>Feature sequence001 43 2739 gene locus_tag LOCUS_0010 43 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 2919 4106 gene locus_tag LOCUS_0020 2919 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 protein_id gnl|my_center|LOCUS_0020 4116 4655 gene locus_tag LOCUS_0030 4116 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4671 5615 gene locus_tag LOCUS_0040 4671 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 5626 5868 gene locus_tag LOCUS_0050 5626 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 5943 6374 gene locus_tag LOCUS_0060 5943 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 6374 6865 gene locus_tag LOCUS_0070 6374 6865 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_0070 6869 7348 gene locus_tag LOCUS_0080 6869 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 7358 7588 gene locus_tag LOCUS_0090 7358 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 7604 8524 gene locus_tag LOCUS_0100 7604 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 8593 9228 gene locus_tag LOCUS_0110 8593 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 >Feature sequence002 62 823 gene locus_tag LOCUS_0120 62 823 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_0120 820 2307 gene locus_tag LOCUS_0130 gene glpK 820 2307 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_0130 2474 3925 gene locus_tag LOCUS_0140 2474 3925 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_0140 3922 5169 gene locus_tag LOCUS_0150 3922 5169 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582449.1 protein_id gnl|my_center|LOCUS_0150 5166 5552 gene locus_tag LOCUS_0160 5166 5552 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_0160 5536 6600 gene locus_tag LOCUS_0170 gene corA 5536 6600 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_0170 >Feature sequence003 131 817 gene locus_tag LOCUS_0180 131 817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_0180 853 2115 gene locus_tag LOCUS_0190 853 2115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_0190 2125 3381 gene locus_tag LOCUS_0200 2125 3381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_0200 3405 4133 gene locus_tag LOCUS_0210 3405 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 4134 5243 gene locus_tag LOCUS_0220 4134 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 5546 6316 gene locus_tag LOCUS_0230 gene trpA 5546 6316 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_0230 6313 7092 gene locus_tag LOCUS_0240 6313 7092 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_0240 >Feature sequence004 1293 1442 gene locus_tag LOCUS_0250 1293 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 1729 3264 gene locus_tag LOCUS_0260 gene guaA 1729 3264 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_0260 3319 5235 gene locus_tag LOCUS_0270 3319 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 5331 6824 gene locus_tag LOCUS_0280 gene hydG 5331 6824 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546878.1 protein_id gnl|my_center|LOCUS_0280 6802 7098 gene locus_tag LOCUS_0290 6802 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 >Feature sequence005 473 282 gene locus_tag LOCUS_0300 473 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 1255 491 gene locus_tag LOCUS_0310 1255 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 1771 2394 gene locus_tag LOCUS_0320 1771 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 2391 2780 gene locus_tag LOCUS_0330 2391 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 2791 3084 gene locus_tag LOCUS_0340 2791 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 3175 5133 gene locus_tag LOCUS_0350 3175 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 5153 6106 gene locus_tag LOCUS_0360 5153 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 6117 6317 gene locus_tag LOCUS_0370 6117 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 6421 6825 gene locus_tag LOCUS_0380 6421 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 >Feature sequence006 92 775 gene locus_tag LOCUS_0390 92 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 776 1384 gene locus_tag LOCUS_0400 776 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 1399 2817 gene locus_tag LOCUS_0410 gene dnaB 1399 2817 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_0410 2884 3645 gene locus_tag LOCUS_0420 2884 3645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_0420 3653 4450 gene locus_tag LOCUS_0430 3653 4450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_0430 4494 5405 gene locus_tag LOCUS_0440 4494 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 5506 6603 gene locus_tag LOCUS_0450 5506 6603 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947153.1 protein_id gnl|my_center|LOCUS_0450 >Feature sequence007 3367 4788 gene locus_tag LOCUS_0460 gene bioA 3367 4788 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_0460 4785 5972 gene locus_tag LOCUS_0470 gene bioF 4785 5972 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693580.1 protein_id gnl|my_center|LOCUS_0470 >Feature sequence008 2 3124 gene locus_tag LOCUS_0480 gene rpoB 2 3124 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_0480 >Feature sequence009 47 421 gene locus_tag LOCUS_0490 gene rpsL 47 421 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583340.1 protein_id gnl|my_center|LOCUS_0490 434 907 gene locus_tag LOCUS_0500 gene rpsG 434 907 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_0500 920 3007 gene locus_tag LOCUS_0510 gene fusA 920 3007 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_0510 3042 4226 gene locus_tag LOCUS_0520 gene tuf 3042 4226 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_0520 4238 4540 gene locus_tag LOCUS_0530 gene rpsJ 4238 4540 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557068.1 protein_id gnl|my_center|LOCUS_0530 4672 5274 gene locus_tag LOCUS_0540 gene rplC 4672 5274 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_0540 5278 5907 gene locus_tag LOCUS_0550 gene rplD 5278 5907 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093737.1 protein_id gnl|my_center|LOCUS_0550 >Feature sequence010 66 4343 gene locus_tag LOCUS_0560 66 4343 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_0560 4493 5380 gene locus_tag LOCUS_0570 gene nadC 4493 5380 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_0570 >Feature sequence011 >Feature sequence012 2983 1787 gene locus_tag LOCUS_0580 2983 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 4104 3280 gene locus_tag LOCUS_0590 4104 3280 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119048.1 protein_id gnl|my_center|LOCUS_0590 4829 4176 gene locus_tag LOCUS_0600 gene thiE 4829 4176 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939635.1 protein_id gnl|my_center|LOCUS_0600 5616 4816 gene locus_tag LOCUS_0610 gene thiM 5616 4816 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_0610 >Feature sequence013 140 388 gene locus_tag LOCUS_0620 140 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0620 538 2283 gene locus_tag LOCUS_0630 538 2283 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_0630 2985 2335 gene locus_tag LOCUS_0640 2985 2335 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_0640 5498 2988 gene locus_tag LOCUS_0650 5498 2988 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_0650 >Feature sequence014 130 3492 gene locus_tag LOCUS_0660 gene recB 130 3492 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261335.1 protein_id gnl|my_center|LOCUS_0660 3489 5279 gene locus_tag LOCUS_0670 gene recD 3489 5279 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_0670 >Feature sequence015 152 349 gene locus_tag LOCUS_0680 152 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 353 580 gene locus_tag LOCUS_0690 353 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 1469 828 gene locus_tag LOCUS_0700 1469 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 2970 1498 gene locus_tag LOCUS_0710 gene gcvPB 2970 1498 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_0710 4274 2967 gene locus_tag LOCUS_0720 gene gcvPA 4274 2967 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_0720 4649 4275 gene locus_tag LOCUS_0730 gene gcvH 4649 4275 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941044.1 protein_id gnl|my_center|LOCUS_0730 <5646 4789 gene locus_tag LOCUS_0740 <5646 4789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941043.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence016 <1 1888 gene locus_tag LOCUS_0750 <1 1888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674848.1:ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent 1911 2540 gene locus_tag LOCUS_0760 1911 2540 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_0760 2518 3180 gene locus_tag LOCUS_0770 2518 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 3184 5166 gene locus_tag LOCUS_0780 3184 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 >Feature sequence017 <1 1122 gene locus_tag LOCUS_0790 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015955.1:YibE/F family protein 1122 2387 gene locus_tag LOCUS_0800 1122 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_0800 <5378 2398 gene locus_tag LOCUS_0810 <5378 2398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583743.1:DNA polymerase III subunit alpha >Feature sequence018 149 1204 gene locus_tag LOCUS_0820 149 1204 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_0820 1624 2037 gene locus_tag LOCUS_0830 1624 2037 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_0830 2100 3674 gene locus_tag LOCUS_0840 2100 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 4875 3634 gene locus_tag LOCUS_0850 gene mtaB 4875 3634 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_0850 >Feature sequence019 <1 1167 gene locus_tag LOCUS_0860 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545264.1:homoserine dehydrogenase 2100 1732 gene locus_tag LOCUS_0870 gene rplQ 2100 1732 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_0870 3113 2103 gene locus_tag LOCUS_0880 3113 2103 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054108.1 protein_id gnl|my_center|LOCUS_0880 3550 3152 gene locus_tag LOCUS_0890 gene rpsK 3550 3152 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_0890 3931 3566 gene locus_tag LOCUS_0900 gene rpsM 3931 3566 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081785.1 protein_id gnl|my_center|LOCUS_0900 4301 4083 gene locus_tag LOCUS_0910 gene infA 4301 4083 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_0910 4945 4301 gene locus_tag LOCUS_0920 4945 4301 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_0920 >Feature sequence020 <1 815 gene locus_tag LOCUS_0930 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256420.1:alpha-amylase family glycosyl hydrolase 4613 924 gene locus_tag LOCUS_0940 4613 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 >Feature sequence021 1221 376 gene locus_tag LOCUS_0950 gene galU 1221 376 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721336.1 protein_id gnl|my_center|LOCUS_0950 2247 1225 gene locus_tag LOCUS_0960 gene prfB 2247 1225 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_0960 3803 2328 gene locus_tag LOCUS_0970 gene gltX 3803 2328 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081547.1 protein_id gnl|my_center|LOCUS_0970 <5057 4327 gene locus_tag LOCUS_0980 <5057 4327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942479.1:type I glutamate--ammonia ligase >Feature sequence022 <1 948 gene locus_tag LOCUS_0990 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250797.1:MoxR family ATPase 945 2255 gene locus_tag LOCUS_1000 945 2255 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_1000 3437 2265 gene locus_tag LOCUS_1010 3437 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 4505 3468 gene locus_tag LOCUS_1020 4505 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 4892 4527 gene locus_tag LOCUS_1030 4892 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 >Feature sequence023 3119 1338 gene locus_tag LOCUS_1040 3119 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 3510 4313 gene locus_tag LOCUS_1050 3510 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 >Feature sequence024 321 2312 gene locus_tag LOCUS_1060 321 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 2397 2813 gene locus_tag LOCUS_1070 2397 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 2817 3656 gene locus_tag LOCUS_1080 2817 3656 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868801.1 protein_id gnl|my_center|LOCUS_1080 4923 3904 gene locus_tag LOCUS_1090 4923 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 >Feature sequence025 85 1248 gene locus_tag LOCUS_1100 85 1248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889816.1 protein_id gnl|my_center|LOCUS_1100 3062 1245 gene locus_tag LOCUS_1110 3062 1245 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_1110 4052 3066 gene locus_tag LOCUS_1120 4052 3066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_1120 4720 4067 gene locus_tag LOCUS_1130 4720 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 >Feature sequence026 26 2200 gene locus_tag LOCUS_1140 gene feoB 26 2200 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943880.1 protein_id gnl|my_center|LOCUS_1140 2922 4352 gene locus_tag LOCUS_1150 gene mgtE 2922 4352 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_1150 >Feature sequence027 50 1375 gene locus_tag LOCUS_1160 50 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 1372 1749 gene locus_tag LOCUS_1170 1372 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 1751 2389 gene locus_tag LOCUS_1180 gene hisG 1751 2389 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_1180 2370 2804 gene locus_tag LOCUS_1190 2370 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 2857 3873 gene locus_tag LOCUS_1200 gene tsaD 2857 3873 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_1200 >Feature sequence028 276 2885 gene locus_tag LOCUS_1210 gene alaS 276 2885 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880825.1 protein_id gnl|my_center|LOCUS_1210 3279 3575 gene locus_tag LOCUS_1220 3279 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 3572 4474 gene locus_tag LOCUS_1230 3572 4474 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_1230 >Feature sequence029 <1 950 gene locus_tag LOCUS_1240 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479753.1:phosphate ABC transporter substrate-binding protein PstS 1043 2362 gene locus_tag LOCUS_1250 1043 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 2359 3258 gene locus_tag LOCUS_1260 gene pstA 2359 3258 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_1260 3240 3998 gene locus_tag LOCUS_1270 gene pstB 3240 3998 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582862.1 protein_id gnl|my_center|LOCUS_1270 4047 4709 gene locus_tag LOCUS_1280 gene phoU 4047 4709 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880553.1 protein_id gnl|my_center|LOCUS_1280 >Feature sequence030 1091 108 gene locus_tag LOCUS_1290 1091 108 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_1290 2143 1115 gene locus_tag LOCUS_1300 gene plsX 2143 1115 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_1300 2351 2157 gene locus_tag LOCUS_1310 gene rpmF 2351 2157 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_1310 <4777 2476 gene locus_tag LOCUS_1320 <4777 2476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860925.1:phenylalanine--tRNA ligase subunit beta >Feature sequence031 1325 366 gene locus_tag LOCUS_1330 1325 366 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_1330 1517 2299 gene locus_tag LOCUS_1340 gene hisF 1517 2299 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_1340 2299 3222 gene locus_tag LOCUS_1350 2299 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 3315 3614 gene locus_tag LOCUS_1360 gene spoIIAA 3315 3614 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_1360 3617 3958 gene locus_tag LOCUS_1370 3617 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 >Feature sequence032 <1 3639 gene locus_tag LOCUS_1380 <1 3639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202408.1:MG2 domain-containing protein >Feature sequence033 199 1419 gene locus_tag LOCUS_1390 199 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 1419 2567 gene locus_tag LOCUS_1400 1419 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 2644 3372 gene locus_tag LOCUS_1410 2644 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 3374 4543 gene locus_tag LOCUS_1420 3374 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 >Feature sequence034 113 1336 gene locus_tag LOCUS_1430 113 1336 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_1430 2419 1412 gene locus_tag LOCUS_1440 2419 1412 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_1440 2567 3376 gene locus_tag LOCUS_1450 2567 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 3785 3378 gene locus_tag LOCUS_1460 gene hslR 3785 3378 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 protein_id gnl|my_center|LOCUS_1460 >Feature sequence035 99 836 gene locus_tag LOCUS_1470 99 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 2626 902 gene locus_tag LOCUS_1480 2626 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 3202 4425 gene locus_tag LOCUS_1490 3202 4425 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_1490 >Feature sequence036 405 1943 gene locus_tag LOCUS_1500 405 1943 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_1500 >Feature sequence037 <1 1526 gene locus_tag LOCUS_1510 <1 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920602.1:FlgD immunoglobulin-like domain containing protein 1528 1686 gene locus_tag LOCUS_1520 1528 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 1885 1676 gene locus_tag LOCUS_1530 1885 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 2040 1963 gene locus_tag LOCUS_t0010 2040 1963 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4325 2313 gene locus_tag LOCUS_1540 4325 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 >Feature sequence038 1548 3530 gene locus_tag LOCUS_1550 1548 3530 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971495.1 protein_id gnl|my_center|LOCUS_1550 <4438 3545 gene locus_tag LOCUS_1560 <4438 3545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927141.1:PAS domain-containing protein >Feature sequence039 475 870 gene locus_tag LOCUS_1570 475 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_1570 880 2667 gene locus_tag LOCUS_1580 gene nuoF 880 2667 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_1580 >Feature sequence040 3834 577 gene locus_tag LOCUS_1590 3834 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 >Feature sequence041 3440 15 gene locus_tag LOCUS_1600 3440 15 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_1600 3973 3566 gene locus_tag LOCUS_1610 3973 3566 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_1610 >Feature sequence042 1308 124 gene locus_tag LOCUS_1620 gene ftsZ 1308 124 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_1620 2584 1349 gene locus_tag LOCUS_1630 gene ftsA 2584 1349 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_1630 3281 2604 gene locus_tag LOCUS_1640 3281 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 4237 3305 gene locus_tag LOCUS_1650 4237 3305 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_1650 >Feature sequence043 1019 555 gene locus_tag LOCUS_1660 1019 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 1624 1022 gene locus_tag LOCUS_1670 gene ruvA 1624 1022 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_1670 3717 1624 gene locus_tag LOCUS_1680 3717 1624 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926967.1 protein_id gnl|my_center|LOCUS_1680 >Feature sequence044 2518 995 gene locus_tag LOCUS_1690 2518 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 >Feature sequence045 2 187 gene locus_tag LOCUS_1700 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 197 1402 gene locus_tag LOCUS_1710 197 1402 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103068.1 protein_id gnl|my_center|LOCUS_1710 1408 2667 gene locus_tag LOCUS_1720 1408 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 3855 2770 gene locus_tag LOCUS_1730 3855 2770 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_1730 4217 3858 gene locus_tag LOCUS_1740 4217 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 >Feature sequence046 34 3255 gene locus_tag LOCUS_1750 gene treS 34 3255 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942997.1 protein_id gnl|my_center|LOCUS_1750 >Feature sequence047 906 280 gene locus_tag LOCUS_1760 906 280 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_1760 2963 1032 gene locus_tag LOCUS_1770 2963 1032 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_1770 4047 3046 gene locus_tag LOCUS_1780 4047 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 >Feature sequence048 2550 646 gene locus_tag LOCUS_1790 2550 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 3462 2641 gene locus_tag LOCUS_1800 3462 2641 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_1800 3684 3553 gene locus_tag LOCUS_1810 3684 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 4100 3840 gene locus_tag LOCUS_1820 4100 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 >Feature sequence049 2181 817 gene locus_tag LOCUS_1830 gene mnmE 2181 817 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_1830 4046 2346 gene locus_tag LOCUS_1840 gene yidC 4046 2346 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021785.1 protein_id gnl|my_center|LOCUS_1840 >Feature sequence050 736 296 gene locus_tag LOCUS_1850 736 296 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_1850 878 678 gene locus_tag LOCUS_1860 878 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 1142 1399 gene locus_tag LOCUS_1870 gene rpsP 1142 1399 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557282.1 protein_id gnl|my_center|LOCUS_1870 1412 1915 gene locus_tag LOCUS_1880 gene rimM 1412 1915 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583885.1 protein_id gnl|my_center|LOCUS_1880 1928 2737 gene locus_tag LOCUS_1890 gene trmD 1928 2737 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_1890 2718 3248 gene locus_tag LOCUS_1900 2718 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 3248 3907 gene locus_tag LOCUS_1910 3248 3907 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 protein_id gnl|my_center|LOCUS_1910 3858 4070 gene locus_tag LOCUS_1920 3858 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 >Feature sequence051 10 933 gene locus_tag LOCUS_1930 gene argF 10 933 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_1930 933 2303 gene locus_tag LOCUS_1940 933 2303 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037386.1 protein_id gnl|my_center|LOCUS_1940 2296 2928 gene locus_tag LOCUS_1950 2296 2928 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987042.1 protein_id gnl|my_center|LOCUS_1950 3539 2940 gene locus_tag LOCUS_1960 3539 2940 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_1960 <4078 3536 gene locus_tag LOCUS_1970 <4078 3536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546604.1:sigma-54 dependent transcriptional regulator >Feature sequence052 1221 202 gene locus_tag LOCUS_1980 1221 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 3108 1384 gene locus_tag LOCUS_1990 3108 1384 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965008.1 protein_id gnl|my_center|LOCUS_1990 3788 3105 gene locus_tag LOCUS_2000 3788 3105 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_2000 >Feature sequence053 <1 1630 gene locus_tag LOCUS_2010 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965141.1:DNA mismatch repair endonuclease MutL 1855 2559 gene locus_tag LOCUS_2020 1855 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 2671 3825 gene locus_tag LOCUS_2030 2671 3825 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_2030 >Feature sequence054 616 38 gene locus_tag LOCUS_2040 616 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 914 594 gene locus_tag LOCUS_2050 914 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 2260 926 gene locus_tag LOCUS_2060 gene accC 2260 926 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_2060 2699 2277 gene locus_tag LOCUS_2070 gene accB 2699 2277 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141286.1 protein_id gnl|my_center|LOCUS_2070 3274 2714 gene locus_tag LOCUS_2080 gene efp 3274 2714 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_2080 <4025 3346 gene locus_tag LOCUS_2090 <4025 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583399.1:Xaa-Pro peptidase family protein >Feature sequence055 <1 669 gene locus_tag LOCUS_2100 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020082.1:zinc ABC transporter substrate-binding protein 659 1390 gene locus_tag LOCUS_2110 659 1390 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584029.1 protein_id gnl|my_center|LOCUS_2110 2503 1529 gene locus_tag LOCUS_2120 2503 1529 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_2120 >Feature sequence056 >Feature sequence057 1127 12 gene locus_tag LOCUS_2130 gene dnaJ 1127 12 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_2130 3193 1286 gene locus_tag LOCUS_2140 gene dnaK 3193 1286 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031822.1 protein_id gnl|my_center|LOCUS_2140 3790 3206 gene locus_tag LOCUS_2150 3790 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 >Feature sequence058 213 383 gene locus_tag LOCUS_2160 213 383 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_2160 >Feature sequence059 2280 508 gene locus_tag LOCUS_2170 2280 508 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_2170 2873 2283 gene locus_tag LOCUS_2180 2873 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 3205 2900 gene locus_tag LOCUS_2190 3205 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 3696 3211 gene locus_tag LOCUS_2200 3696 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 >Feature sequence060 <1 2909 gene locus_tag LOCUS_2210 <1 2909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061214.1:excinuclease ABC subunit UvrA >Feature sequence061 <1 2730 gene locus_tag LOCUS_2220 <1 2730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880625.1:exonuclease subunit SbcC 2857 3555 gene locus_tag LOCUS_2230 2857 3555 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_2230 >Feature sequence062 389 60 gene locus_tag LOCUS_2240 gene fliE 389 60 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405186.1 protein_id gnl|my_center|LOCUS_2240 938 483 gene locus_tag LOCUS_2250 gene flgC 938 483 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657104.1 protein_id gnl|my_center|LOCUS_2250 1413 991 gene locus_tag LOCUS_2260 gene flgB 1413 991 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462091.1 protein_id gnl|my_center|LOCUS_2260 3861 1528 gene locus_tag LOCUS_2270 3861 1528 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_2270 >Feature sequence063 <1 759 gene locus_tag LOCUS_2280 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256600.1:alpha-amylase family glycosyl hydrolase 908 1465 gene locus_tag LOCUS_2290 908 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 1462 2172 gene locus_tag LOCUS_2300 1462 2172 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_2300 >Feature sequence064 1366 1019 gene locus_tag LOCUS_2310 1366 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 1566 1363 gene locus_tag LOCUS_2320 1566 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 >Feature sequence065 280 567 gene locus_tag LOCUS_2330 280 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 568 1905 gene locus_tag LOCUS_2340 gene radA 568 1905 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_2340 3011 1920 gene locus_tag LOCUS_2350 gene murG 3011 1920 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_2350 >Feature sequence066 195 2528 gene locus_tag LOCUS_2360 195 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 2714 2926 gene locus_tag LOCUS_2370 2714 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2370 2914 3810 gene locus_tag LOCUS_2380 gene ychF 2914 3810 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2380 >Feature sequence067 199 2667 gene locus_tag LOCUS_2390 gene bamA 199 2667 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_2390 2746 3291 gene locus_tag LOCUS_2400 2746 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 >Feature sequence068 2487 235 gene locus_tag LOCUS_2410 2487 235 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_2410 2879 3277 gene locus_tag LOCUS_2420 2879 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 3278 >3751 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagttactaggactcaggttatttgatt >Feature sequence069 1707 352 gene locus_tag LOCUS_2430 1707 352 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545858.1 protein_id gnl|my_center|LOCUS_2430 2130 1792 gene locus_tag LOCUS_2440 2130 1792 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_2440 <3720 2179 gene locus_tag LOCUS_2450 <3720 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005896598.1:PP2C family protein-serine/threonine phosphatase >Feature sequence070 984 427 gene locus_tag LOCUS_2460 984 427 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146506.1 protein_id gnl|my_center|LOCUS_2460 1676 981 gene locus_tag LOCUS_2470 gene queC 1676 981 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_2470 2008 1676 gene locus_tag LOCUS_2480 2008 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 2488 2330 gene locus_tag LOCUS_2490 gene rpmH 2488 2330 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_2490 2592 2518 gene locus_tag LOCUS_t0020 2592 2518 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 <3699 2722 gene locus_tag LOCUS_2500 <3699 2722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545272.1:ABC transporter permease >Feature sequence071 79 2193 gene locus_tag LOCUS_2510 79 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 <3672 2618 gene locus_tag LOCUS_2520 <3672 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001276589.1:LptF/LptG family permease >Feature sequence072 <3651 84 gene locus_tag LOCUS_2530 <3651 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein >Feature sequence073 <1 855 gene locus_tag LOCUS_2540 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867684.1:RtcB family protein 2406 1234 gene locus_tag LOCUS_2550 2406 1234 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_2550 >Feature sequence074 <1 798 gene locus_tag LOCUS_2560 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920781.1:ABC transporter ATP-binding protein 770 1375 gene locus_tag LOCUS_2570 770 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 1362 1895 gene locus_tag LOCUS_2580 1362 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 1907 2182 gene locus_tag LOCUS_2590 1907 2182 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_2590 3042 2179 gene locus_tag LOCUS_2600 gene lipA 3042 2179 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_2600 >Feature sequence075 <1 2644 gene locus_tag LOCUS_2610 <1 2644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081557.1:isoleucine--tRNA ligase 2662 3183 gene locus_tag LOCUS_2620 2662 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 >Feature sequence076 1148 327 gene locus_tag LOCUS_2630 1148 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 3243 1174 gene locus_tag LOCUS_2640 3243 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 >Feature sequence077 962 258 gene locus_tag LOCUS_2650 962 258 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_2650 2081 966 gene locus_tag LOCUS_2660 gene hisC 2081 966 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_2660 2767 2066 gene locus_tag LOCUS_2670 gene purQ 2767 2066 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_2670 3161 2886 gene locus_tag LOCUS_2680 3161 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 3517 3164 gene locus_tag LOCUS_2690 3517 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 >Feature sequence078 30 1550 gene locus_tag LOCUS_2700 30 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 2504 2067 gene locus_tag LOCUS_2710 2504 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 2844 2506 gene locus_tag LOCUS_2720 2844 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 3534 3058 gene locus_tag LOCUS_2730 3534 3058 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_2730 >Feature sequence079 148 1404 gene locus_tag LOCUS_2740 148 1404 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_2740 1431 2651 gene locus_tag LOCUS_2750 1431 2651 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103068.1 protein_id gnl|my_center|LOCUS_2750 >Feature sequence080 55 1479 gene locus_tag LOCUS_2760 55 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 1472 1912 gene locus_tag LOCUS_2770 gene tsaE 1472 1912 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_2770 1905 2801 gene locus_tag LOCUS_2780 gene mtnP 1905 2801 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_2780 >Feature sequence081 2366 1146 gene locus_tag LOCUS_2790 2366 1146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_2790 3400 2381 gene locus_tag LOCUS_2800 3400 2381 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572362.1 protein_id gnl|my_center|LOCUS_2800 >Feature sequence082 >Feature sequence083 815 48 gene locus_tag LOCUS_2810 815 48 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_2810 1996 815 gene locus_tag LOCUS_2820 1996 815 CDS product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232391.1 protein_id gnl|my_center|LOCUS_2820 3250 2015 gene locus_tag LOCUS_2830 3250 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 >Feature sequence084 <1 1406 gene locus_tag LOCUS_2840 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048136.1:threonine--tRNA ligase 1503 2003 gene locus_tag LOCUS_2850 gene infC 1503 2003 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_2850 2050 2247 gene locus_tag LOCUS_2860 gene rpmI 2050 2247 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_2860 2263 2616 gene locus_tag LOCUS_2870 gene rplT 2263 2616 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_2870 2616 3458 gene locus_tag LOCUS_2880 2616 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 >Feature sequence085 74 1672 gene locus_tag LOCUS_2890 74 1672 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_2890 1672 1884 gene locus_tag LOCUS_2900 1672 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 2004 3353 gene locus_tag LOCUS_2910 2004 3353 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_2910 >Feature sequence086 252 911 gene locus_tag LOCUS_2920 252 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 968 1885 gene locus_tag LOCUS_2930 gene nadA 968 1885 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_2930 1906 2058 gene locus_tag LOCUS_2940 1906 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 2065 2739 gene locus_tag LOCUS_2950 2065 2739 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_2950 >Feature sequence087 679 3174 gene locus_tag LOCUS_2960 gene gyrA 679 3174 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_2960 >Feature sequence088 2128 1355 gene locus_tag LOCUS_2970 2128 1355 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679546.1 protein_id gnl|my_center|LOCUS_2970 <3520 2153 gene locus_tag LOCUS_2980 <3520 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein note possible pseudo, internal stop codon >Feature sequence089 215 1099 gene locus_tag LOCUS_2990 215 1099 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_2990 1121 2917 gene locus_tag LOCUS_3000 1121 2917 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_3000 >Feature sequence090 878 237 gene locus_tag LOCUS_3010 878 237 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_3010 1095 1694 gene locus_tag LOCUS_3020 1095 1694 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_3020 1798 2424 gene locus_tag LOCUS_3030 gene tmk 1798 2424 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_3030 3108 2431 gene locus_tag LOCUS_3040 3108 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 >Feature sequence091 >Feature sequence092 444 2411 gene locus_tag LOCUS_3050 gene gyrB 444 2411 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583896.1 protein_id gnl|my_center|LOCUS_3050 3248 2445 gene locus_tag LOCUS_3060 3248 2445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_3060 >Feature sequence093 710 2248 gene locus_tag LOCUS_3070 710 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 2251 3141 gene locus_tag LOCUS_3080 2251 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 >Feature sequence094 1292 954 gene locus_tag LOCUS_3090 gene glnK 1292 954 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_3090 <3447 1560 gene locus_tag LOCUS_3100 <3447 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence095 132 545 gene locus_tag LOCUS_3110 gene queF 132 545 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_3110 535 1350 gene locus_tag LOCUS_3120 535 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 1511 2836 gene locus_tag LOCUS_3130 1511 2836 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_3130 >Feature sequence096 1298 1633 gene locus_tag LOCUS_3140 1298 1633 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_3140 1646 2419 gene locus_tag LOCUS_3150 gene truA 1646 2419 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_3150 <3422 2392 gene locus_tag LOCUS_3160 <3422 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:MASE3 domain-containing protein >Feature sequence097 1497 40 gene locus_tag LOCUS_3170 1497 40 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964981.1 protein_id gnl|my_center|LOCUS_3170 <3418 1490 gene locus_tag LOCUS_3180 <3418 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000227769.1:glutamate synthase large subunit >Feature sequence098 1070 732 gene locus_tag LOCUS_3190 1070 732 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_3190 2360 1083 gene locus_tag LOCUS_3200 2360 1083 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_3200 >Feature sequence099 1990 524 gene locus_tag LOCUS_3210 1990 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 3320 1920 gene locus_tag LOCUS_3220 3320 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 >Feature sequence100 3253 1007 gene locus_tag LOCUS_3230 gene recJ 3253 1007 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_3230 >Feature sequence101 <1 1081 gene locus_tag LOCUS_3240 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378421.1:UvrD-helicase domain-containing protein 3365 1110 gene locus_tag LOCUS_3250 3365 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 >Feature sequence102 165 1520 gene locus_tag LOCUS_3260 165 1520 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_3260 1666 2721 gene locus_tag LOCUS_3270 1666 2721 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_3270 >Feature sequence103 20 1390 gene locus_tag LOCUS_3280 gene lpdA 20 1390 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258694.1 protein_id gnl|my_center|LOCUS_3280 2712 1396 gene locus_tag LOCUS_3290 2712 1396 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_3290 <3391 2699 gene locus_tag LOCUS_3300 <3391 2699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022450.1:tRNA pseudouridine(55) synthase TruB >Feature sequence104 1878 940 gene locus_tag LOCUS_3310 gene murB 1878 940 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_3310 3277 1952 gene locus_tag LOCUS_3320 3277 1952 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_3320 >Feature sequence105 429 208 gene locus_tag LOCUS_3330 429 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 1799 438 gene locus_tag LOCUS_3340 1799 438 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670692.1 protein_id gnl|my_center|LOCUS_3340 3380 1842 gene locus_tag LOCUS_3350 3380 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 >Feature sequence106 894 1577 gene locus_tag LOCUS_3360 894 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 1872 1621 gene locus_tag LOCUS_3370 1872 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 2771 2424 gene locus_tag LOCUS_3380 2771 2424 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_3380 <3379 2781 gene locus_tag LOCUS_3390 <3379 2781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920960.1:ammonium transporter >Feature sequence107 3072 1618 gene locus_tag LOCUS_3400 3072 1618 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_3400 >Feature sequence108 1260 403 gene locus_tag LOCUS_3410 gene purU 1260 403 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_3410 2407 1379 gene locus_tag LOCUS_3420 2407 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 >Feature sequence109 1384 602 gene locus_tag LOCUS_3430 gene dapB 1384 602 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_3430 1537 3006 gene locus_tag LOCUS_3440 1537 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_3440 >Feature sequence110 1327 767 gene locus_tag LOCUS_3450 1327 767 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_3450 2015 1422 gene locus_tag LOCUS_3460 2015 1422 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_3460 2702 2064 gene locus_tag LOCUS_3470 2702 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 >Feature sequence111 200 1159 gene locus_tag LOCUS_3480 200 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 1622 2674 gene locus_tag LOCUS_3490 gene idsA 1622 2674 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_3490 >Feature sequence112 <1 692 gene locus_tag LOCUS_3500 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681055.1:undecaprenyl-diphosphatase UppP 713 3190 gene locus_tag LOCUS_3510 713 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 >Feature sequence113 26 676 gene locus_tag LOCUS_3520 26 676 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_3520 1021 731 gene locus_tag LOCUS_3530 1021 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 1567 1049 gene locus_tag LOCUS_3540 1567 1049 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_3540 3081 1588 gene locus_tag LOCUS_3550 gene glgA 3081 1588 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_3550 >Feature sequence114 293 1318 gene locus_tag LOCUS_3560 gene aroF 293 1318 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_3560 1315 2163 gene locus_tag LOCUS_3570 1315 2163 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_3570 2160 2813 gene locus_tag LOCUS_3580 gene cmk 2160 2813 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_3580 2833 3204 gene locus_tag LOCUS_3590 2833 3204 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_3590 >Feature sequence115 1490 1251 gene locus_tag LOCUS_3600 1490 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 2253 1645 gene locus_tag LOCUS_3610 2253 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 3095 2265 gene locus_tag LOCUS_3620 3095 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 >Feature sequence116 36 1787 gene locus_tag LOCUS_3630 36 1787 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_3630 2120 2422 gene locus_tag LOCUS_3640 2120 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 2438 2902 gene locus_tag LOCUS_3650 gene smpB 2438 2902 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289013.1 protein_id gnl|my_center|LOCUS_3650 >Feature sequence117 578 6 gene locus_tag LOCUS_3660 578 6 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141641.1 protein_id gnl|my_center|LOCUS_3660 807 880 gene locus_tag LOCUS_t0030 807 880 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2467 923 gene locus_tag LOCUS_3670 2467 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 3100 2480 gene locus_tag LOCUS_3680 3100 2480 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_3680 >Feature sequence118 264 806 gene locus_tag LOCUS_3690 264 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 893 1954 gene locus_tag LOCUS_3700 gene fliM 893 1954 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_3700 2047 3126 gene locus_tag LOCUS_3710 gene fliN 2047 3126 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503780.1 protein_id gnl|my_center|LOCUS_3710 >Feature sequence119 162 968 gene locus_tag LOCUS_3720 162 968 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_3720 2336 1254 gene locus_tag LOCUS_3730 2336 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 2945 2400 gene locus_tag LOCUS_3740 2945 2400 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_3740 >Feature sequence120 <1 1088 gene locus_tag LOCUS_3750 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000192966.1:TOMM precursor leader peptide-binding protein 1118 1954 gene locus_tag LOCUS_3760 1118 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 >Feature sequence121 274 38 gene locus_tag LOCUS_3770 274 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 885 280 gene locus_tag LOCUS_3780 885 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 1243 851 gene locus_tag LOCUS_3790 1243 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 2243 1233 gene locus_tag LOCUS_3800 gene lpxD 2243 1233 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_3800 2823 3065 gene locus_tag LOCUS_3810 2823 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 >Feature sequence122 1788 271 gene locus_tag LOCUS_3820 gene terL 1788 271 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_3820 2256 1789 gene locus_tag LOCUS_3830 2256 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 2876 2256 gene locus_tag LOCUS_3840 2876 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 >Feature sequence123 <1 590 gene locus_tag LOCUS_3850 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141278.1:ATP-dependent DNA helicase RecG 2059 662 gene locus_tag LOCUS_3860 2059 662 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_3860 2527 2075 gene locus_tag LOCUS_3870 2527 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 >Feature sequence124 2836 1160 gene locus_tag LOCUS_3880 2836 1160 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_3880 >Feature sequence125 133 738 gene locus_tag LOCUS_3890 gene thiE 133 738 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_3890 850 2187 gene locus_tag LOCUS_3900 850 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 2993 2748 gene locus_tag LOCUS_3910 2993 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 >Feature sequence126 897 1301 gene locus_tag LOCUS_3920 897 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 1410 2099 gene locus_tag LOCUS_3930 1410 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 >Feature sequence127 1011 2141 gene locus_tag LOCUS_3940 1011 2141 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 protein_id gnl|my_center|LOCUS_3940 2138 2851 gene locus_tag LOCUS_3950 2138 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 >Feature sequence128 24 920 gene locus_tag LOCUS_3960 24 920 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867832.1 protein_id gnl|my_center|LOCUS_3960 935 1507 gene locus_tag LOCUS_3970 935 1507 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_3970 1518 2039 gene locus_tag LOCUS_3980 1518 2039 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080084.1 protein_id gnl|my_center|LOCUS_3980 >Feature sequence129 267 725 gene locus_tag LOCUS_3990 267 725 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_3990 745 1167 gene locus_tag LOCUS_4000 745 1167 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_4000 1178 2152 gene locus_tag LOCUS_4010 1178 2152 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_4010 >Feature sequence130 1638 2534 gene locus_tag LOCUS_4020 1638 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 2537 2950 gene locus_tag LOCUS_4030 2537 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 >Feature sequence131 2425 1367 gene locus_tag LOCUS_4040 gene fliG 2425 1367 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_4040 <3032 2435 gene locus_tag LOCUS_4050 <3032 2435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001115055.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence132 1002 172 gene locus_tag LOCUS_4060 1002 172 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_4060 1467 1018 gene locus_tag LOCUS_4070 gene dtd 1467 1018 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_4070 2027 1464 gene locus_tag LOCUS_4080 2027 1464 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_4080 <3031 2048 gene locus_tag LOCUS_4090 <3031 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194370.1:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence133 165 2162 gene locus_tag LOCUS_4100 165 2162 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966095.1 protein_id gnl|my_center|LOCUS_4100 2159 2599 gene locus_tag LOCUS_4110 2159 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 >Feature sequence134 <1 713 gene locus_tag LOCUS_4120 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937402.1:NYN domain-containing protein 790 1413 gene locus_tag LOCUS_4130 gene rluF 790 1413 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222171.1 protein_id gnl|my_center|LOCUS_4130 1493 2440 gene locus_tag LOCUS_4140 1493 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 <3028 2441 gene locus_tag LOCUS_4150 <3028 2441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964575.1:bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK >Feature sequence135 >Feature sequence136 <1 708 gene locus_tag LOCUS_4160 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669611.1:ABC transporter ATP-binding protein 718 2250 gene locus_tag LOCUS_4170 718 2250 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_4170 >Feature sequence137 2333 1305 gene locus_tag LOCUS_4180 2333 1305 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048367.1 protein_id gnl|my_center|LOCUS_4180 2934 2320 gene locus_tag LOCUS_4190 2934 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 >Feature sequence138 318 1328 gene locus_tag LOCUS_4200 318 1328 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_4200 1483 1785 gene locus_tag LOCUS_4210 1483 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 2951 1782 gene locus_tag LOCUS_4220 2951 1782 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_4220 >Feature sequence139 72 944 gene locus_tag LOCUS_4230 72 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 1310 1546 gene locus_tag LOCUS_4240 1310 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 1539 1847 gene locus_tag LOCUS_4250 1539 1847 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_4250 1840 2766 gene locus_tag LOCUS_4260 1840 2766 CDS product lpg2370 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948074.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence140 1771 1016 gene locus_tag LOCUS_4270 1771 1016 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_4270 1886 1813 gene locus_tag LOCUS_t0040 1886 1813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2035 2577 gene locus_tag LOCUS_4280 gene hslV 2035 2577 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_4280 >Feature sequence141 >Feature sequence142 59 514 gene locus_tag LOCUS_4290 59 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 524 898 gene locus_tag LOCUS_4300 524 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 2866 905 gene locus_tag LOCUS_4310 2866 905 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080080.1 protein_id gnl|my_center|LOCUS_4310 >Feature sequence143 377 1192 gene locus_tag LOCUS_4320 377 1192 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_4320 1189 2799 gene locus_tag LOCUS_4330 1189 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 >Feature sequence144 <1 2248 gene locus_tag LOCUS_4340 <1 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258977.1:ATP-dependent chaperone ClpB 2389 2829 gene locus_tag LOCUS_4350 2389 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 >Feature sequence145 677 468 gene locus_tag LOCUS_4360 677 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146930.1 protein_id gnl|my_center|LOCUS_4360 1203 739 gene locus_tag LOCUS_4370 1203 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 2939 1209 gene locus_tag LOCUS_4380 2939 1209 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_4380 >Feature sequence146 79 855 gene locus_tag LOCUS_4390 gene cdaA 79 855 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_4390 842 1771 gene locus_tag LOCUS_4400 842 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 1776 2687 gene locus_tag LOCUS_4410 1776 2687 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_4410 >Feature sequence147 55 357 gene locus_tag LOCUS_4420 55 357 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_4420 >Feature sequence148 97 735 gene locus_tag LOCUS_4430 97 735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_4430 738 1790 gene locus_tag LOCUS_4440 gene queA 738 1790 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004339588.1 protein_id gnl|my_center|LOCUS_4440 <2892 1828 gene locus_tag LOCUS_4450 <2892 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence149 316 624 gene locus_tag LOCUS_4460 316 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 615 818 gene locus_tag LOCUS_4470 615 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 818 952 gene locus_tag LOCUS_4480 818 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 977 1393 gene locus_tag LOCUS_4490 977 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 1403 1732 gene locus_tag LOCUS_4500 1403 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 1656 1838 gene locus_tag LOCUS_4510 1656 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 1930 2487 gene locus_tag LOCUS_4520 1930 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 2490 2708 gene locus_tag LOCUS_4530 2490 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 >Feature sequence150 966 334 gene locus_tag LOCUS_4540 gene hisH 966 334 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_4540 1559 963 gene locus_tag LOCUS_4550 gene hisB 1559 963 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_4550 >Feature sequence151 505 1533 gene locus_tag LOCUS_4560 gene argC 505 1533 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_4560 1610 2779 gene locus_tag LOCUS_4570 1610 2779 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_4570 >Feature sequence152 914 60 gene locus_tag LOCUS_4580 914 60 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709894.1 protein_id gnl|my_center|LOCUS_4580 1647 907 gene locus_tag LOCUS_4590 1647 907 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583560.1 protein_id gnl|my_center|LOCUS_4590 2214 1648 gene locus_tag LOCUS_4600 gene frr 2214 1648 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_4600 >Feature sequence153 479 189 gene locus_tag LOCUS_4610 479 189 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_4610 1748 480 gene locus_tag LOCUS_4620 1748 480 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679428.1 protein_id gnl|my_center|LOCUS_4620 2831 1818 gene locus_tag LOCUS_4630 gene gap 2831 1818 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_4630 >Feature sequence154 >Feature sequence155 <1 621 gene locus_tag LOCUS_4640 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048417.1:PHP domain-containing protein 618 1331 gene locus_tag LOCUS_4650 618 1331 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_4650 1409 2068 gene locus_tag LOCUS_4660 1409 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 >Feature sequence156 <1 967 gene locus_tag LOCUS_4670 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258958.1:ribosome biogenesis GTPase Der >Feature sequence157 1178 810 gene locus_tag LOCUS_4680 1178 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 1367 1206 gene locus_tag LOCUS_4690 1367 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 2043 1360 gene locus_tag LOCUS_4700 2043 1360 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_4700 <2802 2094 gene locus_tag LOCUS_4710 <2802 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948373.1:ATP-binding protein >Feature sequence158 1156 80 gene locus_tag LOCUS_4720 gene pheA 1156 80 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_4720 2020 1169 gene locus_tag LOCUS_4730 2020 1169 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358679.1 protein_id gnl|my_center|LOCUS_4730 2657 2013 gene locus_tag LOCUS_4740 gene scpB 2657 2013 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439024.1 protein_id gnl|my_center|LOCUS_4740 >Feature sequence159 1907 189 gene locus_tag LOCUS_4750 1907 189 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_4750 2099 2719 gene locus_tag LOCUS_4760 2099 2719 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_4760 >Feature sequence160 897 193 gene locus_tag LOCUS_4770 897 193 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_4770 <2791 1410 gene locus_tag LOCUS_4780 <2791 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931885.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence161 <1 924 gene locus_tag LOCUS_4790 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047906.1:flagellar protein export ATPase FliI 924 1565 gene locus_tag LOCUS_4800 924 1565 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545776.1 protein_id gnl|my_center|LOCUS_4800 >Feature sequence162 <1 1652 gene locus_tag LOCUS_4810 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:SpoIIE family protein phosphatase 1653 2537 gene locus_tag LOCUS_4820 gene rsmH 1653 2537 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_4820 >Feature sequence163 1516 830 gene locus_tag LOCUS_4830 1516 830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_4830 2750 1563 gene locus_tag LOCUS_4840 2750 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 >Feature sequence164 <1 518 gene locus_tag LOCUS_4850 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257687.1:type I restriction endonuclease subunit R 727 864 gene locus_tag LOCUS_4860 727 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 1166 2410 gene locus_tag LOCUS_4870 1166 2410 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_4870 >Feature sequence165 >Feature sequence166 105 1289 gene locus_tag LOCUS_4880 105 1289 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_4880 1341 2480 gene locus_tag LOCUS_4890 1341 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 2724 2566 gene locus_tag LOCUS_4900 2724 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 >Feature sequence167 <1 747 gene locus_tag LOCUS_4910 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082389.1:type I pullulanase 863 1279 gene locus_tag LOCUS_4920 863 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 1276 1794 gene locus_tag LOCUS_4930 1276 1794 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_4930 >Feature sequence168 >Feature sequence169 1909 83 gene locus_tag LOCUS_4940 1909 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 2623 2015 gene locus_tag LOCUS_4950 2623 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 >Feature sequence170 264 566 gene locus_tag LOCUS_4960 264 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 576 1172 gene locus_tag LOCUS_4970 gene recR 576 1172 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582670.1 protein_id gnl|my_center|LOCUS_4970 >Feature sequence171 443 2128 gene locus_tag LOCUS_4980 443 2128 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042798.1 protein_id gnl|my_center|LOCUS_4980 >Feature sequence172 930 520 gene locus_tag LOCUS_4990 930 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 >Feature sequence173 1253 396 gene locus_tag LOCUS_5000 1253 396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080933.1 protein_id gnl|my_center|LOCUS_5000 1662 1231 gene locus_tag LOCUS_5010 1662 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 >Feature sequence174 117 1181 gene locus_tag LOCUS_5020 gene prfA 117 1181 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_5020 1181 1999 gene locus_tag LOCUS_5030 gene prmC 1181 1999 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_5030 >Feature sequence175 3 866 gene locus_tag LOCUS_5040 3 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 919 1398 gene locus_tag LOCUS_5050 919 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 1496 2503 gene locus_tag LOCUS_5060 1496 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 >Feature sequence176 2243 321 gene locus_tag LOCUS_5070 2243 321 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_5070 >Feature sequence177 2237 474 gene locus_tag LOCUS_5080 2237 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 >Feature sequence178 >Feature sequence179 1644 406 gene locus_tag LOCUS_5090 1644 406 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213028.1 protein_id gnl|my_center|LOCUS_5090 2428 1688 gene locus_tag LOCUS_5100 2428 1688 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213030.1 protein_id gnl|my_center|LOCUS_5100 >Feature sequence180 97 846 gene locus_tag LOCUS_5110 gene fabG 97 846 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_5110 868 2112 gene locus_tag LOCUS_5120 gene fabF 868 2112 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_5120 >Feature sequence181 <2696 356 gene locus_tag LOCUS_5130 <2696 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393311.1:malto-oligosyltrehalose synthase >Feature sequence182 1196 2344 gene locus_tag LOCUS_5140 1196 2344 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_5140 >Feature sequence183 2428 887 gene locus_tag LOCUS_5150 gene secD 2428 887 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_5150 >Feature sequence184 1636 116 gene locus_tag LOCUS_5160 1636 116 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_5160 <2674 1633 gene locus_tag LOCUS_5170 <2674 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256246.1:DNA mismatch repair protein MutS >Feature sequence185 <1 1277 gene locus_tag LOCUS_5180 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005668014.1:septal ring lytic transglycosylase RlpA family protein 1274 2317 gene locus_tag LOCUS_5190 gene ispG 1274 2317 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_5190 >Feature sequence186 1 513 gene locus_tag LOCUS_5200 gene rfbC 1 513 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 protein_id gnl|my_center|LOCUS_5200 467 1375 gene locus_tag LOCUS_5210 gene rfbD 467 1375 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_5210 1527 2597 gene locus_tag LOCUS_5220 gene rfbB 1527 2597 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_5220 >Feature sequence187 1515 505 gene locus_tag LOCUS_5230 1515 505 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_5230 <2665 1496 gene locus_tag LOCUS_5240 <2665 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ABC-ATPase domain-containing protein >Feature sequence188 <1 1475 gene locus_tag LOCUS_5250 <1 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706654.1:HD-GYP domain-containing protein 1634 1509 gene locus_tag LOCUS_5260 1634 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 1876 2238 gene locus_tag LOCUS_5270 1876 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 2251 2415 gene locus_tag LOCUS_5280 2251 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 2426 2620 gene locus_tag LOCUS_5290 2426 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 >Feature sequence189 233 913 gene locus_tag LOCUS_5300 233 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 2561 981 gene locus_tag LOCUS_5310 2561 981 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_5310 >Feature sequence190 1052 180 gene locus_tag LOCUS_5320 1052 180 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_5320 1392 2387 gene locus_tag LOCUS_5330 gene galE 1392 2387 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_5330 >Feature sequence191 <1 1079 gene locus_tag LOCUS_5340 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921313.1:alpha-amylase family glycosyl hydrolase 1503 1727 gene locus_tag LOCUS_5350 1503 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 1714 2625 gene locus_tag LOCUS_5360 gene miaA 1714 2625 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811584.1 protein_id gnl|my_center|LOCUS_5360 >Feature sequence192 <2636 676 gene locus_tag LOCUS_5370 <2636 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730645.1:thiamine pyrophosphate-binding protein >Feature sequence193 680 1444 gene locus_tag LOCUS_5380 gene xth 680 1444 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_5380 >Feature sequence194 122 2629 gene locus_tag LOCUS_5390 122 2629 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657480.1 protein_id gnl|my_center|LOCUS_5390 >Feature sequence195 47 1015 gene locus_tag LOCUS_5400 47 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 1034 2179 gene locus_tag LOCUS_5410 1034 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 >Feature sequence196 <2603 1083 gene locus_tag LOCUS_5420 <2603 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001029966.1:chaperonin GroEL >Feature sequence197 1244 585 gene locus_tag LOCUS_5430 1244 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 2582 1260 gene locus_tag LOCUS_5440 2582 1260 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582928.1 protein_id gnl|my_center|LOCUS_5440 >Feature sequence198 <2590 1466 gene locus_tag LOCUS_5450 <2590 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence199 <1 638 gene locus_tag LOCUS_5460 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867583.1:tryptophan synthase subunit beta 1172 642 gene locus_tag LOCUS_5470 1172 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 2267 1266 gene locus_tag LOCUS_5480 2267 1266 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_5480 >Feature sequence200 >Feature sequence201 2542 1364 gene locus_tag LOCUS_5490 2542 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 >Feature sequence202 524 2116 gene locus_tag LOCUS_5500 gene lnt 524 2116 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_5500 >Feature sequence203 237 689 gene locus_tag LOCUS_5510 gene rpiB 237 689 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_5510 686 1561 gene locus_tag LOCUS_5520 gene aroE 686 1561 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_5520 1619 1690 gene locus_tag LOCUS_t0050 1619 1690 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 2499 40 gene locus_tag LOCUS_5530 2499 40 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_5530 >Feature sequence205 1349 384 gene locus_tag LOCUS_5540 1349 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 <2568 1413 gene locus_tag LOCUS_5550 <2568 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681149.1:ribonuclease Y >Feature sequence206 34 2463 gene locus_tag LOCUS_5560 34 2463 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_5560 >Feature sequence207 <1 887 gene locus_tag LOCUS_5570 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425940.1:cation diffusion facilitator family transporter 1058 2563 gene locus_tag LOCUS_5580 gene guaB 1058 2563 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_5580 >Feature sequence208 1802 249 gene locus_tag LOCUS_5590 gene nadB 1802 249 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_5590 <2550 1802 gene locus_tag LOCUS_5600 <2550 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017049.1:type I methionyl aminopeptidase >Feature sequence209 <1 1948 gene locus_tag LOCUS_5610 <1 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467081.1:molecular chaperone HtpG >Feature sequence210 <2543 1822 gene locus_tag LOCUS_5620 <2543 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667252.1:aminopeptidase >Feature sequence211 <1 979 gene locus_tag LOCUS_5630 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259421.1:FAD-dependent oxidoreductase 989 1468 gene locus_tag LOCUS_5640 989 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 >Feature sequence212 1207 68 gene locus_tag LOCUS_5650 gene lpxB 1207 68 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901943.1 protein_id gnl|my_center|LOCUS_5650 2002 1211 gene locus_tag LOCUS_5660 gene lpxA 2002 1211 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_5660 2513 1995 gene locus_tag LOCUS_5670 2513 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 >Feature sequence213 >Feature sequence214 >Feature sequence215 800 165 gene locus_tag LOCUS_5680 800 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 <2524 801 gene locus_tag LOCUS_5690 <2524 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582444.1:molecular chaperone DnaK >Feature sequence216 <1 687 gene locus_tag LOCUS_5700 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476199.1:ATP-binding protein >Feature sequence217 <1 565 gene locus_tag LOCUS_5710 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124926.1:ATP-binding protein 637 2232 gene locus_tag LOCUS_5720 gene serA 637 2232 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_5720 >Feature sequence218 49 1521 gene locus_tag LOCUS_5730 49 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 <2507 1540 gene locus_tag LOCUS_5740 <2507 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence219 1052 979 gene locus_tag LOCUS_t0060 1052 979 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1317 1063 gene locus_tag LOCUS_5750 gene spoVG 1317 1063 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_5750 2242 1382 gene locus_tag LOCUS_5760 gene ispE 2242 1382 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081581.1 protein_id gnl|my_center|LOCUS_5760 >Feature sequence220 131 712 gene locus_tag LOCUS_5770 131 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 2327 714 gene locus_tag LOCUS_5780 2327 714 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_5780 >Feature sequence221 <1 843 gene locus_tag LOCUS_5790 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966273.1:methionine--tRNA ligase 880 2076 gene locus_tag LOCUS_5800 880 2076 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_5800 >Feature sequence222 <2488 263 gene locus_tag LOCUS_5810 <2488 263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase >Feature sequence223 31 639 gene locus_tag LOCUS_5820 31 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 >Feature sequence224 >Feature sequence225 >Feature sequence226 38 640 gene locus_tag LOCUS_5830 38 640 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_5830 <2462 659 gene locus_tag LOCUS_5840 <2462 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989370.1:glycoside hydrolase family 31 protein >Feature sequence227 214 579 gene locus_tag LOCUS_5850 gene rbfA 214 579 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_5850 588 1604 gene locus_tag LOCUS_5860 588 1604 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_5860 >Feature sequence228 700 65 gene locus_tag LOCUS_5870 gene purN 700 65 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_5870 2121 697 gene locus_tag LOCUS_5880 gene rseP 2121 697 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_5880 >Feature sequence229 <2445 1364 gene locus_tag LOCUS_5890 <2445 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941973.1:ATP-binding protein >Feature sequence230 <2443 133 gene locus_tag LOCUS_5900 <2443 133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932746.1:exodeoxyribonuclease V subunit gamma >Feature sequence231 2376 1657 gene locus_tag LOCUS_5910 gene hisA 2376 1657 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_5910 >Feature sequence232 1073 60 gene locus_tag LOCUS_5920 1073 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 1746 1147 gene locus_tag LOCUS_5930 gene gmk 1746 1147 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_5930 <2439 1827 gene locus_tag LOCUS_5940 <2439 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965023.1:YicC family protein >Feature sequence233 1196 162 gene locus_tag LOCUS_5950 gene cas1c 1196 162 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080011780.1 protein_id gnl|my_center|LOCUS_5950 <2439 1213 gene locus_tag LOCUS_5960 <2439 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871198.1:TIGR02221 family CRISPR-associated protein >Feature sequence234 760 2331 gene locus_tag LOCUS_5970 760 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence235 <1 965 gene locus_tag LOCUS_5980 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001085747.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence236 1056 187 gene locus_tag LOCUS_5990 gene argB 1056 187 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_5990 1309 1100 gene locus_tag LOCUS_6000 1309 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 <2421 1321 gene locus_tag LOCUS_6010 <2421 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461084.1:LL-diaminopimelate aminotransferase >Feature sequence237 >Feature sequence238 241 1320 gene locus_tag LOCUS_6020 241 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 >Feature sequence239 776 315 gene locus_tag LOCUS_6030 776 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 1321 785 gene locus_tag LOCUS_6040 1321 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 <2411 1322 gene locus_tag LOCUS_6050 <2411 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081541.1:polyribonucleotide nucleotidyltransferase >Feature sequence240 <1 513 gene locus_tag LOCUS_6060 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181711626.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 524 2047 gene locus_tag LOCUS_6070 524 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 >Feature sequence241 196 804 gene locus_tag LOCUS_6080 196 804 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495104.1 protein_id gnl|my_center|LOCUS_6080 2248 1088 gene locus_tag LOCUS_6090 2248 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_6090 >Feature sequence242 42 1133 gene locus_tag LOCUS_6100 gene ribD 42 1133 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038059103.1 protein_id gnl|my_center|LOCUS_6100 1120 2196 gene locus_tag LOCUS_6110 1120 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 >Feature sequence243 <1 1049 gene locus_tag LOCUS_6120 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147353.1:ATP synthase subunit B 1046 1696 gene locus_tag LOCUS_6130 1046 1696 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_6130 1832 2284 gene locus_tag LOCUS_6140 1832 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 >Feature sequence244 <1 1473 gene locus_tag LOCUS_6150 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080592854.1:translation elongation factor 4 1466 2038 gene locus_tag LOCUS_6160 1466 2038 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_6160 >Feature sequence245 763 32 gene locus_tag LOCUS_6170 763 32 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_6170 1331 753 gene locus_tag LOCUS_6180 1331 753 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_6180 <2401 1342 gene locus_tag LOCUS_6190 <2401 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428487.1:RnfABCDGE type electron transport complex subunit D >Feature sequence246 >Feature sequence247 1318 293 gene locus_tag LOCUS_6200 gene bioB 1318 293 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931746.1 protein_id gnl|my_center|LOCUS_6200 <2394 1498 gene locus_tag LOCUS_6210 <2394 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence248 >Feature sequence249 <1 617 gene locus_tag LOCUS_6220 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584117.1:FprA family A-type flavoprotein 631 1149 gene locus_tag LOCUS_6230 631 1149 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020219.1 protein_id gnl|my_center|LOCUS_6230 1151 1540 gene locus_tag LOCUS_6240 1151 1540 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_6240 1544 2119 gene locus_tag LOCUS_6250 1544 2119 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_6250 >Feature sequence250 >Feature sequence251 3 1082 gene locus_tag LOCUS_6260 3 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 >Feature sequence252 423 1466 gene locus_tag LOCUS_6270 423 1466 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918546.1 protein_id gnl|my_center|LOCUS_6270 1530 2189 gene locus_tag LOCUS_6280 1530 2189 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667217.1 protein_id gnl|my_center|LOCUS_6280 >Feature sequence253 2304 43 gene locus_tag LOCUS_6290 2304 43 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_6290 >Feature sequence254 1207 140 gene locus_tag LOCUS_6300 1207 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 1949 1218 gene locus_tag LOCUS_6310 1949 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 2261 1965 gene locus_tag LOCUS_6320 2261 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 >Feature sequence255 1255 1824 gene locus_tag LOCUS_6330 1255 1824 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_6330 >Feature sequence256 1235 348 gene locus_tag LOCUS_6340 1235 348 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_6340 <2337 1290 gene locus_tag LOCUS_6350 <2337 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965445.1:flagellar biosynthesis protein FlhF >Feature sequence257 2292 445 gene locus_tag LOCUS_6360 gene glmS 2292 445 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_6360 >Feature sequence258 1332 853 gene locus_tag LOCUS_6370 1332 853 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_6370 1731 1357 gene locus_tag LOCUS_6380 gene cheY1 1731 1357 CDS product chemotaxis response regulator CheY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 protein_id gnl|my_center|LOCUS_6380 <2326 1728 gene locus_tag LOCUS_6390 <2326 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081040.1:chemotaxis protein CheA >Feature sequence259 <1 569 gene locus_tag LOCUS_6400 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881354.1:GTPase ObgE 550 1683 gene locus_tag LOCUS_6410 gene proB 550 1683 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_6410 >Feature sequence260 <2317 1627 gene locus_tag LOCUS_6420 <2317 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860649.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB >Feature sequence261 <2316 24 gene locus_tag LOCUS_6430 <2316 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001221442.1:C1 family peptidase >Feature sequence262 249 163 gene locus_tag LOCUS_t0070 249 163 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 780 385 gene locus_tag LOCUS_6440 780 385 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_6440 1001 777 gene locus_tag LOCUS_6450 1001 777 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_6450 1589 1083 gene locus_tag LOCUS_6460 1589 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 <2316 1600 gene locus_tag LOCUS_6470 <2316 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460729.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence263 >Feature sequence264 810 130 gene locus_tag LOCUS_6480 810 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 1207 938 gene locus_tag LOCUS_6490 gene fliQ 1207 938 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655982.1 protein_id gnl|my_center|LOCUS_6490 2009 1239 gene locus_tag LOCUS_6500 gene fliP 2009 1239 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783972.1 protein_id gnl|my_center|LOCUS_6500 >Feature sequence265 >Feature sequence266 >Feature sequence267 >Feature sequence268 876 2270 gene locus_tag LOCUS_6510 876 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 >Feature sequence269 445 750 gene locus_tag LOCUS_6520 445 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 747 1340 gene locus_tag LOCUS_6530 747 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 1349 2074 gene locus_tag LOCUS_6540 1349 2074 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence270 165 1046 gene locus_tag LOCUS_6550 165 1046 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668952.1 protein_id gnl|my_center|LOCUS_6550 >Feature sequence271 108 1520 gene locus_tag LOCUS_6560 gene ahcY 108 1520 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_6560 1559 2056 gene locus_tag LOCUS_6570 1559 2056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_6570 >Feature sequence272 63 1850 gene locus_tag LOCUS_6580 gene ptsP 63 1850 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966368.1 protein_id gnl|my_center|LOCUS_6580 >Feature sequence273 1079 99 gene locus_tag LOCUS_6590 gene gmd 1079 99 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709513.1 protein_id gnl|my_center|LOCUS_6590 2132 1080 gene locus_tag LOCUS_6600 gene gmd 2132 1080 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_6600 >Feature sequence274 244 32 gene locus_tag LOCUS_6610 gene thiS 244 32 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_6610 488 1486 gene locus_tag LOCUS_6620 488 1486 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_6620 >Feature sequence275 <2236 821 gene locus_tag LOCUS_6630 <2236 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965975.1:DNA helicase RecQ >Feature sequence276 1007 117 gene locus_tag LOCUS_6640 1007 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 1966 1007 gene locus_tag LOCUS_6650 1966 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 >Feature sequence277 2062 989 gene locus_tag LOCUS_6660 2062 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 >Feature sequence278 <1 1933 gene locus_tag LOCUS_6670 <1 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839714.1:alpha-amylase family glycosyl hydrolase >Feature sequence279 <1 1326 gene locus_tag LOCUS_6680 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804147.1:efflux RND transporter permease subunit >Feature sequence280 <1 1642 gene locus_tag LOCUS_6690 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895854.1:glutamate synthase-related protein >Feature sequence281 146 850 gene locus_tag LOCUS_6700 146 850 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_6700 935 1008 gene locus_tag LOCUS_t0080 935 1008 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1398 1048 gene locus_tag LOCUS_6710 1398 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 <2213 1411 gene locus_tag LOCUS_6720 <2213 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987056.1:cation:proton antiporter >Feature sequence282 658 155 gene locus_tag LOCUS_6730 gene cas4 658 155 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_6730 <2209 655 gene locus_tag LOCUS_6740 <2209 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922513.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence283 <1 1291 gene locus_tag LOCUS_6750 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682344.1:HD domain-containing protein <2208 1320 gene locus_tag LOCUS_6760 <2208 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871106.1:aspartate carbamoyltransferase >Feature sequence284 207 1205 gene locus_tag LOCUS_6770 gene pta 207 1205 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_6770 >Feature sequence285 >Feature sequence286 96 1886 gene locus_tag LOCUS_6780 gene aspS 96 1886 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881092.1 protein_id gnl|my_center|LOCUS_6780 >Feature sequence287 1336 59 gene locus_tag LOCUS_6790 gene eno 1336 59 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_6790 >Feature sequence288 898 440 gene locus_tag LOCUS_6800 898 440 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 protein_id gnl|my_center|LOCUS_6800 2063 1134 gene locus_tag LOCUS_6810 gene lpxC 2063 1134 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_6810 >Feature sequence289 <2187 344 gene locus_tag LOCUS_6820 <2187 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272308.1:DEAD/DEAH box helicase >Feature sequence290 <1 1062 gene locus_tag LOCUS_6830 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1055 1618 gene locus_tag LOCUS_6840 1055 1618 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_6840 >Feature sequence291 775 155 gene locus_tag LOCUS_6850 775 155 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869608.1 protein_id gnl|my_center|LOCUS_6850 2168 762 gene locus_tag LOCUS_6860 2168 762 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_6860 >Feature sequence292 <2180 251 gene locus_tag LOCUS_6870 <2180 251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951299.1:polymorphic toxin MafB class 1 >Feature sequence293 83 1147 gene locus_tag LOCUS_6880 gene hydE 83 1147 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_6880 1841 1128 gene locus_tag LOCUS_6890 1841 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 >Feature sequence294 311 120 gene locus_tag LOCUS_6900 311 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 425 2101 gene locus_tag LOCUS_6910 425 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 >Feature sequence295 >Feature sequence296 <1 703 gene locus_tag LOCUS_6920 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921140.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase 785 1801 gene locus_tag LOCUS_6930 gene trxB 785 1801 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_6930 >Feature sequence297 <1 1226 gene locus_tag LOCUS_6940 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045006.1:SpoIIE family protein phosphatase 1337 2164 gene locus_tag LOCUS_6950 gene ymdB 1337 2164 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_6950 >Feature sequence298 <2159 1361 gene locus_tag LOCUS_6960 <2159 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016475763.1:BRO family protein >Feature sequence299 47 1309 gene locus_tag LOCUS_6970 47 1309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401256.1 protein_id gnl|my_center|LOCUS_6970 >Feature sequence300 1398 940 gene locus_tag LOCUS_6980 gene dut 1398 940 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_6980 1590 2135 gene locus_tag LOCUS_6990 1590 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 >Feature sequence301 191 919 gene locus_tag LOCUS_7000 191 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 912 1649 gene locus_tag LOCUS_7010 912 1649 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425174.1 protein_id gnl|my_center|LOCUS_7010 >Feature sequence302 >Feature sequence303 <1 974 gene locus_tag LOCUS_7020 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202318704.1:MFS transporter <2140 1035 gene locus_tag LOCUS_7030 <2140 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965697.1:acyl-CoA dehydratase activase-related protein >Feature sequence304 1345 155 gene locus_tag LOCUS_7040 gene folP 1345 155 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582989.1 protein_id gnl|my_center|LOCUS_7040 >Feature sequence305 1156 407 gene locus_tag LOCUS_7050 1156 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 1667 1284 gene locus_tag LOCUS_7060 1667 1284 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_7060 2121 1717 gene locus_tag LOCUS_7070 2121 1717 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932630.1 protein_id gnl|my_center|LOCUS_7070 >Feature sequence306 131 1114 gene locus_tag LOCUS_7080 131 1114 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_7080 1218 1898 gene locus_tag LOCUS_7090 1218 1898 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_7090 >Feature sequence307 1949 1473 gene locus_tag LOCUS_7100 1949 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 2130 1939 gene locus_tag LOCUS_7110 2130 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 >Feature sequence308 <1 776 gene locus_tag LOCUS_7120 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066469.1:cysteate synthase 863 2122 gene locus_tag LOCUS_7130 863 2122 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_7130 >Feature sequence309 <1 1125 gene locus_tag LOCUS_7140 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888861.1:hemolysin family protein >Feature sequence310 1118 117 gene locus_tag LOCUS_7150 gene pheS 1118 117 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_7150 1937 1245 gene locus_tag LOCUS_7160 1937 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 >Feature sequence311 176 355 gene locus_tag LOCUS_7170 176 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 585 1175 gene locus_tag LOCUS_7180 585 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 1195 2055 gene locus_tag LOCUS_7190 gene pyrD 1195 2055 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_7190 >Feature sequence312 >Feature sequence313 <1 1494 gene locus_tag LOCUS_7200 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080599.1:M3 family oligoendopeptidase >Feature sequence314 <1 1100 gene locus_tag LOCUS_7210 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143858.1:mechanosensitive ion channel family protein >Feature sequence315 54 1172 gene locus_tag LOCUS_7220 54 1172 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_7220 <2098 1232 gene locus_tag LOCUS_7230 <2098 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228405.1:DNA polymerase I >Feature sequence316 <1 1784 gene locus_tag LOCUS_7240 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231947.1:flagellar biosynthesis protein FlhA >Feature sequence317 2086 788 gene locus_tag LOCUS_7250 2086 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 >Feature sequence318 556 233 gene locus_tag LOCUS_7260 gene trxA 556 233 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_7260 1388 621 gene locus_tag LOCUS_7270 gene lptB 1388 621 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_7270 <2086 1403 gene locus_tag LOCUS_7280 <2086 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545653.1:acetyl-CoA carboxylase, carboxyltransferase subunit beta >Feature sequence319 485 1360 gene locus_tag LOCUS_7290 gene dapF 485 1360 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_7290 >Feature sequence320 >Feature sequence321 406 948 gene locus_tag LOCUS_7300 gene rplF 406 948 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_7300 963 1328 gene locus_tag LOCUS_7310 gene rplR 963 1328 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_7310 1342 1887 gene locus_tag LOCUS_7320 gene rpsE 1342 1887 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_7320 >Feature sequence322 671 1486 gene locus_tag LOCUS_7330 671 1486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213024.1 protein_id gnl|my_center|LOCUS_7330 1505 1747 gene locus_tag LOCUS_7340 1505 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 >Feature sequence323 296 1147 gene locus_tag LOCUS_7350 gene panC 296 1147 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_7350 1866 1177 gene locus_tag LOCUS_7360 1866 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 >Feature sequence324 <2060 244 gene locus_tag LOCUS_7370 <2060 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765636.1:alpha-amylase family protein >Feature sequence325 784 26 gene locus_tag LOCUS_7380 gene cas6 784 26 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_7380 <2058 1001 gene locus_tag LOCUS_7390 <2058 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:SpoIIE family protein phosphatase >Feature sequence326 >Feature sequence327 892 1851 gene locus_tag LOCUS_7400 892 1851 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_7400 >Feature sequence328 1712 660 gene locus_tag LOCUS_7410 1712 660 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128929876.1 protein_id gnl|my_center|LOCUS_7410 >Feature sequence329 226 1647 gene locus_tag LOCUS_7420 gene trpE 226 1647 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_7420 >Feature sequence330 244 702 gene locus_tag LOCUS_7430 244 702 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933865.1 protein_id gnl|my_center|LOCUS_7430 1068 1211 gene locus_tag LOCUS_7440 1068 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 <2042 1363 gene locus_tag LOCUS_7450 <2042 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722710.1:carbohydrate ABC transporter permease >Feature sequence331 <1 1040 gene locus_tag LOCUS_7460 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269236.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence332 1083 319 gene locus_tag LOCUS_7470 1083 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 1849 1088 gene locus_tag LOCUS_7480 1849 1088 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_7480 >Feature sequence333 >Feature sequence334 >Feature sequence335 <1 945 gene locus_tag LOCUS_7490 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886190.1:palindromic element RPE3 domain-containing protein 1426 1905 gene locus_tag LOCUS_7500 gene coaD 1426 1905 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_7500 >Feature sequence336 <1 1655 gene locus_tag LOCUS_7510 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000058907.1:alpha-hydroxy-acid oxidizing protein >Feature sequence337 <1 1251 gene locus_tag LOCUS_7520 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976585.1:ABC transporter permease subunit >Feature sequence338 <1 1128 gene locus_tag LOCUS_7530 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679870.1:tetratricopeptide repeat protein 1118 1693 gene locus_tag LOCUS_7540 1118 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 >Feature sequence339 246 1967 gene locus_tag LOCUS_7550 246 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 >Feature sequence340 1773 1369 gene locus_tag LOCUS_7560 1773 1369 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762050.1 protein_id gnl|my_center|LOCUS_7560 >Feature sequence341 8 385 gene locus_tag LOCUS_7570 8 385 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_7570 524 859 gene locus_tag LOCUS_7580 524 859 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069606080.1 protein_id gnl|my_center|LOCUS_7580 859 1269 gene locus_tag LOCUS_7590 859 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 >Feature sequence342 598 1581 gene locus_tag LOCUS_7600 598 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 >Feature sequence343