJ 1431 205 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_07140 1670 2752 gene locus_tag LOCUS_07150 1670 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4182 2788 gene locus_tag LOCUS_07160 gene rimO 4182 2788 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_07160 5109 4390 gene locus_tag LOCUS_07170 gene pyrH 5109 4390 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124676.1 protein_id gnl|my_center|LOCUS_07170 5686 5162 gene locus_tag LOCUS_07180 gene ilvN 5686 5162 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_07180 6072 5728 gene locus_tag LOCUS_07190 gene rplS 6072 5728 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_07190 6871 6185 gene locus_tag LOCUS_07200 gene trmD 6871 6185 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_07200 7215 6883 gene locus_tag LOCUS_07210 7215 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7659 7231 gene locus_tag LOCUS_07220 7659 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8059 8448 gene locus_tag LOCUS_07230 8059 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8490 9935 gene locus_tag LOCUS_07240 gene purB 8490 9935 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_07240 10042 10254 gene locus_tag LOCUS_07250 10042 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 10251 11426 gene locus_tag LOCUS_07260 10251 11426 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_07260 11771 13201 gene locus_tag LOCUS_07270 11771 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13240 14712 gene locus_tag LOCUS_07280 gene omcB 13240 14712 CDS product outer membrane complex protein OmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883195.1 protein_id gnl|my_center|LOCUS_07280 14881 14806 gene locus_tag LOCUS_t00140 14881 14806 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15348 16337 gene locus_tag LOCUS_07290 15348 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 16424 16501 gene locus_tag LOCUS_t00150 16424 16501 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16822 16733 gene locus_tag LOCUS_t00160 16822 16733 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17000 18355 gene locus_tag LOCUS_07300 17000 18355 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206819.1 protein_id gnl|my_center|LOCUS_07300 18938 18477 gene locus_tag LOCUS_07310 18938 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 19048 19860 gene locus_tag LOCUS_07320 19048 19860 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_07320 19857 20267 gene locus_tag LOCUS_07330 gene arfB 19857 20267 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_07330 20260 20676 gene locus_tag LOCUS_07340 20260 20676 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_07340 20764 21312 gene locus_tag LOCUS_07350 20764 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 21316 21720 gene locus_tag LOCUS_07360 21316 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21720 22406 gene locus_tag LOCUS_07370 21720 22406 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820420.1 protein_id gnl|my_center|LOCUS_07370 22406 23146 gene locus_tag LOCUS_07380 22406 23146 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867271.1 protein_id gnl|my_center|LOCUS_07380 23344 24072 gene locus_tag LOCUS_07390 gene bioD 23344 24072 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_07390 24095 24856 gene locus_tag LOCUS_07400 24095 24856 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883499.1 protein_id gnl|my_center|LOCUS_07400 25691 24774 gene locus_tag LOCUS_07410 25691 24774 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_07410 26554 25688 gene locus_tag LOCUS_07420 26554 25688 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 protein_id gnl|my_center|LOCUS_07420 27612 26596 gene locus_tag LOCUS_07430 gene pheS 27612 26596 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_07430 28327 27719 gene locus_tag LOCUS_07440 28327 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 28567 29559 gene locus_tag LOCUS_07450 28567 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 29649 29987 gene locus_tag LOCUS_07460 29649 29987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 29987 30961 gene locus_tag LOCUS_07470 29987 30961 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_07470 30958 32481 gene locus_tag LOCUS_07480 30958 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence021 3277 1112 gene locus_tag LOCUS_07490 3277 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3515 3318 gene locus_tag LOCUS_07500 3515 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5317 3722 gene locus_tag LOCUS_07510 5317 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6827 6324 gene locus_tag LOCUS_07520 6827 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7440 6841 gene locus_tag LOCUS_07530 7440 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10666 7826 gene locus_tag LOCUS_07540 10666 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 10877 11500 gene locus_tag LOCUS_07550 10877 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11505 14204 gene locus_tag LOCUS_07560 gene valS 11505 14204 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_07560 14418 15305 gene locus_tag LOCUS_07570 gene accD 14418 15305 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_07570 16362 15694 gene locus_tag LOCUS_07580 16362 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16794 16447 gene locus_tag LOCUS_07590 16794 16447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 18862 17000 gene locus_tag LOCUS_07600 gene fucI 18862 17000 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_07600 19398 19325 gene locus_tag LOCUS_t00170 19398 19325 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19605 20702 gene locus_tag LOCUS_07610 19605 20702 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_07610 20716 22035 gene locus_tag LOCUS_07620 20716 22035 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_07620 22927 22208 gene locus_tag LOCUS_07630 gene pdxJ 22927 22208 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_07630 23156 23554 gene locus_tag LOCUS_07640 23156 23554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 23604 26426 gene locus_tag LOCUS_07650 gene ppdK 23604 26426 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_07650 26639 26511 gene locus_tag LOCUS_07660 26639 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 27395 26688 gene locus_tag LOCUS_07670 27395 26688 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_07670 28287 27367 gene locus_tag LOCUS_07680 28287 27367 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_07680 28474 30633 gene locus_tag LOCUS_07690 28474 30633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 30673 33072 gene locus_tag LOCUS_07700 30673 33072 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence022 <1 939 gene locus_tag LOCUS_07710 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118525.1:nucleotide sugar dehydrogenase 1233 3722 gene locus_tag LOCUS_07720 1233 3722 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_07720 4282 3749 gene locus_tag LOCUS_07730 4282 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4668 4279 gene locus_tag LOCUS_07740 4668 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 5351 4668 gene locus_tag LOCUS_07750 5351 4668 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_07750 5596 6288 gene locus_tag LOCUS_07760 gene rsmI 5596 6288 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_07760 6434 8104 gene locus_tag LOCUS_07770 6434 8104 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460432.1 protein_id gnl|my_center|LOCUS_07770 8123 8836 gene locus_tag LOCUS_07780 8123 8836 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_07780 8833 10314 gene locus_tag LOCUS_07790 8833 10314 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584080.1 protein_id gnl|my_center|LOCUS_07790 12113 10737 gene locus_tag LOCUS_07800 12113 10737 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480393.1 protein_id gnl|my_center|LOCUS_07800 13068 12160 gene locus_tag LOCUS_07810 13068 12160 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_07810 14687 13236 gene locus_tag LOCUS_07820 14687 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15841 14684 gene locus_tag LOCUS_07830 15841 14684 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631402.1 protein_id gnl|my_center|LOCUS_07830 16565 15834 gene locus_tag LOCUS_07840 16565 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 17564 16572 gene locus_tag LOCUS_07850 17564 16572 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761991.1 protein_id gnl|my_center|LOCUS_07850 18295 17573 gene locus_tag LOCUS_07860 gene cobI 18295 17573 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_07860 19287 18292 gene locus_tag LOCUS_07870 19287 18292 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932081.1 protein_id gnl|my_center|LOCUS_07870 19575 21287 gene locus_tag LOCUS_07880 19575 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 21757 22605 gene locus_tag LOCUS_07890 21757 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 24325 22853 gene locus_tag LOCUS_07900 24325 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 24793 25212 gene locus_tag LOCUS_07910 24793 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 25286 26872 gene locus_tag LOCUS_07920 25286 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 26898 28829 gene locus_tag LOCUS_07930 26898 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 29474 30511 gene locus_tag LOCUS_07940 29474 30511 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_07940 30527 32119 gene locus_tag LOCUS_07950 30527 32119 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_07950 32116 32763 gene locus_tag LOCUS_07960 32116 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence023 62 151 gene locus_tag LOCUS_t00180 62 151 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1380 436 gene locus_tag LOCUS_07970 1380 436 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_07970 2493 1492 gene locus_tag LOCUS_07980 2493 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3362 2490 gene locus_tag LOCUS_07990 3362 2490 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_07990 6653 3393 gene locus_tag LOCUS_08000 gene carB 6653 3393 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_08000 8878 7520 gene locus_tag LOCUS_08010 8878 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 9550 8879 gene locus_tag LOCUS_08020 9550 8879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_08020 11049 9553 gene locus_tag LOCUS_08030 11049 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 11819 11046 gene locus_tag LOCUS_08040 11819 11046 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_08040 12024 12797 gene locus_tag LOCUS_08050 12024 12797 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_08050 14271 12946 gene locus_tag LOCUS_08060 14271 12946 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_08060 14466 15560 gene locus_tag LOCUS_08070 gene waaF 14466 15560 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225061.1 protein_id gnl|my_center|LOCUS_08070 16230 15712 gene locus_tag LOCUS_08080 16230 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 19023 16243 gene locus_tag LOCUS_08090 19023 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 19888 19127 gene locus_tag LOCUS_08100 19888 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20666 19905 gene locus_tag LOCUS_08110 20666 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 21312 20707 gene locus_tag LOCUS_08120 21312 20707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 22105 21392 gene locus_tag LOCUS_08130 22105 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 22800 23345 gene locus_tag LOCUS_08140 22800 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23406 24077 gene locus_tag LOCUS_08150 23406 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 24822 24415 gene locus_tag LOCUS_08160 24822 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 25247 26011 gene locus_tag LOCUS_08170 gene hisF 25247 26011 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_08170 26082 26966 gene locus_tag LOCUS_08180 26082 26966 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_08180 26932 28446 gene locus_tag LOCUS_08190 gene gltA 26932 28446 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_08190 28465 29271 gene locus_tag LOCUS_08200 28465 29271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 30428 29295 gene locus_tag LOCUS_08210 30428 29295 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence024 427 1182 gene locus_tag LOCUS_08220 gene istB 427 1182 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_08220 1812 1381 gene locus_tag LOCUS_08230 1812 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2919 3998 gene locus_tag LOCUS_08240 2919 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5517 4183 gene locus_tag LOCUS_08250 5517 4183 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182934.1 protein_id gnl|my_center|LOCUS_08250 5676 5518 gene locus_tag LOCUS_08260 5676 5518 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_08260 6081 5707 gene locus_tag LOCUS_08270 6081 5707 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_08270 6750 6160 gene locus_tag LOCUS_08280 6750 6160 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_08280 7354 6833 gene locus_tag LOCUS_08290 7354 6833 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_08290 7864 7406 gene locus_tag LOCUS_08300 7864 7406 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_08300 8076 10628 gene locus_tag LOCUS_08310 8076 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 10760 12148 gene locus_tag LOCUS_08320 10760 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13339 12362 gene locus_tag LOCUS_08330 13339 12362 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_08330 13894 13445 gene locus_tag LOCUS_08340 13894 13445 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_08340 14659 14078 gene locus_tag LOCUS_08350 gene pgsA 14659 14078 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 protein_id gnl|my_center|LOCUS_08350 15600 14656 gene locus_tag LOCUS_08360 gene rnhC 15600 14656 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_08360 15837 15646 gene locus_tag LOCUS_08370 15837 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 15866 17422 gene locus_tag LOCUS_08380 15866 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 17436 18848 gene locus_tag LOCUS_08390 17436 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 19183 19578 gene locus_tag LOCUS_08400 gene rpsM 19183 19578 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883266.1 protein_id gnl|my_center|LOCUS_08400 19608 20159 gene locus_tag LOCUS_08410 19608 20159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 20308 21330 gene locus_tag LOCUS_08420 20308 21330 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_08420 21335 21850 gene locus_tag LOCUS_08430 21335 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 22931 22158 gene locus_tag LOCUS_08440 22931 22158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_08440 25476 22969 gene locus_tag LOCUS_08450 25476 22969 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_08450 25953 25525 gene locus_tag LOCUS_08460 25953 25525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 26227 27267 gene locus_tag LOCUS_08470 26227 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 27976 27419 gene locus_tag LOCUS_08480 27976 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 28412 27993 gene locus_tag LOCUS_08490 28412 27993 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_08490 29114 28422 gene locus_tag LOCUS_08500 gene queE 29114 28422 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267001.1 protein_id gnl|my_center|LOCUS_08500 29210 29283 gene locus_tag LOCUS_t00190 29210 29283 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 584 201 gene locus_tag LOCUS_08510 584 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1521 577 gene locus_tag LOCUS_08520 gene trxB 1521 577 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_08520 2006 1521 gene locus_tag LOCUS_08530 2006 1521 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_08530 2461 2030 gene locus_tag LOCUS_08540 2461 2030 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_08540 3373 2534 gene locus_tag LOCUS_08550 3373 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4251 3466 gene locus_tag LOCUS_08560 4251 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7574 4314 gene locus_tag LOCUS_08570 7574 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8068 7655 gene locus_tag LOCUS_08580 8068 7655 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_08580 9509 8112 gene locus_tag LOCUS_08590 gene murC 9509 8112 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_08590 10497 9562 gene locus_tag LOCUS_08600 10497 9562 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_08600 11810 10494 gene locus_tag LOCUS_08610 gene hflX 11810 10494 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873770.1 protein_id gnl|my_center|LOCUS_08610 12002 12952 gene locus_tag LOCUS_08620 12002 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13194 13874 gene locus_tag LOCUS_08630 13194 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 13894 14877 gene locus_tag LOCUS_08640 13894 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 15167 14976 gene locus_tag LOCUS_08650 15167 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 15111 15584 gene locus_tag LOCUS_08660 15111 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15603 16388 gene locus_tag LOCUS_08670 15603 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 17513 16308 gene locus_tag LOCUS_08680 gene ftsW 17513 16308 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_08680 19043 17544 gene locus_tag LOCUS_08690 gene guaB 19043 17544 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_08690 20718 19159 gene locus_tag LOCUS_08700 20718 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 21699 20926 gene locus_tag LOCUS_08710 21699 20926 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_08710 21921 23018 gene locus_tag LOCUS_08720 21921 23018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 23058 23774 gene locus_tag LOCUS_08730 23058 23774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_08730 23761 24348 gene locus_tag LOCUS_08740 23761 24348 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_08740 24350 25414 gene locus_tag LOCUS_08750 24350 25414 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_08750 25411 26160 gene locus_tag LOCUS_08760 25411 26160 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_08760 26442 27452 gene locus_tag LOCUS_08770 26442 27452 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_08770 29395 28148 gene locus_tag LOCUS_08780 29395 28148 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_08780 30382 30864 gene locus_tag LOCUS_08790 30382 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence026 797 1744 gene locus_tag LOCUS_08800 797 1744 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_08800 1804 2460 gene locus_tag LOCUS_08810 1804 2460 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 protein_id gnl|my_center|LOCUS_08810 2473 3090 gene locus_tag LOCUS_08820 gene pth 2473 3090 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_08820 3056 3352 gene locus_tag LOCUS_08830 3056 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3412 4044 gene locus_tag LOCUS_08840 3412 4044 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_08840 4110 4340 gene locus_tag LOCUS_08850 gene rpsR 4110 4340 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_08850 4362 4811 gene locus_tag LOCUS_08860 gene rplI 4362 4811 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_08860 5021 6253 gene locus_tag LOCUS_08870 5021 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6963 6250 gene locus_tag LOCUS_08880 6963 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 7829 6960 gene locus_tag LOCUS_08890 gene ispH 7829 6960 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_08890 8162 9649 gene locus_tag LOCUS_08900 gene dnaB 8162 9649 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_08900 10777 9953 gene locus_tag LOCUS_08910 10777 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 11649 10774 gene locus_tag LOCUS_08920 11649 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12004 12501 gene locus_tag LOCUS_08930 12004 12501 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249124.1 protein_id gnl|my_center|LOCUS_08930 12633 13649 gene locus_tag LOCUS_08940 gene pseB 12633 13649 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_08940 14193 14411 gene locus_tag LOCUS_08950 14193 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 14408 14977 gene locus_tag LOCUS_08960 14408 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 15542 16705 gene locus_tag LOCUS_08970 gene pseC 15542 16705 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_08970 16721 17278 gene locus_tag LOCUS_08980 16721 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 17259 17465 gene locus_tag LOCUS_08990 17259 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 17614 17462 gene locus_tag LOCUS_09000 17614 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18016 18684 gene locus_tag LOCUS_09010 18016 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 18904 19887 gene locus_tag LOCUS_09020 gene arnC 18904 19887 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099176.1 protein_id gnl|my_center|LOCUS_09020 19900 21888 gene locus_tag LOCUS_09030 gene arnA 19900 21888 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704925.1 protein_id gnl|my_center|LOCUS_09030 21908 23683 gene locus_tag LOCUS_09040 21908 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 23683 24822 gene locus_tag LOCUS_09050 gene arnB 23683 24822 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001379974.1 protein_id gnl|my_center|LOCUS_09050 25112 26050 gene locus_tag LOCUS_09060 gene arnD 25112 26050 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267893.1 protein_id gnl|my_center|LOCUS_09060 27127 27999 gene locus_tag LOCUS_09070 27127 27999 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_09070 28453 29223 gene locus_tag LOCUS_09080 28453 29223 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_09080 29220 30515 gene locus_tag LOCUS_09090 29220 30515 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence027 957 316 gene locus_tag LOCUS_09100 957 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2549 1059 gene locus_tag LOCUS_09110 2549 1059 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_09110 2834 4231 gene locus_tag LOCUS_09120 gene lpdA 2834 4231 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_09120 4188 4394 gene locus_tag LOCUS_09130 4188 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4395 4468 gene locus_tag LOCUS_t00200 4395 4468 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5093 4938 gene locus_tag LOCUS_09140 5093 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5170 7038 gene locus_tag LOCUS_09150 gene mnmG 5170 7038 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_09150 7460 8215 gene locus_tag LOCUS_09160 7460 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 8318 9385 gene locus_tag LOCUS_09170 8318 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_09170 9425 9991 gene locus_tag LOCUS_09180 9425 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10287 11984 gene locus_tag LOCUS_09190 10287 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12430 12654 gene locus_tag LOCUS_09200 12430 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 12651 12836 gene locus_tag LOCUS_09210 12651 12836 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_09210 13021 14727 gene locus_tag LOCUS_09220 13021 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 15037 15855 gene locus_tag LOCUS_09230 15037 15855 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_09230 15852 16856 gene locus_tag LOCUS_09240 15852 16856 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_09240 16853 18280 gene locus_tag LOCUS_09250 16853 18280 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_09250 19201 18338 gene locus_tag LOCUS_09260 19201 18338 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_09260 20174 19272 gene locus_tag LOCUS_09270 20174 19272 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_09270 21084 20164 gene locus_tag LOCUS_09280 21084 20164 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_09280 22681 21305 gene locus_tag LOCUS_09290 22681 21305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_09290 23406 22984 gene locus_tag LOCUS_09300 23406 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 24328 23513 gene locus_tag LOCUS_09310 24328 23513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 24591 24325 gene locus_tag LOCUS_09320 24591 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 24940 26964 gene locus_tag LOCUS_09330 24940 26964 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_09330 27235 26981 gene locus_tag LOCUS_09340 27235 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 27492 27232 gene locus_tag LOCUS_09350 27492 27232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 27850 27662 gene locus_tag LOCUS_09360 27850 27662 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_09360 28059 27847 gene locus_tag LOCUS_09370 28059 27847 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_09370 <29512 28254 gene locus_tag LOCUS_09380 <29512 28254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938194.1:ATP-dependent RecD-like DNA helicase >Feature sequence028 294 1508 gene locus_tag LOCUS_09390 294 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1689 4067 gene locus_tag LOCUS_09400 1689 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5054 4332 gene locus_tag LOCUS_09410 5054 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6388 5069 gene locus_tag LOCUS_09420 6388 5069 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_09420 6771 6529 gene locus_tag LOCUS_09430 6771 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 6988 6764 gene locus_tag LOCUS_09440 6988 6764 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_09440 8438 7203 gene locus_tag LOCUS_09450 8438 7203 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_09450 8605 9582 gene locus_tag LOCUS_09460 8605 9582 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_09460 9645 12260 gene locus_tag LOCUS_09470 9645 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15147 12586 gene locus_tag LOCUS_09480 15147 12586 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107267.1 protein_id gnl|my_center|LOCUS_09480 15451 17133 gene locus_tag LOCUS_09490 15451 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 17173 18297 gene locus_tag LOCUS_09500 17173 18297 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869194.1 protein_id gnl|my_center|LOCUS_09500 18337 19701 gene locus_tag LOCUS_09510 18337 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 19813 21354 gene locus_tag LOCUS_09520 19813 21354 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922611.1 protein_id gnl|my_center|LOCUS_09520 22502 21429 gene locus_tag LOCUS_09530 22502 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23721 22600 gene locus_tag LOCUS_09540 23721 22600 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_09540 25045 23774 gene locus_tag LOCUS_09550 gene eno 25045 23774 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_09550 26170 25163 gene locus_tag LOCUS_09560 gene gap 26170 25163 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_09560 27926 26340 gene locus_tag LOCUS_09570 27926 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 28893 28015 gene locus_tag LOCUS_09580 28893 28015 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence029 <1 795 gene locus_tag LOCUS_09590 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438130.1:exodeoxyribonuclease VII large subunit 792 2150 gene locus_tag LOCUS_09600 792 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2199 2936 gene locus_tag LOCUS_09610 2199 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4424 3003 gene locus_tag LOCUS_09620 4424 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4656 5285 gene locus_tag LOCUS_09630 4656 5285 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_09630 6653 5574 gene locus_tag LOCUS_09640 gene fbaA 6653 5574 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_09640 7171 6887 gene locus_tag LOCUS_09650 7171 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7633 9063 gene locus_tag LOCUS_09660 gene pyk 7633 9063 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125075.1 protein_id gnl|my_center|LOCUS_09660 9264 10550 gene locus_tag LOCUS_09670 9264 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10547 11452 gene locus_tag LOCUS_09680 10547 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11565 11876 gene locus_tag LOCUS_09690 11565 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 12577 11999 gene locus_tag LOCUS_09700 12577 11999 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_09700 13275 12574 gene locus_tag LOCUS_09710 gene rnc 13275 12574 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_09710 15018 13315 gene locus_tag LOCUS_09720 15018 13315 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_09720 15387 15043 gene locus_tag LOCUS_09730 15387 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 16828 15413 gene locus_tag LOCUS_09740 16828 15413 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_09740 17870 17094 gene locus_tag LOCUS_09750 17870 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18231 22214 gene locus_tag LOCUS_09760 18231 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 22199 23575 gene locus_tag LOCUS_09770 22199 23575 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_09770 23586 24893 gene locus_tag LOCUS_09780 23586 24893 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_09780 25083 26450 gene locus_tag LOCUS_09790 25083 26450 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_09790 26559 28427 gene locus_tag LOCUS_09800 26559 28427 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_09800 <29179 28517 gene locus_tag LOCUS_09810 <29179 28517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence030 <1 1091 gene locus_tag LOCUS_09820 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073846.1:VCBS domain-containing protein 2963 1239 gene locus_tag LOCUS_09830 2963 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3249 3770 gene locus_tag LOCUS_09840 3249 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3827 4024 gene locus_tag LOCUS_09850 3827 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4067 6403 gene locus_tag LOCUS_09860 4067 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 6529 8250 gene locus_tag LOCUS_09870 6529 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 8315 8670 gene locus_tag LOCUS_tm00010 8315 8670 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8783 9028 gene locus_tag LOCUS_09880 8783 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9706 9413 gene locus_tag LOCUS_09890 9706 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10198 10551 gene locus_tag LOCUS_09900 10198 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 10526 10711 gene locus_tag LOCUS_09910 10526 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 10712 10846 gene locus_tag LOCUS_09920 10712 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 11049 11576 gene locus_tag LOCUS_09930 11049 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 12440 11628 gene locus_tag LOCUS_09940 12440 11628 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_09940 13017 13976 gene locus_tag LOCUS_09950 gene cbiB 13017 13976 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_09950 13987 14391 gene locus_tag LOCUS_09960 13987 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 15470 14673 gene locus_tag LOCUS_09970 15470 14673 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485784.1 protein_id gnl|my_center|LOCUS_09970 16816 15713 gene locus_tag LOCUS_09980 gene prfB 16816 15713 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_09980 17034 17561 gene locus_tag LOCUS_09990 17034 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 19679 17826 gene locus_tag LOCUS_10000 19679 17826 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_10000 20081 19680 gene locus_tag LOCUS_10010 20081 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 20679 20068 gene locus_tag LOCUS_10020 20679 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 21728 20769 gene locus_tag LOCUS_10030 21728 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 22498 21989 gene locus_tag LOCUS_10040 gene purE 22498 21989 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_10040 22868 22518 gene locus_tag LOCUS_10050 22868 22518 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_10050 24639 22921 gene locus_tag LOCUS_10060 24639 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 25046 24636 gene locus_tag LOCUS_10070 gene prpB 25046 24636 CDS product protein arginine phosphatase PrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227664.1 protein_id gnl|my_center|LOCUS_10070 25435 27591 gene locus_tag LOCUS_10080 gene clpB 25435 27591 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_10080 27735 28484 gene locus_tag LOCUS_10090 27735 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence031 1293 61 gene locus_tag LOCUS_10100 1293 61 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_10100 1644 2735 gene locus_tag LOCUS_10110 1644 2735 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496935.1 protein_id gnl|my_center|LOCUS_10110 3079 3789 gene locus_tag LOCUS_10120 3079 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3853 6579 gene locus_tag LOCUS_10130 3853 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6572 7570 gene locus_tag LOCUS_10140 6572 7570 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_10140 7583 8491 gene locus_tag LOCUS_10150 7583 8491 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_10150 8488 10422 gene locus_tag LOCUS_10160 8488 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10422 11735 gene locus_tag LOCUS_10170 10422 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11725 13719 gene locus_tag LOCUS_10180 11725 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13716 16064 gene locus_tag LOCUS_10190 13716 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 18090 16141 gene locus_tag LOCUS_10200 18090 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 20707 18116 gene locus_tag LOCUS_10210 gene secDF 20707 18116 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_10210 21081 20704 gene locus_tag LOCUS_10220 21081 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 21365 23170 gene locus_tag LOCUS_10230 gene ptsP 21365 23170 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048342.1 protein_id gnl|my_center|LOCUS_10230 23175 23678 gene locus_tag LOCUS_10240 23175 23678 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_10240 23812 24690 gene locus_tag LOCUS_10250 23812 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 24699 25667 gene locus_tag LOCUS_10260 24699 25667 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_10260 25664 26173 gene locus_tag LOCUS_10270 25664 26173 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933865.1 protein_id gnl|my_center|LOCUS_10270 26170 26832 gene locus_tag LOCUS_10280 26170 26832 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence032 76 1608 gene locus_tag LOCUS_10290 76 1608 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_10290 1637 2116 gene locus_tag LOCUS_10300 1637 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2296 4479 gene locus_tag LOCUS_10310 2296 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4607 4963 gene locus_tag LOCUS_10320 4607 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4960 5757 gene locus_tag LOCUS_10330 gene mazG 4960 5757 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_10330 5953 7389 gene locus_tag LOCUS_10340 5953 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 7403 9049 gene locus_tag LOCUS_10350 7403 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9046 11082 gene locus_tag LOCUS_10360 9046 11082 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_10360 11264 12046 gene locus_tag LOCUS_10370 11264 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 12129 12740 gene locus_tag LOCUS_10380 gene infC 12129 12740 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_10380 12721 12918 gene locus_tag LOCUS_10390 gene rpmI 12721 12918 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_10390 12949 13299 gene locus_tag LOCUS_10400 gene rplT 12949 13299 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_10400 14647 13865 gene locus_tag LOCUS_10410 14647 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 16394 14625 gene locus_tag LOCUS_10420 16394 14625 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_10420 16711 17310 gene locus_tag LOCUS_10430 16711 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 17307 18482 gene locus_tag LOCUS_10440 gene rodA 17307 18482 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_10440 20419 18947 gene locus_tag LOCUS_10450 20419 18947 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_10450 21752 20736 gene locus_tag LOCUS_10460 21752 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 22933 22733 gene locus_tag LOCUS_10470 22933 22733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 23163 23453 gene locus_tag LOCUS_10480 23163 23453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 23984 24232 gene locus_tag LOCUS_10490 23984 24232 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_10490 24225 24614 gene locus_tag LOCUS_10500 24225 24614 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_10500 25031 25297 gene locus_tag LOCUS_10510 25031 25297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 26673 25330 gene locus_tag LOCUS_10520 26673 25330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence033 1495 716 gene locus_tag LOCUS_10530 1495 716 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_10530 2474 3370 gene locus_tag LOCUS_10540 gene folD 2474 3370 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_10540 3474 3716 gene locus_tag LOCUS_10550 3474 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3814 4761 gene locus_tag LOCUS_10560 3814 4761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_10560 4758 6359 gene locus_tag LOCUS_10570 4758 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6356 7582 gene locus_tag LOCUS_10580 6356 7582 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_10580 9132 7732 gene locus_tag LOCUS_10590 9132 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 9495 10085 gene locus_tag LOCUS_10600 9495 10085 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545744.1 protein_id gnl|my_center|LOCUS_10600 10175 10357 gene locus_tag LOCUS_10610 10175 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10354 10809 gene locus_tag LOCUS_10620 10354 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 10835 11554 gene locus_tag LOCUS_10630 10835 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11554 12180 gene locus_tag LOCUS_10640 gene gmhB 11554 12180 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_10640 12460 13461 gene locus_tag LOCUS_10650 12460 13461 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383609.1 protein_id gnl|my_center|LOCUS_10650 13505 14632 gene locus_tag LOCUS_10660 13505 14632 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_10660 14669 15607 gene locus_tag LOCUS_10670 14669 15607 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_10670 15985 17430 gene locus_tag LOCUS_10680 15985 17430 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_10680 17475 18350 gene locus_tag LOCUS_10690 17475 18350 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_10690 18340 19278 gene locus_tag LOCUS_10700 18340 19278 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548230.1 protein_id gnl|my_center|LOCUS_10700 19279 20163 gene locus_tag LOCUS_10710 19279 20163 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_10710 20163 20852 gene locus_tag LOCUS_10720 20163 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 20868 21743 gene locus_tag LOCUS_10730 20868 21743 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082140.1 protein_id gnl|my_center|LOCUS_10730 21931 23772 gene locus_tag LOCUS_10740 21931 23772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_10740 23774 24757 gene locus_tag LOCUS_10750 23774 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 24772 25869 gene locus_tag LOCUS_10760 24772 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 25862 26779 gene locus_tag LOCUS_10770 25862 26779 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence034 1855 575 gene locus_tag LOCUS_10780 gene purD 1855 575 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_10780 2083 2454 gene locus_tag LOCUS_10790 2083 2454 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723010.1 protein_id gnl|my_center|LOCUS_10790 2469 2678 gene locus_tag LOCUS_10800 2469 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2752 2991 gene locus_tag LOCUS_10810 2752 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3155 3754 gene locus_tag LOCUS_10820 3155 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3756 5426 gene locus_tag LOCUS_10830 3756 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6635 5613 gene locus_tag LOCUS_10840 6635 5613 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_10840 7659 6667 gene locus_tag LOCUS_10850 7659 6667 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_10850 8701 7664 gene locus_tag LOCUS_10860 gene plsX 8701 7664 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_10860 8915 8736 gene locus_tag LOCUS_10870 gene rpmF 8915 8736 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_10870 9287 10093 gene locus_tag LOCUS_10880 gene thiF 9287 10093 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_10880 10267 11940 gene locus_tag LOCUS_10890 gene ilvD 10267 11940 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_10890 11970 13571 gene locus_tag LOCUS_10900 11970 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 13568 14095 gene locus_tag LOCUS_10910 13568 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14080 14865 gene locus_tag LOCUS_10920 14080 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 14858 16561 gene locus_tag LOCUS_10930 14858 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 16558 17640 gene locus_tag LOCUS_10940 gene rlmN 16558 17640 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_10940 18968 18024 gene locus_tag LOCUS_10950 18968 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 19297 19575 gene locus_tag LOCUS_10960 19297 19575 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_10960 19917 21122 gene locus_tag LOCUS_10970 19917 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 21171 21893 gene locus_tag LOCUS_10980 21171 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 22320 23123 gene locus_tag LOCUS_10990 22320 23123 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881166.1 protein_id gnl|my_center|LOCUS_10990 23792 23322 gene locus_tag LOCUS_11000 gene tadA 23792 23322 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_11000 24051 23800 gene locus_tag LOCUS_11010 24051 23800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 24349 26784 gene locus_tag LOCUS_11020 24349 26784 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence035 1008 1754 gene locus_tag LOCUS_11030 1008 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1986 2939 gene locus_tag LOCUS_11040 1986 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2936 3784 gene locus_tag LOCUS_11050 gene lipA 2936 3784 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938204.1 protein_id gnl|my_center|LOCUS_11050 5321 3831 gene locus_tag LOCUS_11060 5321 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5631 5706 gene locus_tag LOCUS_t00210 5631 5706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6165 5737 gene locus_tag LOCUS_11070 6165 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 7872 6301 gene locus_tag LOCUS_11080 gene serA 7872 6301 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_11080 8149 8538 gene locus_tag LOCUS_11090 gene rbfA 8149 8538 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_11090 9978 9016 gene locus_tag LOCUS_11100 9978 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 10238 12373 gene locus_tag LOCUS_11110 10238 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 13089 12835 gene locus_tag LOCUS_11120 gene rpsT 13089 12835 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_11120 15071 13224 gene locus_tag LOCUS_11130 15071 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 15537 15337 gene locus_tag LOCUS_11140 15537 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 15797 15549 gene locus_tag LOCUS_11150 15797 15549 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_11150 16502 16014 gene locus_tag LOCUS_11160 16502 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 17418 16465 gene locus_tag LOCUS_11170 17418 16465 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_11170 17603 17415 gene locus_tag LOCUS_11180 17603 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 18313 18397 gene locus_tag LOCUS_t00220 18313 18397 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 19790 18429 gene locus_tag LOCUS_11190 gene rpoD 19790 18429 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_11190 20961 19840 gene locus_tag LOCUS_11200 20961 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 21143 21059 gene locus_tag LOCUS_t00230 21143 21059 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23011 21527 gene locus_tag LOCUS_11210 gene ffh 23011 21527 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_11210 23465 23013 gene locus_tag LOCUS_11220 23465 23013 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_11220 23843 23592 gene locus_tag LOCUS_11230 23843 23592 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence036 1387 1160 gene locus_tag LOCUS_11240 1387 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1423 2745 gene locus_tag LOCUS_11250 1423 2745 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_11250 2745 3437 gene locus_tag LOCUS_11260 gene queC 2745 3437 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 protein_id gnl|my_center|LOCUS_11260 3761 4024 gene locus_tag LOCUS_11270 3761 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4300 4458 gene locus_tag LOCUS_11280 4300 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4721 4921 gene locus_tag LOCUS_11290 4721 4921 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_11290 5810 5082 gene locus_tag LOCUS_11300 5810 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6105 5950 gene locus_tag LOCUS_11310 6105 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 7798 6263 gene locus_tag LOCUS_11320 7798 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 10323 7795 gene locus_tag LOCUS_11330 10323 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 11166 10552 gene locus_tag LOCUS_11340 11166 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 11483 12517 gene locus_tag LOCUS_11350 11483 12517 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_11350 12514 13917 gene locus_tag LOCUS_11360 12514 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 15484 14099 gene locus_tag LOCUS_11370 15484 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 16209 15652 gene locus_tag LOCUS_11380 16209 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 18246 17056 gene locus_tag LOCUS_11390 18246 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 19290 18457 gene locus_tag LOCUS_11400 19290 18457 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_11400 21872 19668 gene locus_tag LOCUS_11410 21872 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 22448 22035 gene locus_tag LOCUS_11420 22448 22035 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_11420 23197 22445 gene locus_tag LOCUS_11430 23197 22445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 23504 24943 gene locus_tag LOCUS_11440 gene gatB 23504 24943 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence037 1099 212 gene locus_tag LOCUS_11450 1099 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1689 1096 gene locus_tag LOCUS_11460 gene rpoE 1689 1096 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_11460 4140 1975 gene locus_tag LOCUS_11470 gene fusA 4140 1975 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_11470 4251 5012 gene locus_tag LOCUS_11480 4251 5012 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 protein_id gnl|my_center|LOCUS_11480 5095 6576 gene locus_tag LOCUS_11490 5095 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6827 7453 gene locus_tag LOCUS_11500 gene rsxA 6827 7453 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 protein_id gnl|my_center|LOCUS_11500 10223 7650 gene locus_tag LOCUS_11510 10223 7650 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_11510 10638 10162 gene locus_tag LOCUS_11520 10638 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10930 11679 gene locus_tag LOCUS_11530 10930 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11868 12785 gene locus_tag LOCUS_11540 gene fabD 11868 12785 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_11540 12849 15404 gene locus_tag LOCUS_11550 12849 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 15401 16198 gene locus_tag LOCUS_11560 15401 16198 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_11560 16195 17463 gene locus_tag LOCUS_11570 16195 17463 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_11570 17460 18566 gene locus_tag LOCUS_11580 17460 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 20922 18619 gene locus_tag LOCUS_11590 20922 18619 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_11590 23889 21298 gene locus_tag LOCUS_11600 23889 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence038 554 1504 gene locus_tag LOCUS_11610 554 1504 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_11610 1515 2201 gene locus_tag LOCUS_11620 1515 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2198 3655 gene locus_tag LOCUS_11630 2198 3655 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_11630 3659 5230 gene locus_tag LOCUS_11640 3659 5230 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_11640 5263 6030 gene locus_tag LOCUS_11650 5263 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6023 8140 gene locus_tag LOCUS_11660 gene hyfB 6023 8140 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_11660 8322 9059 gene locus_tag LOCUS_11670 8322 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9162 9779 gene locus_tag LOCUS_11680 9162 9779 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_11680 12036 9883 gene locus_tag LOCUS_11690 12036 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 13230 12112 gene locus_tag LOCUS_11700 13230 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 14428 13370 gene locus_tag LOCUS_11710 14428 13370 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_11710 14732 14998 gene locus_tag LOCUS_11720 gene rpsO 14732 14998 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_11720 15419 17518 gene locus_tag LOCUS_11730 gene pnp 15419 17518 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_11730 17519 19585 gene locus_tag LOCUS_11740 gene pheT 17519 19585 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_11740 20094 23366 gene locus_tag LOCUS_11750 20094 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 23409 24335 gene locus_tag LOCUS_11760 gene cmoB 23409 24335 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483112.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence039 431 159 gene locus_tag LOCUS_11770 431 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1423 431 gene locus_tag LOCUS_11780 1423 431 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_11780 2497 1439 gene locus_tag LOCUS_11790 2497 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2861 4681 gene locus_tag LOCUS_11800 2861 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4719 6992 gene locus_tag LOCUS_11810 4719 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7367 6963 gene locus_tag LOCUS_11820 7367 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 7572 8120 gene locus_tag LOCUS_11830 gene pyrR 7572 8120 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_11830 8165 9088 gene locus_tag LOCUS_11840 8165 9088 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_11840 9085 10284 gene locus_tag LOCUS_11850 9085 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 10759 13758 gene locus_tag LOCUS_11860 gene secA 10759 13758 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_11860 14840 14583 gene locus_tag LOCUS_11870 14840 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14934 15851 gene locus_tag LOCUS_11880 14934 15851 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_11880 16026 16472 gene locus_tag LOCUS_11890 16026 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16765 17007 gene locus_tag LOCUS_11900 16765 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 17004 17267 gene locus_tag LOCUS_11910 17004 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 20998 17474 gene locus_tag LOCUS_11920 gene nifJ 20998 17474 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_11920 23148 21586 gene locus_tag LOCUS_11930 23148 21586 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_11930 23434 23604 gene locus_tag LOCUS_11940 23434 23604 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence040 <1 506 gene locus_tag LOCUS_11950 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289296.1:3-phosphoshikimate 1-carboxyvinyltransferase 1840 728 gene locus_tag LOCUS_11960 gene hemW 1840 728 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_11960 3439 1913 gene locus_tag LOCUS_11970 3439 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3600 4592 gene locus_tag LOCUS_11980 3600 4592 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_11980 4589 5428 gene locus_tag LOCUS_11990 gene rsmA 4589 5428 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_11990 5644 6909 gene locus_tag LOCUS_12000 5644 6909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861196.1 protein_id gnl|my_center|LOCUS_12000 6951 8852 gene locus_tag LOCUS_12010 6951 8852 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_12010 9193 10809 gene locus_tag LOCUS_12020 9193 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 10983 11993 gene locus_tag LOCUS_12030 10983 11993 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_12030 12008 12409 gene locus_tag LOCUS_12040 12008 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 12874 12572 gene locus_tag LOCUS_12050 12874 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 12984 13172 gene locus_tag LOCUS_12060 12984 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 13189 13734 gene locus_tag LOCUS_12070 13189 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 14168 14662 gene locus_tag LOCUS_12080 14168 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 14724 14987 gene locus_tag LOCUS_12090 14724 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 15233 15721 gene locus_tag LOCUS_12100 15233 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 16649 15894 gene locus_tag LOCUS_12110 16649 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 17556 16858 gene locus_tag LOCUS_12120 gene rpe 17556 16858 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_12120 18073 17639 gene locus_tag LOCUS_12130 18073 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 19196 18147 gene locus_tag LOCUS_12140 19196 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 19418 20158 gene locus_tag LOCUS_12150 19418 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 21082 20243 gene locus_tag LOCUS_12160 21082 20243 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697455.1 protein_id gnl|my_center|LOCUS_12160 21882 21079 gene locus_tag LOCUS_12170 21882 21079 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_12170 22131 23948 gene locus_tag LOCUS_12180 22131 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 24042 24272 gene locus_tag LOCUS_12190 24042 24272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence041 2507 474 gene locus_tag LOCUS_12200 gene msbA 2507 474 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_12200 2988 2671 gene locus_tag LOCUS_12210 2988 2671 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 protein_id gnl|my_center|LOCUS_12210 3689 2994 gene locus_tag LOCUS_12220 3689 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5423 3810 gene locus_tag LOCUS_12230 gene rng 5423 3810 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_12230 7414 5474 gene locus_tag LOCUS_12240 gene ftsH 7414 5474 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_12240 8074 7490 gene locus_tag LOCUS_12250 8074 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8693 10201 gene locus_tag LOCUS_12260 gene tig 8693 10201 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384982.1 protein_id gnl|my_center|LOCUS_12260 10202 10786 gene locus_tag LOCUS_12270 gene clpP 10202 10786 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_12270 10832 11386 gene locus_tag LOCUS_12280 10832 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11449 13236 gene locus_tag LOCUS_12290 gene aspS 11449 13236 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_12290 13428 15158 gene locus_tag LOCUS_12300 13428 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 16099 15221 gene locus_tag LOCUS_12310 gene argB 16099 15221 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_12310 16497 17312 gene locus_tag LOCUS_12320 16497 17312 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_12320 17446 18267 gene locus_tag LOCUS_12330 17446 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 18264 19235 gene locus_tag LOCUS_12340 18264 19235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 19429 21594 gene locus_tag LOCUS_12350 19429 21594 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_12350 21616 22371 gene locus_tag LOCUS_12360 21616 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 22414 23439 gene locus_tag LOCUS_12370 22414 23439 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240531.1 protein_id gnl|my_center|LOCUS_12370 23956 23534 gene locus_tag LOCUS_12380 23956 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence042 479 390 gene locus_tag LOCUS_t00240 479 390 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1250 576 gene locus_tag LOCUS_12390 1250 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1439 1657 gene locus_tag LOCUS_12400 1439 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1722 3467 gene locus_tag LOCUS_12410 1722 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3620 7549 gene locus_tag LOCUS_12420 3620 7549 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555770.1 protein_id gnl|my_center|LOCUS_12420 7613 8620 gene locus_tag LOCUS_12430 7613 8620 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_12430 9404 8742 gene locus_tag LOCUS_12440 9404 8742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288085.1 protein_id gnl|my_center|LOCUS_12440 10119 9412 gene locus_tag LOCUS_12450 10119 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10448 11434 gene locus_tag LOCUS_12460 10448 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 11596 11805 gene locus_tag LOCUS_12470 11596 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 11811 12095 gene locus_tag LOCUS_12480 11811 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 12418 12092 gene locus_tag LOCUS_12490 12418 12092 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957958.1 protein_id gnl|my_center|LOCUS_12490 12830 12411 gene locus_tag LOCUS_12500 12830 12411 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_12500 15319 13178 gene locus_tag LOCUS_12510 15319 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 16180 15338 gene locus_tag LOCUS_12520 16180 15338 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_12520 18156 16219 gene locus_tag LOCUS_12530 18156 16219 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_12530 18987 18181 gene locus_tag LOCUS_12540 gene lpxA 18987 18181 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 protein_id gnl|my_center|LOCUS_12540 19252 20761 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgcctcaaagtcgcgatatccgcggagtgttcaac 21437 21150 gene locus_tag LOCUS_12550 gene cas2 21437 21150 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_12550 23149 21461 gene locus_tag LOCUS_12560 gene cas1 23149 21461 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_12560 23873 23133 gene locus_tag LOCUS_12570 23873 23133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence043 688 1272 gene locus_tag LOCUS_12580 688 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1259 1993 gene locus_tag LOCUS_12590 1259 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2569 1931 gene locus_tag LOCUS_12600 gene metW 2569 1931 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_12600 5574 2569 gene locus_tag LOCUS_12610 5574 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5654 6484 gene locus_tag LOCUS_12620 gene prmC 5654 6484 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_12620 7854 6667 gene locus_tag LOCUS_12630 7854 6667 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_12630 8524 7940 gene locus_tag LOCUS_12640 8524 7940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677237.1 protein_id gnl|my_center|LOCUS_12640 10979 8853 gene locus_tag LOCUS_12650 10979 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 11206 13212 gene locus_tag LOCUS_12660 11206 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 14311 14129 gene locus_tag LOCUS_12670 14311 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14283 14474 gene locus_tag LOCUS_12680 14283 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 20836 14705 gene locus_tag LOCUS_12690 20836 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <23378 21305 gene locus_tag LOCUS_12700 <23378 21305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000579563.1:serine/threonine protein kinase Stk1 >Feature sequence044 273 1916 gene locus_tag LOCUS_12710 273 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1924 3705 gene locus_tag LOCUS_12720 gene msbA 1924 3705 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263297.1 protein_id gnl|my_center|LOCUS_12720 3713 5578 gene locus_tag LOCUS_12730 gene asnB 3713 5578 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942597.1 protein_id gnl|my_center|LOCUS_12730 6215 7420 gene locus_tag LOCUS_12740 6215 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 8121 8501 gene locus_tag LOCUS_12750 8121 8501 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_12750 8704 9294 gene locus_tag LOCUS_12760 8704 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9645 10397 gene locus_tag LOCUS_12770 9645 10397 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_12770 10394 11398 gene locus_tag LOCUS_12780 10394 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 11789 13078 gene locus_tag LOCUS_12790 11789 13078 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_12790 13197 13742 gene locus_tag LOCUS_12800 13197 13742 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_12800 13739 14860 gene locus_tag LOCUS_12810 13739 14860 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015749.1 protein_id gnl|my_center|LOCUS_12810 14863 15495 gene locus_tag LOCUS_12820 gene hisH 14863 15495 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560360.1 protein_id gnl|my_center|LOCUS_12820 15495 16361 gene locus_tag LOCUS_12830 gene hisF 15495 16361 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_12830 16358 17611 gene locus_tag LOCUS_12840 gene pseA 16358 17611 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_12840 17637 18482 gene locus_tag LOCUS_12850 17637 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 18621 19955 gene locus_tag LOCUS_12860 18621 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 19948 21465 gene locus_tag LOCUS_12870 19948 21465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 21462 22181 gene locus_tag LOCUS_12880 21462 22181 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403200.1 protein_id gnl|my_center|LOCUS_12880 22201 22884 gene locus_tag LOCUS_12890 22201 22884 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence045 392 1690 gene locus_tag LOCUS_12900 392 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2315 3781 gene locus_tag LOCUS_12910 2315 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5360 3747 gene locus_tag LOCUS_12920 5360 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6918 5380 gene locus_tag LOCUS_12930 6918 5380 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_12930 7063 8133 gene locus_tag LOCUS_12940 7063 8133 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_12940 8138 9220 gene locus_tag LOCUS_12950 8138 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9318 11060 gene locus_tag LOCUS_12960 9318 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 11719 11210 gene locus_tag LOCUS_12970 11719 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 12240 11746 gene locus_tag LOCUS_12980 gene coaD 12240 11746 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_12980 12402 13370 gene locus_tag LOCUS_12990 12402 13370 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_12990 13378 14598 gene locus_tag LOCUS_13000 gene eboE 13378 14598 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_13000 14556 15038 gene locus_tag LOCUS_13010 gene trmL 14556 15038 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_13010 16303 15350 gene locus_tag LOCUS_13020 16303 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 16566 17693 gene locus_tag LOCUS_13030 16566 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 17690 18046 gene locus_tag LOCUS_13040 17690 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 19705 18071 gene locus_tag LOCUS_13050 19705 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 20633 20723 gene locus_tag LOCUS_t00250 20633 20723 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 766 1050 gene locus_tag LOCUS_13060 766 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1114 2676 gene locus_tag LOCUS_13070 1114 2676 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_13070 3607 2702 gene locus_tag LOCUS_13080 3607 2702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_13080 6138 3673 gene locus_tag LOCUS_13090 6138 3673 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_13090 6915 7835 gene locus_tag LOCUS_13100 6915 7835 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_13100 8212 9120 gene locus_tag LOCUS_13110 gene amrB 8212 9120 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_13110 9117 10019 gene locus_tag LOCUS_13120 9117 10019 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922368.1 protein_id gnl|my_center|LOCUS_13120 10705 10040 gene locus_tag LOCUS_13130 10705 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 12190 10868 gene locus_tag LOCUS_13140 12190 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12815 12342 gene locus_tag LOCUS_13150 12815 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 13958 12825 gene locus_tag LOCUS_13160 13958 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14275 15768 gene locus_tag LOCUS_13170 14275 15768 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_13170 15844 16488 gene locus_tag LOCUS_13180 15844 16488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 17993 16839 gene locus_tag LOCUS_13190 gene thiH 17993 16839 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008477.1 protein_id gnl|my_center|LOCUS_13190 18272 20491 gene locus_tag LOCUS_13200 gene bamA 18272 20491 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_13200 20677 20507 gene locus_tag LOCUS_13210 20677 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 <22102 20908 gene locus_tag LOCUS_13220 <22102 20908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122655.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence047 1400 2194 gene locus_tag LOCUS_13230 1400 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2233 3570 gene locus_tag LOCUS_13240 2233 3570 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_13240 3557 4927 gene locus_tag LOCUS_13250 gene mgtE 3557 4927 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_13250 5039 6430 gene locus_tag LOCUS_13260 5039 6430 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_13260 7092 6565 gene locus_tag LOCUS_13270 7092 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8632 7343 gene locus_tag LOCUS_13280 8632 7343 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_13280 9388 10887 gene locus_tag LOCUS_13290 9388 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11754 11302 gene locus_tag LOCUS_13300 11754 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 11956 12522 gene locus_tag LOCUS_13310 gene frr 11956 12522 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_13310 12594 13235 gene locus_tag LOCUS_13320 gene purO 12594 13235 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_13320 13232 15784 gene locus_tag LOCUS_13330 13232 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15913 15704 gene locus_tag LOCUS_13340 15913 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 17362 15917 gene locus_tag LOCUS_13350 gene cysS 17362 15917 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_13350 17744 17481 gene locus_tag LOCUS_13360 17744 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17665 18354 gene locus_tag LOCUS_13370 17665 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18351 19340 gene locus_tag LOCUS_13380 18351 19340 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_13380 19469 20251 gene locus_tag LOCUS_13390 19469 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20248 21651 gene locus_tag LOCUS_13400 20248 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence048 323 697 gene locus_tag LOCUS_13410 323 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 712 1308 gene locus_tag LOCUS_13420 712 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1302 1523 gene locus_tag LOCUS_13430 1302 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3421 1604 gene locus_tag LOCUS_13440 3421 1604 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_13440 4106 3414 gene locus_tag LOCUS_13450 4106 3414 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_13450 4318 6387 gene locus_tag LOCUS_13460 4318 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7937 6414 gene locus_tag LOCUS_13470 7937 6414 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_13470 8982 7948 gene locus_tag LOCUS_13480 8982 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 10787 8940 gene locus_tag LOCUS_13490 10787 8940 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_13490 11416 10784 gene locus_tag LOCUS_13500 11416 10784 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_13500 12745 11453 gene locus_tag LOCUS_13510 12745 11453 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_13510 14481 12742 gene locus_tag LOCUS_13520 14481 12742 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_13520 14726 15733 gene locus_tag LOCUS_13530 14726 15733 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_13530 15845 16411 gene locus_tag LOCUS_13540 15845 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 16568 17506 gene locus_tag LOCUS_13550 16568 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 17499 19325 gene locus_tag LOCUS_13560 17499 19325 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence049 389 586 gene locus_tag LOCUS_13570 389 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2251 692 gene locus_tag LOCUS_13580 2251 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3873 2248 gene locus_tag LOCUS_13590 3873 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 5033 3870 gene locus_tag LOCUS_13600 5033 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6889 5036 gene locus_tag LOCUS_13610 6889 5036 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_13610 10117 6908 gene locus_tag LOCUS_13620 10117 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 12547 10631 gene locus_tag LOCUS_13630 12547 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 13441 12671 gene locus_tag LOCUS_13640 13441 12671 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940171.1 protein_id gnl|my_center|LOCUS_13640 14618 13665 gene locus_tag LOCUS_13650 gene ftsY 14618 13665 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_13650 15708 14626 gene locus_tag LOCUS_13660 15708 14626 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_13660 16150 15908 gene locus_tag LOCUS_13670 16150 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 17420 16131 gene locus_tag LOCUS_13680 gene thiI 17420 16131 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_13680 18171 17434 gene locus_tag LOCUS_13690 18171 17434 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975612.1 protein_id gnl|my_center|LOCUS_13690 18724 18194 gene locus_tag LOCUS_13700 18724 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 20321 18729 gene locus_tag LOCUS_13710 20321 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 20646 21101 gene locus_tag LOCUS_13720 20646 21101 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence050 1746 337 gene locus_tag LOCUS_13730 1746 337 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 protein_id gnl|my_center|LOCUS_13730 3047 2070 gene locus_tag LOCUS_13740 3047 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4399 3044 gene locus_tag LOCUS_13750 gene glmM 4399 3044 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_13750 5045 6160 gene locus_tag LOCUS_13760 gene mnmH 5045 6160 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064861.1 protein_id gnl|my_center|LOCUS_13760 7264 6518 gene locus_tag LOCUS_13770 7264 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 8304 7303 gene locus_tag LOCUS_13780 8304 7303 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_13780 8939 8301 gene locus_tag LOCUS_13790 gene plsY 8939 8301 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_13790 10275 9706 gene locus_tag LOCUS_13800 gene efp 10275 9706 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_13800 10446 11675 gene locus_tag LOCUS_13810 10446 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11672 12436 gene locus_tag LOCUS_13820 11672 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12620 12829 gene locus_tag LOCUS_13830 12620 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 13217 14581 gene locus_tag LOCUS_13840 13217 14581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_13840 15146 14835 gene locus_tag LOCUS_13850 15146 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 15354 17831 gene locus_tag LOCUS_13860 15354 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 18205 20364 gene locus_tag LOCUS_13870 18205 20364 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_13870 20921 21139 gene locus_tag LOCUS_13880 20921 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence051 <1 1212 gene locus_tag LOCUS_13890 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110527488.1:exodeoxyribonuclease V subunit gamma 1205 4831 gene locus_tag LOCUS_13900 gene recB 1205 4831 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271602.1 protein_id gnl|my_center|LOCUS_13900 5630 7498 gene locus_tag LOCUS_13910 gene recD 5630 7498 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_13910 7742 12853 gene locus_tag LOCUS_13920 7742 12853 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_13920 12856 15705 gene locus_tag LOCUS_13930 12856 15705 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 protein_id gnl|my_center|LOCUS_13930 15721 17274 gene locus_tag LOCUS_13940 15721 17274 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022384.1 protein_id gnl|my_center|LOCUS_13940 17271 17672 gene locus_tag LOCUS_13950 17271 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 18022 17669 gene locus_tag LOCUS_13960 18022 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 20056 19301 gene locus_tag LOCUS_13970 20056 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence052 132 935 gene locus_tag LOCUS_13980 132 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 856 1077 gene locus_tag LOCUS_13990 856 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1442 1669 gene locus_tag LOCUS_14000 1442 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1682 2338 gene locus_tag LOCUS_14010 1682 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3358 2627 gene locus_tag LOCUS_14020 3358 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4040 3510 gene locus_tag LOCUS_14030 4040 3510 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_14030 4393 4082 gene locus_tag LOCUS_14040 4393 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6062 4701 gene locus_tag LOCUS_14050 6062 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6874 6047 gene locus_tag LOCUS_14060 6874 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7623 6883 gene locus_tag LOCUS_14070 7623 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8084 7773 gene locus_tag LOCUS_14080 8084 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_14080 9372 8065 gene locus_tag LOCUS_14090 9372 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 10894 9365 gene locus_tag LOCUS_14100 10894 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11998 11273 gene locus_tag LOCUS_14110 11998 11273 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_14110 14748 11995 gene locus_tag LOCUS_14120 14748 11995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 15461 14772 gene locus_tag LOCUS_14130 15461 14772 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_14130 16735 15521 gene locus_tag LOCUS_14140 16735 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 17754 16738 gene locus_tag LOCUS_14150 gene gmd 17754 16738 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_14150 18173 17751 gene locus_tag LOCUS_14160 18173 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 19368 18163 gene locus_tag LOCUS_14170 19368 18163 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957740.1 protein_id gnl|my_center|LOCUS_14170 20536 19415 gene locus_tag LOCUS_14180 gene per 20536 19415 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_14180 20933 20538 gene locus_tag LOCUS_14190 20933 20538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence053 148 624 gene locus_tag LOCUS_14200 gene ribE 148 624 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_14200 1426 743 gene locus_tag LOCUS_14210 1426 743 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_14210 2048 1602 gene locus_tag LOCUS_14220 2048 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3828 2056 gene locus_tag LOCUS_14230 3828 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4966 3962 gene locus_tag LOCUS_14240 4966 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5195 5932 gene locus_tag LOCUS_14250 gene fabG 5195 5932 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_14250 5935 6732 gene locus_tag LOCUS_14260 5935 6732 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_14260 7715 6891 gene locus_tag LOCUS_14270 7715 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8487 7762 gene locus_tag LOCUS_14280 8487 7762 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_14280 8718 9311 gene locus_tag LOCUS_14290 gene ruvA 8718 9311 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403236.1 protein_id gnl|my_center|LOCUS_14290 9659 9582 gene locus_tag LOCUS_t00260 9659 9582 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10528 9722 gene locus_tag LOCUS_14300 10528 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10428 10703 gene locus_tag LOCUS_14310 10428 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 11163 10933 gene locus_tag LOCUS_14320 11163 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 11435 13327 gene locus_tag LOCUS_14330 gene asnB 11435 13327 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14330 15579 13339 gene locus_tag LOCUS_14340 15579 13339 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_14340 16086 15661 gene locus_tag LOCUS_14350 16086 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 16159 17190 gene locus_tag LOCUS_14360 gene dusB 16159 17190 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_14360 17486 20479 gene locus_tag LOCUS_14370 17486 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 20526 20759 gene locus_tag LOCUS_14380 20526 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence054 2368 14 gene locus_tag LOCUS_14390 gene nuoF 2368 14 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_14390 2617 3303 gene locus_tag LOCUS_14400 2617 3303 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_14400 3311 3757 gene locus_tag LOCUS_14410 3311 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3798 4514 gene locus_tag LOCUS_14420 3798 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4514 4750 gene locus_tag LOCUS_14430 4514 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4754 6295 gene locus_tag LOCUS_14440 gene guaA 4754 6295 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_14440 6326 8200 gene locus_tag LOCUS_14450 6326 8200 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_14450 8264 10705 gene locus_tag LOCUS_14460 8264 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 10803 13382 gene locus_tag LOCUS_14470 10803 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 13894 15597 gene locus_tag LOCUS_14480 gene ilvB 13894 15597 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_14480 15680 16366 gene locus_tag LOCUS_14490 15680 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 16419 19604 gene locus_tag LOCUS_14500 gene ileS 16419 19604 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889833.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence055 4951 569 gene locus_tag LOCUS_14510 4951 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5108 7564 gene locus_tag LOCUS_14520 5108 7564 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_14520 7749 8045 gene locus_tag LOCUS_14530 7749 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 8347 9744 gene locus_tag LOCUS_14540 8347 9744 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108623.1 protein_id gnl|my_center|LOCUS_14540 10173 13646 gene locus_tag LOCUS_14550 10173 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 15702 13984 gene locus_tag LOCUS_14560 15702 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 18138 16132 gene locus_tag LOCUS_14570 gene rnr 18138 16132 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228288.1 protein_id gnl|my_center|LOCUS_14570 19463 18135 gene locus_tag LOCUS_14580 19463 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence056 <1 700 gene locus_tag LOCUS_14590 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939054.1:aspartate ammonia-lyase 694 1896 gene locus_tag LOCUS_14600 gene hydF 694 1896 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_14600 1964 2356 gene locus_tag LOCUS_14610 1964 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2536 2883 gene locus_tag LOCUS_14620 2536 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4145 2982 gene locus_tag LOCUS_14630 4145 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5768 4149 gene locus_tag LOCUS_14640 5768 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6390 5944 gene locus_tag LOCUS_14650 6390 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7627 6404 gene locus_tag LOCUS_14660 7627 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 9520 7631 gene locus_tag LOCUS_14670 gene dxs 9520 7631 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_14670 10938 9637 gene locus_tag LOCUS_14680 gene thrC 10938 9637 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_14680 11135 13450 gene locus_tag LOCUS_14690 11135 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14447 13584 gene locus_tag LOCUS_14700 gene nadC 14447 13584 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_14700 15104 14565 gene locus_tag LOCUS_14710 15104 14565 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_14710 15418 15116 gene locus_tag LOCUS_14720 15418 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 15690 16535 gene locus_tag LOCUS_14730 15690 16535 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_14730 16532 17458 gene locus_tag LOCUS_14740 gene thiL 16532 17458 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_14740 17766 18995 gene locus_tag LOCUS_14750 17766 18995 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence057 398 1438 gene locus_tag LOCUS_14760 398 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1538 3346 gene locus_tag LOCUS_14770 1538 3346 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_14770 5237 3420 gene locus_tag LOCUS_14780 5237 3420 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_14780 5640 7904 gene locus_tag LOCUS_14790 5640 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8092 8427 gene locus_tag LOCUS_14800 8092 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8465 8950 gene locus_tag LOCUS_14810 8465 8950 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_14810 8913 10109 gene locus_tag LOCUS_14820 8913 10109 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_14820 10256 11575 gene locus_tag LOCUS_14830 gene clpX 10256 11575 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_14830 14659 11585 gene locus_tag LOCUS_14840 14659 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 15419 14661 gene locus_tag LOCUS_14850 gene thiG 15419 14661 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 protein_id gnl|my_center|LOCUS_14850 16339 15416 gene locus_tag LOCUS_14860 16339 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 16418 17170 gene locus_tag LOCUS_14870 gene cmoA 16418 17170 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 protein_id gnl|my_center|LOCUS_14870 18035 17286 gene locus_tag LOCUS_14880 18035 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 19051 18074 gene locus_tag LOCUS_14890 19051 18074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_14890 19137 19430 gene locus_tag LOCUS_14900 19137 19430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence058 4737 2545 gene locus_tag LOCUS_14910 4737 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 6639 4780 gene locus_tag LOCUS_14920 6639 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7295 6948 gene locus_tag LOCUS_14930 7295 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8823 7828 gene locus_tag LOCUS_14940 8823 7828 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_14940 11795 8820 gene locus_tag LOCUS_14950 11795 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12715 11795 gene locus_tag LOCUS_14960 12715 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927025.1 protein_id gnl|my_center|LOCUS_14960 13162 14469 gene locus_tag LOCUS_14970 13162 14469 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_14970 14494 15600 gene locus_tag LOCUS_14980 gene mraY 14494 15600 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224924.1 protein_id gnl|my_center|LOCUS_14980 15702 16652 gene locus_tag LOCUS_14990 15702 16652 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_14990 16649 17863 gene locus_tag LOCUS_15000 gene lysA 16649 17863 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_15000 17867 18730 gene locus_tag LOCUS_15010 gene dapF 17867 18730 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence059 1494 319 gene locus_tag LOCUS_15020 1494 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3629 2121 gene locus_tag LOCUS_15030 3629 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4253 6769 gene locus_tag LOCUS_15040 4253 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6850 7335 gene locus_tag LOCUS_15050 6850 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7429 9618 gene locus_tag LOCUS_15060 7429 9618 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_15060 9725 10810 gene locus_tag LOCUS_15070 9725 10810 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_15070 10821 13868 gene locus_tag LOCUS_15080 gene vmeI 10821 13868 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_15080 14543 15064 gene locus_tag LOCUS_15090 14543 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 15181 15447 gene locus_tag LOCUS_15100 15181 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 15625 16359 gene locus_tag LOCUS_15110 15625 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <19159 17627 gene locus_tag LOCUS_15120 <19159 17627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530161.1:polynucleotide kinase-phosphatase >Feature sequence060 1514 1714 gene locus_tag LOCUS_15130 1514 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1958 2713 gene locus_tag LOCUS_15140 1958 2713 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_15140 3401 4666 gene locus_tag LOCUS_15150 3401 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7627 6080 gene locus_tag LOCUS_15160 7627 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8158 8745 gene locus_tag LOCUS_15170 8158 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8750 10000 gene locus_tag LOCUS_15180 8750 10000 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_15180 10144 10434 gene locus_tag LOCUS_15190 10144 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 10485 10757 gene locus_tag LOCUS_15200 10485 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 10785 13436 gene locus_tag LOCUS_15210 10785 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13570 15978 gene locus_tag LOCUS_15220 13570 15978 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_15220 16240 16956 gene locus_tag LOCUS_15230 16240 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 18804 17272 gene locus_tag LOCUS_15240 18804 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence061 2989 2573 gene locus_tag LOCUS_15250 2989 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4060 3167 gene locus_tag LOCUS_15260 4060 3167 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_15260 5921 4062 gene locus_tag LOCUS_15270 5921 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6315 5959 gene locus_tag LOCUS_15280 6315 5959 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_15280 6847 6515 gene locus_tag LOCUS_15290 6847 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7383 7021 gene locus_tag LOCUS_15300 7383 7021 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_15300 7949 7614 gene locus_tag LOCUS_15310 7949 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8609 8145 gene locus_tag LOCUS_15320 8609 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 9696 8899 gene locus_tag LOCUS_15330 9696 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11377 9719 gene locus_tag LOCUS_15340 gene gpmI 11377 9719 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_15340 11854 12048 gene locus_tag LOCUS_15350 11854 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 13595 12066 gene locus_tag LOCUS_15360 13595 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13860 16037 gene locus_tag LOCUS_15370 13860 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 16034 17071 gene locus_tag LOCUS_15380 16034 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 17116 18303 gene locus_tag LOCUS_15390 17116 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence062 1044 211 gene locus_tag LOCUS_15400 1044 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1361 2104 gene locus_tag LOCUS_15410 1361 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2104 2490 gene locus_tag LOCUS_15420 gene queD 2104 2490 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_15420 3335 2730 gene locus_tag LOCUS_15430 3335 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3826 3332 gene locus_tag LOCUS_15440 gene gigB 3826 3332 CDS product anti-anti-sigma factor GigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_15440 5642 3870 gene locus_tag LOCUS_15450 5642 3870 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_15450 5942 6391 gene locus_tag LOCUS_15460 5942 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6457 6945 gene locus_tag LOCUS_15470 6457 6945 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_15470 8320 6902 gene locus_tag LOCUS_15480 8320 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8601 9707 gene locus_tag LOCUS_15490 gene gcvT 8601 9707 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938973.1 protein_id gnl|my_center|LOCUS_15490 11809 9746 gene locus_tag LOCUS_15500 11809 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 12141 14117 gene locus_tag LOCUS_15510 12141 14117 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145060936.1 protein_id gnl|my_center|LOCUS_15510 14574 17084 gene locus_tag LOCUS_15520 gene gyrB 14574 17084 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_15520 17114 18076 gene locus_tag LOCUS_15530 17114 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence063 595 1185 gene locus_tag LOCUS_15540 gene hisB 595 1185 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_15540 1199 2716 gene locus_tag LOCUS_15550 1199 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3753 2848 gene locus_tag LOCUS_15560 3753 2848 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_15560 3939 3775 gene locus_tag LOCUS_15570 3939 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5332 4010 gene locus_tag LOCUS_15580 gene rpoD 5332 4010 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_15580 5426 8716 gene locus_tag LOCUS_15590 5426 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8795 9313 gene locus_tag LOCUS_15600 8795 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 10294 9392 gene locus_tag LOCUS_15610 10294 9392 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_15610 10929 10330 gene locus_tag LOCUS_15620 10929 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 11579 10989 gene locus_tag LOCUS_15630 11579 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 13521 11668 gene locus_tag LOCUS_15640 13521 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 14132 13752 gene locus_tag LOCUS_15650 14132 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 16441 15119 gene locus_tag LOCUS_15660 16441 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 17769 16438 gene locus_tag LOCUS_15670 gene thiC 17769 16438 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_15670 <18453 17748 gene locus_tag LOCUS_15680 <18453 17748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004410829.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase >Feature sequence064 1930 1361 gene locus_tag LOCUS_15690 1930 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2155 3132 gene locus_tag LOCUS_15700 2155 3132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_15700 3114 4097 gene locus_tag LOCUS_15710 3114 4097 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_15710 4189 5232 gene locus_tag LOCUS_15720 4189 5232 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_15720 5252 6181 gene locus_tag LOCUS_15730 5252 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6320 7528 gene locus_tag LOCUS_15740 6320 7528 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_15740 7554 8735 gene locus_tag LOCUS_15750 7554 8735 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_15750 8884 9624 gene locus_tag LOCUS_15760 8884 9624 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_15760 9634 11544 gene locus_tag LOCUS_15770 9634 11544 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_15770 11534 12394 gene locus_tag LOCUS_15780 11534 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 13697 12696 gene locus_tag LOCUS_15790 13697 12696 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_15790 13982 13767 gene locus_tag LOCUS_15800 gene infA 13982 13767 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_15800 14746 13967 gene locus_tag LOCUS_15810 gene map 14746 13967 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_15810 15396 14743 gene locus_tag LOCUS_15820 15396 14743 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_15820 15754 16989 gene locus_tag LOCUS_15830 15754 16989 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence065 332 505 gene locus_tag LOCUS_15840 332 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2572 641 gene locus_tag LOCUS_15850 2572 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3084 3281 gene locus_tag LOCUS_15860 3084 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3301 4215 gene locus_tag LOCUS_15870 3301 4215 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258605.1 protein_id gnl|my_center|LOCUS_15870 4212 5027 gene locus_tag LOCUS_15880 4212 5027 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 protein_id gnl|my_center|LOCUS_15880 5029 6825 gene locus_tag LOCUS_15890 gene pepF 5029 6825 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_15890 6887 7345 gene locus_tag LOCUS_15900 6887 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7332 7499 gene locus_tag LOCUS_15910 7332 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 7480 8253 gene locus_tag LOCUS_15920 7480 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 8382 9086 gene locus_tag LOCUS_15930 8382 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 10822 9962 gene locus_tag LOCUS_15940 10822 9962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_15940 13520 10833 gene locus_tag LOCUS_15950 13520 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 14128 13706 gene locus_tag LOCUS_15960 gene queF 14128 13706 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_15960 14337 15149 gene locus_tag LOCUS_15970 14337 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 15234 15857 gene locus_tag LOCUS_15980 15234 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 16248 15901 gene locus_tag LOCUS_15990 16248 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 <17627 16467 gene locus_tag LOCUS_16000 <17627 16467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582636.1:beta-N-acetylhexosaminidase >Feature sequence066 2162 612 gene locus_tag LOCUS_16010 2162 612 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_16010 2724 2149 gene locus_tag LOCUS_16020 2724 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2938 2717 gene locus_tag LOCUS_16030 2938 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3109 3267 gene locus_tag LOCUS_16040 3109 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3252 4166 gene locus_tag LOCUS_16050 3252 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4163 5716 gene locus_tag LOCUS_16060 4163 5716 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_16060 5713 7329 gene locus_tag LOCUS_16070 5713 7329 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922615.1 protein_id gnl|my_center|LOCUS_16070 8472 7624 gene locus_tag LOCUS_16080 gene rfbD 8472 7624 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_16080 9697 8648 gene locus_tag LOCUS_16090 9697 8648 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_16090 12634 9896 gene locus_tag LOCUS_16100 12634 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 12952 17466 gene locus_tag LOCUS_16110 12952 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence067 519 710 gene locus_tag LOCUS_16120 519 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 707 940 gene locus_tag LOCUS_16130 707 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1004 1204 gene locus_tag LOCUS_16140 1004 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1412 1600 gene locus_tag LOCUS_16150 1412 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1609 2115 gene locus_tag LOCUS_16160 1609 2115 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_16160 2149 3600 gene locus_tag LOCUS_16170 2149 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3631 4848 gene locus_tag LOCUS_16180 3631 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4874 5512 gene locus_tag LOCUS_16190 4874 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5567 6478 gene locus_tag LOCUS_16200 5567 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 6480 7439 gene locus_tag LOCUS_16210 6480 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7436 8947 gene locus_tag LOCUS_16220 gene escC 7436 8947 CDS product type III secretion system LEE outer membrane ring protein EscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723942.1 protein_id gnl|my_center|LOCUS_16220 8944 10533 gene locus_tag LOCUS_16230 8944 10533 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_16230 10530 11393 gene locus_tag LOCUS_16240 10530 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11386 12309 gene locus_tag LOCUS_16250 11386 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 12331 13335 gene locus_tag LOCUS_16260 12331 13335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13381 15384 gene locus_tag LOCUS_16270 13381 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 15684 16082 gene locus_tag LOCUS_16280 15684 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence068 1749 1564 gene locus_tag LOCUS_16290 1749 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1708 2718 gene locus_tag LOCUS_16300 gene hypD 1708 2718 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_16300 3159 3464 gene locus_tag LOCUS_16310 3159 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3893 3723 gene locus_tag LOCUS_16320 3893 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4008 3886 gene locus_tag LOCUS_16330 4008 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5133 4231 gene locus_tag LOCUS_16340 5133 4231 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_16340 5568 5329 gene locus_tag LOCUS_16350 5568 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6850 5594 gene locus_tag LOCUS_16360 gene hisS 6850 5594 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_16360 7247 6942 gene locus_tag LOCUS_16370 7247 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8396 7563 gene locus_tag LOCUS_16380 gene lgt 8396 7563 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_16380 9028 9252 gene locus_tag LOCUS_16390 9028 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9206 10165 gene locus_tag LOCUS_16400 9206 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 10646 10389 gene locus_tag LOCUS_16410 10646 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 10845 10636 gene locus_tag LOCUS_16420 10845 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11139 10897 gene locus_tag LOCUS_16430 11139 10897 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_16430 11198 12265 gene locus_tag LOCUS_16440 11198 12265 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221064.1 protein_id gnl|my_center|LOCUS_16440 12679 12338 gene locus_tag LOCUS_16450 12679 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 13140 12859 gene locus_tag LOCUS_16460 13140 12859 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_16460 13412 13152 gene locus_tag LOCUS_16470 13412 13152 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_16470 13834 13520 gene locus_tag LOCUS_16480 13834 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14061 13831 gene locus_tag LOCUS_16490 14061 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 14437 14619 gene locus_tag LOCUS_16500 14437 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 15557 14817 gene locus_tag LOCUS_16510 15557 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence069 4080 2764 gene locus_tag LOCUS_16520 4080 2764 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_16520 6194 4083 gene locus_tag LOCUS_16530 6194 4083 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073844.1 protein_id gnl|my_center|LOCUS_16530 7479 6187 gene locus_tag LOCUS_16540 7479 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9176 7476 gene locus_tag LOCUS_16550 9176 7476 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_16550 9623 9904 gene locus_tag LOCUS_16560 9623 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9906 10262 gene locus_tag LOCUS_16570 9906 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11411 10287 gene locus_tag LOCUS_16580 gene alr 11411 10287 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_16580 12512 11559 gene locus_tag LOCUS_16590 12512 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 13878 12589 gene locus_tag LOCUS_16600 13878 12589 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_16600 14658 13909 gene locus_tag LOCUS_16610 14658 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 14769 14948 gene locus_tag LOCUS_16620 14769 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence070 359 87 gene locus_tag LOCUS_16630 359 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 583 356 gene locus_tag LOCUS_16640 583 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1124 2017 gene locus_tag LOCUS_16650 1124 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3221 2424 gene locus_tag LOCUS_16660 gene nagB 3221 2424 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_16660 3656 3273 gene locus_tag LOCUS_16670 3656 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 5021 3747 gene locus_tag LOCUS_16680 gene murA 5021 3747 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656466.1 protein_id gnl|my_center|LOCUS_16680 5530 5018 gene locus_tag LOCUS_16690 5530 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6799 5546 gene locus_tag LOCUS_16700 gene fabF 6799 5546 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_16700 7180 6941 gene locus_tag LOCUS_16710 gene acpP 7180 6941 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003631752.1 protein_id gnl|my_center|LOCUS_16710 8122 7373 gene locus_tag LOCUS_16720 gene fabG 8122 7373 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_16720 8373 9185 gene locus_tag LOCUS_16730 8373 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 10155 9442 gene locus_tag LOCUS_16740 10155 9442 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_16740 11497 10823 gene locus_tag LOCUS_16750 11497 10823 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_16750 12731 11526 gene locus_tag LOCUS_16760 12731 11526 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_16760 13117 13806 gene locus_tag LOCUS_16770 13117 13806 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_16770 14290 14742 gene locus_tag LOCUS_16780 14290 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 14834 15106 gene locus_tag LOCUS_16790 14834 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence071 1743 847 gene locus_tag LOCUS_16800 1743 847 CDS product sce7726 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_16800 2738 1827 gene locus_tag LOCUS_16810 2738 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3547 2735 gene locus_tag LOCUS_16820 3547 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3816 4424 gene locus_tag LOCUS_16830 3816 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 4421 4903 gene locus_tag LOCUS_16840 gene folK 4421 4903 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_16840 4944 5354 gene locus_tag LOCUS_16850 4944 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7232 5541 gene locus_tag LOCUS_16860 7232 5541 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_16860 7424 9409 gene locus_tag LOCUS_16870 7424 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 9451 11832 gene locus_tag LOCUS_16880 9451 11832 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_16880 13161 12130 gene locus_tag LOCUS_16890 gene waaC 13161 12130 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_16890 13362 14159 gene locus_tag LOCUS_16900 13362 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 <15236 14214 gene locus_tag LOCUS_16910 <15236 14214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003565745.1:molecular chaperone DnaJ >Feature sequence072 540 2237 gene locus_tag LOCUS_16920 540 2237 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_16920 2243 3478 gene locus_tag LOCUS_16930 2243 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3599 3895 gene locus_tag LOCUS_16940 3599 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3888 5003 gene locus_tag LOCUS_16950 gene aroB 3888 5003 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_16950 4996 6132 gene locus_tag LOCUS_16960 gene dprA 4996 6132 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_16960 6263 7267 gene locus_tag LOCUS_16970 gene gmd 6263 7267 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_16970 7310 8254 gene locus_tag LOCUS_16980 7310 8254 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_16980 8331 9527 gene locus_tag LOCUS_16990 8331 9527 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_16990 10316 9753 gene locus_tag LOCUS_17000 10316 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13780 10547 gene locus_tag LOCUS_17010 13780 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 14137 14862 gene locus_tag LOCUS_17020 14137 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence073 <1 697 gene locus_tag LOCUS_17030 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074037.1:beta-ketoacyl-ACP synthase 1703 672 gene locus_tag LOCUS_17040 gene trpD 1703 672 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_17040 2767 1802 gene locus_tag LOCUS_17050 gene bioB 2767 1802 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_17050 2885 2812 gene locus_tag LOCUS_t00270 2885 2812 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4325 2934 gene locus_tag LOCUS_17060 gene zwf 4325 2934 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402864.1 protein_id gnl|my_center|LOCUS_17060 5202 4390 gene locus_tag LOCUS_17070 5202 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5636 5199 gene locus_tag LOCUS_17080 5636 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6865 5906 gene locus_tag LOCUS_17090 6865 5906 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_17090 8283 6880 gene locus_tag LOCUS_17100 gene der 8283 6880 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_17100 8585 11620 gene locus_tag LOCUS_17110 8585 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 13170 11653 gene locus_tag LOCUS_17120 gene cls 13170 11653 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_17120 14287 13223 gene locus_tag LOCUS_17130 14287 13223 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_17130 14714 15070 gene locus_tag LOCUS_17140 14714 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence074 2395 443 gene locus_tag LOCUS_17150 gene rpsA 2395 443 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_17150 2910 3206 gene locus_tag LOCUS_17160 gene groES 2910 3206 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_17160 3257 4897 gene locus_tag LOCUS_17170 gene groL 3257 4897 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_17170 7999 5483 gene locus_tag LOCUS_17180 7999 5483 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_17180 10221 8002 gene locus_tag LOCUS_17190 10221 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 11386 10241 gene locus_tag LOCUS_17200 11386 10241 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_17200 14682 11383 gene locus_tag LOCUS_17210 14682 11383 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_17210 <15202 14696 gene locus_tag LOCUS_17220 <15202 14696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464630.1:6-phosphogluconolactonase >Feature sequence075 291 1433 gene locus_tag LOCUS_17230 gene pdxB 291 1433 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_17230 2378 2055 gene locus_tag LOCUS_17240 2378 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3378 2776 gene locus_tag LOCUS_17250 3378 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3755 3949 gene locus_tag LOCUS_17260 3755 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5111 3966 gene locus_tag LOCUS_17270 5111 3966 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583980.1 protein_id gnl|my_center|LOCUS_17270 5203 6144 gene locus_tag LOCUS_17280 5203 6144 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_17280 6141 6854 gene locus_tag LOCUS_17290 6141 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 6851 7576 gene locus_tag LOCUS_17300 6851 7576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_17300 7560 9221 gene locus_tag LOCUS_17310 gene recN 7560 9221 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_17310 10595 9234 gene locus_tag LOCUS_17320 10595 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 12142 10592 gene locus_tag LOCUS_17330 12142 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 12495 12139 gene locus_tag LOCUS_17340 12495 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 13594 12716 gene locus_tag LOCUS_17350 13594 12716 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064052.1 protein_id gnl|my_center|LOCUS_17350 14498 13602 gene locus_tag LOCUS_17360 14498 13602 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_17360 <15125 14498 gene locus_tag LOCUS_17370 <15125 14498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256416.1:CpaF family protein >Feature sequence076 385 2310 gene locus_tag LOCUS_17380 gene ligA 385 2310 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869864.1 protein_id gnl|my_center|LOCUS_17380 2307 4682 gene locus_tag LOCUS_17390 2307 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5610 4687 gene locus_tag LOCUS_17400 5610 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6320 5607 gene locus_tag LOCUS_17410 gene radC 6320 5607 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_17410 7257 6325 gene locus_tag LOCUS_17420 7257 6325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_17420 9662 7254 gene locus_tag LOCUS_17430 9662 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 10173 9892 gene locus_tag LOCUS_17440 10173 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10686 10447 gene locus_tag LOCUS_17450 10686 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12212 10887 gene locus_tag LOCUS_17460 12212 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 13315 12341 gene locus_tag LOCUS_17470 13315 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 13706 14716 gene locus_tag LOCUS_17480 13706 14716 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence077 79 2415 gene locus_tag LOCUS_17490 79 2415 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815880.1 protein_id gnl|my_center|LOCUS_17490 2884 3390 gene locus_tag LOCUS_17500 2884 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3458 3985 gene locus_tag LOCUS_17510 3458 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4076 6445 gene locus_tag LOCUS_17520 4076 6445 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_17520 6442 7800 gene locus_tag LOCUS_17530 6442 7800 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_17530 7797 8912 gene locus_tag LOCUS_17540 7797 8912 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_17540 8909 9112 gene locus_tag LOCUS_17550 8909 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9116 12130 gene locus_tag LOCUS_17560 9116 12130 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 protein_id gnl|my_center|LOCUS_17560 12223 12639 gene locus_tag LOCUS_17570 12223 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 12759 13724 gene locus_tag LOCUS_17580 12759 13724 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_17580 13743 13961 gene locus_tag LOCUS_17590 13743 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14190 13972 gene locus_tag LOCUS_17600 14190 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14407 14712 gene locus_tag LOCUS_17610 14407 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence078 745 188 gene locus_tag LOCUS_17620 745 188 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_17620 910 1854 gene locus_tag LOCUS_17630 gene xerD 910 1854 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 protein_id gnl|my_center|LOCUS_17630 3414 1888 gene locus_tag LOCUS_17640 3414 1888 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_17640 4109 6358 gene locus_tag LOCUS_17650 4109 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7930 6896 gene locus_tag LOCUS_17660 7930 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 8457 9443 gene locus_tag LOCUS_17670 8457 9443 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_17670 10454 10963 gene locus_tag LOCUS_17680 10454 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 11255 11998 gene locus_tag LOCUS_17690 11255 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 13391 12303 gene locus_tag LOCUS_17700 13391 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 14098 13727 gene locus_tag LOCUS_17710 14098 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence079 322 1608 gene locus_tag LOCUS_17720 gene glgC 322 1608 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_17720 1636 1842 gene locus_tag LOCUS_17730 1636 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3889 2270 gene locus_tag LOCUS_17740 3889 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5148 3991 gene locus_tag LOCUS_17750 5148 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7305 5395 gene locus_tag LOCUS_17760 7305 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 9107 7410 gene locus_tag LOCUS_17770 9107 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 9213 9299 gene locus_tag LOCUS_t00280 9213 9299 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10670 9684 gene locus_tag LOCUS_17780 gene pdxA 10670 9684 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086666.1 protein_id gnl|my_center|LOCUS_17780 11188 10682 gene locus_tag LOCUS_17790 11188 10682 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_17790 12018 11353 gene locus_tag LOCUS_17800 12018 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 12059 12958 gene locus_tag LOCUS_17810 12059 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence080 3098 2232 gene locus_tag LOCUS_17820 gene dapA 3098 2232 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_17820 3390 6926 gene locus_tag LOCUS_17830 3390 6926 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_17830 6926 8617 gene locus_tag LOCUS_17840 6926 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 9108 8707 gene locus_tag LOCUS_17850 9108 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence081 1061 1157 gene locus_tag LOCUS_r00010 1061 1157 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2431 1223 gene locus_tag LOCUS_17860 2431 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4218 2593 gene locus_tag LOCUS_17870 4218 2593 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944001.1 protein_id gnl|my_center|LOCUS_17870 4587 5603 gene locus_tag LOCUS_17880 4587 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6989 5631 gene locus_tag LOCUS_17890 gene glmM 6989 5631 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_17890 8344 6986 gene locus_tag LOCUS_17900 gene glmM 8344 6986 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_17900 9829 8516 gene locus_tag LOCUS_17910 9829 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11145 9985 gene locus_tag LOCUS_17920 11145 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 11339 11145 gene locus_tag LOCUS_17930 11339 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 11287 11835 gene locus_tag LOCUS_17940 11287 11835 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_17940 11993 13681 gene locus_tag LOCUS_17950 11993 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence082 368 171 gene locus_tag LOCUS_17960 368 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 894 361 gene locus_tag LOCUS_17970 894 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2679 1390 gene locus_tag LOCUS_17980 2679 1390 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_17980 2813 3418 gene locus_tag LOCUS_17990 2813 3418 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_17990 3725 3474 gene locus_tag LOCUS_18000 3725 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3840 4115 gene locus_tag LOCUS_18010 3840 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4319 6277 gene locus_tag LOCUS_18020 4319 6277 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_18020 7085 6411 gene locus_tag LOCUS_18030 gene ispD 7085 6411 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 protein_id gnl|my_center|LOCUS_18030 8413 7166 gene locus_tag LOCUS_18040 8413 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9054 8413 gene locus_tag LOCUS_18050 9054 8413 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723611.1 protein_id gnl|my_center|LOCUS_18050 10710 9232 gene locus_tag LOCUS_18060 10710 9232 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_18060 11583 10747 gene locus_tag LOCUS_18070 11583 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 11759 11835 gene locus_tag LOCUS_t00290 11759 11835 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11882 12598 gene locus_tag LOCUS_18080 11882 12598 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_18080 13036 13623 gene locus_tag LOCUS_18090 13036 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence083 324 980 gene locus_tag LOCUS_18100 324 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 998 5641 gene locus_tag LOCUS_18110 998 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 8025 6013 gene locus_tag LOCUS_18120 8025 6013 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_18120 11221 8048 gene locus_tag LOCUS_18130 11221 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 11630 13174 gene locus_tag LOCUS_18140 11630 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence084 474 217 gene locus_tag LOCUS_18150 474 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1085 699 gene locus_tag LOCUS_18160 1085 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1408 3105 gene locus_tag LOCUS_18170 1408 3105 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940631.1 protein_id gnl|my_center|LOCUS_18170 3080 4231 gene locus_tag LOCUS_18180 3080 4231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_18180 4265 6280 gene locus_tag LOCUS_18190 4265 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 9045 6766 gene locus_tag LOCUS_18200 9045 6766 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_18200 10281 9082 gene locus_tag LOCUS_18210 gene bioF 10281 9082 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_18210 10582 11181 gene locus_tag LOCUS_18220 gene grpE 10582 11181 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_18220 11174 12331 gene locus_tag LOCUS_18230 gene dnaJ 11174 12331 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_18230 12539 13342 gene locus_tag LOCUS_18240 12539 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence085 1125 592 gene locus_tag LOCUS_18250 1125 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1295 1483 gene locus_tag LOCUS_18260 1295 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2491 1799 gene locus_tag LOCUS_18270 2491 1799 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_18270 3581 2481 gene locus_tag LOCUS_18280 3581 2481 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_18280 4971 3910 gene locus_tag LOCUS_18290 4971 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6277 5399 gene locus_tag LOCUS_18300 6277 5399 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254238.1 protein_id gnl|my_center|LOCUS_18300 7710 6709 gene locus_tag LOCUS_18310 7710 6709 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117186.1 protein_id gnl|my_center|LOCUS_18310 9283 8567 gene locus_tag LOCUS_18320 9283 8567 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061495.1 protein_id gnl|my_center|LOCUS_18320 10486 9599 gene locus_tag LOCUS_18330 10486 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 11523 10507 gene locus_tag LOCUS_18340 11523 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 13150 12113 gene locus_tag LOCUS_18350 gene neuB 13150 12113 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_18350 13596 13222 gene locus_tag LOCUS_18360 13596 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence086 615 1607 gene locus_tag LOCUS_18370 615 1607 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_18370 2805 1705 gene locus_tag LOCUS_18380 gene serC 2805 1705 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_18380 3022 3498 gene locus_tag LOCUS_18390 3022 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3645 3893 gene locus_tag LOCUS_18400 3645 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3890 4963 gene locus_tag LOCUS_18410 3890 4963 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_18410 4972 6411 gene locus_tag LOCUS_18420 4972 6411 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_18420 6474 7532 gene locus_tag LOCUS_18430 6474 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8272 7649 gene locus_tag LOCUS_18440 8272 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 8599 10497 gene locus_tag LOCUS_18450 8599 10497 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_18450 10494 11216 gene locus_tag LOCUS_18460 10494 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence087 334 1020 gene locus_tag LOCUS_18470 334 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1017 2807 gene locus_tag LOCUS_18480 1017 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2807 4144 gene locus_tag LOCUS_18490 2807 4144 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_18490 4141 5466 gene locus_tag LOCUS_18500 4141 5466 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_18500 5469 6614 gene locus_tag LOCUS_18510 5469 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6762 7490 gene locus_tag LOCUS_18520 6762 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7858 9168 gene locus_tag LOCUS_18530 7858 9168 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_18530 11707 9476 gene locus_tag LOCUS_18540 11707 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 12681 11704 gene locus_tag LOCUS_18550 12681 11704 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence088 1830 511 gene locus_tag LOCUS_18560 1830 511 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_18560 2029 3423 gene locus_tag LOCUS_18570 gene argH 2029 3423 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_18570 3443 4339 gene locus_tag LOCUS_18580 3443 4339 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_18580 5183 4419 gene locus_tag LOCUS_18590 5183 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6258 5266 gene locus_tag LOCUS_18600 6258 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7456 6365 gene locus_tag LOCUS_18610 gene mtnA 7456 6365 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_18610 8800 7562 gene locus_tag LOCUS_18620 8800 7562 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_18620 9849 8920 gene locus_tag LOCUS_18630 9849 8920 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_18630 10116 11282 gene locus_tag LOCUS_18640 10116 11282 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_18640 11392 11892 gene locus_tag LOCUS_18650 11392 11892 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence089 155 343 gene locus_tag LOCUS_18660 155 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 365 1612 gene locus_tag LOCUS_18670 365 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1503 2711 gene locus_tag LOCUS_18680 1503 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3025 3621 gene locus_tag LOCUS_18690 gene rpsD 3025 3621 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_18690 4934 3684 gene locus_tag LOCUS_18700 4934 3684 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_18700 5509 5033 gene locus_tag LOCUS_18710 5509 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 5588 7615 gene locus_tag LOCUS_18720 5588 7615 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_18720 8044 7670 gene locus_tag LOCUS_18730 8044 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 8412 8813 gene locus_tag LOCUS_18740 8412 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 9156 10517 gene locus_tag LOCUS_18750 gene trkA 9156 10517 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_18750 10549 12069 gene locus_tag LOCUS_18760 10549 12069 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_18760 12338 12262 gene locus_tag LOCUS_t00300 12338 12262 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence090 241 3243 gene locus_tag LOCUS_18770 241 3243 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_18770 3417 3677 gene locus_tag LOCUS_18780 3417 3677 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_18780 3667 3903 gene locus_tag LOCUS_18790 3667 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_18790 4012 4200 gene locus_tag LOCUS_18800 4012 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 4149 4349 gene locus_tag LOCUS_18810 4149 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4417 4923 gene locus_tag LOCUS_18820 4417 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8085 5800 gene locus_tag LOCUS_18830 8085 5800 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_18830 8701 9174 gene locus_tag LOCUS_18840 gene eco 8701 9174 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114416.1 protein_id gnl|my_center|LOCUS_18840 9612 10244 gene locus_tag LOCUS_18850 9612 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11765 11145 gene locus_tag LOCUS_18860 gene hisH 11765 11145 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_18860 <12563 11823 gene locus_tag LOCUS_18870 <12563 11823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020218.1:radical SAM protein >Feature sequence091 381 154 gene locus_tag LOCUS_18880 381 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 917 510 gene locus_tag LOCUS_18890 gene tolR 917 510 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_18890 1919 1218 gene locus_tag LOCUS_18900 gene tolQ 1919 1218 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_18900 2557 1919 gene locus_tag LOCUS_18910 2557 1919 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_18910 3553 4761 gene locus_tag LOCUS_18920 3553 4761 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_18920 5313 6794 gene locus_tag LOCUS_18930 5313 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 6844 7164 gene locus_tag LOCUS_18940 6844 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8268 7048 gene locus_tag LOCUS_18950 8268 7048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_18950 8843 9856 gene locus_tag LOCUS_18960 8843 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 10065 11012 gene locus_tag LOCUS_18970 10065 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 11384 11016 gene locus_tag LOCUS_18980 11384 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 11610 11407 gene locus_tag LOCUS_18990 11610 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 12079 11603 gene locus_tag LOCUS_19000 12079 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence092 2324 366 gene locus_tag LOCUS_19010 2324 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2504 2653 gene locus_tag LOCUS_19020 2504 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2829 3245 gene locus_tag LOCUS_19030 2829 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4131 3214 gene locus_tag LOCUS_19040 4131 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6173 4284 gene locus_tag LOCUS_19050 6173 4284 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_19050 6352 6891 gene locus_tag LOCUS_19060 6352 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6822 7001 gene locus_tag LOCUS_19070 6822 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 6985 7917 gene locus_tag LOCUS_19080 6985 7917 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_19080 7901 9889 gene locus_tag LOCUS_19090 7901 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 10088 9906 gene locus_tag LOCUS_19100 10088 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 11636 10488 gene locus_tag LOCUS_19110 11636 10488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_19110 12109 11969 gene locus_tag LOCUS_19120 12109 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence093 1420 731 gene locus_tag LOCUS_19130 gene rsmG 1420 731 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 protein_id gnl|my_center|LOCUS_19130 2133 1585 gene locus_tag LOCUS_19140 2133 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2548 2144 gene locus_tag LOCUS_19150 2548 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2861 2562 gene locus_tag LOCUS_19160 2861 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3097 5616 gene locus_tag LOCUS_19170 gene lon 3097 5616 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_19170 8318 5685 gene locus_tag LOCUS_19180 8318 5685 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_19180 9802 8720 gene locus_tag LOCUS_19190 9802 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11096 9792 gene locus_tag LOCUS_19200 11096 9792 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence094 778 1518 gene locus_tag LOCUS_19210 778 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1595 3229 gene locus_tag LOCUS_19220 gene hutH 1595 3229 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_19220 3944 4912 gene locus_tag LOCUS_19230 3944 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5008 5805 gene locus_tag LOCUS_19240 5008 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 6145 6069 gene locus_tag LOCUS_t00310 6145 6069 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6377 7711 gene locus_tag LOCUS_19250 6377 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 7789 7865 gene locus_tag LOCUS_t00320 7789 7865 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8638 7928 gene locus_tag LOCUS_19260 8638 7928 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_19260 8999 9982 gene locus_tag LOCUS_19270 8999 9982 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_19270 10023 11549 gene locus_tag LOCUS_19280 10023 11549 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence095 1797 946 gene locus_tag LOCUS_19290 1797 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2425 1808 gene locus_tag LOCUS_19300 gene recR 2425 1808 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391218.1 protein_id gnl|my_center|LOCUS_19300 3436 2693 gene locus_tag LOCUS_19310 3436 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4322 3507 gene locus_tag LOCUS_19320 gene dapB 4322 3507 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_19320 4501 5472 gene locus_tag LOCUS_19330 4501 5472 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_19330 6634 5522 gene locus_tag LOCUS_19340 6634 5522 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_19340 7731 6682 gene locus_tag LOCUS_19350 7731 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9889 7967 gene locus_tag LOCUS_19360 9889 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 11536 9950 gene locus_tag LOCUS_19370 11536 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence096 664 2493 gene locus_tag LOCUS_19380 664 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2562 2747 gene locus_tag LOCUS_19390 2562 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3372 3040 gene locus_tag LOCUS_19400 3372 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4226 3369 gene locus_tag LOCUS_19410 4226 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6831 4411 gene locus_tag LOCUS_19420 6831 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8511 6985 gene locus_tag LOCUS_19430 8511 6985 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_19430 9472 8516 gene locus_tag LOCUS_19440 9472 8516 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_19440 10964 9891 gene locus_tag LOCUS_19450 10964 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11608 10961 gene locus_tag LOCUS_19460 11608 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence097 2419 1106 gene locus_tag LOCUS_19470 2419 1106 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_19470 3592 2642 gene locus_tag LOCUS_19480 3592 2642 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_19480 3939 3589 gene locus_tag LOCUS_19490 3939 3589 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_19490 4153 3932 gene locus_tag LOCUS_19500 4153 3932 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_19500 5034 4714 gene locus_tag LOCUS_19510 5034 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5295 5867 gene locus_tag LOCUS_19520 5295 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 5864 9607 gene locus_tag LOCUS_19530 5864 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence098 310 1518 gene locus_tag LOCUS_19540 310 1518 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_19540 1583 3310 gene locus_tag LOCUS_19550 gene thrS 1583 3310 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_19550 5684 3513 gene locus_tag LOCUS_19560 5684 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 7843 5705 gene locus_tag LOCUS_19570 7843 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 8928 8347 gene locus_tag LOCUS_19580 gene rsmD 8928 8347 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_19580 <11501 8925 gene locus_tag LOCUS_19590 <11501 8925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001052877.1:cobyric acid synthase >Feature sequence099 <1 1644 gene locus_tag LOCUS_19600 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791956.1:translational GTPase TypA 2537 1812 gene locus_tag LOCUS_19610 2537 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5508 2629 gene locus_tag LOCUS_19620 gene uvrA 5508 2629 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_19620 6502 5558 gene locus_tag LOCUS_19630 6502 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 7571 6567 gene locus_tag LOCUS_19640 7571 6567 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_19640 7743 8591 gene locus_tag LOCUS_19650 gene lpxI 7743 8591 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930695.1 protein_id gnl|my_center|LOCUS_19650 8593 9699 gene locus_tag LOCUS_19660 8593 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 10935 9853 gene locus_tag LOCUS_19670 10935 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence100 376 128 gene locus_tag LOCUS_19680 376 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 903 1127 gene locus_tag LOCUS_19690 903 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1225 1416 gene locus_tag LOCUS_19700 1225 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2850 1318 gene locus_tag LOCUS_19710 gene rhlB 2850 1318 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_19710 4245 2947 gene locus_tag LOCUS_19720 gene dnaA 4245 2947 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290433.1 protein_id gnl|my_center|LOCUS_19720 4803 6020 gene locus_tag LOCUS_19730 gene nagA 4803 6020 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_19730 6028 7569 gene locus_tag LOCUS_19740 6028 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 7618 8517 gene locus_tag LOCUS_19750 gene epmA 7618 8517 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_19750 8702 9730 gene locus_tag LOCUS_19760 8702 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 9845 10600 gene locus_tag LOCUS_19770 9845 10600 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467616.1 protein_id gnl|my_center|LOCUS_19770 <11387 10715 gene locus_tag LOCUS_19780 <11387 10715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727033.1:ABC transporter ATP-binding protein >Feature sequence101 427 65 gene locus_tag LOCUS_19790 427 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1776 427 gene locus_tag LOCUS_19800 1776 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2192 2890 gene locus_tag LOCUS_19810 2192 2890 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_19810 2989 4251 gene locus_tag LOCUS_19820 2989 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5689 5177 gene locus_tag LOCUS_19830 5689 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5763 6596 gene locus_tag LOCUS_19840 gene murI 5763 6596 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_19840 6708 7211 gene locus_tag LOCUS_19850 gene ruvC 6708 7211 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933328.1 protein_id gnl|my_center|LOCUS_19850 7346 7804 gene locus_tag LOCUS_19860 7346 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8341 11274 gene locus_tag LOCUS_19870 8341 11274 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence102 1470 73 gene locus_tag LOCUS_19880 1470 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1614 1862 gene locus_tag LOCUS_19890 1614 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1859 2254 gene locus_tag LOCUS_19900 1859 2254 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_19900 2377 3789 gene locus_tag LOCUS_19910 2377 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3946 4347 gene locus_tag LOCUS_19920 3946 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 4344 5825 gene locus_tag LOCUS_19930 4344 5825 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_19930 6008 7327 gene locus_tag LOCUS_19940 6008 7327 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_19940 7324 8496 gene locus_tag LOCUS_19950 gene lpxK 7324 8496 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_19950 9361 8477 gene locus_tag LOCUS_19960 9361 8477 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_19960 10693 9404 gene locus_tag LOCUS_19970 10693 9404 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence103 458 1612 gene locus_tag LOCUS_19980 458 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1774 2001 gene locus_tag LOCUS_19990 1774 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2028 2414 gene locus_tag LOCUS_20000 2028 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4534 2393 gene locus_tag LOCUS_20010 4534 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4965 5891 gene locus_tag LOCUS_20020 4965 5891 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_20020 6188 7786 gene locus_tag LOCUS_20030 6188 7786 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_20030 9414 7885 gene locus_tag LOCUS_20040 9414 7885 CDS product IS1634-like element ISMac12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065563.1 protein_id gnl|my_center|LOCUS_20040 9823 10077 gene locus_tag LOCUS_20050 9823 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10483 10686 gene locus_tag LOCUS_20060 10483 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 10870 10676 gene locus_tag LOCUS_20070 10870 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence104 345 160 gene locus_tag LOCUS_20080 345 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1538 342 gene locus_tag LOCUS_20090 1538 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3329 1695 gene locus_tag LOCUS_20100 3329 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4693 3845 gene locus_tag LOCUS_20110 4693 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5604 4876 gene locus_tag LOCUS_20120 5604 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5799 5623 gene locus_tag LOCUS_20130 5799 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8787 6223 gene locus_tag LOCUS_20140 8787 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence105 1403 183 gene locus_tag LOCUS_20150 1403 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2011 1433 gene locus_tag LOCUS_20160 2011 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2194 2478 gene locus_tag LOCUS_20170 2194 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2855 3070 gene locus_tag LOCUS_20180 2855 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4181 3096 gene locus_tag LOCUS_20190 4181 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 5932 4475 gene locus_tag LOCUS_20200 gene gcvPB 5932 4475 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938717.1 protein_id gnl|my_center|LOCUS_20200 7286 5943 gene locus_tag LOCUS_20210 gene gcvPA 7286 5943 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938718.1 protein_id gnl|my_center|LOCUS_20210 7655 7287 gene locus_tag LOCUS_20220 gene gcvH 7655 7287 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865076.1 protein_id gnl|my_center|LOCUS_20220 9063 7861 gene locus_tag LOCUS_20230 9063 7861 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_20230 9562 9086 gene locus_tag LOCUS_20240 9562 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence106 1457 279 gene locus_tag LOCUS_20250 1457 279 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_20250 1973 1458 gene locus_tag LOCUS_20260 1973 1458 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_20260 2084 2344 gene locus_tag LOCUS_20270 gene rpmE 2084 2344 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_20270 2341 3441 gene locus_tag LOCUS_20280 gene prfA 2341 3441 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_20280 3441 4043 gene locus_tag LOCUS_20290 3441 4043 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_20290 5387 4137 gene locus_tag LOCUS_20300 5387 4137 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_20300 5592 6785 gene locus_tag LOCUS_20310 5592 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 6872 7132 gene locus_tag LOCUS_20320 6872 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 7129 7506 gene locus_tag LOCUS_20330 7129 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7537 8286 gene locus_tag LOCUS_20340 7537 8286 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245835.1 protein_id gnl|my_center|LOCUS_20340 8456 9187 gene locus_tag LOCUS_20350 8456 9187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence107 1008 271 gene locus_tag LOCUS_20360 1008 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1675 3534 gene locus_tag LOCUS_20370 1675 3534 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_20370 3581 4762 gene locus_tag LOCUS_20380 3581 4762 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_20380 5016 6149 gene locus_tag LOCUS_20390 5016 6149 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 protein_id gnl|my_center|LOCUS_20390 6501 6250 gene locus_tag LOCUS_20400 6501 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 9238 6956 gene locus_tag LOCUS_20410 9238 6956 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_20410 9719 9312 gene locus_tag LOCUS_20420 9719 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence108 113 874 gene locus_tag LOCUS_20430 113 874 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947571.1 protein_id gnl|my_center|LOCUS_20430 885 2252 gene locus_tag LOCUS_20440 885 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904381.1 protein_id gnl|my_center|LOCUS_20440 2386 3225 gene locus_tag LOCUS_20450 2386 3225 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_20450 3239 4399 gene locus_tag LOCUS_20460 3239 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4396 5079 gene locus_tag LOCUS_20470 4396 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5096 6247 gene locus_tag LOCUS_20480 gene murG 5096 6247 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_20480 6716 6324 gene locus_tag LOCUS_20490 6716 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6870 7571 gene locus_tag LOCUS_20500 6870 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8011 7568 gene locus_tag LOCUS_20510 8011 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 8406 8197 gene locus_tag LOCUS_20520 8406 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 9788 8403 gene locus_tag LOCUS_20530 9788 8403 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence109 473 2131 gene locus_tag LOCUS_20540 473 2131 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_20540 2240 4768 gene locus_tag LOCUS_20550 2240 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7768 4787 gene locus_tag LOCUS_20560 7768 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 8854 7889 gene locus_tag LOCUS_20570 8854 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 8967 9677 gene locus_tag LOCUS_20580 gene pyrF 8967 9677 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence110 295 2151 gene locus_tag LOCUS_20590 gene asnB 295 2151 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_20590 2546 3655 gene locus_tag LOCUS_20600 2546 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3939 7217 gene locus_tag LOCUS_20610 3939 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7526 9367 gene locus_tag LOCUS_20620 7526 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence111 262 86 gene locus_tag LOCUS_20630 262 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2223 706 gene locus_tag LOCUS_20640 2223 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2913 2263 gene locus_tag LOCUS_20650 2913 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3776 2910 gene locus_tag LOCUS_20660 3776 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4103 3948 gene locus_tag LOCUS_20670 4103 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5251 4172 gene locus_tag LOCUS_20680 5251 4172 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_20680 6671 5436 gene locus_tag LOCUS_20690 6671 5436 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_20690 8453 6678 gene locus_tag LOCUS_20700 8453 6678 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence112 127 1284 gene locus_tag LOCUS_20710 127 1284 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_20710 2633 1440 gene locus_tag LOCUS_20720 gene trpB 2633 1440 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_20720 2778 4487 gene locus_tag LOCUS_20730 2778 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4749 5795 gene locus_tag LOCUS_20740 4749 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6054 7862 gene locus_tag LOCUS_20750 6054 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 9071 7878 gene locus_tag LOCUS_20760 9071 7878 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence113 400 1347 gene locus_tag LOCUS_20770 400 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1746 1465 gene locus_tag LOCUS_20780 1746 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3110 1947 gene locus_tag LOCUS_20790 3110 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5320 3107 gene locus_tag LOCUS_20800 5320 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_20800 5686 5997 gene locus_tag LOCUS_20810 5686 5997 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257356.1 protein_id gnl|my_center|LOCUS_20810 5994 7760 gene locus_tag LOCUS_20820 5994 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 7753 8196 gene locus_tag LOCUS_20830 7753 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 8215 9006 gene locus_tag LOCUS_20840 8215 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence114 90 1 gene locus_tag LOCUS_t00330 90 1 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 320 1162 gene locus_tag LOCUS_20850 320 1162 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_20850 2597 1269 gene locus_tag LOCUS_20860 2597 1269 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_20860 3630 2752 gene locus_tag LOCUS_20870 3630 2752 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_20870 4667 3624 gene locus_tag LOCUS_20880 4667 3624 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_20880 4850 6724 gene locus_tag LOCUS_20890 4850 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence115 3541 398 gene locus_tag LOCUS_20900 3541 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 5012 3531 gene locus_tag LOCUS_20910 5012 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 5492 7000 gene locus_tag LOCUS_20920 5492 7000 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_20920 7072 7413 gene locus_tag LOCUS_20930 7072 7413 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_20930 8156 7950 gene locus_tag LOCUS_20940 8156 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 8631 8146 gene locus_tag LOCUS_20950 8631 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence116 220 1185 gene locus_tag LOCUS_20960 220 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1182 2393 gene locus_tag LOCUS_20970 1182 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2406 3368 gene locus_tag LOCUS_20980 2406 3368 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938694.1 protein_id gnl|my_center|LOCUS_20980 3442 4791 gene locus_tag LOCUS_20990 3442 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4821 5261 gene locus_tag LOCUS_21000 gene dut 4821 5261 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_21000 5805 6827 gene locus_tag LOCUS_21010 5805 6827 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_21010 6829 7677 gene locus_tag LOCUS_21020 6829 7677 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_21020 7677 8435 gene locus_tag LOCUS_21030 7677 8435 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence117 228 139 gene locus_tag LOCUS_t00340 228 139 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 333 653 gene locus_tag LOCUS_21040 333 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2529 631 gene locus_tag LOCUS_21050 2529 631 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_21050 2942 4261 gene locus_tag LOCUS_21060 2942 4261 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_21060 4265 6646 gene locus_tag LOCUS_21070 4265 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6950 8080 gene locus_tag LOCUS_21080 6950 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence118 640 1389 gene locus_tag LOCUS_21090 gene tatC 640 1389 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015780.1 protein_id gnl|my_center|LOCUS_21090 2216 1647 gene locus_tag LOCUS_21100 2216 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2453 2890 gene locus_tag LOCUS_21110 2453 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2965 4671 gene locus_tag LOCUS_21120 gene leuA 2965 4671 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933761.1 protein_id gnl|my_center|LOCUS_21120 4745 5797 gene locus_tag LOCUS_21130 4745 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 7721 6222 gene locus_tag LOCUS_21140 7721 6222 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_21140 8004 7786 gene locus_tag LOCUS_21150 8004 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence119 557 1438 gene locus_tag LOCUS_21160 557 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21160 1530 3167 gene locus_tag LOCUS_21170 1530 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3160 4101 gene locus_tag LOCUS_21180 3160 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 4416 5501 gene locus_tag LOCUS_21190 4416 5501 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_21190 5618 5902 gene locus_tag LOCUS_21200 5618 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5895 6743 gene locus_tag LOCUS_21210 5895 6743 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_21210 7132 8433 gene locus_tag LOCUS_21220 7132 8433 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755904.1 protein_id gnl|my_center|LOCUS_21220 8495 8571 gene locus_tag LOCUS_t00350 8495 8571 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence120 291 1097 gene locus_tag LOCUS_21230 291 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1394 2548 gene locus_tag LOCUS_21240 1394 2548 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_21240 2859 3152 gene locus_tag LOCUS_21250 2859 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3749 4609 gene locus_tag LOCUS_21260 3749 4609 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_21260 4650 6575 gene locus_tag LOCUS_21270 gene asnB 4650 6575 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_21270 7530 8633 gene locus_tag LOCUS_21280 7530 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence121 869 2146 gene locus_tag LOCUS_21290 869 2146 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_21290 2237 3511 gene locus_tag LOCUS_21300 2237 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4812 4318 gene locus_tag LOCUS_21310 4812 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4925 5368 gene locus_tag LOCUS_21320 4925 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5398 6327 gene locus_tag LOCUS_21330 gene cysK 5398 6327 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_21330 6381 7670 gene locus_tag LOCUS_21340 6381 7670 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence122 3526 1079 gene locus_tag LOCUS_21350 3526 1079 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_21350 4408 3671 gene locus_tag LOCUS_21360 4408 3671 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_21360 4750 4505 gene locus_tag LOCUS_21370 gene rpmA 4750 4505 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036349.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence123 1710 823 gene locus_tag LOCUS_21380 1710 823 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_21380 3298 2315 gene locus_tag LOCUS_21390 3298 2315 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_21390 6151 4388 gene locus_tag LOCUS_21400 6151 4388 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_21400 6583 6179 gene locus_tag LOCUS_21410 6583 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 7584 6646 gene locus_tag LOCUS_21420 gene rsmH 7584 6646 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_21420 7958 7581 gene locus_tag LOCUS_21430 7958 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence124 463 1167 gene locus_tag LOCUS_21440 463 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1532 2389 gene locus_tag LOCUS_21450 1532 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2450 2638 gene locus_tag LOCUS_21460 2450 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2684 6004 gene locus_tag LOCUS_21470 2684 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 <8116 6325 gene locus_tag LOCUS_21480 <8116 6325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922218.1:DEAD/DEAH box helicase family protein >Feature sequence125 2461 1361 gene locus_tag LOCUS_21490 2461 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3099 2488 gene locus_tag LOCUS_21500 3099 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4072 3218 gene locus_tag LOCUS_21510 4072 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5935 4970 gene locus_tag LOCUS_21520 5935 4970 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_21520 6552 6169 gene locus_tag LOCUS_21530 6552 6169 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_21530 7522 6644 gene locus_tag LOCUS_21540 7522 6644 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence126 1515 202 gene locus_tag LOCUS_21550 1515 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2049 1822 gene locus_tag LOCUS_21560 2049 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3218 2349 gene locus_tag LOCUS_21570 3218 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4068 3259 gene locus_tag LOCUS_21580 4068 3259 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_21580 4228 4070 gene locus_tag LOCUS_21590 4228 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 6031 4601 gene locus_tag LOCUS_21600 6031 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 <7885 6361 gene locus_tag LOCUS_21610 <7885 6361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106682.1:type II secretion system secretin GspD >Feature sequence127 104 1738 gene locus_tag LOCUS_21620 104 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1763 2776 gene locus_tag LOCUS_21630 gene rfbB 1763 2776 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_21630 2783 3637 gene locus_tag LOCUS_21640 gene purU 2783 3637 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_21640 3634 4638 gene locus_tag LOCUS_21650 3634 4638 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080650.1 protein_id gnl|my_center|LOCUS_21650 5088 4777 gene locus_tag LOCUS_21660 5088 4777 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_21660 5487 5137 gene locus_tag LOCUS_21670 5487 5137 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_21670 6987 5674 gene locus_tag LOCUS_21680 6987 5674 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073868.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence128 110 685 gene locus_tag LOCUS_21690 110 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1463 708 gene locus_tag LOCUS_21700 gene istB 1463 708 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_21700 3056 1554 gene locus_tag LOCUS_21710 gene istA 3056 1554 CDS product IS21-like element ISRsp2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440448.1 protein_id gnl|my_center|LOCUS_21710 3207 3671 gene locus_tag LOCUS_21720 3207 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3807 5936 gene locus_tag LOCUS_21730 3807 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 5941 7401 gene locus_tag LOCUS_21740 5941 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence129 <1 749 gene locus_tag LOCUS_21750 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583837.1:excinuclease ABC subunit UvrC 1767 1159 gene locus_tag LOCUS_21760 1767 1159 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_21760 2316 1798 gene locus_tag LOCUS_21770 2316 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2622 2401 gene locus_tag LOCUS_21780 2622 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4500 2866 gene locus_tag LOCUS_21790 4500 2866 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_21790 5648 4497 gene locus_tag LOCUS_21800 5648 4497 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262887.1 protein_id gnl|my_center|LOCUS_21800 6803 5652 gene locus_tag LOCUS_21810 6803 5652 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058063.1 protein_id gnl|my_center|LOCUS_21810 <7328 6796 gene locus_tag LOCUS_21820 <7328 6796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058064.1:type I restriction endonuclease subunit R >Feature sequence130 52 258 gene locus_tag LOCUS_21830 52 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1205 321 gene locus_tag LOCUS_21840 1205 321 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_21840 1365 1195 gene locus_tag LOCUS_21850 1365 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1387 2109 gene locus_tag LOCUS_21860 1387 2109 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_21860 2279 2620 gene locus_tag LOCUS_21870 2279 2620 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 protein_id gnl|my_center|LOCUS_21870 2623 2907 gene locus_tag LOCUS_21880 2623 2907 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_21880 4321 3044 gene locus_tag LOCUS_21890 4321 3044 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_21890 4597 4827 gene locus_tag LOCUS_21900 4597 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5184 6701 gene locus_tag LOCUS_21910 5184 6701 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172762.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence131 572 198 gene locus_tag LOCUS_21920 572 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1316 834 gene locus_tag LOCUS_21930 1316 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1711 1424 gene locus_tag LOCUS_21940 1711 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3308 2349 gene locus_tag LOCUS_21950 3308 2349 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388866.1 protein_id gnl|my_center|LOCUS_21950 3848 3339 gene locus_tag LOCUS_21960 3848 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4869 3910 gene locus_tag LOCUS_21970 4869 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5634 4873 gene locus_tag LOCUS_21980 5634 4873 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_21980 <7234 6121 gene locus_tag LOCUS_21990 <7234 6121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase >Feature sequence132 2832 211 gene locus_tag LOCUS_22000 2832 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5473 2924 gene locus_tag LOCUS_22010 5473 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 6755 5676 gene locus_tag LOCUS_22020 6755 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence133 284 1861 gene locus_tag LOCUS_22030 284 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1918 1992 gene locus_tag LOCUS_t00360 1918 1992 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2718 3689 gene locus_tag LOCUS_22040 gene trpS 2718 3689 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_22040 3767 4150 gene locus_tag LOCUS_22050 gene hisI 3767 4150 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_22050 6467 4335 gene locus_tag LOCUS_22060 gene ppk1 6467 4335 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence134 859 784 gene locus_tag LOCUS_t00370 859 784 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2498 993 gene locus_tag LOCUS_22070 gene trpE 2498 993 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_22070 4094 2664 gene locus_tag LOCUS_22080 4094 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 5553 4108 gene locus_tag LOCUS_22090 5553 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 <6748 5735 gene locus_tag LOCUS_22100 <6748 5735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461820.1:radical SAM protein >Feature sequence135 1424 243 gene locus_tag LOCUS_22110 1424 243 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_22110 1881 1465 gene locus_tag LOCUS_22120 1881 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 3154 2090 gene locus_tag LOCUS_22130 gene pseI 3154 2090 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_22130 4596 4030 gene locus_tag LOCUS_22140 4596 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 4768 4583 gene locus_tag LOCUS_22150 4768 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6287 5025 gene locus_tag LOCUS_22160 6287 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence136 2040 1183 gene locus_tag LOCUS_22170 gene panC 2040 1183 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_22170 2316 3518 gene locus_tag LOCUS_22180 2316 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3535 4743 gene locus_tag LOCUS_22190 gene rhaT 3535 4743 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_22190 5112 5036 gene locus_tag LOCUS_t00380 5112 5036 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence137 101 916 gene locus_tag LOCUS_22200 101 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2028 1264 gene locus_tag LOCUS_22210 2028 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2846 2025 gene locus_tag LOCUS_22220 2846 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3409 4899 gene locus_tag LOCUS_22230 3409 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 4902 6251 gene locus_tag LOCUS_22240 gene atoC 4902 6251 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence138 2253 397 gene locus_tag LOCUS_22250 gene pabB 2253 397 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927074.1 protein_id gnl|my_center|LOCUS_22250 5433 2281 gene locus_tag LOCUS_22260 5433 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 5577 5744 gene locus_tag LOCUS_22270 5577 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence139 1169 2314 gene locus_tag LOCUS_22280 gene carA 1169 2314 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_22280 2550 2371 gene locus_tag LOCUS_22290 2550 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4207 2579 gene locus_tag LOCUS_22300 gene hcp 4207 2579 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_22300 4772 4245 gene locus_tag LOCUS_22310 4772 4245 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943331.1 protein_id gnl|my_center|LOCUS_22310 5113 4769 gene locus_tag LOCUS_22320 5113 4769 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_22320 6243 5422 gene locus_tag LOCUS_22330 6243 5422 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence140 1104 160 gene locus_tag LOCUS_22340 gene miaA 1104 160 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439583.1 protein_id gnl|my_center|LOCUS_22340 1541 2383 gene locus_tag LOCUS_22350 1541 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22350 2376 3329 gene locus_tag LOCUS_22360 2376 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3809 3432 gene locus_tag LOCUS_22370 3809 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4038 4113 gene locus_tag LOCUS_t00390 4038 4113 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4181 4408 gene locus_tag LOCUS_22380 gene rpmB 4181 4408 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_22380 4439 5662 gene locus_tag LOCUS_22390 4439 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence141 1921 1007 gene locus_tag LOCUS_22400 1921 1007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_22400 3798 2530 gene locus_tag LOCUS_22410 3798 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5271 3925 gene locus_tag LOCUS_22420 5271 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 6172 5438 gene locus_tag LOCUS_22430 6172 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence142 1145 489 gene locus_tag LOCUS_22440 1145 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2351 1323 gene locus_tag LOCUS_22450 2351 1323 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_22450 3139 4833 gene locus_tag LOCUS_22460 3139 4833 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_22460 4885 5898 gene locus_tag LOCUS_22470 4885 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence143 1795 2343 gene locus_tag LOCUS_22480 1795 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2697 3551 gene locus_tag LOCUS_22490 gene trpA 2697 3551 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124727.1 protein_id gnl|my_center|LOCUS_22490 5885 3696 gene locus_tag LOCUS_22500 5885 3696 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence144 650 381 gene locus_tag LOCUS_22510 650 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1090 884 gene locus_tag LOCUS_22520 1090 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2057 1071 gene locus_tag LOCUS_22530 2057 1071 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_22530 4284 2050 gene locus_tag LOCUS_22540 4284 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence145 2165 168 gene locus_tag LOCUS_22550 gene infB 2165 168 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965108.1 protein_id gnl|my_center|LOCUS_22550 3474 2176 gene locus_tag LOCUS_22560 gene nusA 3474 2176 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527896.1 protein_id gnl|my_center|LOCUS_22560 4589 4041 gene locus_tag LOCUS_22570 4589 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 5212 4586 gene locus_tag LOCUS_22580 gene gmk 5212 4586 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence146 95 1381 gene locus_tag LOCUS_22590 95 1381 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_22590 1381 2364 gene locus_tag LOCUS_22600 1381 2364 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_22600 2365 3696 gene locus_tag LOCUS_22610 gene miaB 2365 3696 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_22610 3693 4337 gene locus_tag LOCUS_22620 3693 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence147 1401 568 gene locus_tag LOCUS_22630 1401 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2313 1723 gene locus_tag LOCUS_22640 2313 1723 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_22640 2462 3334 gene locus_tag LOCUS_22650 2462 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_22650 3315 4100 gene locus_tag LOCUS_22660 3315 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4129 4770 gene locus_tag LOCUS_22670 gene thiE 4129 4770 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_22670 4767 5642 gene locus_tag LOCUS_22680 4767 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence148 612 1055 gene locus_tag LOCUS_22690 612 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2704 1604 gene locus_tag LOCUS_22700 gene cobT 2704 1604 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932626.1 protein_id gnl|my_center|LOCUS_22700 2894 5062 gene locus_tag LOCUS_22710 2894 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 <5785 5155 gene locus_tag LOCUS_22720 <5785 5155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence149 758 1546 gene locus_tag LOCUS_22730 758 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1543 2193 gene locus_tag LOCUS_22740 1543 2193 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 protein_id gnl|my_center|LOCUS_22740 2218 4449 gene locus_tag LOCUS_22750 gene priA 2218 4449 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_22750 4561 5460 gene locus_tag LOCUS_22760 4561 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence150 <1 800 gene locus_tag LOCUS_22770 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544964.1:Ni/Fe hydrogenase subunit alpha 954 790 gene locus_tag LOCUS_22780 954 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2366 1218 gene locus_tag LOCUS_22790 2366 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3258 2548 gene locus_tag LOCUS_22800 3258 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5324 3381 gene locus_tag LOCUS_22810 5324 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence151 1910 360 gene locus_tag LOCUS_22820 1910 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2622 2020 gene locus_tag LOCUS_22830 2622 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence152 179 451 gene locus_tag LOCUS_22840 179 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 448 2574 gene locus_tag LOCUS_22850 gene fusA 448 2574 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925413.1 protein_id gnl|my_center|LOCUS_22850 2684 2609 gene locus_tag LOCUS_t00400 2684 2609 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2844 5198 gene locus_tag LOCUS_22860 2844 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence153 509 799 gene locus_tag LOCUS_22870 509 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 786 1004 gene locus_tag LOCUS_22880 786 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1479 1339 gene locus_tag LOCUS_22890 1479 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2489 1503 gene locus_tag LOCUS_22900 2489 1503 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_22900 2890 2501 gene locus_tag LOCUS_22910 2890 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22910 3558 2842 gene locus_tag LOCUS_22920 3558 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22920 4328 3678 gene locus_tag LOCUS_22930 4328 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence154 729 1631 gene locus_tag LOCUS_22940 729 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2522 1962 gene locus_tag LOCUS_22950 2522 1962 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_22950 5190 2575 gene locus_tag LOCUS_22960 gene gyrA 5190 2575 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence155 1241 264 gene locus_tag LOCUS_22970 1241 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1728 1123 gene locus_tag LOCUS_22980 1728 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2103 1741 gene locus_tag LOCUS_22990 2103 1741 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_22990 3425 2133 gene locus_tag LOCUS_23000 3425 2133 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_23000 <5233 3825 gene locus_tag LOCUS_23010 <5233 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940711.1:molecular chaperone DnaK >Feature sequence156 2030 516 gene locus_tag LOCUS_23020 2030 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3498 2113 gene locus_tag LOCUS_23030 gene gspD 3498 2113 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358887.1 protein_id gnl|my_center|LOCUS_23030 3782 4795 gene locus_tag LOCUS_23040 3782 4795 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence157 1496 468 gene locus_tag LOCUS_23050 1496 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1776 1699 gene locus_tag LOCUS_t00410 1776 1699 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2850 1993 gene locus_tag LOCUS_23060 2850 1993 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_23060 3666 2911 gene locus_tag LOCUS_23070 3666 2911 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_23070 4139 3666 gene locus_tag LOCUS_23080 4139 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4801 4127 gene locus_tag LOCUS_23090 gene nadD 4801 4127 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144004.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence158 569 1018 gene locus_tag LOCUS_23100 569 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1036 1950 gene locus_tag LOCUS_23110 1036 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2634 3002 gene locus_tag LOCUS_23120 2634 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3033 4103 gene locus_tag LOCUS_23130 3033 4103 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence159 <1 2209 gene locus_tag LOCUS_23140 <1 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000904759.1:serine/threonine protein kinase PrkC 2708 3787 gene locus_tag LOCUS_23150 gene recF 2708 3787 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723768.1 protein_id gnl|my_center|LOCUS_23150 4588 3860 gene locus_tag LOCUS_23160 4588 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence160 147 1352 gene locus_tag LOCUS_23170 147 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1382 2368 gene locus_tag LOCUS_23180 1382 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4049 2730 gene locus_tag LOCUS_23190 4049 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence161 791 2998 gene locus_tag LOCUS_23200 791 2998 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_23200 2995 4320 gene locus_tag LOCUS_23210 gene mtaB 2995 4320 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence162 2 3928 gene locus_tag LOCUS_23220 2 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4199 4044 gene locus_tag LOCUS_23230 4199 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence163 599 366 gene locus_tag LOCUS_23240 599 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 513 920 gene locus_tag LOCUS_23250 513 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1378 980 gene locus_tag LOCUS_23260 1378 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1719 1381 gene locus_tag LOCUS_23270 1719 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2111 1794 gene locus_tag LOCUS_23280 gene trxA 2111 1794 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018943.1 protein_id gnl|my_center|LOCUS_23280 2463 3479 gene locus_tag LOCUS_23290 2463 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3476 4042 gene locus_tag LOCUS_23300 3476 4042 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023860.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence164 2660 504 gene locus_tag LOCUS_23310 2660 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence165 545 2128 gene locus_tag LOCUS_23320 545 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence166 1849 218 gene locus_tag LOCUS_23330 1849 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2292 1849 gene locus_tag LOCUS_23340 2292 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3530 2304 gene locus_tag LOCUS_23350 3530 2304 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084216.1 protein_id gnl|my_center|LOCUS_23350 <4638 3613 gene locus_tag LOCUS_23360 <4638 3613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942511.1:PhoH family protein >Feature sequence167 711 1703 gene locus_tag LOCUS_23370 711 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1961 3862 gene locus_tag LOCUS_23380 1961 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence168 1698 529 gene locus_tag LOCUS_23390 1698 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2045 1866 gene locus_tag LOCUS_23400 2045 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2044 3075 gene locus_tag LOCUS_23410 gene purM 2044 3075 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_23410 3857 3231 gene locus_tag LOCUS_23420 gene lexA 3857 3231 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence169 4244 150 gene locus_tag LOCUS_23430 4244 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence170 1011 478 gene locus_tag LOCUS_23440 1011 478 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_23440 1435 992 gene locus_tag LOCUS_23450 1435 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1906 1529 gene locus_tag LOCUS_23460 1906 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4213 2048 gene locus_tag LOCUS_23470 4213 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence171 418 1539 gene locus_tag LOCUS_23480 418 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1917 3137 gene locus_tag LOCUS_23490 gene dcm 1917 3137 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence172 101 325 gene locus_tag LOCUS_23500 101 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 481 837 gene locus_tag LOCUS_23510 gene folX 481 837 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072826.1 protein_id gnl|my_center|LOCUS_23510 968 2149 gene locus_tag LOCUS_23520 968 2149 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_23520 2161 3132 gene locus_tag LOCUS_23530 gene argF 2161 3132 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_23530 3125 3556 gene locus_tag LOCUS_23540 3125 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence173 1886 591 gene locus_tag LOCUS_23550 1886 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2193 1876 gene locus_tag LOCUS_23560 2193 1876 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940054.1 protein_id gnl|my_center|LOCUS_23560 2390 2911 gene locus_tag LOCUS_23570 2390 2911 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence174 215 81 gene locus_tag LOCUS_23580 215 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1349 771 gene locus_tag LOCUS_23590 1349 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 2170 1367 gene locus_tag LOCUS_23600 gene proC 2170 1367 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_23600 3469 2261 gene locus_tag LOCUS_23610 gene trpB 3469 2261 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence175 785 219 gene locus_tag LOCUS_23620 785 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2669 1530 gene locus_tag LOCUS_23630 2669 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence176 497 625 gene locus_tag LOCUS_23640 497 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 867 1691 gene locus_tag LOCUS_23650 867 1691 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 protein_id gnl|my_center|LOCUS_23650 1868 2452 gene locus_tag LOCUS_23660 1868 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2449 3492 gene locus_tag LOCUS_23670 gene lpxD 2449 3492 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence177 1738 2328 gene locus_tag LOCUS_23680 1738 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2601 2810 gene locus_tag LOCUS_23690 2601 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence178 1714 680 gene locus_tag LOCUS_23700 1714 680 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_23700 2346 1711 gene locus_tag LOCUS_23710 2346 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence179 909 229 gene locus_tag LOCUS_23720 909 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2259 1357 gene locus_tag LOCUS_23730 2259 1357 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence180 2060 15 gene locus_tag LOCUS_23740 2060 15 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_23740 2490 3176 gene locus_tag LOCUS_23750 2490 3176 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence181 2728 1250 gene locus_tag LOCUS_23760 2728 1250 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence182 1149 181 gene locus_tag LOCUS_23770 1149 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2987 1146 gene locus_tag LOCUS_23780 2987 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence183 168 1934 gene locus_tag LOCUS_23790 168 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1931 2797 gene locus_tag LOCUS_23800 1931 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2764 2928 gene locus_tag LOCUS_23810 2764 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence184 >Feature sequence185 131 322 gene locus_tag LOCUS_23820 131 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2482 788 gene locus_tag LOCUS_23830 2482 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence186 3 1217 gene locus_tag LOCUS_23840 3 1217 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_23840 1419 2180 gene locus_tag LOCUS_23850 1419 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2065 2457 gene locus_tag LOCUS_23860 2065 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence187 200 481 gene locus_tag LOCUS_23870 200 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1081 1950 gene locus_tag LOCUS_23880 gene hisG 1081 1950 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_23880 2015 2569 gene locus_tag LOCUS_23890 gene rfbC 2015 2569 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence188 >Feature sequence189 >Feature sequence190 357 1586 gene locus_tag LOCUS_23900 357 1586 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_23900 1730 2368 gene locus_tag LOCUS_23910 1730 2368 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence191 209 84 gene locus_tag LOCUS_23920 209 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2202 526 gene locus_tag LOCUS_23930 2202 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence192 <1 2184 gene locus_tag LOCUS_23940 <1 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048348.1:Na/Pi cotransporter family protein >Feature sequence193 750 127 gene locus_tag LOCUS_23950 750 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 >Feature sequence194 315 1412 gene locus_tag LOCUS_23960 315 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1486 2082 gene locus_tag LOCUS_23970 1486 2082 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948229.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence195 784 227 gene locus_tag LOCUS_23980 gene pal 784 227 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720848.1 protein_id gnl|my_center|LOCUS_23980 905 1915 gene locus_tag LOCUS_23990 905 1915 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_23990