>Feature sequence001 253 939 gene locus_tag LOCUS_00010 253 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1300 3051 gene locus_tag LOCUS_00020 1300 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3048 3746 gene locus_tag LOCUS_00030 3048 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3743 5212 gene locus_tag LOCUS_00040 3743 5212 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_00040 5209 6306 gene locus_tag LOCUS_00050 5209 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6299 7462 gene locus_tag LOCUS_00060 6299 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8162 11881 gene locus_tag LOCUS_00070 8162 11881 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00070 12423 13727 gene locus_tag LOCUS_00080 12423 13727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_00080 13770 15278 gene locus_tag LOCUS_00090 13770 15278 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_00090 15646 16272 gene locus_tag LOCUS_00100 15646 16272 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_00100 17072 16290 gene locus_tag LOCUS_00110 17072 16290 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_00110 18208 17384 gene locus_tag LOCUS_00120 18208 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18451 18239 gene locus_tag LOCUS_00130 gene yidD 18451 18239 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 protein_id gnl|my_center|LOCUS_00130 18809 18444 gene locus_tag LOCUS_00140 gene rnpA 18809 18444 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_00140 19013 18876 gene locus_tag LOCUS_00150 19013 18876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20250 19291 gene locus_tag LOCUS_00160 20250 19291 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_00160 20746 21471 gene locus_tag LOCUS_00170 20746 21471 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_00170 21482 22171 gene locus_tag LOCUS_00180 21482 22171 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_00180 22173 22805 gene locus_tag LOCUS_00190 22173 22805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23808 22834 gene locus_tag LOCUS_00200 23808 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24242 25264 gene locus_tag LOCUS_00210 gene amrS 24242 25264 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_00210 25271 26107 gene locus_tag LOCUS_00220 gene amrB 25271 26107 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_00220 26119 26694 gene locus_tag LOCUS_00230 26119 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27090 26722 gene locus_tag LOCUS_00240 27090 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28995 27235 gene locus_tag LOCUS_00250 28995 27235 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_00250 30309 30139 gene locus_tag LOCUS_00260 30309 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30676 30350 gene locus_tag LOCUS_00270 30676 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32373 30976 gene locus_tag LOCUS_00280 gene mtaB 32373 30976 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_00280 32720 34012 gene locus_tag LOCUS_00290 32720 34012 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_00290 34083 34721 gene locus_tag LOCUS_00300 34083 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35321 34827 gene locus_tag LOCUS_00310 35321 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36628 35657 gene locus_tag LOCUS_00320 36628 35657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38854 37175 gene locus_tag LOCUS_00330 38854 37175 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_00330 39676 39284 gene locus_tag LOCUS_00340 39676 39284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41247 40051 gene locus_tag LOCUS_00350 41247 40051 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_00350 41600 41244 gene locus_tag LOCUS_00360 41600 41244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41961 41587 gene locus_tag LOCUS_00370 41961 41587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44119 41966 gene locus_tag LOCUS_00380 gene fdhF 44119 41966 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_00380 44904 44215 gene locus_tag LOCUS_00390 44904 44215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45620 44910 gene locus_tag LOCUS_00400 45620 44910 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_00400 46864 45617 gene locus_tag LOCUS_00410 46864 45617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 47343 46864 gene locus_tag LOCUS_00420 gene nuoE 47343 46864 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 protein_id gnl|my_center|LOCUS_00420 48305 47481 gene locus_tag LOCUS_00430 48305 47481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50563 48296 gene locus_tag LOCUS_00440 50563 48296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51875 50664 gene locus_tag LOCUS_00450 51875 50664 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257433.1 protein_id gnl|my_center|LOCUS_00450 52060 52509 gene locus_tag LOCUS_00460 gene ndk 52060 52509 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_00460 52519 53202 gene locus_tag LOCUS_00470 52519 53202 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_00470 53340 53146 gene locus_tag LOCUS_00480 53340 53146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53385 54890 gene locus_tag LOCUS_00490 gene malQ 53385 54890 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_00490 54887 55297 gene locus_tag LOCUS_00500 54887 55297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55593 56957 gene locus_tag LOCUS_00510 gene mazG 55593 56957 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_00510 57823 57119 gene locus_tag LOCUS_00520 gene radC 57823 57119 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_00520 58141 58659 gene locus_tag LOCUS_00530 58141 58659 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_00530 59172 58666 gene locus_tag LOCUS_00540 59172 58666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 <59994 59190 gene locus_tag LOCUS_00550 <59994 59190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000166375.1:lipoyl synthase >Feature sequence002 1626 910 gene locus_tag LOCUS_00560 1626 910 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_00560 2539 1718 gene locus_tag LOCUS_00570 2539 1718 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_00570 2834 2655 gene locus_tag LOCUS_00580 2834 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 3343 2957 gene locus_tag LOCUS_00590 3343 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 3768 3340 gene locus_tag LOCUS_00600 3768 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4978 4340 gene locus_tag LOCUS_00610 4978 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 5434 5255 gene locus_tag LOCUS_00620 5434 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 6706 5504 gene locus_tag LOCUS_00630 6706 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8304 6769 gene locus_tag LOCUS_00640 8304 6769 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_00640 8971 8330 gene locus_tag LOCUS_00650 8971 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 10108 9005 gene locus_tag LOCUS_00660 10108 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 11037 11243 gene locus_tag LOCUS_00670 11037 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12019 11249 gene locus_tag LOCUS_00680 12019 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 12320 12030 gene locus_tag LOCUS_00690 12320 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 13337 12345 gene locus_tag LOCUS_00700 13337 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15282 13348 gene locus_tag LOCUS_00710 gene asnB 15282 13348 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_00710 16119 15445 gene locus_tag LOCUS_00720 16119 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 17982 16606 gene locus_tag LOCUS_00730 17982 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 19250 18045 gene locus_tag LOCUS_00740 19250 18045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 20287 19217 gene locus_tag LOCUS_00750 20287 19217 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_00750 20759 20280 gene locus_tag LOCUS_00760 20759 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 21349 20762 gene locus_tag LOCUS_00770 21349 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 23913 22534 gene locus_tag LOCUS_00780 23913 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 25355 23913 gene locus_tag LOCUS_00790 25355 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 26431 25352 gene locus_tag LOCUS_00800 26431 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 27270 26425 gene locus_tag LOCUS_00810 27270 26425 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_00810 28139 27267 gene locus_tag LOCUS_00820 28139 27267 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_00820 28931 28158 gene locus_tag LOCUS_00830 28931 28158 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_00830 29260 28934 gene locus_tag LOCUS_00840 29260 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 29786 29244 gene locus_tag LOCUS_00850 29786 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 30893 29838 gene locus_tag LOCUS_00860 30893 29838 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_00860 31639 30890 gene locus_tag LOCUS_00870 31639 30890 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_00870 32793 31639 gene locus_tag LOCUS_00880 gene neuC 32793 31639 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_00880 33858 32839 gene locus_tag LOCUS_00890 gene neuB 33858 32839 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_00890 34922 33855 gene locus_tag LOCUS_00900 34922 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 36031 34919 gene locus_tag LOCUS_00910 36031 34919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 37289 36081 gene locus_tag LOCUS_00920 37289 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 39093 37429 gene locus_tag LOCUS_00930 39093 37429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 39515 39177 gene locus_tag LOCUS_00940 39515 39177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 39726 39493 gene locus_tag LOCUS_00950 39726 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 40797 39802 gene locus_tag LOCUS_00960 gene rfaE1 40797 39802 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583086.1 protein_id gnl|my_center|LOCUS_00960 41363 40794 gene locus_tag LOCUS_00970 41363 40794 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870429.1 protein_id gnl|my_center|LOCUS_00970 42457 41363 gene locus_tag LOCUS_00980 42457 41363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 43724 42447 gene locus_tag LOCUS_00990 gene waaF 43724 42447 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00990 44047 43721 gene locus_tag LOCUS_01000 44047 43721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence003 <1 638 gene locus_tag LOCUS_01010 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108469.1:FHA domain-containing protein 694 3642 gene locus_tag LOCUS_01020 694 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 3748 6507 gene locus_tag LOCUS_01030 3748 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7164 10067 gene locus_tag LOCUS_01040 7164 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10850 13630 gene locus_tag LOCUS_01050 10850 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 13675 15402 gene locus_tag LOCUS_01060 13675 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 15402 19319 gene locus_tag LOCUS_01070 15402 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19834 20706 gene locus_tag LOCUS_01080 19834 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 20697 22973 gene locus_tag LOCUS_01090 20697 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 22997 23263 gene locus_tag LOCUS_01100 22997 23263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 23310 25505 gene locus_tag LOCUS_01110 23310 25505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 25762 26892 gene locus_tag LOCUS_01120 25762 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 26944 28971 gene locus_tag LOCUS_01130 26944 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 29152 30711 gene locus_tag LOCUS_01140 29152 30711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 30766 34011 gene locus_tag LOCUS_01150 30766 34011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 34099 34428 gene locus_tag LOCUS_01160 34099 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 34430 36412 gene locus_tag LOCUS_01170 34430 36412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 36549 36842 gene locus_tag LOCUS_01180 36549 36842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 37413 39230 gene locus_tag LOCUS_01190 37413 39230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 39677 40204 gene locus_tag LOCUS_01200 39677 40204 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258745.1 protein_id gnl|my_center|LOCUS_01200 40903 40331 gene locus_tag LOCUS_01210 gene rfaH 40903 40331 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence004 198 1442 gene locus_tag LOCUS_01220 198 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 1439 2152 gene locus_tag LOCUS_01230 1439 2152 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_01230 2487 3221 gene locus_tag LOCUS_01240 gene rph 2487 3221 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_01240 3413 4006 gene locus_tag LOCUS_01250 3413 4006 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_01250 4006 4659 gene locus_tag LOCUS_01260 4006 4659 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_01260 5658 4846 gene locus_tag LOCUS_01270 5658 4846 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256891.1 protein_id gnl|my_center|LOCUS_01270 7298 5655 gene locus_tag LOCUS_01280 7298 5655 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_01280 8395 7298 gene locus_tag LOCUS_01290 8395 7298 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257083.1 protein_id gnl|my_center|LOCUS_01290 9706 8399 gene locus_tag LOCUS_01300 9706 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10400 9840 gene locus_tag LOCUS_01310 10400 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11554 10550 gene locus_tag LOCUS_01320 11554 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 12607 12242 gene locus_tag LOCUS_01330 gene rsfS 12607 12242 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257176.1 protein_id gnl|my_center|LOCUS_01330 15247 12695 gene locus_tag LOCUS_01340 15247 12695 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_01340 16878 15439 gene locus_tag LOCUS_01350 16878 15439 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_01350 17305 16871 gene locus_tag LOCUS_01360 gene mce 17305 16871 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01360 17808 17302 gene locus_tag LOCUS_01370 17808 17302 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_01370 18679 18272 gene locus_tag LOCUS_01380 18679 18272 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_01380 19937 18858 gene locus_tag LOCUS_01390 gene aroB 19937 18858 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690567.1 protein_id gnl|my_center|LOCUS_01390 20494 19934 gene locus_tag LOCUS_01400 20494 19934 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272425.1 protein_id gnl|my_center|LOCUS_01400 21377 20484 gene locus_tag LOCUS_01410 21377 20484 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 protein_id gnl|my_center|LOCUS_01410 22267 21374 gene locus_tag LOCUS_01420 22267 21374 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909160.1 protein_id gnl|my_center|LOCUS_01420 22962 22291 gene locus_tag LOCUS_01430 22962 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 23497 24273 gene locus_tag LOCUS_01440 23497 24273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_01440 24714 28898 gene locus_tag LOCUS_01450 24714 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence005 139 1116 gene locus_tag LOCUS_01460 139 1116 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_01460 1127 2692 gene locus_tag LOCUS_01470 1127 2692 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_01470 3009 3758 gene locus_tag LOCUS_01480 3009 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3843 4388 gene locus_tag LOCUS_01490 3843 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 6772 7470 gene locus_tag LOCUS_01500 6772 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 8608 9402 gene locus_tag LOCUS_01510 8608 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10118 10519 gene locus_tag LOCUS_01520 10118 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10509 11525 gene locus_tag LOCUS_01530 10509 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11935 13431 gene locus_tag LOCUS_01540 11935 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 13791 15185 gene locus_tag LOCUS_01550 13791 15185 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_01550 16328 17041 gene locus_tag LOCUS_01560 16328 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 17661 17930 gene locus_tag LOCUS_01570 17661 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 17945 19093 gene locus_tag LOCUS_01580 17945 19093 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_01580 19206 20315 gene locus_tag LOCUS_01590 19206 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20308 20973 gene locus_tag LOCUS_01600 20308 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 21023 22207 gene locus_tag LOCUS_01610 21023 22207 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533106.1 protein_id gnl|my_center|LOCUS_01610 22302 23495 gene locus_tag LOCUS_01620 22302 23495 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_01620 23677 24159 gene locus_tag LOCUS_01630 23677 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 24409 24131 gene locus_tag LOCUS_01640 24409 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 24764 24411 gene locus_tag LOCUS_01650 24764 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 24684 25082 gene locus_tag LOCUS_01660 24684 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 25072 27057 gene locus_tag LOCUS_01670 25072 27057 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence006 421 1242 gene locus_tag LOCUS_01680 421 1242 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_01680 1356 2189 gene locus_tag LOCUS_01690 1356 2189 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_01690 2182 3027 gene locus_tag LOCUS_01700 2182 3027 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_01700 3247 3681 gene locus_tag LOCUS_01710 3247 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4044 4892 gene locus_tag LOCUS_01720 4044 4892 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207595.1 protein_id gnl|my_center|LOCUS_01720 6607 5198 gene locus_tag LOCUS_01730 6607 5198 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257833.1 protein_id gnl|my_center|LOCUS_01730 7242 7754 gene locus_tag LOCUS_01740 7242 7754 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_01740 9380 8277 gene locus_tag LOCUS_01750 9380 8277 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928453.1 protein_id gnl|my_center|LOCUS_01750 10868 10062 gene locus_tag LOCUS_01760 10868 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 12362 12988 gene locus_tag LOCUS_01770 12362 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 12985 14739 gene locus_tag LOCUS_01780 12985 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 14982 15665 gene locus_tag LOCUS_01790 14982 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 16108 16791 gene locus_tag LOCUS_01800 16108 16791 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_01800 16917 17273 gene locus_tag LOCUS_01810 16917 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 18897 17380 gene locus_tag LOCUS_01820 18897 17380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 19802 20833 gene locus_tag LOCUS_01830 gene pheS 19802 20833 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_01830 20866 23355 gene locus_tag LOCUS_01840 gene pheT 20866 23355 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence007 368 901 gene locus_tag LOCUS_01850 368 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 894 1271 gene locus_tag LOCUS_01860 894 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 1308 2675 gene locus_tag LOCUS_01870 1308 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2679 4898 gene locus_tag LOCUS_01880 2679 4898 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_01880 4965 6512 gene locus_tag LOCUS_01890 4965 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 6516 7553 gene locus_tag LOCUS_01900 gene cheB 6516 7553 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_01900 8035 9312 gene locus_tag LOCUS_01910 8035 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 11220 9415 gene locus_tag LOCUS_01920 gene lepA 11220 9415 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_01920 15869 11838 gene locus_tag LOCUS_01930 15869 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 16955 16242 gene locus_tag LOCUS_01940 16955 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 20212 17429 gene locus_tag LOCUS_01950 20212 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 21318 20218 gene locus_tag LOCUS_01960 21318 20218 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01960 21530 21315 gene locus_tag LOCUS_01970 21530 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 21838 21527 gene locus_tag LOCUS_01980 21838 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 22344 22075 gene locus_tag LOCUS_01990 22344 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 23422 22337 gene locus_tag LOCUS_02000 gene mnmA 23422 22337 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence008 326 1456 gene locus_tag LOCUS_02010 326 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1456 2019 gene locus_tag LOCUS_02020 1456 2019 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870429.1 protein_id gnl|my_center|LOCUS_02020 2022 2981 gene locus_tag LOCUS_02030 2022 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3211 4842 gene locus_tag LOCUS_02040 3211 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5022 5948 gene locus_tag LOCUS_02050 5022 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6110 7108 gene locus_tag LOCUS_02060 6110 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7353 8306 gene locus_tag LOCUS_02070 7353 8306 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_02070 8501 9715 gene locus_tag LOCUS_02080 8501 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 9787 10920 gene locus_tag LOCUS_02090 9787 10920 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_02090 11066 11230 gene locus_tag LOCUS_02100 11066 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11940 12458 gene locus_tag LOCUS_02110 11940 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12885 13184 gene locus_tag LOCUS_02120 12885 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 13687 14304 gene locus_tag LOCUS_02130 13687 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 14316 16526 gene locus_tag LOCUS_02140 14316 16526 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_02140 16660 17904 gene locus_tag LOCUS_02150 16660 17904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_02150 17917 18969 gene locus_tag LOCUS_02160 17917 18969 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546819.1 protein_id gnl|my_center|LOCUS_02160 18979 20112 gene locus_tag LOCUS_02170 gene wecB 18979 20112 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_02170 20114 21622 gene locus_tag LOCUS_02180 20114 21622 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_02180 <22431 21690 gene locus_tag LOCUS_02190 <22431 21690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014466641.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase >Feature sequence009 996 2405 gene locus_tag LOCUS_02200 996 2405 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_02200 2418 3887 gene locus_tag LOCUS_02210 2418 3887 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_02210 4224 4862 gene locus_tag LOCUS_02220 4224 4862 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_02220 4843 5817 gene locus_tag LOCUS_02230 4843 5817 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_02230 5798 6340 gene locus_tag LOCUS_02240 5798 6340 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632567.1 protein_id gnl|my_center|LOCUS_02240 6537 7985 gene locus_tag LOCUS_02250 gene proS 6537 7985 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_02250 8010 8648 gene locus_tag LOCUS_02260 8010 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9377 8862 gene locus_tag LOCUS_02270 9377 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11098 9374 gene locus_tag LOCUS_02280 11098 9374 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_02280 12538 11309 gene locus_tag LOCUS_02290 gene rlmD 12538 11309 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_02290 12836 13900 gene locus_tag LOCUS_02300 12836 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 14245 14072 gene locus_tag LOCUS_02310 14245 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 14677 15825 gene locus_tag LOCUS_02320 14677 15825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_02320 15852 16853 gene locus_tag LOCUS_02330 15852 16853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_02330 16875 18425 gene locus_tag LOCUS_02340 16875 18425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_02340 18659 19705 gene locus_tag LOCUS_02350 gene recA 18659 19705 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_02350 20392 21033 gene locus_tag LOCUS_02360 20392 21033 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence010 348 1346 gene locus_tag LOCUS_02370 348 1346 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_02370 1661 1398 gene locus_tag LOCUS_02380 1661 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1753 2469 gene locus_tag LOCUS_02390 1753 2469 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808326.1 protein_id gnl|my_center|LOCUS_02390 2466 3596 gene locus_tag LOCUS_02400 2466 3596 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_02400 4021 5310 gene locus_tag LOCUS_02410 4021 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5495 5749 gene locus_tag LOCUS_02420 5495 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5845 5976 gene locus_tag LOCUS_02430 5845 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5995 6147 gene locus_tag LOCUS_02440 5995 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6150 6434 gene locus_tag LOCUS_02450 6150 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7220 8137 gene locus_tag LOCUS_02460 7220 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 8715 8924 gene locus_tag LOCUS_02470 8715 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8918 9367 gene locus_tag LOCUS_02480 8918 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9425 10213 gene locus_tag LOCUS_02490 9425 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 10197 10469 gene locus_tag LOCUS_02500 10197 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10515 11198 gene locus_tag LOCUS_02510 10515 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 11416 13635 gene locus_tag LOCUS_02520 11416 13635 CDS product C25 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256976.1 protein_id gnl|my_center|LOCUS_02520 14137 13892 gene locus_tag LOCUS_02530 14137 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 14835 14356 gene locus_tag LOCUS_02540 14835 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 14953 17013 gene locus_tag LOCUS_02550 14953 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 17440 17673 gene locus_tag LOCUS_02560 17440 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 17655 18743 gene locus_tag LOCUS_02570 17655 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 19144 18902 gene locus_tag LOCUS_02580 19144 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 19119 19676 gene locus_tag LOCUS_02590 19119 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19613 20026 gene locus_tag LOCUS_02600 19613 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 20030 20530 gene locus_tag LOCUS_02610 20030 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02610 20792 21118 gene locus_tag LOCUS_02620 20792 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 21115 21393 gene locus_tag LOCUS_02630 21115 21393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence011 645 352 gene locus_tag LOCUS_02640 645 352 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660651.1 protein_id gnl|my_center|LOCUS_02640 1037 642 gene locus_tag LOCUS_02650 1037 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 1675 1031 gene locus_tag LOCUS_02660 1675 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1941 1672 gene locus_tag LOCUS_02670 1941 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2350 2015 gene locus_tag LOCUS_02680 gene sdhC 2350 2015 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544970.1 protein_id gnl|my_center|LOCUS_02680 2765 2364 gene locus_tag LOCUS_02690 2765 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3486 2779 gene locus_tag LOCUS_02700 3486 2779 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_02700 4664 3489 gene locus_tag LOCUS_02710 4664 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6669 5152 gene locus_tag LOCUS_02720 gene glpK 6669 5152 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_02720 7469 6807 gene locus_tag LOCUS_02730 gene dhaL 7469 6807 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_02730 8618 7545 gene locus_tag LOCUS_02740 gene dhaK 8618 7545 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_02740 9563 8763 gene locus_tag LOCUS_02750 9563 8763 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_02750 11882 10254 gene locus_tag LOCUS_02760 11882 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 12158 11973 gene locus_tag LOCUS_02770 12158 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 13547 12171 gene locus_tag LOCUS_02780 13547 12171 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_02780 15378 13654 gene locus_tag LOCUS_02790 15378 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 15475 16431 gene locus_tag LOCUS_02800 15475 16431 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233437.1 protein_id gnl|my_center|LOCUS_02800 16517 17449 gene locus_tag LOCUS_02810 gene mdh 16517 17449 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_02810 17736 19037 gene locus_tag LOCUS_02820 gene larA 17736 19037 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_02820 19342 19169 gene locus_tag LOCUS_02830 19342 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19417 20538 gene locus_tag LOCUS_02840 gene dprA 19417 20538 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence012 2487 874 gene locus_tag LOCUS_02850 2487 874 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_02850 4761 2500 gene locus_tag LOCUS_02860 4761 2500 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_02860 6815 5010 gene locus_tag LOCUS_02870 6815 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7235 7053 gene locus_tag LOCUS_02880 7235 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7593 7339 gene locus_tag LOCUS_02890 7593 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7808 7641 gene locus_tag LOCUS_02900 7808 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 8109 7822 gene locus_tag LOCUS_02910 8109 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 8425 8156 gene locus_tag LOCUS_02920 8425 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704401.1 protein_id gnl|my_center|LOCUS_02920 9209 8985 gene locus_tag LOCUS_02930 9209 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 9463 9209 gene locus_tag LOCUS_02940 9463 9209 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_02940 10201 9854 gene locus_tag LOCUS_02950 gene mazF 10201 9854 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_02950 10425 10195 gene locus_tag LOCUS_02960 10425 10195 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_02960 12051 10669 gene locus_tag LOCUS_02970 12051 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12503 12282 gene locus_tag LOCUS_02980 12503 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13749 13078 gene locus_tag LOCUS_02990 13749 13078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255961.1 protein_id gnl|my_center|LOCUS_02990 14234 14001 gene locus_tag LOCUS_03000 14234 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14649 14410 gene locus_tag LOCUS_03010 14649 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15672 14746 gene locus_tag LOCUS_03020 15672 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16646 16446 gene locus_tag LOCUS_03030 16646 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16931 16659 gene locus_tag LOCUS_03040 16931 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 17541 17134 gene locus_tag LOCUS_03050 17541 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 17756 17541 gene locus_tag LOCUS_03060 17756 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 18263 18132 gene locus_tag LOCUS_03070 18263 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 19193 18735 gene locus_tag LOCUS_03080 19193 18735 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_03080 19466 19257 gene locus_tag LOCUS_03090 19466 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 20542 19655 gene locus_tag LOCUS_03100 20542 19655 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331313.1 protein_id gnl|my_center|LOCUS_03100 20825 20562 gene locus_tag LOCUS_03110 20825 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence013 1711 482 gene locus_tag LOCUS_03120 1711 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3039 2050 gene locus_tag LOCUS_03130 3039 2050 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_03130 3679 3044 gene locus_tag LOCUS_03140 3679 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3959 4642 gene locus_tag LOCUS_03150 3959 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4789 5472 gene locus_tag LOCUS_03160 4789 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5488 6354 gene locus_tag LOCUS_03170 5488 6354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_03170 7364 6411 gene locus_tag LOCUS_03180 7364 6411 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_03180 8358 7738 gene locus_tag LOCUS_03190 8358 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 10011 8479 gene locus_tag LOCUS_03200 10011 8479 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_03200 10721 10011 gene locus_tag LOCUS_03210 10721 10011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_03210 11700 10756 gene locus_tag LOCUS_03220 11700 10756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03220 12235 12519 gene locus_tag LOCUS_03230 12235 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 12523 14313 gene locus_tag LOCUS_03240 12523 14313 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_03240 14325 15029 gene locus_tag LOCUS_03250 14325 15029 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_03250 15183 15413 gene locus_tag LOCUS_03260 15183 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 16182 15343 gene locus_tag LOCUS_03270 16182 15343 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566050.1 protein_id gnl|my_center|LOCUS_03270 17556 16231 gene locus_tag LOCUS_03280 17556 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 18122 17943 gene locus_tag LOCUS_03290 18122 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 18687 18088 gene locus_tag LOCUS_03300 18687 18088 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_03300 <19608 18792 gene locus_tag LOCUS_03310 <19608 18792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228691.1:phospholipase D-like domain-containing protein >Feature sequence014 957 142 gene locus_tag LOCUS_03320 gene murI 957 142 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 protein_id gnl|my_center|LOCUS_03320 2231 954 gene locus_tag LOCUS_03330 2231 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4098 2437 gene locus_tag LOCUS_03340 4098 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5198 4206 gene locus_tag LOCUS_03350 gene wtpA 5198 4206 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_03350 6039 5425 gene locus_tag LOCUS_03360 gene nadD 6039 5425 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869642.1 protein_id gnl|my_center|LOCUS_03360 7309 6029 gene locus_tag LOCUS_03370 gene obgE 7309 6029 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_03370 8107 7313 gene locus_tag LOCUS_03380 8107 7313 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_03380 9836 11071 gene locus_tag LOCUS_03390 9836 11071 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_03390 11240 12112 gene locus_tag LOCUS_03400 11240 12112 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_03400 12230 13261 gene locus_tag LOCUS_03410 12230 13261 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_03410 13264 14043 gene locus_tag LOCUS_03420 13264 14043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_03420 14058 14762 gene locus_tag LOCUS_03430 14058 14762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_03430 15300 15521 gene locus_tag LOCUS_03440 15300 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 15611 18505 gene locus_tag LOCUS_03450 15611 18505 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence015 187 1356 gene locus_tag LOCUS_03460 gene nuoH 187 1356 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_03460 1375 1875 gene locus_tag LOCUS_03470 1375 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 1897 2205 gene locus_tag LOCUS_03480 gene nuoK 1897 2205 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_03480 2288 4405 gene locus_tag LOCUS_03490 gene nuoL 2288 4405 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_03490 4516 6051 gene locus_tag LOCUS_03500 4516 6051 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_03500 6118 7590 gene locus_tag LOCUS_03510 6118 7590 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_03510 8176 11301 gene locus_tag LOCUS_03520 8176 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11568 13001 gene locus_tag LOCUS_03530 11568 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 13377 14228 gene locus_tag LOCUS_03540 13377 14228 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_03540 14352 15743 gene locus_tag LOCUS_03550 14352 15743 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_03550 16354 17556 gene locus_tag LOCUS_03560 16354 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 17672 17986 gene locus_tag LOCUS_03570 17672 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence016 3688 1619 gene locus_tag LOCUS_03580 gene fusA 3688 1619 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03580 4383 3913 gene locus_tag LOCUS_03590 gene rpsG 4383 3913 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_03590 5193 4777 gene locus_tag LOCUS_03600 gene rpsL 5193 4777 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_03600 10402 5774 gene locus_tag LOCUS_03610 10402 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14537 10608 gene locus_tag LOCUS_03620 14537 10608 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 protein_id gnl|my_center|LOCUS_03620 16582 15554 gene locus_tag LOCUS_03630 16582 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 <18565 16599 gene locus_tag LOCUS_03640 <18565 16599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259579.1:penicillin acylase family protein >Feature sequence017 <1 1110 gene locus_tag LOCUS_03650 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187352.1:putative glycoside hydrolase 1593 3989 gene locus_tag LOCUS_03660 1593 3989 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_03660 4053 5750 gene locus_tag LOCUS_03670 4053 5750 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_03670 7561 5897 gene locus_tag LOCUS_03680 gene hutU 7561 5897 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_03680 8409 7684 gene locus_tag LOCUS_03690 8409 7684 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_03690 8828 9835 gene locus_tag LOCUS_03700 gene holB 8828 9835 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_03700 9878 10675 gene locus_tag LOCUS_03710 9878 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11730 10849 gene locus_tag LOCUS_03720 11730 10849 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_03720 13032 11800 gene locus_tag LOCUS_03730 13032 11800 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03730 13844 13029 gene locus_tag LOCUS_03740 gene trpA 13844 13029 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_03740 15075 13831 gene locus_tag LOCUS_03750 gene trpB 15075 13831 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_03750 15552 15794 gene locus_tag LOCUS_03760 15552 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 15784 17529 gene locus_tag LOCUS_03770 gene recN 15784 17529 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_03770 17550 18236 gene locus_tag LOCUS_03780 17550 18236 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence018 204 689 gene locus_tag LOCUS_03790 gene coaD 204 689 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_03790 805 1155 gene locus_tag LOCUS_03800 805 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1403 4375 gene locus_tag LOCUS_03810 1403 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4640 8239 gene locus_tag LOCUS_03820 4640 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 8310 8534 gene locus_tag LOCUS_03830 8310 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10327 8999 gene locus_tag LOCUS_03840 10327 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 11288 10419 gene locus_tag LOCUS_03850 gene ubiA 11288 10419 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_03850 12810 11620 gene locus_tag LOCUS_03860 12810 11620 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_03860 14711 13158 gene locus_tag LOCUS_03870 gene murJ 14711 13158 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_03870 16024 14810 gene locus_tag LOCUS_03880 16024 14810 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_03880 17615 16515 gene locus_tag LOCUS_03890 17615 16515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence019 1006 2019 gene locus_tag LOCUS_03900 gene aroF 1006 2019 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_03900 2156 3181 gene locus_tag LOCUS_03910 gene aroF 2156 3181 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_03910 3949 5802 gene locus_tag LOCUS_03920 gene glmS 3949 5802 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_03920 6915 6157 gene locus_tag LOCUS_03930 gene rsmG 6915 6157 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_03930 8384 6969 gene locus_tag LOCUS_03940 8384 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8988 8302 gene locus_tag LOCUS_03950 8988 8302 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_03950 10381 9017 gene locus_tag LOCUS_03960 gene dnaB 10381 9017 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_03960 11051 10512 gene locus_tag LOCUS_03970 11051 10512 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_03970 13066 11615 gene locus_tag LOCUS_03980 13066 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_03980 14703 13708 gene locus_tag LOCUS_03990 14703 13708 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_03990 16299 14959 gene locus_tag LOCUS_04000 gene thrC 16299 14959 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122990.1 protein_id gnl|my_center|LOCUS_04000 <17844 16502 gene locus_tag LOCUS_04010 <17844 16502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392141.1:glycine--tRNA ligase subunit beta >Feature sequence020 <1 737 gene locus_tag LOCUS_04020 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817158.1:electron transfer flavoprotein subunit beta/FixA family protein 751 1719 gene locus_tag LOCUS_04030 751 1719 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_04030 1999 2208 gene locus_tag LOCUS_04040 1999 2208 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_04040 2317 2556 gene locus_tag LOCUS_04050 2317 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 2704 3426 gene locus_tag LOCUS_04060 gene lexA 2704 3426 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_04060 3547 4611 gene locus_tag LOCUS_04070 3547 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4608 4952 gene locus_tag LOCUS_04080 4608 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5292 6569 gene locus_tag LOCUS_04090 5292 6569 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_04090 8641 6656 gene locus_tag LOCUS_04100 8641 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 8898 8683 gene locus_tag LOCUS_04110 8898 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9234 9740 gene locus_tag LOCUS_04120 9234 9740 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_04120 10072 11085 gene locus_tag LOCUS_04130 gene argC 10072 11085 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_04130 11096 11866 gene locus_tag LOCUS_04140 gene argB 11096 11866 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259245.1 protein_id gnl|my_center|LOCUS_04140 12137 13321 gene locus_tag LOCUS_04150 12137 13321 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_04150 13278 13805 gene locus_tag LOCUS_04160 13278 13805 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_04160 13826 14866 gene locus_tag LOCUS_04170 13826 14866 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257791.1 protein_id gnl|my_center|LOCUS_04170 14913 15434 gene locus_tag LOCUS_04180 14913 15434 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 protein_id gnl|my_center|LOCUS_04180 15629 16351 gene locus_tag LOCUS_04190 15629 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence021 2 937 gene locus_tag LOCUS_04200 2 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 934 1131 gene locus_tag LOCUS_04210 934 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1397 2188 gene locus_tag LOCUS_04220 1397 2188 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_04220 3789 2653 gene locus_tag LOCUS_04230 3789 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3764 4288 gene locus_tag LOCUS_04240 3764 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04240 4531 5379 gene locus_tag LOCUS_04250 4531 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5376 5669 gene locus_tag LOCUS_04260 5376 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7132 5771 gene locus_tag LOCUS_04270 7132 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8616 7153 gene locus_tag LOCUS_04280 8616 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 9225 8935 gene locus_tag LOCUS_04290 9225 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256207.1 protein_id gnl|my_center|LOCUS_04290 10783 9284 gene locus_tag LOCUS_04300 10783 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11900 10923 gene locus_tag LOCUS_04310 11900 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 12488 13405 gene locus_tag LOCUS_04320 12488 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13860 14396 gene locus_tag LOCUS_04330 13860 14396 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_04330 14396 14797 gene locus_tag LOCUS_04340 14396 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence022 <1 3183 gene locus_tag LOCUS_04350 <1 3183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258505.1:GAF domain-containing protein 4564 3557 gene locus_tag LOCUS_04360 4564 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4731 4561 gene locus_tag LOCUS_04370 4731 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5823 5026 gene locus_tag LOCUS_04380 5823 5026 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_04380 7608 6196 gene locus_tag LOCUS_04390 gene purB 7608 6196 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_04390 8888 7605 gene locus_tag LOCUS_04400 8888 7605 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257810.1 protein_id gnl|my_center|LOCUS_04400 10431 8962 gene locus_tag LOCUS_04410 gene guaB 10431 8962 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_04410 10744 10463 gene locus_tag LOCUS_04420 10744 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11160 10759 gene locus_tag LOCUS_04430 11160 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 11957 11157 gene locus_tag LOCUS_04440 gene hisF 11957 11157 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_04440 12621 12013 gene locus_tag LOCUS_04450 12621 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 13394 12621 gene locus_tag LOCUS_04460 gene hisA 13394 12621 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_04460 14062 13421 gene locus_tag LOCUS_04470 gene hisH 14062 13421 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_04470 14679 14080 gene locus_tag LOCUS_04480 gene hisB 14679 14080 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_04480 <16079 14776 gene locus_tag LOCUS_04490 <16079 14776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257493.1:helicase C-terminal domain-containing protein >Feature sequence023 984 43 gene locus_tag LOCUS_04500 984 43 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_04500 2285 981 gene locus_tag LOCUS_04510 gene hpnJ 2285 981 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_04510 2650 2282 gene locus_tag LOCUS_04520 2650 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4403 2622 gene locus_tag LOCUS_04530 4403 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6036 4417 gene locus_tag LOCUS_04540 6036 4417 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_04540 6754 6041 gene locus_tag LOCUS_04550 6754 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8689 6965 gene locus_tag LOCUS_04560 8689 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9341 12925 gene locus_tag LOCUS_04570 9341 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14211 13099 gene locus_tag LOCUS_04580 gene ald 14211 13099 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_04580 15300 14284 gene locus_tag LOCUS_04590 15300 14284 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence024 213 665 gene locus_tag LOCUS_04600 213 665 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_04600 1653 715 gene locus_tag LOCUS_04610 1653 715 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_04610 2908 2081 gene locus_tag LOCUS_04620 2908 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3672 2905 gene locus_tag LOCUS_04630 3672 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4370 3666 gene locus_tag LOCUS_04640 4370 3666 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_04640 4789 4529 gene locus_tag LOCUS_04650 4789 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6219 5023 gene locus_tag LOCUS_04660 6219 5023 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_04660 7445 6678 gene locus_tag LOCUS_04670 7445 6678 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_04670 9099 7429 gene locus_tag LOCUS_04680 9099 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9790 9170 gene locus_tag LOCUS_04690 gene recR 9790 9170 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256424.1 protein_id gnl|my_center|LOCUS_04690 10416 10051 gene locus_tag LOCUS_04700 10416 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 12097 10409 gene locus_tag LOCUS_04710 gene dnaX 12097 10409 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_04710 14225 12108 gene locus_tag LOCUS_04720 14225 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14889 15659 gene locus_tag LOCUS_04730 14889 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence025 1035 1820 gene locus_tag LOCUS_04740 1035 1820 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_04740 1817 2557 gene locus_tag LOCUS_04750 1817 2557 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409382.1 protein_id gnl|my_center|LOCUS_04750 2759 4348 gene locus_tag LOCUS_04760 2759 4348 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_04760 4626 5489 gene locus_tag LOCUS_04770 4626 5489 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_04770 5513 6838 gene locus_tag LOCUS_04780 5513 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6948 7787 gene locus_tag LOCUS_04790 6948 7787 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932247.1 protein_id gnl|my_center|LOCUS_04790 8090 10792 gene locus_tag LOCUS_04800 8090 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 10830 11663 gene locus_tag LOCUS_04810 10830 11663 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_04810 11932 12489 gene locus_tag LOCUS_04820 11932 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 12857 13792 gene locus_tag LOCUS_04830 12857 13792 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_04830 13889 14740 gene locus_tag LOCUS_04840 13889 14740 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_04840 14737 15420 gene locus_tag LOCUS_04850 14737 15420 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence026 983 9 gene locus_tag LOCUS_04860 gene rpoD 983 9 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_04860 2114 1251 gene locus_tag LOCUS_04870 2114 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3331 4404 gene locus_tag LOCUS_04880 3331 4404 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070801.1 protein_id gnl|my_center|LOCUS_04880 5204 4875 gene locus_tag LOCUS_04890 5204 4875 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_04890 5857 5204 gene locus_tag LOCUS_04900 gene tmk 5857 5204 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_04900 7399 5864 gene locus_tag LOCUS_04910 7399 5864 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_04910 8467 7421 gene locus_tag LOCUS_04920 8467 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 9073 9378 gene locus_tag LOCUS_04930 9073 9378 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066790080.1 protein_id gnl|my_center|LOCUS_04930 10608 9412 gene locus_tag LOCUS_04940 gene queG 10608 9412 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_04940 12167 10617 gene locus_tag LOCUS_04950 12167 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 14989 12155 gene locus_tag LOCUS_04960 14989 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <15732 15095 gene locus_tag LOCUS_04970 <15732 15095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426511.1:mannose-1-phosphate guanylyltransferase >Feature sequence027 <1 680 gene locus_tag LOCUS_04980 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037226281.1:glycosyltransferase family 4 protein 2037 808 gene locus_tag LOCUS_04990 2037 808 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_04990 3224 2325 gene locus_tag LOCUS_05000 3224 2325 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224665.1 protein_id gnl|my_center|LOCUS_05000 4184 3228 gene locus_tag LOCUS_05010 4184 3228 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_05010 5901 4435 gene locus_tag LOCUS_05020 5901 4435 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_05020 7047 6031 gene locus_tag LOCUS_05030 7047 6031 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_05030 8539 7853 gene locus_tag LOCUS_05040 8539 7853 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_05040 10015 8561 gene locus_tag LOCUS_05050 10015 8561 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_05050 12760 10019 gene locus_tag LOCUS_05060 gene gyrA 12760 10019 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_05060 13874 14497 gene locus_tag LOCUS_05070 13874 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence028 1343 216 gene locus_tag LOCUS_05080 1343 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2736 1360 gene locus_tag LOCUS_05090 2736 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3126 2785 gene locus_tag LOCUS_05100 3126 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4165 3140 gene locus_tag LOCUS_05110 4165 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4706 4158 gene locus_tag LOCUS_05120 4706 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5664 4699 gene locus_tag LOCUS_05130 5664 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6498 5668 gene locus_tag LOCUS_05140 gene csx7 6498 5668 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_05140 6971 6495 gene locus_tag LOCUS_05150 6971 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 8260 6968 gene locus_tag LOCUS_05160 8260 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 8931 8248 gene locus_tag LOCUS_05170 gene csx7 8931 8248 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_05170 10739 8910 gene locus_tag LOCUS_05180 10739 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258154.1 protein_id gnl|my_center|LOCUS_05180 12209 10860 gene locus_tag LOCUS_05190 12209 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 12375 12563 gene locus_tag LOCUS_05200 12375 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 12564 13652 gene locus_tag LOCUS_05210 12564 13652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13667 14617 gene locus_tag LOCUS_05220 gene rfaD 13667 14617 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587750.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence029 2103 400 gene locus_tag LOCUS_05230 2103 400 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_05230 3342 2251 gene locus_tag LOCUS_05240 gene leuB 3342 2251 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_05240 5119 4019 gene locus_tag LOCUS_05250 5119 4019 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_05250 6184 5285 gene locus_tag LOCUS_05260 6184 5285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529473.1 protein_id gnl|my_center|LOCUS_05260 7814 6279 gene locus_tag LOCUS_05270 7814 6279 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_05270 8683 7865 gene locus_tag LOCUS_05280 gene fabG 8683 7865 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_05280 9598 8714 gene locus_tag LOCUS_05290 9598 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 10452 9634 gene locus_tag LOCUS_05300 10452 9634 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_05300 11949 10486 gene locus_tag LOCUS_05310 11949 10486 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257565.1 protein_id gnl|my_center|LOCUS_05310 12949 11963 gene locus_tag LOCUS_05320 12949 11963 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_05320 13661 12936 gene locus_tag LOCUS_05330 13661 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 14724 13981 gene locus_tag LOCUS_05340 14724 13981 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009388335.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence030 1461 2096 gene locus_tag LOCUS_05350 1461 2096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966699.1 protein_id gnl|my_center|LOCUS_05350 2111 3556 gene locus_tag LOCUS_05360 2111 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4501 3602 gene locus_tag LOCUS_05370 4501 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5344 4520 gene locus_tag LOCUS_05380 5344 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 6827 5688 gene locus_tag LOCUS_05390 gene hybB 6827 5688 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_05390 7116 6829 gene locus_tag LOCUS_05400 7116 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7334 7113 gene locus_tag LOCUS_05410 7334 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 10348 7652 gene locus_tag LOCUS_05420 gene fdnG 10348 7652 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 protein_id gnl|my_center|LOCUS_05420 11615 12751 gene locus_tag LOCUS_05430 11615 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12767 13402 gene locus_tag LOCUS_05440 12767 13402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_05440 13531 14151 gene locus_tag LOCUS_05450 13531 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence031 2550 3455 gene locus_tag LOCUS_05460 2550 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4093 3677 gene locus_tag LOCUS_05470 4093 3677 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868448.1 protein_id gnl|my_center|LOCUS_05470 4374 4700 gene locus_tag LOCUS_05480 4374 4700 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_05480 4828 6636 gene locus_tag LOCUS_05490 4828 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 7040 7678 gene locus_tag LOCUS_05500 7040 7678 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_05500 7713 9080 gene locus_tag LOCUS_05510 gene mgtE 7713 9080 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_05510 9942 9328 gene locus_tag LOCUS_05520 gene plsY 9942 9328 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_05520 11163 10171 gene locus_tag LOCUS_05530 11163 10171 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_05530 12885 11806 gene locus_tag LOCUS_05540 12885 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13920 12901 gene locus_tag LOCUS_05550 13920 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence032 3488 2079 gene locus_tag LOCUS_05560 gene glpK 3488 2079 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975967.1 protein_id gnl|my_center|LOCUS_05560 5213 3684 gene locus_tag LOCUS_05570 5213 3684 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_05570 8260 5231 gene locus_tag LOCUS_05580 8260 5231 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909245.1 protein_id gnl|my_center|LOCUS_05580 10210 8468 gene locus_tag LOCUS_05590 10210 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12945 10405 gene locus_tag LOCUS_05600 12945 10405 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_05600 <14878 13044 gene locus_tag LOCUS_05610 <14878 13044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence033 <1 1841 gene locus_tag LOCUS_05620 <1 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403314.1:3'-5' exonuclease 2368 3705 gene locus_tag LOCUS_05630 2368 3705 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_05630 4897 3758 gene locus_tag LOCUS_05640 4897 3758 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142349.1 protein_id gnl|my_center|LOCUS_05640 5766 4951 gene locus_tag LOCUS_05650 5766 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 7531 5840 gene locus_tag LOCUS_05660 7531 5840 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257153.1 protein_id gnl|my_center|LOCUS_05660 8778 7531 gene locus_tag LOCUS_05670 8778 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9639 8965 gene locus_tag LOCUS_05680 9639 8965 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258171.1 protein_id gnl|my_center|LOCUS_05680 10515 10964 gene locus_tag LOCUS_05690 10515 10964 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_05690 11144 13309 gene locus_tag LOCUS_05700 11144 13309 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_05700 13306 13797 gene locus_tag LOCUS_05710 gene ybeY 13306 13797 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_05710 13787 14197 gene locus_tag LOCUS_05720 13787 14197 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382764.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence034 1842 841 gene locus_tag LOCUS_05730 1842 841 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_05730 3647 2067 gene locus_tag LOCUS_05740 3647 2067 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_05740 4251 4457 gene locus_tag LOCUS_05750 4251 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4752 4570 gene locus_tag LOCUS_05760 4752 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5033 4884 gene locus_tag LOCUS_05770 5033 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5712 5086 gene locus_tag LOCUS_05780 5712 5086 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_05780 7511 5895 gene locus_tag LOCUS_05790 7511 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9500 7554 gene locus_tag LOCUS_05800 9500 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 9870 9607 gene locus_tag LOCUS_05810 9870 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 10150 10806 gene locus_tag LOCUS_05820 gene fsa 10150 10806 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869995.1 protein_id gnl|my_center|LOCUS_05820 10886 11566 gene locus_tag LOCUS_05830 10886 11566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_05830 11578 12957 gene locus_tag LOCUS_05840 11578 12957 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_05840 12968 14017 gene locus_tag LOCUS_05850 gene add 12968 14017 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence035 1112 2023 gene locus_tag LOCUS_05860 gene xerD 1112 2023 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_05860 2062 2904 gene locus_tag LOCUS_05870 2062 2904 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258778.1 protein_id gnl|my_center|LOCUS_05870 3518 3730 gene locus_tag LOCUS_05880 3518 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3720 4031 gene locus_tag LOCUS_05890 3720 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4075 5811 gene locus_tag LOCUS_05900 4075 5811 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_05900 6386 6171 gene locus_tag LOCUS_05910 6386 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6325 8136 gene locus_tag LOCUS_05920 6325 8136 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_05920 8300 8494 gene locus_tag LOCUS_05930 8300 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9036 8806 gene locus_tag LOCUS_05940 9036 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9191 10186 gene locus_tag LOCUS_05950 9191 10186 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975976.1 protein_id gnl|my_center|LOCUS_05950 10226 11338 gene locus_tag LOCUS_05960 10226 11338 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_05960 11354 12202 gene locus_tag LOCUS_05970 11354 12202 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_05970 12309 14204 gene locus_tag LOCUS_05980 12309 14204 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence036 4037 2322 gene locus_tag LOCUS_05990 gene recJ 4037 2322 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_05990 4337 4924 gene locus_tag LOCUS_06000 4337 4924 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_06000 5445 4984 gene locus_tag LOCUS_06010 5445 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6769 5615 gene locus_tag LOCUS_06020 6769 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256125.1 protein_id gnl|my_center|LOCUS_06020 7860 6760 gene locus_tag LOCUS_06030 gene asd 7860 6760 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_06030 8011 7847 gene locus_tag LOCUS_06040 8011 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8507 9922 gene locus_tag LOCUS_06050 gene glnA 8507 9922 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_06050 11071 10232 gene locus_tag LOCUS_06060 11071 10232 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259067.1 protein_id gnl|my_center|LOCUS_06060 12281 11037 gene locus_tag LOCUS_06070 gene fabF 12281 11037 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_06070 13242 12751 gene locus_tag LOCUS_06080 13242 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 14221 13508 gene locus_tag LOCUS_06090 14221 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence037 703 146 gene locus_tag LOCUS_06100 gene frr 703 146 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_06100 1562 846 gene locus_tag LOCUS_06110 gene pyrH 1562 846 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_06110 2163 1570 gene locus_tag LOCUS_06120 gene tsf 2163 1570 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_06120 3475 2537 gene locus_tag LOCUS_06130 3475 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3796 4785 gene locus_tag LOCUS_06140 gene rnz 3796 4785 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_06140 5100 5486 gene locus_tag LOCUS_06150 5100 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5517 6041 gene locus_tag LOCUS_06160 5517 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6732 6325 gene locus_tag LOCUS_06170 6732 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7271 6738 gene locus_tag LOCUS_06180 7271 6738 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814161.1 protein_id gnl|my_center|LOCUS_06180 8827 7268 gene locus_tag LOCUS_06190 8827 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9155 9080 gene locus_tag LOCUS_t00010 9155 9080 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10128 9244 gene locus_tag LOCUS_06200 gene metF 10128 9244 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_06200 10667 10452 gene locus_tag LOCUS_06210 10667 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10729 13107 gene locus_tag LOCUS_06220 10729 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 13118 13342 gene locus_tag LOCUS_06230 13118 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence038 <1 1155 gene locus_tag LOCUS_06240 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257906.1:ATP-dependent zinc metalloprotease FtsH 1405 2145 gene locus_tag LOCUS_06250 1405 2145 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_06250 2176 4131 gene locus_tag LOCUS_06260 2176 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4792 4172 gene locus_tag LOCUS_06270 4792 4172 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_06270 6332 4911 gene locus_tag LOCUS_06280 6332 4911 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104117.1 protein_id gnl|my_center|LOCUS_06280 6873 6349 gene locus_tag LOCUS_06290 6873 6349 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404467.1 protein_id gnl|my_center|LOCUS_06290 7142 7215 gene locus_tag LOCUS_t00020 7142 7215 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8597 7254 gene locus_tag LOCUS_06300 gene rimO 8597 7254 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_06300 9497 8607 gene locus_tag LOCUS_06310 9497 8607 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_06310 10192 9779 gene locus_tag LOCUS_06320 10192 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 11698 10355 gene locus_tag LOCUS_06330 11698 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 12882 11695 gene locus_tag LOCUS_06340 12882 11695 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence039 3115 821 gene locus_tag LOCUS_06350 3115 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6212 3402 gene locus_tag LOCUS_06360 6212 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6524 6339 gene locus_tag LOCUS_06370 6524 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7563 6466 gene locus_tag LOCUS_06380 7563 6466 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_06380 9378 7687 gene locus_tag LOCUS_06390 9378 7687 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_06390 10050 11444 gene locus_tag LOCUS_06400 10050 11444 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence040 1016 2761 gene locus_tag LOCUS_06410 1016 2761 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_06410 2790 3644 gene locus_tag LOCUS_06420 2790 3644 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_06420 4300 5079 gene locus_tag LOCUS_06430 4300 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5166 5723 gene locus_tag LOCUS_06440 gene efp 5166 5723 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_06440 6037 6258 gene locus_tag LOCUS_06450 6037 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 6274 7923 gene locus_tag LOCUS_06460 6274 7923 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_06460 8201 11335 gene locus_tag LOCUS_06470 8201 11335 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_06470 11340 12131 gene locus_tag LOCUS_06480 gene surE 11340 12131 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence041 5294 741 gene locus_tag LOCUS_06490 5294 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 6758 5649 gene locus_tag LOCUS_06500 6758 5649 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_06500 8799 7105 gene locus_tag LOCUS_06510 8799 7105 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_06510 10124 9252 gene locus_tag LOCUS_06520 gene sucD 10124 9252 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_06520 11289 10147 gene locus_tag LOCUS_06530 gene sucC 11289 10147 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_06530 12738 11842 gene locus_tag LOCUS_06540 12738 11842 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057477.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence042 1633 2826 gene locus_tag LOCUS_06550 1633 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2823 3455 gene locus_tag LOCUS_06560 gene absA2 2823 3455 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 protein_id gnl|my_center|LOCUS_06560 3840 5897 gene locus_tag LOCUS_06570 3840 5897 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868596.1 protein_id gnl|my_center|LOCUS_06570 5901 6368 gene locus_tag LOCUS_06580 5901 6368 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_06580 6484 7947 gene locus_tag LOCUS_06590 6484 7947 CDS product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147047.1 protein_id gnl|my_center|LOCUS_06590 7952 9946 gene locus_tag LOCUS_06600 7952 9946 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147045.1 protein_id gnl|my_center|LOCUS_06600 9958 10881 gene locus_tag LOCUS_06610 9958 10881 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868592.1 protein_id gnl|my_center|LOCUS_06610 10913 12610 gene locus_tag LOCUS_06620 10913 12610 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868591.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence043 68 1441 gene locus_tag LOCUS_06630 68 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1449 3641 gene locus_tag LOCUS_06640 1449 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4257 5699 gene locus_tag LOCUS_06650 gene tig 4257 5699 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_06650 6558 7166 gene locus_tag LOCUS_06660 6558 7166 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_06660 7163 8446 gene locus_tag LOCUS_06670 gene clpX 7163 8446 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071917.1 protein_id gnl|my_center|LOCUS_06670 8585 8941 gene locus_tag LOCUS_06680 8585 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10381 9152 gene locus_tag LOCUS_06690 10381 9152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_06690 11151 10378 gene locus_tag LOCUS_06700 11151 10378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_06700 12555 11170 gene locus_tag LOCUS_06710 12555 11170 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence044 1970 2359 gene locus_tag LOCUS_06720 1970 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2530 2916 gene locus_tag LOCUS_06730 2530 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3245 3733 gene locus_tag LOCUS_06740 3245 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4045 6489 gene locus_tag LOCUS_06750 4045 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6505 7317 gene locus_tag LOCUS_06760 6505 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7414 7569 gene locus_tag LOCUS_06770 7414 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 7773 8057 gene locus_tag LOCUS_06780 7773 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8041 8511 gene locus_tag LOCUS_06790 8041 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8515 9186 gene locus_tag LOCUS_06800 8515 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 9183 11297 gene locus_tag LOCUS_06810 9183 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 11294 12280 gene locus_tag LOCUS_06820 11294 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence045 1527 289 gene locus_tag LOCUS_06830 1527 289 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_06830 2416 1961 gene locus_tag LOCUS_06840 2416 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3538 2825 gene locus_tag LOCUS_06850 3538 2825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_06850 4305 3538 gene locus_tag LOCUS_06860 4305 3538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_06860 5273 4302 gene locus_tag LOCUS_06870 5273 4302 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_06870 6139 5276 gene locus_tag LOCUS_06880 6139 5276 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064222.1 protein_id gnl|my_center|LOCUS_06880 7531 6224 gene locus_tag LOCUS_06890 7531 6224 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_06890 8661 9072 gene locus_tag LOCUS_tm00010 8661 9072 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9468 9112 gene locus_tag LOCUS_06900 9468 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 10297 9470 gene locus_tag LOCUS_06910 10297 9470 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_06910 12357 10294 gene locus_tag LOCUS_06920 gene uvrB 12357 10294 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence046 305 1543 gene locus_tag LOCUS_06930 305 1543 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_06930 1697 2578 gene locus_tag LOCUS_06940 1697 2578 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_06940 2581 3666 gene locus_tag LOCUS_06950 gene serC 2581 3666 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_06950 4201 5970 gene locus_tag LOCUS_06960 4201 5970 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_06960 5957 6802 gene locus_tag LOCUS_06970 5957 6802 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 protein_id gnl|my_center|LOCUS_06970 7041 7586 gene locus_tag LOCUS_06980 7041 7586 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_06980 7595 8359 gene locus_tag LOCUS_06990 7595 8359 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_06990 8737 9816 gene locus_tag LOCUS_07000 gene tdh 8737 9816 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_07000 9873 11057 gene locus_tag LOCUS_07010 9873 11057 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_07010 11370 12458 gene locus_tag LOCUS_07020 11370 12458 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence047 3 1679 gene locus_tag LOCUS_07030 3 1679 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256859.1 protein_id gnl|my_center|LOCUS_07030 2774 1695 gene locus_tag LOCUS_07040 gene queA 2774 1695 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_07040 3021 2782 gene locus_tag LOCUS_07050 3021 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3730 3011 gene locus_tag LOCUS_07060 3730 3011 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_07060 4821 3727 gene locus_tag LOCUS_07070 gene ruvB 4821 3727 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_07070 5636 4998 gene locus_tag LOCUS_07080 5636 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6033 6419 gene locus_tag LOCUS_07090 6033 6419 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_07090 7174 6728 gene locus_tag LOCUS_07100 7174 6728 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_07100 7732 7457 gene locus_tag LOCUS_07110 gene groES 7732 7457 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_07110 8086 7832 gene locus_tag LOCUS_07120 8086 7832 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_07120 9045 8386 gene locus_tag LOCUS_07130 9045 8386 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_07130 10573 9245 gene locus_tag LOCUS_07140 10573 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11558 10692 gene locus_tag LOCUS_07150 11558 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11948 11667 gene locus_tag LOCUS_07160 11948 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 12360 12545 gene locus_tag LOCUS_07170 12360 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence048 2131 836 gene locus_tag LOCUS_07180 2131 836 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_07180 3078 2374 gene locus_tag LOCUS_07190 3078 2374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_07190 3796 3071 gene locus_tag LOCUS_07200 3796 3071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_07200 4778 3774 gene locus_tag LOCUS_07210 4778 3774 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_07210 5644 4775 gene locus_tag LOCUS_07220 5644 4775 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_07220 6994 5711 gene locus_tag LOCUS_07230 6994 5711 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_07230 7429 7073 gene locus_tag LOCUS_07240 7429 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 9594 7864 gene locus_tag LOCUS_07250 9594 7864 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391751.1 protein_id gnl|my_center|LOCUS_07250 12037 10238 gene locus_tag LOCUS_07260 12037 10238 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258584.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence049 286 2427 gene locus_tag LOCUS_07270 286 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3659 2682 gene locus_tag LOCUS_07280 3659 2682 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_07280 4096 3656 gene locus_tag LOCUS_07290 4096 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4814 4101 gene locus_tag LOCUS_07300 4814 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5062 8307 gene locus_tag LOCUS_07310 gene carB 5062 8307 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_07310 8304 8876 gene locus_tag LOCUS_07320 8304 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 9394 10641 gene locus_tag LOCUS_07330 gene tyrS 9394 10641 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_07330 10746 11573 gene locus_tag LOCUS_07340 10746 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence050 342 58 gene locus_tag LOCUS_07350 342 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 569 339 gene locus_tag LOCUS_07360 569 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4387 1412 gene locus_tag LOCUS_07370 4387 1412 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_07370 5143 4400 gene locus_tag LOCUS_07380 5143 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6316 5678 gene locus_tag LOCUS_07390 6316 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07390 7091 6321 gene locus_tag LOCUS_07400 7091 6321 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_07400 10285 7088 gene locus_tag LOCUS_07410 10285 7088 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence051 <1 1955 gene locus_tag LOCUS_07420 <1 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256248.1:DNA polymerase I 2142 3806 gene locus_tag LOCUS_07430 gene argS 2142 3806 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_07430 3852 5438 gene locus_tag LOCUS_07440 gene serA 3852 5438 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_07440 5966 5682 gene locus_tag LOCUS_07450 5966 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_07450 <12169 6524 gene locus_tag LOCUS_07460 <12169 6524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001015947.1:MG2 domain-containing protein >Feature sequence052 729 46 gene locus_tag LOCUS_07470 729 46 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_07470 1347 733 gene locus_tag LOCUS_07480 1347 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2374 1358 gene locus_tag LOCUS_07490 2374 1358 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_07490 3650 2454 gene locus_tag LOCUS_07500 3650 2454 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_07500 4840 3653 gene locus_tag LOCUS_07510 4840 3653 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_07510 6430 5120 gene locus_tag LOCUS_07520 6430 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7699 6461 gene locus_tag LOCUS_07530 7699 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8081 7806 gene locus_tag LOCUS_07540 8081 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8904 8251 gene locus_tag LOCUS_07550 8904 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 10244 9144 gene locus_tag LOCUS_07560 10244 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 11430 10228 gene locus_tag LOCUS_07570 11430 10228 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_07570 <12156 11512 gene locus_tag LOCUS_07580 <12156 11512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868579.1:glycosyltransferase family 4 protein >Feature sequence053 590 2830 gene locus_tag LOCUS_07590 590 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3194 3877 gene locus_tag LOCUS_07600 3194 3877 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_07600 3874 4848 gene locus_tag LOCUS_07610 gene era 3874 4848 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_07610 4958 5830 gene locus_tag LOCUS_07620 4958 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 6058 6681 gene locus_tag LOCUS_07630 6058 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 6771 7547 gene locus_tag LOCUS_07640 6771 7547 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_07640 7836 7660 gene locus_tag LOCUS_07650 7836 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7853 8593 gene locus_tag LOCUS_07660 7853 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 8663 9742 gene locus_tag LOCUS_07670 8663 9742 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257871.1 protein_id gnl|my_center|LOCUS_07670 9748 10716 gene locus_tag LOCUS_07680 9748 10716 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_07680 10713 11735 gene locus_tag LOCUS_07690 10713 11735 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence054 <1 1580 gene locus_tag LOCUS_07700 <1 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583043.1:ABC transporter ATP-binding protein 1664 1873 gene locus_tag LOCUS_07710 1664 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2111 2683 gene locus_tag LOCUS_07720 2111 2683 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_07720 2673 3284 gene locus_tag LOCUS_07730 2673 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3271 4362 gene locus_tag LOCUS_07740 3271 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4355 5257 gene locus_tag LOCUS_07750 gene rsmA 4355 5257 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_07750 5619 6041 gene locus_tag LOCUS_07760 5619 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8189 6111 gene locus_tag LOCUS_07770 gene fusA 8189 6111 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_07770 9209 8559 gene locus_tag LOCUS_07780 9209 8559 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_07780 9643 9206 gene locus_tag LOCUS_07790 9643 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 10971 9808 gene locus_tag LOCUS_07800 10971 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11654 11211 gene locus_tag LOCUS_07810 11654 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence055 743 1414 gene locus_tag LOCUS_07820 743 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1857 4067 gene locus_tag LOCUS_07830 1857 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5259 3997 gene locus_tag LOCUS_07840 5259 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5893 7191 gene locus_tag LOCUS_07850 5893 7191 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_07850 7547 8452 gene locus_tag LOCUS_07860 7547 8452 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_07860 8459 9349 gene locus_tag LOCUS_07870 8459 9349 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_07870 10370 11794 gene locus_tag LOCUS_07880 10370 11794 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence056 701 2386 gene locus_tag LOCUS_07890 701 2386 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_07890 2951 3424 gene locus_tag LOCUS_07900 2951 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3516 5522 gene locus_tag LOCUS_07910 3516 5522 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257772.1 protein_id gnl|my_center|LOCUS_07910 6447 5578 gene locus_tag LOCUS_07920 6447 5578 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_07920 7714 6797 gene locus_tag LOCUS_07930 7714 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_07930 8596 7721 gene locus_tag LOCUS_07940 8596 7721 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888338.1 protein_id gnl|my_center|LOCUS_07940 9381 8593 gene locus_tag LOCUS_07950 9381 8593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_07950 10792 9626 gene locus_tag LOCUS_07960 10792 9626 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_07960 11412 10948 gene locus_tag LOCUS_07970 11412 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence057 128 1360 gene locus_tag LOCUS_07980 128 1360 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_07980 1462 2082 gene locus_tag LOCUS_07990 1462 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2085 2843 gene locus_tag LOCUS_08000 2085 2843 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_08000 3070 4164 gene locus_tag LOCUS_08010 3070 4164 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_08010 4244 7081 gene locus_tag LOCUS_08020 4244 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7499 7128 gene locus_tag LOCUS_08030 7499 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8106 7780 gene locus_tag LOCUS_08040 8106 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9527 8196 gene locus_tag LOCUS_08050 9527 8196 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228691.1 protein_id gnl|my_center|LOCUS_08050 10151 9588 gene locus_tag LOCUS_08060 10151 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 10936 10157 gene locus_tag LOCUS_08070 10936 10157 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence058 100 300 gene locus_tag LOCUS_08080 gene rpmC 100 300 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_08080 304 555 gene locus_tag LOCUS_08090 gene rpsQ 304 555 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_08090 605 973 gene locus_tag LOCUS_08100 gene rplN 605 973 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_08100 985 1356 gene locus_tag LOCUS_08110 gene rplX 985 1356 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_08110 1387 1938 gene locus_tag LOCUS_08120 gene rplE 1387 1938 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258243.1 protein_id gnl|my_center|LOCUS_08120 1950 2132 gene locus_tag LOCUS_08130 1950 2132 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_08130 2384 2779 gene locus_tag LOCUS_08140 gene rpsH 2384 2779 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_08140 2806 3348 gene locus_tag LOCUS_08150 gene rplF 2806 3348 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_08150 3399 3764 gene locus_tag LOCUS_08160 gene rplR 3399 3764 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_08160 3790 4341 gene locus_tag LOCUS_08170 gene rpsE 3790 4341 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08170 4334 4534 gene locus_tag LOCUS_08180 gene rpmD 4334 4534 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_08180 4540 4995 gene locus_tag LOCUS_08190 gene rplO 4540 4995 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_08190 5089 6372 gene locus_tag LOCUS_08200 gene secY 5089 6372 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_08200 6654 7325 gene locus_tag LOCUS_08210 6654 7325 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258252.1 protein_id gnl|my_center|LOCUS_08210 7322 8107 gene locus_tag LOCUS_08220 gene map 7322 8107 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_08220 8269 8646 gene locus_tag LOCUS_08230 gene rpsM 8269 8646 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_08230 8715 9119 gene locus_tag LOCUS_08240 gene rpsK 8715 9119 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_08240 9507 9995 gene locus_tag LOCUS_08250 gene rpsD 9507 9995 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08250 10065 11012 gene locus_tag LOCUS_08260 10065 11012 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258258.1 protein_id gnl|my_center|LOCUS_08260 11045 11428 gene locus_tag LOCUS_08270 11045 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence059 960 85 gene locus_tag LOCUS_08280 960 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1090 2511 gene locus_tag LOCUS_08290 1090 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4042 2639 gene locus_tag LOCUS_08300 4042 2639 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_08300 5195 4254 gene locus_tag LOCUS_08310 5195 4254 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531925.1 protein_id gnl|my_center|LOCUS_08310 6708 5269 gene locus_tag LOCUS_08320 6708 5269 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597466.1 protein_id gnl|my_center|LOCUS_08320 7726 6833 gene locus_tag LOCUS_08330 7726 6833 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_08330 8902 8240 gene locus_tag LOCUS_08340 8902 8240 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_08340 11202 8908 gene locus_tag LOCUS_08350 11202 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence060 456 268 gene locus_tag LOCUS_08360 456 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 612 1340 gene locus_tag LOCUS_08370 612 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1749 1534 gene locus_tag LOCUS_08380 1749 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1833 4133 gene locus_tag LOCUS_08390 1833 4133 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257190.1 protein_id gnl|my_center|LOCUS_08390 4431 4904 gene locus_tag LOCUS_08400 4431 4904 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_08400 5892 4840 gene locus_tag LOCUS_08410 5892 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7795 5894 gene locus_tag LOCUS_08420 7795 5894 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_08420 8648 7890 gene locus_tag LOCUS_08430 8648 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9115 10170 gene locus_tag LOCUS_08440 9115 10170 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775666.1 protein_id gnl|my_center|LOCUS_08440 10447 10656 gene locus_tag LOCUS_08450 gene cspC 10447 10656 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234247.1 protein_id gnl|my_center|LOCUS_08450 10672 10983 gene locus_tag LOCUS_08460 10672 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence061 833 42 gene locus_tag LOCUS_08470 833 42 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_08470 1769 1239 gene locus_tag LOCUS_08480 1769 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2269 1766 gene locus_tag LOCUS_08490 gene pssD 2269 1766 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143701.1 protein_id gnl|my_center|LOCUS_08490 3255 2269 gene locus_tag LOCUS_08500 3255 2269 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868715.1 protein_id gnl|my_center|LOCUS_08500 4286 3252 gene locus_tag LOCUS_08510 4286 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5425 4283 gene locus_tag LOCUS_08520 5425 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6911 5418 gene locus_tag LOCUS_08530 6911 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8137 6908 gene locus_tag LOCUS_08540 8137 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9319 8141 gene locus_tag LOCUS_08550 9319 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 11108 9672 gene locus_tag LOCUS_08560 11108 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence062 1626 730 gene locus_tag LOCUS_08570 1626 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2064 1645 gene locus_tag LOCUS_08580 2064 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3190 2294 gene locus_tag LOCUS_08590 3190 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4661 3909 gene locus_tag LOCUS_08600 gene cobB 4661 3909 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_08600 5277 4702 gene locus_tag LOCUS_08610 5277 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5765 7336 gene locus_tag LOCUS_08620 5765 7336 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 protein_id gnl|my_center|LOCUS_08620 7372 8622 gene locus_tag LOCUS_08630 7372 8622 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_08630 9224 8922 gene locus_tag LOCUS_08640 9224 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 10021 9206 gene locus_tag LOCUS_08650 10021 9206 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_08650 10317 11477 gene locus_tag LOCUS_08660 10317 11477 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence063 469 1143 gene locus_tag LOCUS_08670 469 1143 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228173.1 protein_id gnl|my_center|LOCUS_08670 1140 2159 gene locus_tag LOCUS_08680 1140 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2456 4528 gene locus_tag LOCUS_08690 gene feoB 2456 4528 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_08690 5187 7034 gene locus_tag LOCUS_08700 gene ftsH 5187 7034 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_08700 7134 9332 gene locus_tag LOCUS_08710 7134 9332 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_08710 9531 9340 gene locus_tag LOCUS_08720 9531 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 10022 9843 gene locus_tag LOCUS_08730 10022 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10003 10686 gene locus_tag LOCUS_08740 10003 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence064 1620 1225 gene locus_tag LOCUS_08750 1620 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2457 1672 gene locus_tag LOCUS_08760 gene recO 2457 1672 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_08760 2810 2499 gene locus_tag LOCUS_08770 2810 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5436 2926 gene locus_tag LOCUS_08780 5436 2926 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_08780 8635 6131 gene locus_tag LOCUS_08790 8635 6131 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_08790 8956 10623 gene locus_tag LOCUS_08800 8956 10623 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_08800 11121 10648 gene locus_tag LOCUS_08810 11121 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence065 1370 84 gene locus_tag LOCUS_08820 1370 84 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_08820 2002 3201 gene locus_tag LOCUS_08830 2002 3201 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256990.1 protein_id gnl|my_center|LOCUS_08830 3242 4627 gene locus_tag LOCUS_08840 3242 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4691 5542 gene locus_tag LOCUS_08850 4691 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6022 7095 gene locus_tag LOCUS_08860 6022 7095 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_08860 7264 8175 gene locus_tag LOCUS_08870 7264 8175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_08870 8225 9256 gene locus_tag LOCUS_08880 8225 9256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583425.1 protein_id gnl|my_center|LOCUS_08880 9390 10259 gene locus_tag LOCUS_08890 9390 10259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence066 1130 54 gene locus_tag LOCUS_08900 1130 54 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_08900 2169 1174 gene locus_tag LOCUS_08910 gene cbiB 2169 1174 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_08910 2832 2194 gene locus_tag LOCUS_08920 2832 2194 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_08920 3614 2829 gene locus_tag LOCUS_08930 gene cobS 3614 2829 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_08930 4670 3618 gene locus_tag LOCUS_08940 gene cobT 4670 3618 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_08940 6170 4689 gene locus_tag LOCUS_08950 6170 4689 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_08950 7034 6177 gene locus_tag LOCUS_08960 7034 6177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_08960 8014 7022 gene locus_tag LOCUS_08970 8014 7022 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_08970 8736 8011 gene locus_tag LOCUS_08980 8736 8011 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763194.1 protein_id gnl|my_center|LOCUS_08980 9847 8798 gene locus_tag LOCUS_08990 9847 8798 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence067 <1 779 gene locus_tag LOCUS_09000 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256279.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 875 1636 gene locus_tag LOCUS_09010 875 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1633 3357 gene locus_tag LOCUS_09020 1633 3357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_09020 3476 4294 gene locus_tag LOCUS_09030 gene thiX 3476 4294 CDS product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 protein_id gnl|my_center|LOCUS_09030 5083 4556 gene locus_tag LOCUS_09040 5083 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6822 5683 gene locus_tag LOCUS_09050 6822 5683 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_09050 8052 6913 gene locus_tag LOCUS_09060 8052 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9185 8052 gene locus_tag LOCUS_09070 9185 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9639 9274 gene locus_tag LOCUS_09080 9639 9274 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_09080 9928 9587 gene locus_tag LOCUS_09090 9928 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 <10590 10029 gene locus_tag LOCUS_09100 <10590 10029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989658.1:CDP-glycerol glycerophosphotransferase family protein >Feature sequence068 <1 1231 gene locus_tag LOCUS_09110 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228149.1:aconitate hydratase AcnA 3065 1788 gene locus_tag LOCUS_09120 gene murA 3065 1788 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_09120 3426 3079 gene locus_tag LOCUS_09130 3426 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09130 3902 3312 gene locus_tag LOCUS_09140 3902 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 3956 4120 gene locus_tag LOCUS_09150 3956 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4564 5904 gene locus_tag LOCUS_09160 4564 5904 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_09160 6404 6865 gene locus_tag LOCUS_09170 6404 6865 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_09170 7556 6936 gene locus_tag LOCUS_09180 7556 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931057.1 protein_id gnl|my_center|LOCUS_09180 7899 7561 gene locus_tag LOCUS_09190 7899 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 8977 7988 gene locus_tag LOCUS_09200 8977 7988 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_09200 9789 8989 gene locus_tag LOCUS_09210 9789 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence069 266 1030 gene locus_tag LOCUS_09220 266 1030 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245643.1 protein_id gnl|my_center|LOCUS_09220 1234 1986 gene locus_tag LOCUS_09230 1234 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2052 2606 gene locus_tag LOCUS_09240 2052 2606 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_09240 2839 4125 gene locus_tag LOCUS_09250 2839 4125 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_09250 4470 5528 gene locus_tag LOCUS_09260 4470 5528 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_09260 5688 6173 gene locus_tag LOCUS_09270 5688 6173 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_09270 6434 10357 gene locus_tag LOCUS_09280 6434 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence070 1248 571 gene locus_tag LOCUS_09290 1248 571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_09290 2277 1360 gene locus_tag LOCUS_09300 2277 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2933 4183 gene locus_tag LOCUS_09310 gene gdhA 2933 4183 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_09310 7648 4433 gene locus_tag LOCUS_09320 7648 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 8679 7654 gene locus_tag LOCUS_09330 8679 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10154 9018 gene locus_tag LOCUS_09340 10154 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence071 296 60 gene locus_tag LOCUS_09350 296 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1275 346 gene locus_tag LOCUS_09360 gene atpB 1275 346 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_09360 1747 2613 gene locus_tag LOCUS_09370 1747 2613 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_09370 2764 5178 gene locus_tag LOCUS_09380 gene lon 2764 5178 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_09380 5993 5373 gene locus_tag LOCUS_09390 5993 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7182 6190 gene locus_tag LOCUS_09400 7182 6190 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_09400 8153 7179 gene locus_tag LOCUS_09410 8153 7179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_09410 9148 8195 gene locus_tag LOCUS_09420 9148 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <10352 9213 gene locus_tag LOCUS_09430 <10352 9213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963501.1:ABC transporter permease >Feature sequence072 <1 711 gene locus_tag LOCUS_09440 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256291.1:RNA methyltransferase 837 1490 gene locus_tag LOCUS_09450 837 1490 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_09450 2120 4168 gene locus_tag LOCUS_09460 gene ligA 2120 4168 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_09460 4365 5045 gene locus_tag LOCUS_09470 gene coaE 4365 5045 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_09470 5042 5245 gene locus_tag LOCUS_09480 5042 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5235 6386 gene locus_tag LOCUS_09490 gene dnaJ 5235 6386 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_09490 6395 6955 gene locus_tag LOCUS_09500 gene rsmD 6395 6955 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_09500 8139 7150 gene locus_tag LOCUS_09510 8139 7150 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_09510 8597 8136 gene locus_tag LOCUS_09520 8597 8136 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_09520 9346 8696 gene locus_tag LOCUS_09530 9346 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence073 1247 426 gene locus_tag LOCUS_09540 1247 426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 protein_id gnl|my_center|LOCUS_09540 2136 1285 gene locus_tag LOCUS_09550 2136 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3587 2592 gene locus_tag LOCUS_09560 gene glpX 3587 2592 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869760.1 protein_id gnl|my_center|LOCUS_09560 5500 4250 gene locus_tag LOCUS_09570 5500 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5941 5513 gene locus_tag LOCUS_09580 5941 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6336 5938 gene locus_tag LOCUS_09590 6336 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6600 9770 gene locus_tag LOCUS_09600 gene ileS 6600 9770 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence074 255 524 gene locus_tag LOCUS_09610 gene rpsO 255 524 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_09610 907 3138 gene locus_tag LOCUS_09620 gene pnp 907 3138 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_09620 3237 3824 gene locus_tag LOCUS_09630 gene lepB 3237 3824 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_09630 5201 3945 gene locus_tag LOCUS_09640 5201 3945 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_09640 6108 5194 gene locus_tag LOCUS_09650 6108 5194 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_09650 6412 6101 gene locus_tag LOCUS_09660 6412 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6719 6883 gene locus_tag LOCUS_09670 6719 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7152 8162 gene locus_tag LOCUS_09680 gene bfmBAA 7152 8162 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_09680 8211 9194 gene locus_tag LOCUS_09690 8211 9194 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence075 532 1314 gene locus_tag LOCUS_09700 532 1314 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731345.1 protein_id gnl|my_center|LOCUS_09700 1331 2038 gene locus_tag LOCUS_09710 1331 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2050 2682 gene locus_tag LOCUS_09720 2050 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3193 3002 gene locus_tag LOCUS_09730 3193 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3192 4265 gene locus_tag LOCUS_09740 3192 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4587 6158 gene locus_tag LOCUS_09750 gene xylB 4587 6158 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_09750 7001 6282 gene locus_tag LOCUS_09760 7001 6282 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_09760 7687 8082 gene locus_tag LOCUS_09770 7687 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 8114 9301 gene locus_tag LOCUS_09780 8114 9301 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_09780 9370 10185 gene locus_tag LOCUS_09790 9370 10185 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence076 944 333 gene locus_tag LOCUS_09800 944 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2682 946 gene locus_tag LOCUS_09810 2682 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3270 5537 gene locus_tag LOCUS_09820 3270 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6128 8410 gene locus_tag LOCUS_09830 6128 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 9677 8505 gene locus_tag LOCUS_09840 9677 8505 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_09840 <10198 9674 gene locus_tag LOCUS_09850 <10198 9674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257254.1:glycosyltransferase family 4 protein >Feature sequence077 1284 1069 gene locus_tag LOCUS_09860 1284 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1526 1341 gene locus_tag LOCUS_09870 1526 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3325 2024 gene locus_tag LOCUS_09880 3325 2024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909244.1 protein_id gnl|my_center|LOCUS_09880 3878 3534 gene locus_tag LOCUS_09890 3878 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4565 3879 gene locus_tag LOCUS_09900 4565 3879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_09900 7472 5307 gene locus_tag LOCUS_09910 7472 5307 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_09910 8075 8002 gene locus_tag LOCUS_t00030 8075 8002 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8654 8148 gene locus_tag LOCUS_09920 8654 8148 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_09920 9373 8978 gene locus_tag LOCUS_09930 gene rpsI 9373 8978 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_09930 9816 9388 gene locus_tag LOCUS_09940 gene rplM 9816 9388 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence078 24 1601 gene locus_tag LOCUS_09950 24 1601 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_09950 1609 3177 gene locus_tag LOCUS_09960 1609 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3177 3560 gene locus_tag LOCUS_09970 3177 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5121 3919 gene locus_tag LOCUS_09980 5121 3919 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_09980 7241 5124 gene locus_tag LOCUS_09990 gene pta 7241 5124 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_09990 8840 7806 gene locus_tag LOCUS_10000 8840 7806 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_10000 9400 9209 gene locus_tag LOCUS_10010 9400 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence079 <1 759 gene locus_tag LOCUS_10020 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065206.1:ATP-binding protein 1168 3093 gene locus_tag LOCUS_10030 1168 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3112 6876 gene locus_tag LOCUS_10040 gene brxC 3112 6876 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_10040 6869 8845 gene locus_tag LOCUS_10050 6869 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 >Feature sequence080 1599 673 gene locus_tag LOCUS_10060 1599 673 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531925.1 protein_id gnl|my_center|LOCUS_10060 3115 1676 gene locus_tag LOCUS_10070 3115 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4134 3241 gene locus_tag LOCUS_10080 4134 3241 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_10080 5417 4755 gene locus_tag LOCUS_10090 5417 4755 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_10090 7720 5423 gene locus_tag LOCUS_10100 7720 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8299 8559 gene locus_tag LOCUS_10110 8299 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8559 8984 gene locus_tag LOCUS_10120 8559 8984 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545852.1 protein_id gnl|my_center|LOCUS_10120 9015 9239 gene locus_tag LOCUS_10130 9015 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence081 485 1765 gene locus_tag LOCUS_10140 485 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1762 2967 gene locus_tag LOCUS_10150 1762 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3015 3809 gene locus_tag LOCUS_10160 3015 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3701 4141 gene locus_tag LOCUS_10170 3701 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4152 5003 gene locus_tag LOCUS_10180 4152 5003 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_10180 4990 5997 gene locus_tag LOCUS_10190 4990 5997 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_10190 5999 6745 gene locus_tag LOCUS_10200 5999 6745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073146.1 protein_id gnl|my_center|LOCUS_10200 6742 7968 gene locus_tag LOCUS_10210 6742 7968 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_10210 8103 9287 gene locus_tag LOCUS_10220 8103 9287 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065244.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence082 1594 590 gene locus_tag LOCUS_10230 1594 590 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10230 1949 1581 gene locus_tag LOCUS_10240 gene rbfA 1949 1581 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_10240 4047 2218 gene locus_tag LOCUS_10250 4047 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4796 4584 gene locus_tag LOCUS_10260 4796 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6456 4912 gene locus_tag LOCUS_10270 6456 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8441 6747 gene locus_tag LOCUS_10280 8441 6747 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_10280 8529 8774 gene locus_tag LOCUS_10290 8529 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence083 1615 1412 gene locus_tag LOCUS_10300 1615 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2976 1972 gene locus_tag LOCUS_10310 2976 1972 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_10310 3803 3345 gene locus_tag LOCUS_10320 3803 3345 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_10320 5493 4090 gene locus_tag LOCUS_10330 gene atpD 5493 4090 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258893.1 protein_id gnl|my_center|LOCUS_10330 6414 5545 gene locus_tag LOCUS_10340 gene atpG 6414 5545 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_10340 8131 6620 gene locus_tag LOCUS_10350 gene atpA 8131 6620 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_10350 9048 8533 gene locus_tag LOCUS_10360 9048 8533 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383727.1 protein_id gnl|my_center|LOCUS_10360 9551 9063 gene locus_tag LOCUS_10370 9551 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence084 629 1420 gene locus_tag LOCUS_10380 629 1420 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_10380 2582 1530 gene locus_tag LOCUS_10390 2582 1530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257470.1 protein_id gnl|my_center|LOCUS_10390 3055 4389 gene locus_tag LOCUS_10400 3055 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4456 5457 gene locus_tag LOCUS_10410 4456 5457 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_10410 5465 6664 gene locus_tag LOCUS_10420 5465 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6973 8055 gene locus_tag LOCUS_10430 6973 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 8058 8582 gene locus_tag LOCUS_10440 8058 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence085 2229 1783 gene locus_tag LOCUS_10450 2229 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4064 2799 gene locus_tag LOCUS_10460 4064 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4309 4067 gene locus_tag LOCUS_10470 4309 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6402 4624 gene locus_tag LOCUS_10480 gene aspS 6402 4624 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_10480 6916 7605 gene locus_tag LOCUS_10490 6916 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7855 8820 gene locus_tag LOCUS_10500 7855 8820 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence086 2369 1740 gene locus_tag LOCUS_10510 2369 1740 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_10510 5016 3289 gene locus_tag LOCUS_10520 5016 3289 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_10520 5865 9314 gene locus_tag LOCUS_10530 5865 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence087 2918 2253 gene locus_tag LOCUS_10540 2918 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5143 3548 gene locus_tag LOCUS_10550 5143 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 6750 5404 gene locus_tag LOCUS_10560 6750 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7507 6731 gene locus_tag LOCUS_10570 7507 6731 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 protein_id gnl|my_center|LOCUS_10570 8056 9201 gene locus_tag LOCUS_10580 8056 9201 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence088 1491 769 gene locus_tag LOCUS_10590 gene trmB 1491 769 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_10590 2168 1488 gene locus_tag LOCUS_10600 2168 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_10600 3527 2814 gene locus_tag LOCUS_10610 3527 2814 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_10610 4786 3659 gene locus_tag LOCUS_10620 4786 3659 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_10620 <9414 4786 gene locus_tag LOCUS_10630 <9414 4786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460684.1:ATP-binding protein >Feature sequence089 <1 2989 gene locus_tag LOCUS_10640 <1 2989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227616.1:CRISPR-associated helicase/endonuclease Cas3 2986 4539 gene locus_tag LOCUS_10650 gene casA 2986 4539 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_10650 4536 5078 gene locus_tag LOCUS_10660 gene casB 4536 5078 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_10660 5114 6256 gene locus_tag LOCUS_10670 gene cas7e 5114 6256 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_10670 6261 6959 gene locus_tag LOCUS_10680 gene cas5e 6261 6959 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_10680 6959 7594 gene locus_tag LOCUS_10690 gene cas6e 6959 7594 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_10690 7751 8680 gene locus_tag LOCUS_10700 gene cas1e 7751 8680 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_10700 8674 8982 gene locus_tag LOCUS_10710 gene cas2e 8674 8982 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 protein_id gnl|my_center|LOCUS_10710 9038 9377 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttccccacacgcgtgggggtggaccg >Feature sequence090 64 351 gene locus_tag LOCUS_10720 64 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3166 545 gene locus_tag LOCUS_10730 gene ppdK 3166 545 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_10730 4429 3428 gene locus_tag LOCUS_10740 4429 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5218 4532 gene locus_tag LOCUS_10750 gene phoU 5218 4532 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_10750 6475 5693 gene locus_tag LOCUS_10760 gene pstB 6475 5693 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_10760 7972 7031 gene locus_tag LOCUS_10770 gene pstA 7972 7031 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_10770 8974 7976 gene locus_tag LOCUS_10780 gene pstC 8974 7976 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence091 2362 899 gene locus_tag LOCUS_10790 2362 899 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_10790 3975 2359 gene locus_tag LOCUS_10800 3975 2359 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_10800 4761 4255 gene locus_tag LOCUS_10810 4761 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6004 5033 gene locus_tag LOCUS_10820 6004 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7809 6358 gene locus_tag LOCUS_10830 7809 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257256.1 protein_id gnl|my_center|LOCUS_10830 8801 8478 gene locus_tag LOCUS_10840 gene trxA 8801 8478 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence092 264 989 gene locus_tag LOCUS_10850 gene fadR 264 989 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211688.1 protein_id gnl|my_center|LOCUS_10850 1103 2698 gene locus_tag LOCUS_10860 1103 2698 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_10860 2777 4531 gene locus_tag LOCUS_10870 2777 4531 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_10870 5070 5789 gene locus_tag LOCUS_10880 gene rnc 5070 5789 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_10880 5776 6624 gene locus_tag LOCUS_10890 5776 6624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257001.1 protein_id gnl|my_center|LOCUS_10890 6774 6556 gene locus_tag LOCUS_10900 6774 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6920 9004 gene locus_tag LOCUS_10910 6920 9004 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence093 635 2248 gene locus_tag LOCUS_10920 635 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2256 2510 gene locus_tag LOCUS_10930 2256 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3313 2666 gene locus_tag LOCUS_10940 3313 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4310 3510 gene locus_tag LOCUS_10950 4310 3510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_10950 5336 4542 gene locus_tag LOCUS_10960 5336 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5709 5422 gene locus_tag LOCUS_10970 5709 5422 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_10970 6005 5733 gene locus_tag LOCUS_10980 6005 5733 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_10980 6850 6002 gene locus_tag LOCUS_10990 gene proC 6850 6002 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_10990 7651 6923 gene locus_tag LOCUS_11000 7651 6923 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_11000 8442 7648 gene locus_tag LOCUS_11010 gene pgeF 8442 7648 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_11010 <9266 8442 gene locus_tag LOCUS_11020 <9266 8442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938725.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence094 646 720 gene locus_tag LOCUS_t00040 646 720 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1273 806 gene locus_tag LOCUS_11030 1273 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2974 1571 gene locus_tag LOCUS_11040 2974 1571 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_11040 3727 4767 gene locus_tag LOCUS_11050 3727 4767 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_11050 5059 6153 gene locus_tag LOCUS_11060 5059 6153 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_11060 6212 7390 gene locus_tag LOCUS_11070 6212 7390 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_11070 7714 7523 gene locus_tag LOCUS_11080 7714 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8410 8210 gene locus_tag LOCUS_11090 8410 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9180 8578 gene locus_tag LOCUS_11100 9180 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence095 319 1881 gene locus_tag LOCUS_11110 319 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1894 3558 gene locus_tag LOCUS_11120 1894 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3560 5884 gene locus_tag LOCUS_11130 3560 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5881 7614 gene locus_tag LOCUS_11140 5881 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7611 8198 gene locus_tag LOCUS_11150 7611 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence096 1505 36 gene locus_tag LOCUS_11160 gene gatA 1505 36 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_11160 2097 1807 gene locus_tag LOCUS_11170 gene gatC 2097 1807 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_11170 2957 2274 gene locus_tag LOCUS_11180 2957 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4341 2959 gene locus_tag LOCUS_11190 4341 2959 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_11190 4581 6149 gene locus_tag LOCUS_11200 4581 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6350 6661 gene locus_tag LOCUS_11210 gene rplU 6350 6661 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_11210 6685 6966 gene locus_tag LOCUS_11220 gene rpmA 6685 6966 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_11220 6970 7263 gene locus_tag LOCUS_11230 6970 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7352 7933 gene locus_tag LOCUS_11240 7352 7933 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_11240 8942 8013 gene locus_tag LOCUS_11250 8942 8013 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575124.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence097 1446 271 gene locus_tag LOCUS_11260 1446 271 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_11260 2257 1454 gene locus_tag LOCUS_11270 2257 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3466 2324 gene locus_tag LOCUS_11280 3466 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4270 3551 gene locus_tag LOCUS_11290 4270 3551 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_11290 4987 4298 gene locus_tag LOCUS_11300 4987 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5885 4959 gene locus_tag LOCUS_11310 5885 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6214 5882 gene locus_tag LOCUS_11320 6214 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7395 7198 gene locus_tag LOCUS_11330 7395 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 <9131 7714 gene locus_tag LOCUS_11340 <9131 7714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047913.1:polysaccharide deacetylase family protein >Feature sequence098 <1 872 gene locus_tag LOCUS_11350 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256764.1:ATP-binding protein 2433 907 gene locus_tag LOCUS_11360 gene purH 2433 907 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_11360 2941 4971 gene locus_tag LOCUS_11370 2941 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5336 6298 gene locus_tag LOCUS_11380 gene mvk 5336 6298 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_11380 6295 7653 gene locus_tag LOCUS_11390 6295 7653 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_11390 7643 8272 gene locus_tag LOCUS_11400 gene thpR 7643 8272 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256208.1 protein_id gnl|my_center|LOCUS_11400 8276 8971 gene locus_tag LOCUS_11410 8276 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence099 435 749 gene locus_tag LOCUS_11420 435 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 769 2319 gene locus_tag LOCUS_11430 769 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2434 2697 gene locus_tag LOCUS_11440 2434 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2948 3370 gene locus_tag LOCUS_11450 2948 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3838 4110 gene locus_tag LOCUS_11460 3838 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4115 5074 gene locus_tag LOCUS_11470 4115 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5093 5314 gene locus_tag LOCUS_11480 5093 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5412 5678 gene locus_tag LOCUS_11490 5412 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 5675 6193 gene locus_tag LOCUS_11500 5675 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6819 7382 gene locus_tag LOCUS_11510 6819 7382 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence100 2264 1701 gene locus_tag LOCUS_11520 gene scpB 2264 1701 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_11520 2583 3146 gene locus_tag LOCUS_11530 2583 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3851 3258 gene locus_tag LOCUS_11540 3851 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4055 4144 gene locus_tag LOCUS_t00050 4055 4144 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4293 4383 gene locus_tag LOCUS_t00060 4293 4383 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5225 5842 gene locus_tag LOCUS_11550 5225 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6418 7230 gene locus_tag LOCUS_11560 6418 7230 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_11560 7640 8677 gene locus_tag LOCUS_11570 gene ltaE 7640 8677 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence101 1628 117 gene locus_tag LOCUS_11580 1628 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6437 1644 gene locus_tag LOCUS_11590 6437 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6867 6652 gene locus_tag LOCUS_11600 6867 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 8617 6857 gene locus_tag LOCUS_11610 gene uvrC 8617 6857 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence102 193 1812 gene locus_tag LOCUS_11620 193 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2036 2437 gene locus_tag LOCUS_11630 gene ndhC 2036 2437 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_11630 2729 3244 gene locus_tag LOCUS_11640 2729 3244 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_11640 3458 5296 gene locus_tag LOCUS_11650 3458 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5353 7218 gene locus_tag LOCUS_11660 5353 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence103 3401 4183 gene locus_tag LOCUS_11670 3401 4183 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256999.1 protein_id gnl|my_center|LOCUS_11670 4451 4837 gene locus_tag LOCUS_11680 4451 4837 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_11680 4846 6420 gene locus_tag LOCUS_11690 gene guaA 4846 6420 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_11690 6501 7070 gene locus_tag LOCUS_11700 6501 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 7211 8836 gene locus_tag LOCUS_11710 7211 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence104 <1 799 gene locus_tag LOCUS_11720 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256344.1:GTPase HflX 1460 1936 gene locus_tag LOCUS_11730 gene smpB 1460 1936 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_11730 2090 1872 gene locus_tag LOCUS_11740 2090 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2336 5947 gene locus_tag LOCUS_11750 gene smc 2336 5947 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_11750 6106 6510 gene locus_tag LOCUS_11760 6106 6510 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969505.1 protein_id gnl|my_center|LOCUS_11760 6741 8300 gene locus_tag LOCUS_11770 6741 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8297 8764 gene locus_tag LOCUS_11780 8297 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence105 1875 481 gene locus_tag LOCUS_11790 1875 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2513 1872 gene locus_tag LOCUS_11800 2513 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4306 2510 gene locus_tag LOCUS_11810 4306 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4497 5399 gene locus_tag LOCUS_11820 gene ftcD 4497 5399 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 protein_id gnl|my_center|LOCUS_11820 5452 5928 gene locus_tag LOCUS_11830 5452 5928 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_11830 6069 5995 gene locus_tag LOCUS_t00070 6069 5995 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6530 6324 gene locus_tag LOCUS_11840 6530 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6535 7416 gene locus_tag LOCUS_11850 6535 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 <8948 7618 gene locus_tag LOCUS_11860 <8948 7618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545329.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence106 648 2051 gene locus_tag LOCUS_11870 gene lpdA 648 2051 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_11870 2127 3092 gene locus_tag LOCUS_11880 gene fabD 2127 3092 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_11880 3089 3838 gene locus_tag LOCUS_11890 gene fabG 3089 3838 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_11890 4028 4393 gene locus_tag LOCUS_11900 4028 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4368 4847 gene locus_tag LOCUS_11910 gene nusB 4368 4847 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_11910 5130 6455 gene locus_tag LOCUS_11920 5130 6455 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_11920 6778 8136 gene locus_tag LOCUS_11930 6778 8136 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_11930 8160 8714 gene locus_tag LOCUS_11940 8160 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence107 298 1335 gene locus_tag LOCUS_11950 298 1335 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_11950 1357 2364 gene locus_tag LOCUS_11960 1357 2364 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_11960 2785 6369 gene locus_tag LOCUS_11970 2785 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6699 8792 gene locus_tag LOCUS_11980 6699 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence108 1323 853 gene locus_tag LOCUS_11990 1323 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2506 1379 gene locus_tag LOCUS_12000 2506 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2694 2554 gene locus_tag LOCUS_12010 2694 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2913 2713 gene locus_tag LOCUS_12020 2913 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4544 3270 gene locus_tag LOCUS_12030 4544 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5834 4545 gene locus_tag LOCUS_12040 5834 4545 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_12040 7093 5933 gene locus_tag LOCUS_12050 7093 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 8095 7097 gene locus_tag LOCUS_12060 8095 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence109 2082 814 gene locus_tag LOCUS_12070 2082 814 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259174.1 protein_id gnl|my_center|LOCUS_12070 2333 2407 gene locus_tag LOCUS_t00080 2333 2407 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2458 2880 gene locus_tag LOCUS_12080 2458 2880 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_12080 2877 3698 gene locus_tag LOCUS_12090 2877 3698 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_12090 3733 4680 gene locus_tag LOCUS_12100 gene yedA 3733 4680 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_12100 4713 5588 gene locus_tag LOCUS_12110 4713 5588 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932170.1 protein_id gnl|my_center|LOCUS_12110 5812 7470 gene locus_tag LOCUS_12120 5812 7470 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_12120 7543 8559 gene locus_tag LOCUS_12130 7543 8559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080232.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence110 209 2764 gene locus_tag LOCUS_12140 209 2764 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_12140 3088 2798 gene locus_tag LOCUS_12150 3088 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4353 3100 gene locus_tag LOCUS_12160 4353 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5088 4435 gene locus_tag LOCUS_12170 5088 4435 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_12170 8224 5126 gene locus_tag LOCUS_12180 8224 5126 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891868.1 protein_id gnl|my_center|LOCUS_12180 <8795 8229 gene locus_tag LOCUS_12190 <8795 8229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125415.1:DUF4956 domain-containing protein >Feature sequence111 776 153 gene locus_tag LOCUS_12200 776 153 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_12200 3280 773 gene locus_tag LOCUS_12210 3280 773 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_12210 3789 4751 gene locus_tag LOCUS_12220 3789 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5246 6727 gene locus_tag LOCUS_12230 5246 6727 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_12230 6740 7027 gene locus_tag LOCUS_12240 6740 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7024 8142 gene locus_tag LOCUS_12250 7024 8142 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence112 1405 530 gene locus_tag LOCUS_12260 1405 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12260 2508 1798 gene locus_tag LOCUS_12270 2508 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3783 2557 gene locus_tag LOCUS_12280 3783 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4787 3804 gene locus_tag LOCUS_12290 4787 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7690 4799 gene locus_tag LOCUS_12300 7690 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence113 1427 60 gene locus_tag LOCUS_12310 gene gcvPA 1427 60 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_12310 1824 1429 gene locus_tag LOCUS_12320 gene gcvH 1824 1429 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865076.1 protein_id gnl|my_center|LOCUS_12320 3151 2036 gene locus_tag LOCUS_12330 gene gcvT 3151 2036 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_12330 3877 6531 gene locus_tag LOCUS_12340 gene mutS 3877 6531 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_12340 7871 6798 gene locus_tag LOCUS_12350 7871 6798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_12350 8650 7859 gene locus_tag LOCUS_12360 gene wtpB 8650 7859 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence114 2671 596 gene locus_tag LOCUS_12370 2671 596 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_12370 3105 4022 gene locus_tag LOCUS_12380 3105 4022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_12380 4085 5302 gene locus_tag LOCUS_12390 4085 5302 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909136.1 protein_id gnl|my_center|LOCUS_12390 5339 6472 gene locus_tag LOCUS_12400 gene rlmN 5339 6472 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_12400 6475 7152 gene locus_tag LOCUS_12410 gene rpe 6475 7152 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_12410 7230 8747 gene locus_tag LOCUS_12420 7230 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence115 88 711 gene locus_tag LOCUS_12430 88 711 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_12430 721 1470 gene locus_tag LOCUS_12440 721 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1496 2305 gene locus_tag LOCUS_12450 gene mutM 1496 2305 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_12450 2535 2323 gene locus_tag LOCUS_12460 2535 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2874 3527 gene locus_tag LOCUS_12470 2874 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3833 5878 gene locus_tag LOCUS_12480 3833 5878 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_12480 6413 5964 gene locus_tag LOCUS_12490 6413 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6919 8223 gene locus_tag LOCUS_12500 6919 8223 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_12500 <8720 8205 gene locus_tag LOCUS_12510 <8720 8205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775255.1:HAD family hydrolase >Feature sequence116 310 1455 gene locus_tag LOCUS_12520 310 1455 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_12520 1526 2461 gene locus_tag LOCUS_12530 1526 2461 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_12530 2821 4344 gene locus_tag LOCUS_12540 gene glgA 2821 4344 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_12540 4369 5256 gene locus_tag LOCUS_12550 4369 5256 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_12550 5249 6256 gene locus_tag LOCUS_12560 5249 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6568 7839 gene locus_tag LOCUS_12570 6568 7839 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence117 946 2541 gene locus_tag LOCUS_12580 946 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2807 3226 gene locus_tag LOCUS_12590 2807 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3889 3311 gene locus_tag LOCUS_12600 gene def 3889 3311 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_12600 5058 4093 gene locus_tag LOCUS_12610 5058 4093 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226134.1 protein_id gnl|my_center|LOCUS_12610 6429 7424 gene locus_tag LOCUS_12620 gene plsX 6429 7424 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence118 1029 52 gene locus_tag LOCUS_12630 1029 52 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_12630 1850 1014 gene locus_tag LOCUS_12640 1850 1014 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_12640 3136 1943 gene locus_tag LOCUS_12650 3136 1943 CDS product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_12650 4173 3133 gene locus_tag LOCUS_12660 gene mtnA 4173 3133 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_12660 5846 4692 gene locus_tag LOCUS_12670 5846 4692 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_12670 6836 6108 gene locus_tag LOCUS_12680 6836 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7124 7591 gene locus_tag LOCUS_12690 7124 7591 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540491.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence119 851 543 gene locus_tag LOCUS_12700 851 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3593 1020 gene locus_tag LOCUS_12710 3593 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3816 3613 gene locus_tag LOCUS_12720 3816 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 7216 4430 gene locus_tag LOCUS_12730 7216 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7314 7541 gene locus_tag LOCUS_12740 7314 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <8647 7809 gene locus_tag LOCUS_12750 <8647 7809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013069.1:CARDB domain-containing protein >Feature sequence120 2271 715 gene locus_tag LOCUS_12760 2271 715 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_12760 2899 2972 gene locus_tag LOCUS_t00090 2899 2972 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3056 4441 gene locus_tag LOCUS_12770 3056 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4976 5944 gene locus_tag LOCUS_12780 4976 5944 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_12780 5958 7223 gene locus_tag LOCUS_12790 gene ahcY 5958 7223 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_12790 7253 8467 gene locus_tag LOCUS_12800 gene metK 7253 8467 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence121 286 2907 gene locus_tag LOCUS_12810 286 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3617 4987 gene locus_tag LOCUS_12820 gene dnaA 3617 4987 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_12820 5797 8484 gene locus_tag LOCUS_12830 gene alaS 5797 8484 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259677.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence122 179 850 gene locus_tag LOCUS_12840 179 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1822 2472 gene locus_tag LOCUS_12850 1822 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2617 2976 gene locus_tag LOCUS_12860 2617 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2936 3865 gene locus_tag LOCUS_12870 2936 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4323 3958 gene locus_tag LOCUS_12880 4323 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4821 5444 gene locus_tag LOCUS_12890 4821 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 6772 6563 gene locus_tag LOCUS_12900 6772 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7450 6914 gene locus_tag LOCUS_12910 7450 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 7833 7501 gene locus_tag LOCUS_12920 7833 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8059 8232 gene locus_tag LOCUS_12930 8059 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 8308 8436 gene locus_tag LOCUS_12940 8308 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence123 346 876 gene locus_tag LOCUS_12950 346 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1628 1038 gene locus_tag LOCUS_12960 gene rfaH 1628 1038 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073081.1 protein_id gnl|my_center|LOCUS_12960 2355 4991 gene locus_tag LOCUS_12970 gene clpB 2355 4991 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_12970 5376 5215 gene locus_tag LOCUS_12980 5376 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5403 6704 gene locus_tag LOCUS_12990 5403 6704 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002346915.1 protein_id gnl|my_center|LOCUS_12990 8246 6900 gene locus_tag LOCUS_13000 8246 6900 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence124 357 142 gene locus_tag LOCUS_13010 357 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1457 435 gene locus_tag LOCUS_13020 gene rfbB 1457 435 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258175.1 protein_id gnl|my_center|LOCUS_13020 4965 2122 gene locus_tag LOCUS_13030 4965 2122 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255983.1 protein_id gnl|my_center|LOCUS_13030 6109 4979 gene locus_tag LOCUS_13040 gene lpxG 6109 4979 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883216.1 protein_id gnl|my_center|LOCUS_13040 7958 6546 gene locus_tag LOCUS_13050 7958 6546 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence125 6 4898 gene locus_tag LOCUS_13060 6 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5408 6565 gene locus_tag LOCUS_13070 5408 6565 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_13070 7150 7365 gene locus_tag LOCUS_13080 7150 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 7445 7633 gene locus_tag LOCUS_13090 7445 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence126 1495 53 gene locus_tag LOCUS_13100 1495 53 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_13100 3048 1531 gene locus_tag LOCUS_13110 3048 1531 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_13110 4951 3068 gene locus_tag LOCUS_13120 gene nuoL 4951 3068 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_13120 5410 5108 gene locus_tag LOCUS_13130 gene nuoK 5410 5108 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_13130 5942 5421 gene locus_tag LOCUS_13140 5942 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6424 5948 gene locus_tag LOCUS_13150 6424 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7440 6442 gene locus_tag LOCUS_13160 gene nuoH 7440 6442 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_13160 7583 7419 gene locus_tag LOCUS_13170 7583 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <8525 7748 gene locus_tag LOCUS_13180 <8525 7748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071257.1:formate dehydrogenase subunit alpha >Feature sequence127 365 2275 gene locus_tag LOCUS_13190 gene dnaK 365 2275 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_13190 2705 3376 gene locus_tag LOCUS_13200 2705 3376 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_13200 3410 3550 gene locus_tag LOCUS_13210 3410 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3557 4768 gene locus_tag LOCUS_13220 3557 4768 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_13220 5023 6243 gene locus_tag LOCUS_13230 5023 6243 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_13230 6388 7434 gene locus_tag LOCUS_13240 6388 7434 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence128 179 910 gene locus_tag LOCUS_13250 179 910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_13250 1053 1727 gene locus_tag LOCUS_13260 gene ccmB 1053 1727 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384158.1 protein_id gnl|my_center|LOCUS_13260 1730 2449 gene locus_tag LOCUS_13270 gene ccsA 1730 2449 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_13270 2490 2642 gene locus_tag LOCUS_13280 2490 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2920 3708 gene locus_tag LOCUS_13290 2920 3708 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_13290 3711 3926 gene locus_tag LOCUS_13300 3711 3926 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 protein_id gnl|my_center|LOCUS_13300 3929 5290 gene locus_tag LOCUS_13310 3929 5290 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_13310 5453 6850 gene locus_tag LOCUS_13320 gene hydA 5453 6850 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393493.1 protein_id gnl|my_center|LOCUS_13320 6874 7095 gene locus_tag LOCUS_13330 6874 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7794 7126 gene locus_tag LOCUS_13340 7794 7126 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence129 36 1529 gene locus_tag LOCUS_13350 36 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1526 1984 gene locus_tag LOCUS_13360 1526 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1981 3114 gene locus_tag LOCUS_13370 1981 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3135 4244 gene locus_tag LOCUS_13380 3135 4244 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_13380 4250 5482 gene locus_tag LOCUS_13390 4250 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5482 7377 gene locus_tag LOCUS_13400 5482 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence130 2 1375 gene locus_tag LOCUS_13410 2 1375 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259564.1 protein_id gnl|my_center|LOCUS_13410 2182 1643 gene locus_tag LOCUS_13420 2182 1643 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_13420 2864 3103 gene locus_tag LOCUS_13430 2864 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3091 3555 gene locus_tag LOCUS_13440 3091 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 7158 3838 gene locus_tag LOCUS_13450 7158 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence131 1527 466 gene locus_tag LOCUS_13460 gene fni 1527 466 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_13460 1790 2035 gene locus_tag LOCUS_13470 gene acpP 1790 2035 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928985.1 protein_id gnl|my_center|LOCUS_13470 3154 2678 gene locus_tag LOCUS_13480 3154 2678 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577397.1 protein_id gnl|my_center|LOCUS_13480 3613 4224 gene locus_tag LOCUS_13490 3613 4224 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_13490 4228 4962 gene locus_tag LOCUS_13500 4228 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5085 5939 gene locus_tag LOCUS_13510 5085 5939 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_13510 6657 6199 gene locus_tag LOCUS_13520 6657 6199 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_13520 7025 6654 gene locus_tag LOCUS_13530 7025 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7744 7097 gene locus_tag LOCUS_13540 7744 7097 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258966.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence132 124 1068 gene locus_tag LOCUS_13550 124 1068 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459744.1 protein_id gnl|my_center|LOCUS_13550 1102 1914 gene locus_tag LOCUS_13560 1102 1914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 protein_id gnl|my_center|LOCUS_13560 1901 2656 gene locus_tag LOCUS_13570 1901 2656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811476.1 protein_id gnl|my_center|LOCUS_13570 5245 3122 gene locus_tag LOCUS_13580 5245 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5521 5333 gene locus_tag LOCUS_13590 5521 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6073 6732 gene locus_tag LOCUS_13600 gene thyX 6073 6732 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_13600 <7908 6748 gene locus_tag LOCUS_13610 <7908 6748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258807.1:bifunctional riboflavin kinase/FAD synthetase >Feature sequence133 1277 825 gene locus_tag LOCUS_13620 1277 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1724 1281 gene locus_tag LOCUS_13630 1724 1281 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_13630 1968 1729 gene locus_tag LOCUS_13640 1968 1729 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_13640 2615 2271 gene locus_tag LOCUS_13650 2615 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3659 5776 gene locus_tag LOCUS_13660 3659 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6584 6306 gene locus_tag LOCUS_13670 6584 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6790 6581 gene locus_tag LOCUS_13680 6790 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7343 7726 gene locus_tag LOCUS_13690 7343 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence134 1094 282 gene locus_tag LOCUS_13700 1094 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2471 1143 gene locus_tag LOCUS_13710 2471 1143 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_13710 3076 2480 gene locus_tag LOCUS_13720 3076 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3735 3073 gene locus_tag LOCUS_13730 3735 3073 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_13730 4411 4043 gene locus_tag LOCUS_13740 4411 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4777 5700 gene locus_tag LOCUS_13750 4777 5700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_13750 7226 5793 gene locus_tag LOCUS_13760 7226 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence135 1931 687 gene locus_tag LOCUS_13770 1931 687 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_13770 2752 2153 gene locus_tag LOCUS_13780 2752 2153 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_13780 4417 2924 gene locus_tag LOCUS_13790 4417 2924 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_13790 4712 4638 gene locus_tag LOCUS_t00100 4712 4638 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4812 5546 gene locus_tag LOCUS_13800 4812 5546 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_13800 5548 6204 gene locus_tag LOCUS_13810 5548 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6215 6490 gene locus_tag LOCUS_13820 6215 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7774 6515 gene locus_tag LOCUS_13830 7774 6515 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence136 1146 361 gene locus_tag LOCUS_13840 1146 361 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_13840 2074 1172 gene locus_tag LOCUS_13850 2074 1172 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025696.1 protein_id gnl|my_center|LOCUS_13850 2518 2895 gene locus_tag LOCUS_13860 2518 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2980 3441 gene locus_tag LOCUS_13870 2980 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3443 4312 gene locus_tag LOCUS_13880 3443 4312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_13880 4309 5193 gene locus_tag LOCUS_13890 4309 5193 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_13890 5211 5543 gene locus_tag LOCUS_13900 5211 5543 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289113.1 protein_id gnl|my_center|LOCUS_13900 6213 5605 gene locus_tag LOCUS_13910 gene udk 6213 5605 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_13910 7039 6467 gene locus_tag LOCUS_13920 gene ruvA 7039 6467 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_13920 <7805 7036 gene locus_tag LOCUS_13930 <7805 7036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257402.1:response regulator transcription factor >Feature sequence137 4314 5765 gene locus_tag LOCUS_13940 4314 5765 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_13940 6074 7681 gene locus_tag LOCUS_13950 gene pckA 6074 7681 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence138 2259 457 gene locus_tag LOCUS_13960 2259 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2909 3211 gene locus_tag LOCUS_13970 2909 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3236 4975 gene locus_tag LOCUS_13980 3236 4975 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660601.1 protein_id gnl|my_center|LOCUS_13980 5125 5493 gene locus_tag LOCUS_13990 gene rplS 5125 5493 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_13990 5899 6540 gene locus_tag LOCUS_14000 5899 6540 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256927.1 protein_id gnl|my_center|LOCUS_14000 6533 6904 gene locus_tag LOCUS_14010 6533 6904 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence139 349 762 gene locus_tag LOCUS_14020 349 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1495 683 gene locus_tag LOCUS_14030 1495 683 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_14030 4272 1573 gene locus_tag LOCUS_14040 4272 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6441 4297 gene locus_tag LOCUS_14050 6441 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 <7586 6986 gene locus_tag LOCUS_14060 <7586 6986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057180.1:FHA domain-containing protein >Feature sequence140 1059 550 gene locus_tag LOCUS_14070 gene aroH 1059 550 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_14070 3239 1782 gene locus_tag LOCUS_14080 3239 1782 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_14080 3559 4152 gene locus_tag LOCUS_14090 3559 4152 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921477.1 protein_id gnl|my_center|LOCUS_14090 5912 4233 gene locus_tag LOCUS_14100 5912 4233 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_14100 7338 6091 gene locus_tag LOCUS_14110 gene mltG 7338 6091 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence141 228 1112 gene locus_tag LOCUS_14120 228 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3102 1381 gene locus_tag LOCUS_14130 3102 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3848 3300 gene locus_tag LOCUS_14140 3848 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 <7502 6517 gene locus_tag LOCUS_14150 <7502 6517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256544.1:PA14 domain-containing protein >Feature sequence142 520 1137 gene locus_tag LOCUS_14160 520 1137 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142113.1 protein_id gnl|my_center|LOCUS_14160 1972 1109 gene locus_tag LOCUS_14170 1972 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3004 3900 gene locus_tag LOCUS_14180 3004 3900 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_14180 3991 4770 gene locus_tag LOCUS_14190 gene phnC 3991 4770 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_14190 4787 7381 gene locus_tag LOCUS_14200 4787 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence143 1130 5101 gene locus_tag LOCUS_14210 1130 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5427 5729 gene locus_tag LOCUS_14220 5427 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 6778 5885 gene locus_tag LOCUS_14230 6778 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence144 322 1485 gene locus_tag LOCUS_14240 322 1485 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_14240 1489 2121 gene locus_tag LOCUS_14250 1489 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3195 2095 gene locus_tag LOCUS_14260 gene tsaD 3195 2095 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_14260 3802 3413 gene locus_tag LOCUS_14270 3802 3413 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527402.1 protein_id gnl|my_center|LOCUS_14270 5008 3833 gene locus_tag LOCUS_14280 5008 3833 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258702.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence145 1467 454 gene locus_tag LOCUS_14290 1467 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1848 1597 gene locus_tag LOCUS_14300 1848 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2217 1900 gene locus_tag LOCUS_14310 2217 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2874 2284 gene locus_tag LOCUS_14320 2874 2284 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459363.1 protein_id gnl|my_center|LOCUS_14320 3111 3281 gene locus_tag LOCUS_14330 3111 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3899 7273 gene locus_tag LOCUS_14340 3899 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence146 1102 1233 gene locus_tag LOCUS_14350 1102 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1485 2600 gene locus_tag LOCUS_14360 1485 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2628 5813 gene locus_tag LOCUS_14370 2628 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence147 134 1186 gene locus_tag LOCUS_14380 134 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1410 1234 gene locus_tag LOCUS_14390 1410 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1443 2279 gene locus_tag LOCUS_14400 1443 2279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_14400 2667 3656 gene locus_tag LOCUS_14410 2667 3656 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_14410 4722 3739 gene locus_tag LOCUS_14420 gene plsX 4722 3739 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_14420 5575 4727 gene locus_tag LOCUS_14430 5575 4727 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722646.1 protein_id gnl|my_center|LOCUS_14430 5999 6472 gene locus_tag LOCUS_14440 5999 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence148 2991 2206 gene locus_tag LOCUS_14450 2991 2206 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_14450 5745 3001 gene locus_tag LOCUS_14460 5745 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6183 5836 gene locus_tag LOCUS_14470 6183 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 7113 6190 gene locus_tag LOCUS_14480 gene ilvE 7113 6190 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_14480 7374 7307 gene locus_tag LOCUS_t00110 7374 7307 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence149 1718 444 gene locus_tag LOCUS_14490 gene hisS 1718 444 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_14490 3925 1895 gene locus_tag LOCUS_14500 3925 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4220 4522 gene locus_tag LOCUS_14510 4220 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6623 4761 gene locus_tag LOCUS_14520 6623 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence150 557 6067 gene locus_tag LOCUS_14530 557 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6394 6912 gene locus_tag LOCUS_14540 6394 6912 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143524.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence151 1363 929 gene locus_tag LOCUS_14550 gene rpiB 1363 929 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_14550 2327 1653 gene locus_tag LOCUS_14560 2327 1653 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_14560 3249 2395 gene locus_tag LOCUS_14570 3249 2395 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_14570 4387 3494 gene locus_tag LOCUS_14580 gene prmC 4387 3494 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_14580 5439 4384 gene locus_tag LOCUS_14590 gene prfA 5439 4384 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_14590 6014 5466 gene locus_tag LOCUS_14600 6014 5466 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_14600 6733 6593 gene locus_tag LOCUS_14610 6733 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence152 411 1433 gene locus_tag LOCUS_14620 411 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1443 1826 gene locus_tag LOCUS_14630 1443 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1823 2173 gene locus_tag LOCUS_14640 1823 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2175 3380 gene locus_tag LOCUS_14650 2175 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3381 5741 gene locus_tag LOCUS_14660 3381 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5744 6487 gene locus_tag LOCUS_14670 5744 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence153 929 123 gene locus_tag LOCUS_14680 929 123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 protein_id gnl|my_center|LOCUS_14680 1962 970 gene locus_tag LOCUS_14690 1962 970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_14690 2900 2034 gene locus_tag LOCUS_14700 2900 2034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_14700 3639 3821 gene locus_tag LOCUS_14710 3639 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4210 3908 gene locus_tag LOCUS_14720 4210 3908 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947205.1 protein_id gnl|my_center|LOCUS_14720 5112 4654 gene locus_tag LOCUS_14730 5112 4654 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence154 956 654 gene locus_tag LOCUS_14740 956 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1231 953 gene locus_tag LOCUS_14750 1231 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1716 1246 gene locus_tag LOCUS_14760 1716 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2164 1757 gene locus_tag LOCUS_14770 2164 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2538 2164 gene locus_tag LOCUS_14780 2538 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2846 2535 gene locus_tag LOCUS_14790 2846 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4414 2846 gene locus_tag LOCUS_14800 4414 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5386 4421 gene locus_tag LOCUS_14810 5386 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5798 5403 gene locus_tag LOCUS_14820 5798 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7003 5801 gene locus_tag LOCUS_14830 7003 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence155 929 1663 gene locus_tag LOCUS_14840 929 1663 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972591.1 protein_id gnl|my_center|LOCUS_14840 1660 2016 gene locus_tag LOCUS_14850 1660 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2155 2763 gene locus_tag LOCUS_14860 2155 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4041 2800 gene locus_tag LOCUS_14870 4041 2800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_14870 4933 4034 gene locus_tag LOCUS_14880 4933 4034 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_14880 5257 4958 gene locus_tag LOCUS_14890 5257 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 5628 6251 gene locus_tag LOCUS_14900 5628 6251 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932402.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence156 1555 245 gene locus_tag LOCUS_14910 1555 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2469 1567 gene locus_tag LOCUS_14920 2469 1567 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_14920 3570 2473 gene locus_tag LOCUS_14930 3570 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5043 3649 gene locus_tag LOCUS_14940 5043 3649 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958488.1 protein_id gnl|my_center|LOCUS_14940 6705 5503 gene locus_tag LOCUS_14950 6705 5503 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256834.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence157 1021 818 gene locus_tag LOCUS_14960 1021 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1171 3384 gene locus_tag LOCUS_14970 1171 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4084 3647 gene locus_tag LOCUS_14980 4084 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5340 4084 gene locus_tag LOCUS_14990 5340 4084 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_14990 6811 5759 gene locus_tag LOCUS_15000 6811 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence158 <1 1332 gene locus_tag LOCUS_15010 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940975.1:carbamoyltransferase HypF 1338 1595 gene locus_tag LOCUS_15020 1338 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1599 2687 gene locus_tag LOCUS_15030 gene hypD 1599 2687 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_15030 2706 3722 gene locus_tag LOCUS_15040 gene hypE 2706 3722 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_15040 3904 4332 gene locus_tag LOCUS_15050 3904 4332 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227714.1 protein_id gnl|my_center|LOCUS_15050 4540 6513 gene locus_tag LOCUS_15060 4540 6513 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence159 651 2030 gene locus_tag LOCUS_15070 gene miaB 651 2030 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583438.1 protein_id gnl|my_center|LOCUS_15070 2302 2105 gene locus_tag LOCUS_15080 2302 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2817 2224 gene locus_tag LOCUS_15090 2817 2224 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_15090 4649 2838 gene locus_tag LOCUS_15100 gene iorA 4649 2838 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_15100 4858 4646 gene locus_tag LOCUS_15110 4858 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5356 4904 gene locus_tag LOCUS_15120 5356 4904 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_15120 6256 5816 gene locus_tag LOCUS_15130 6256 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6711 6292 gene locus_tag LOCUS_15140 6711 6292 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815877.1 protein_id gnl|my_center|LOCUS_15140 6980 6744 gene locus_tag LOCUS_15150 6980 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence160 41 919 gene locus_tag LOCUS_15160 41 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1019 1906 gene locus_tag LOCUS_15170 1019 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1903 2571 gene locus_tag LOCUS_15180 1903 2571 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_15180 2564 3058 gene locus_tag LOCUS_15190 2564 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3083 4477 gene locus_tag LOCUS_15200 3083 4477 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257217.1 protein_id gnl|my_center|LOCUS_15200 4566 5603 gene locus_tag LOCUS_15210 gene pdhA 4566 5603 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_15210 5596 6582 gene locus_tag LOCUS_15220 5596 6582 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence161 2967 3725 gene locus_tag LOCUS_15230 gene fabL 2967 3725 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_15230 4494 3778 gene locus_tag LOCUS_15240 4494 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5231 4509 gene locus_tag LOCUS_15250 5231 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6330 5503 gene locus_tag LOCUS_15260 gene rlmB 6330 5503 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_15260 <6937 6318 gene locus_tag LOCUS_15270 <6937 6318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257711.1:cysteine--tRNA ligase >Feature sequence162 2089 548 gene locus_tag LOCUS_15280 gene murJ 2089 548 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925416.1 protein_id gnl|my_center|LOCUS_15280 3683 2094 gene locus_tag LOCUS_15290 3683 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4837 3698 gene locus_tag LOCUS_15300 4837 3698 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_15300 5318 6007 gene locus_tag LOCUS_15310 5318 6007 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_15310 6055 6747 gene locus_tag LOCUS_15320 6055 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence163 70 1137 gene locus_tag LOCUS_15330 gene trpS 70 1137 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889658.1 protein_id gnl|my_center|LOCUS_15330 1134 1709 gene locus_tag LOCUS_15340 1134 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15340 1795 2826 gene locus_tag LOCUS_15350 gene trpD 1795 2826 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_15350 3616 2840 gene locus_tag LOCUS_15360 3616 2840 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_15360 4506 3586 gene locus_tag LOCUS_15370 gene prmA 4506 3586 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_15370 6146 4770 gene locus_tag LOCUS_15380 gene radA 6146 4770 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence164 428 1672 gene locus_tag LOCUS_15390 gene lysS 428 1672 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320019.1 protein_id gnl|my_center|LOCUS_15390 1672 3006 gene locus_tag LOCUS_15400 gene leuC 1672 3006 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_15400 3003 3557 gene locus_tag LOCUS_15410 gene leuD 3003 3557 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_15410 3514 4209 gene locus_tag LOCUS_15420 3514 4209 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_15420 4993 5343 gene locus_tag LOCUS_15430 4993 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5396 5935 gene locus_tag LOCUS_15440 5396 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence165 <1 888 gene locus_tag LOCUS_15450 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870108.1:3-isopropylmalate dehydratase large subunit 960 1454 gene locus_tag LOCUS_15460 960 1454 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_15460 1470 2498 gene locus_tag LOCUS_15470 1470 2498 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256238.1 protein_id gnl|my_center|LOCUS_15470 2529 3941 gene locus_tag LOCUS_15480 2529 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4409 3978 gene locus_tag LOCUS_15490 4409 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4672 5100 gene locus_tag LOCUS_15500 4672 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6699 5314 gene locus_tag LOCUS_15510 6699 5314 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816836.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence166 494 1192 gene locus_tag LOCUS_15520 494 1192 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_15520 2067 1714 gene locus_tag LOCUS_15530 2067 1714 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256335.1 protein_id gnl|my_center|LOCUS_15530 3355 2300 gene locus_tag LOCUS_15540 3355 2300 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_15540 <6821 3368 gene locus_tag LOCUS_15550 <6821 3368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162687363.1:sugar-binding protein >Feature sequence167 2340 3305 gene locus_tag LOCUS_15560 2340 3305 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 protein_id gnl|my_center|LOCUS_15560 3326 5044 gene locus_tag LOCUS_15570 3326 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5167 6291 gene locus_tag LOCUS_15580 5167 6291 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence168 307 948 gene locus_tag LOCUS_15590 307 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 945 1883 gene locus_tag LOCUS_15600 945 1883 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181584.1 protein_id gnl|my_center|LOCUS_15600 1865 2257 gene locus_tag LOCUS_15610 1865 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2485 3759 gene locus_tag LOCUS_15620 2485 3759 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_15620 3737 4516 gene locus_tag LOCUS_15630 3737 4516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_15630 4497 5027 gene locus_tag LOCUS_15640 4497 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 <6793 5046 gene locus_tag LOCUS_15650 <6793 5046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243690.1:S9 family peptidase >Feature sequence169 1613 1065 gene locus_tag LOCUS_15660 1613 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1872 2042 gene locus_tag LOCUS_15670 1872 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2039 3529 gene locus_tag LOCUS_15680 2039 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4179 4865 gene locus_tag LOCUS_15690 4179 4865 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_15690 4875 6218 gene locus_tag LOCUS_15700 4875 6218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846588.1 protein_id gnl|my_center|LOCUS_15700 6416 6610 gene locus_tag LOCUS_15710 6416 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence170 <1 1978 gene locus_tag LOCUS_15720 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942749.1:protease Lon-related BREX system protein BrxL 2550 6092 gene locus_tag LOCUS_15730 2550 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence171 1814 1311 gene locus_tag LOCUS_15740 1814 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2882 2016 gene locus_tag LOCUS_15750 2882 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6320 2952 gene locus_tag LOCUS_15760 6320 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence172 <1 659 gene locus_tag LOCUS_15770 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704367.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 917 2356 gene locus_tag LOCUS_15780 gene gatB 917 2356 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_15780 2492 3400 gene locus_tag LOCUS_15790 2492 3400 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_15790 3413 3907 gene locus_tag LOCUS_15800 3413 3907 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_15800 3904 4767 gene locus_tag LOCUS_15810 3904 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence173 20 1036 gene locus_tag LOCUS_15820 20 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1257 2240 gene locus_tag LOCUS_15830 1257 2240 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_15830 2642 2445 gene locus_tag LOCUS_15840 2642 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2616 3200 gene locus_tag LOCUS_15850 2616 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3266 3910 gene locus_tag LOCUS_15860 gene pth 3266 3910 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_15860 3907 6084 gene locus_tag LOCUS_15870 3907 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 >Feature sequence174 5022 5867 gene locus_tag LOCUS_15880 5022 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence175 1182 934 gene locus_tag LOCUS_15890 1182 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2052 2309 gene locus_tag LOCUS_15900 2052 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3024 2656 gene locus_tag LOCUS_15910 3024 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 3487 2975 gene locus_tag LOCUS_15920 3487 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15920 <6628 3535 gene locus_tag LOCUS_15930 <6628 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence176 <1 5295 gene locus_tag LOCUS_15940 <1 5295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071157.1:S8 family serine peptidase 5329 6030 gene locus_tag LOCUS_15950 5329 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence177 1734 916 gene locus_tag LOCUS_15960 1734 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2813 1737 gene locus_tag LOCUS_15970 2813 1737 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_15970 3754 2810 gene locus_tag LOCUS_15980 gene murB 3754 2810 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_15980 5180 3738 gene locus_tag LOCUS_15990 gene murC 5180 3738 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256647.1 protein_id gnl|my_center|LOCUS_15990 5749 5177 gene locus_tag LOCUS_16000 5749 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence178 292 2031 gene locus_tag LOCUS_16010 292 2031 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258639.1 protein_id gnl|my_center|LOCUS_16010 2184 3119 gene locus_tag LOCUS_16020 2184 3119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_16020 3149 4075 gene locus_tag LOCUS_16030 3149 4075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_16030 4595 5995 gene locus_tag LOCUS_16040 4595 5995 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence179 1334 219 gene locus_tag LOCUS_16050 1334 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3355 1331 gene locus_tag LOCUS_16060 3355 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4062 3352 gene locus_tag LOCUS_16070 4062 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 5443 4184 gene locus_tag LOCUS_16080 5443 4184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_16080 6294 5491 gene locus_tag LOCUS_16090 6294 5491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence180 339 533 gene locus_tag LOCUS_16100 339 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1068 2075 gene locus_tag LOCUS_16110 1068 2075 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_16110 2075 2947 gene locus_tag LOCUS_16120 2075 2947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_16120 2950 4248 gene locus_tag LOCUS_16130 2950 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4255 5400 gene locus_tag LOCUS_16140 4255 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence181 1273 497 gene locus_tag LOCUS_16150 1273 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2035 1349 gene locus_tag LOCUS_16160 2035 1349 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_16160 2654 3991 gene locus_tag LOCUS_16170 2654 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4256 4687 gene locus_tag LOCUS_16180 4256 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5623 4667 gene locus_tag LOCUS_16190 5623 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence182 9 1547 gene locus_tag LOCUS_16200 9 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1552 2886 gene locus_tag LOCUS_16210 1552 2886 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_16210 2962 3037 gene locus_tag LOCUS_t00120 2962 3037 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3872 3150 gene locus_tag LOCUS_16220 3872 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4573 3869 gene locus_tag LOCUS_16230 gene cmk 4573 3869 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_16230 5446 4580 gene locus_tag LOCUS_16240 5446 4580 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880947.1 protein_id gnl|my_center|LOCUS_16240 6324 5893 gene locus_tag LOCUS_16250 6324 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence183 780 962 gene locus_tag LOCUS_16260 780 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1086 1274 gene locus_tag LOCUS_16270 1086 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3852 1252 gene locus_tag LOCUS_16280 3852 1252 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_16280 5775 3856 gene locus_tag LOCUS_16290 5775 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 6187 6023 gene locus_tag LOCUS_16300 6187 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence184 345 2120 gene locus_tag LOCUS_16310 345 2120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_16310 2203 4008 gene locus_tag LOCUS_16320 2203 4008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_16320 4517 6115 gene locus_tag LOCUS_16330 4517 6115 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence185 494 204 gene locus_tag LOCUS_16340 494 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16340 905 714 gene locus_tag LOCUS_16350 905 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16350 1052 918 gene locus_tag LOCUS_16360 1052 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1348 1061 gene locus_tag LOCUS_16370 1348 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16370 1391 1684 gene locus_tag LOCUS_16380 1391 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4590 3463 gene locus_tag LOCUS_16390 4590 3463 CDS product IS630-like element ISMac18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990809.1 protein_id gnl|my_center|LOCUS_16390 5993 4782 gene locus_tag LOCUS_16400 5993 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence186 1356 106 gene locus_tag LOCUS_16410 1356 106 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_16410 2485 1367 gene locus_tag LOCUS_16420 2485 1367 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_16420 3859 3203 gene locus_tag LOCUS_16430 3859 3203 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_16430 4447 4854 gene locus_tag LOCUS_16440 4447 4854 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_16440 5046 6209 gene locus_tag LOCUS_16450 5046 6209 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064618.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence187 1716 613 gene locus_tag LOCUS_16460 1716 613 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_16460 2378 1716 gene locus_tag LOCUS_16470 gene eda 2378 1716 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_16470 4228 2423 gene locus_tag LOCUS_16480 4228 2423 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392243.1 protein_id gnl|my_center|LOCUS_16480 5774 4800 gene locus_tag LOCUS_16490 5774 4800 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence188 3237 2161 gene locus_tag LOCUS_16500 3237 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5435 3234 gene locus_tag LOCUS_16510 5435 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 <6273 5748 gene locus_tag LOCUS_16520 <6273 5748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence189 <1 598 gene locus_tag LOCUS_16530 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881258.1:hydantoinase B/oxoprolinase family protein 978 1541 gene locus_tag LOCUS_16540 978 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918766.1 protein_id gnl|my_center|LOCUS_16540 1545 1835 gene locus_tag LOCUS_16550 1545 1835 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090236.1 protein_id gnl|my_center|LOCUS_16550 1855 2766 gene locus_tag LOCUS_16560 1855 2766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_16560 2865 3608 gene locus_tag LOCUS_16570 2865 3608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421578.1 protein_id gnl|my_center|LOCUS_16570 3754 4821 gene locus_tag LOCUS_16580 3754 4821 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_16580 6134 4863 gene locus_tag LOCUS_16590 6134 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence190 1521 184 gene locus_tag LOCUS_16600 1521 184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_16600 2893 1679 gene locus_tag LOCUS_16610 2893 1679 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_16610 3676 2954 gene locus_tag LOCUS_16620 3676 2954 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_16620 5202 3739 gene locus_tag LOCUS_16630 5202 3739 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_16630 6088 5870 gene locus_tag LOCUS_16640 6088 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence191 1492 362 gene locus_tag LOCUS_16650 1492 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2434 2913 gene locus_tag LOCUS_16660 2434 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3112 3525 gene locus_tag LOCUS_16670 3112 3525 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_16670 3648 3902 gene locus_tag LOCUS_16680 3648 3902 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_16680 4044 4490 gene locus_tag LOCUS_16690 4044 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4480 5772 gene locus_tag LOCUS_16700 4480 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence192 1171 50 gene locus_tag LOCUS_16710 1171 50 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_16710 1653 1168 gene locus_tag LOCUS_16720 1653 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3317 2493 gene locus_tag LOCUS_16730 3317 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5512 4538 gene locus_tag LOCUS_16740 5512 4538 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_16740 <6146 5553 gene locus_tag LOCUS_16750 <6146 5553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257983.1:glycosyltransferase >Feature sequence193 1063 362 gene locus_tag LOCUS_16760 1063 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2424 1063 gene locus_tag LOCUS_16770 2424 1063 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_16770 4715 2916 gene locus_tag LOCUS_16780 4715 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5878 5078 gene locus_tag LOCUS_16790 5878 5078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence194 2844 1945 gene locus_tag LOCUS_16800 2844 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5744 2940 gene locus_tag LOCUS_16810 5744 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6102 5923 gene locus_tag LOCUS_16820 6102 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence195 543 1718 gene locus_tag LOCUS_16830 543 1718 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929975.1 protein_id gnl|my_center|LOCUS_16830 1715 2962 gene locus_tag LOCUS_16840 1715 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2959 4056 gene locus_tag LOCUS_16850 gene wecB 2959 4056 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_16850 4173 5513 gene locus_tag LOCUS_16860 4173 5513 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256530.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence196 175 747 gene locus_tag LOCUS_16870 gene rfaH 175 747 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_16870 965 1153 gene locus_tag LOCUS_16880 965 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4555 1220 gene locus_tag LOCUS_16890 4555 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <6070 4558 gene locus_tag LOCUS_16900 <6070 4558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223261.1:CHAT domain-containing protein >Feature sequence197 3459 712 gene locus_tag LOCUS_16910 3459 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3832 4659 gene locus_tag LOCUS_16920 3832 4659 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890440.1 protein_id gnl|my_center|LOCUS_16920 4649 5527 gene locus_tag LOCUS_16930 4649 5527 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence198 3722 2712 gene locus_tag LOCUS_16940 3722 2712 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_16940 4848 3733 gene locus_tag LOCUS_16950 4848 3733 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811665.1 protein_id gnl|my_center|LOCUS_16950 5923 4841 gene locus_tag LOCUS_16960 5923 4841 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence199 1900 2577 gene locus_tag LOCUS_16970 1900 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2706 4256 gene locus_tag LOCUS_16980 2706 4256 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_16980 <6031 4550 gene locus_tag LOCUS_16990 <6031 4550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256387.1:murein biosynthesis integral membrane protein MurJ >Feature sequence200 1769 354 gene locus_tag LOCUS_17000 1769 354 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_17000 2286 2978 gene locus_tag LOCUS_17010 2286 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2975 3682 gene locus_tag LOCUS_17020 2975 3682 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_17020 3818 3997 gene locus_tag LOCUS_17030 3818 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4010 4858 gene locus_tag LOCUS_17040 4010 4858 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_17040 5064 5621 gene locus_tag LOCUS_17050 gene raiA 5064 5621 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257276.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence201 282 518 gene locus_tag LOCUS_17060 282 518 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_17060 530 772 gene locus_tag LOCUS_17070 530 772 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392945.1 protein_id gnl|my_center|LOCUS_17070 787 1323 gene locus_tag LOCUS_17080 787 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1347 3047 gene locus_tag LOCUS_17090 1347 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17090 3140 4333 gene locus_tag LOCUS_17100 3140 4333 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_17100 4571 4837 gene locus_tag LOCUS_17110 4571 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4839 5402 gene locus_tag LOCUS_17120 4839 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5688 5894 gene locus_tag LOCUS_17130 5688 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence202 1082 552 gene locus_tag LOCUS_17140 1082 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1275 1105 gene locus_tag LOCUS_17150 1275 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1765 1304 gene locus_tag LOCUS_17160 1765 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2208 1705 gene locus_tag LOCUS_17170 2208 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3207 2224 gene locus_tag LOCUS_17180 3207 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17180 4051 3185 gene locus_tag LOCUS_17190 4051 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4217 4417 gene locus_tag LOCUS_17200 4217 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4725 4567 gene locus_tag LOCUS_17210 4725 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4984 4712 gene locus_tag LOCUS_17220 4984 4712 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence203 1202 417 gene locus_tag LOCUS_17230 1202 417 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_17230 2535 1318 gene locus_tag LOCUS_17240 2535 1318 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_17240 3283 2564 gene locus_tag LOCUS_17250 3283 2564 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_17250 5272 3392 gene locus_tag LOCUS_17260 5272 3392 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_17260 5605 5357 gene locus_tag LOCUS_17270 5605 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence204 1859 1203 gene locus_tag LOCUS_17280 1859 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5406 2284 gene locus_tag LOCUS_17290 5406 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5480 5659 gene locus_tag LOCUS_17300 5480 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence205 443 1279 gene locus_tag LOCUS_17310 443 1279 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_17310 1281 2282 gene locus_tag LOCUS_17320 1281 2282 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_17320 2362 3351 gene locus_tag LOCUS_17330 gene pdhA 2362 3351 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_17330 3381 4394 gene locus_tag LOCUS_17340 3381 4394 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_17340 4499 5845 gene locus_tag LOCUS_17350 4499 5845 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257217.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence206 <1 4304 gene locus_tag LOCUS_17360 <1 4304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065207.1:helicase-related protein 5123 4326 gene locus_tag LOCUS_17370 5123 4326 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_17370 5260 5499 gene locus_tag LOCUS_17380 5260 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence207 681 1685 gene locus_tag LOCUS_17390 681 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1692 2618 gene locus_tag LOCUS_17400 1692 2618 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_17400 2724 2795 gene locus_tag LOCUS_t00130 2724 2795 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence208 611 1729 gene locus_tag LOCUS_17410 611 1729 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_17410 3580 1946 gene locus_tag LOCUS_17420 3580 1946 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_17420 4455 3577 gene locus_tag LOCUS_17430 4455 3577 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_17430 5243 4452 gene locus_tag LOCUS_17440 5243 4452 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_17440 <5861 5240 gene locus_tag LOCUS_17450 <5861 5240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256060.1:PfkB family carbohydrate kinase >Feature sequence209 439 1728 gene locus_tag LOCUS_17460 gene hemL 439 1728 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_17460 1866 2693 gene locus_tag LOCUS_17470 1866 2693 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_17470 3047 3229 gene locus_tag LOCUS_17480 3047 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3229 4083 gene locus_tag LOCUS_17490 3229 4083 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_17490 4097 5419 gene locus_tag LOCUS_17500 gene lysA 4097 5419 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256477.1 protein_id gnl|my_center|LOCUS_17500 5427 5780 gene locus_tag LOCUS_17510 5427 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence210 <1 1516 gene locus_tag LOCUS_17520 <1 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868972.1:aldehyde ferredoxin oxidoreductase family protein 1513 1800 gene locus_tag LOCUS_17530 1513 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1800 2339 gene locus_tag LOCUS_17540 gene cas4 1800 2339 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_17540 3586 2585 gene locus_tag LOCUS_17550 3586 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4409 3630 gene locus_tag LOCUS_17560 gene tpiA 4409 3630 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_17560 4774 4472 gene locus_tag LOCUS_17570 4774 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 <5783 4949 gene locus_tag LOCUS_17580 <5783 4949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391807.1:phosphoglycerate kinase >Feature sequence211 502 1077 gene locus_tag LOCUS_17590 502 1077 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969630.1 protein_id gnl|my_center|LOCUS_17590 1080 1586 gene locus_tag LOCUS_17600 1080 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1570 2313 gene locus_tag LOCUS_17610 1570 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2310 3956 gene locus_tag LOCUS_17620 2310 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4163 4089 gene locus_tag LOCUS_t00140 4163 4089 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 327 1658 gene locus_tag LOCUS_17630 327 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2256 1840 gene locus_tag LOCUS_17640 2256 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2432 3427 gene locus_tag LOCUS_17650 gene ccpA 2432 3427 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_17650 3472 5151 gene locus_tag LOCUS_17660 3472 5151 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_17660 5167 5586 gene locus_tag LOCUS_17670 5167 5586 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262231.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence213 556 1236 gene locus_tag LOCUS_17680 556 1236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707289.1 protein_id gnl|my_center|LOCUS_17680 1753 2475 gene locus_tag LOCUS_17690 1753 2475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879314.1 protein_id gnl|my_center|LOCUS_17690 2561 4918 gene locus_tag LOCUS_17700 2561 4918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879315.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence214 452 1858 gene locus_tag LOCUS_17710 gene mocA 452 1858 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_17710 2597 2115 gene locus_tag LOCUS_17720 2597 2115 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_17720 2868 2614 gene locus_tag LOCUS_17730 2868 2614 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 protein_id gnl|my_center|LOCUS_17730 4075 2846 gene locus_tag LOCUS_17740 gene xseA 4075 2846 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_17740 5043 4075 gene locus_tag LOCUS_17750 5043 4075 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence215 3545 4258 gene locus_tag LOCUS_17760 gene minC 3545 4258 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_17760 4260 5051 gene locus_tag LOCUS_17770 gene minD 4260 5051 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_17770 5146 5397 gene locus_tag LOCUS_17780 5146 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence216 1749 682 gene locus_tag LOCUS_17790 1749 682 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_17790 3628 2399 gene locus_tag LOCUS_17800 3628 2399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_17800 4063 4272 gene locus_tag LOCUS_17810 4063 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4294 4437 gene locus_tag LOCUS_17820 4294 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4543 4704 gene locus_tag LOCUS_17830 4543 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4786 4947 gene locus_tag LOCUS_17840 4786 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence217 1309 125 gene locus_tag LOCUS_17850 1309 125 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_17850 2128 4371 gene locus_tag LOCUS_17860 2128 4371 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_17860 5346 5633 gene locus_tag LOCUS_17870 5346 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence218 2352 106 gene locus_tag LOCUS_17880 gene pucD 2352 106 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_17880 3825 2356 gene locus_tag LOCUS_17890 3825 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4025 3852 gene locus_tag LOCUS_17900 4025 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5306 4287 gene locus_tag LOCUS_17910 5306 4287 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence219 3676 1934 gene locus_tag LOCUS_17920 3676 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4520 3774 gene locus_tag LOCUS_17930 4520 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4626 4450 gene locus_tag LOCUS_17940 4626 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5641 4958 gene locus_tag LOCUS_17950 5641 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence220 >Feature sequence221 1648 1253 gene locus_tag LOCUS_17960 1648 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966282.1 protein_id gnl|my_center|LOCUS_17960 2053 1664 gene locus_tag LOCUS_17970 2053 1664 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_17970 2621 2322 gene locus_tag LOCUS_17980 2621 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256207.1 protein_id gnl|my_center|LOCUS_17980 4849 2618 gene locus_tag LOCUS_17990 4849 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5152 4919 gene locus_tag LOCUS_18000 5152 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence222 927 2801 gene locus_tag LOCUS_18010 927 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2885 3127 gene locus_tag LOCUS_18020 2885 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3094 4653 gene locus_tag LOCUS_18030 gene hutH 3094 4653 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_18030 4855 5313 gene locus_tag LOCUS_18040 4855 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence223 857 393 gene locus_tag LOCUS_18050 857 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1676 1203 gene locus_tag LOCUS_18060 1676 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2738 2917 gene locus_tag LOCUS_18070 2738 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4654 2978 gene locus_tag LOCUS_18080 4654 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence224 <1 1700 gene locus_tag LOCUS_18090 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144388.1:DUF87 domain-containing protein 1700 2956 gene locus_tag LOCUS_18100 1700 2956 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_18100 3322 4107 gene locus_tag LOCUS_18110 gene lsrF 3322 4107 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_18110 4140 5189 gene locus_tag LOCUS_18120 4140 5189 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence225 714 376 gene locus_tag LOCUS_18130 714 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1362 997 gene locus_tag LOCUS_18140 1362 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 5273 1515 gene locus_tag LOCUS_18150 5273 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence226 <1 2710 gene locus_tag LOCUS_18160 <1 2710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263668.1:CRISPR-associated helicase/endonuclease Cas3 2722 3480 gene locus_tag LOCUS_18170 gene cas5c 2722 3480 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_18170 3482 5443 gene locus_tag LOCUS_18180 3482 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence227 801 2072 gene locus_tag LOCUS_18190 801 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2069 2779 gene locus_tag LOCUS_18200 2069 2779 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_18200 2843 3790 gene locus_tag LOCUS_18210 2843 3790 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_18210 3801 4745 gene locus_tag LOCUS_18220 3801 4745 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence228 274 1029 gene locus_tag LOCUS_18230 274 1029 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582830.1 protein_id gnl|my_center|LOCUS_18230 1037 1564 gene locus_tag LOCUS_18240 1037 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1554 2204 gene locus_tag LOCUS_18250 1554 2204 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088325.1 protein_id gnl|my_center|LOCUS_18250 2249 3007 gene locus_tag LOCUS_18260 2249 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2997 4148 gene locus_tag LOCUS_18270 2997 4148 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_18270 4384 4869 gene locus_tag LOCUS_18280 4384 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence229 1082 177 gene locus_tag LOCUS_18290 1082 177 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_18290 1470 1249 gene locus_tag LOCUS_18300 1470 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1990 1562 gene locus_tag LOCUS_18310 1990 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 3224 2274 gene locus_tag LOCUS_18320 3224 2274 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_18320 3427 4068 gene locus_tag LOCUS_18330 3427 4068 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_18330 4181 4801 gene locus_tag LOCUS_18340 4181 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence230 <1 924 gene locus_tag LOCUS_18350 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939301.1:BREX system Lon protease-like protein BrxL 1474 2907 gene locus_tag LOCUS_18360 1474 2907 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_18360 3234 4598 gene locus_tag LOCUS_18370 3234 4598 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_18370 4910 5338 gene locus_tag LOCUS_18380 4910 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence231 812 1039 gene locus_tag LOCUS_18390 812 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1110 2990 gene locus_tag LOCUS_18400 1110 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2950 3705 gene locus_tag LOCUS_18410 2950 3705 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_18410 4128 3766 gene locus_tag LOCUS_18420 4128 3766 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969441.1 protein_id gnl|my_center|LOCUS_18420 5064 4912 gene locus_tag LOCUS_18430 5064 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence232 1167 139 gene locus_tag LOCUS_18440 1167 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1255 2223 gene locus_tag LOCUS_18450 1255 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2263 2964 gene locus_tag LOCUS_18460 2263 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4838 3123 gene locus_tag LOCUS_18470 4838 3123 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256598.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence233 927 2576 gene locus_tag LOCUS_18480 gene groL 927 2576 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_18480 4138 2885 gene locus_tag LOCUS_18490 4138 2885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_18490 5150 4146 gene locus_tag LOCUS_18500 5150 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence234 1213 80 gene locus_tag LOCUS_18510 1213 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2020 1217 gene locus_tag LOCUS_18520 2020 1217 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_18520 4294 2816 gene locus_tag LOCUS_18530 4294 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 5373 4285 gene locus_tag LOCUS_18540 5373 4285 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence235 464 1087 gene locus_tag LOCUS_18550 464 1087 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_18550 1148 2125 gene locus_tag LOCUS_18560 gene moaA 1148 2125 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_18560 2392 2580 gene locus_tag LOCUS_18570 2392 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2661 4109 gene locus_tag LOCUS_18580 2661 4109 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_18580 4135 4974 gene locus_tag LOCUS_18590 gene trpC 4135 4974 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660663.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence236 353 778 gene locus_tag LOCUS_18600 gene mraZ 353 778 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_18600 857 1765 gene locus_tag LOCUS_18610 gene rsmH 857 1765 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_18610 2167 2682 gene locus_tag LOCUS_18620 2167 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2876 4789 gene locus_tag LOCUS_18630 2876 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence237 511 804 gene locus_tag LOCUS_18640 511 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 779 1204 gene locus_tag LOCUS_18650 779 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2265 1819 gene locus_tag LOCUS_18660 gene tnpA 2265 1819 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_18660 5378 2463 gene locus_tag LOCUS_18670 5378 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence238 99 23 gene locus_tag LOCUS_t00150 99 23 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 633 2234 gene locus_tag LOCUS_18680 633 2234 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_18680 2580 3332 gene locus_tag LOCUS_18690 2580 3332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_18690 3369 3944 gene locus_tag LOCUS_18700 3369 3944 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584065.1 protein_id gnl|my_center|LOCUS_18700 5001 4063 gene locus_tag LOCUS_18710 5001 4063 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_18710 5398 5219 gene locus_tag LOCUS_18720 5398 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence239 1293 130 gene locus_tag LOCUS_18730 1293 130 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_18730 2455 1310 gene locus_tag LOCUS_18740 gene acdA 2455 1310 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_18740 3346 2555 gene locus_tag LOCUS_18750 3346 2555 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence240 153 69 gene locus_tag LOCUS_t00160 153 69 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1296 670 gene locus_tag LOCUS_18760 1296 670 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_18760 2324 1311 gene locus_tag LOCUS_18770 2324 1311 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_18770 3061 2321 gene locus_tag LOCUS_18780 3061 2321 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_18780 3576 3058 gene locus_tag LOCUS_18790 gene moaC 3576 3058 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence241 826 236 gene locus_tag LOCUS_18800 826 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1436 4663 gene locus_tag LOCUS_18810 1436 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5223 4789 gene locus_tag LOCUS_18820 5223 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence242 349 2097 gene locus_tag LOCUS_18830 349 2097 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965042.1 protein_id gnl|my_center|LOCUS_18830 2103 2972 gene locus_tag LOCUS_18840 2103 2972 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence243 670 14 gene locus_tag LOCUS_18850 670 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1640 2257 gene locus_tag LOCUS_18860 1640 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2336 2881 gene locus_tag LOCUS_18870 2336 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3565 2936 gene locus_tag LOCUS_18880 3565 2936 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_18880 4939 3584 gene locus_tag LOCUS_18890 4939 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence244 3126 3548 gene locus_tag LOCUS_18900 3126 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence245 1270 176 gene locus_tag LOCUS_18910 1270 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1964 1275 gene locus_tag LOCUS_18920 gene qcrB 1964 1275 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_18920 2466 1969 gene locus_tag LOCUS_18930 2466 1969 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_18930 4090 2846 gene locus_tag LOCUS_18940 4090 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence246 963 121 gene locus_tag LOCUS_18950 963 121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_18950 1972 977 gene locus_tag LOCUS_18960 1972 977 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_18960 2001 2213 gene locus_tag LOCUS_18970 2001 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2197 2922 gene locus_tag LOCUS_18980 2197 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2919 4424 gene locus_tag LOCUS_18990 2919 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence247 4773 1933 gene locus_tag LOCUS_19000 4773 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5087 4908 gene locus_tag LOCUS_19010 5087 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence248 1570 3357 gene locus_tag LOCUS_19020 gene thrS 1570 3357 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_19020 4795 3476 gene locus_tag LOCUS_19030 4795 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence249 <1 3388 gene locus_tag LOCUS_19040 <1 3388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase 3504 4247 gene locus_tag LOCUS_19050 3504 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence250 1055 117 gene locus_tag LOCUS_19060 1055 117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_19060 2013 1048 gene locus_tag LOCUS_19070 2013 1048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_19070 3124 2018 gene locus_tag LOCUS_19080 3124 2018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_19080 3773 3165 gene locus_tag LOCUS_19090 3773 3165 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256712.1 protein_id gnl|my_center|LOCUS_19090 4500 4961 gene locus_tag LOCUS_19100 4500 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence251 200 1375 gene locus_tag LOCUS_19110 gene dnaN 200 1375 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_19110 1458 2777 gene locus_tag LOCUS_19120 1458 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3486 2758 gene locus_tag LOCUS_19130 3486 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 <5061 3807 gene locus_tag LOCUS_19140 <5061 3807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257427.1:NFACT RNA binding domain-containing protein >Feature sequence252 1694 1023 gene locus_tag LOCUS_19150 gene hypB 1694 1023 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_19150 2101 1760 gene locus_tag LOCUS_19160 gene hypA 2101 1760 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388683.1 protein_id gnl|my_center|LOCUS_19160 2749 2267 gene locus_tag LOCUS_19170 gene hycI 2749 2267 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867982.1 protein_id gnl|my_center|LOCUS_19170 3631 3212 gene locus_tag LOCUS_19180 3631 3212 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147034.1 protein_id gnl|my_center|LOCUS_19180 3941 3633 gene locus_tag LOCUS_19190 3941 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147042.1 protein_id gnl|my_center|LOCUS_19190 4683 3892 gene locus_tag LOCUS_19200 4683 3892 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868589.1 protein_id gnl|my_center|LOCUS_19200 4976 4683 gene locus_tag LOCUS_19210 4976 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence253 210 1709 gene locus_tag LOCUS_19220 gene accC 210 1709 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_19220 1706 2197 gene locus_tag LOCUS_19230 1706 2197 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_19230 2455 3648 gene locus_tag LOCUS_19240 2455 3648 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258379.1 protein_id gnl|my_center|LOCUS_19240 3642 4451 gene locus_tag LOCUS_19250 3642 4451 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence254 <1 857 gene locus_tag LOCUS_19260 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249955.1:SDR family oxidoreductase 1137 2114 gene locus_tag LOCUS_19270 gene pseB 1137 2114 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_19270 2114 3307 gene locus_tag LOCUS_19280 gene pseC 2114 3307 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_19280 3304 4167 gene locus_tag LOCUS_19290 3304 4167 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073144.1 protein_id gnl|my_center|LOCUS_19290 4164 4973 gene locus_tag LOCUS_19300 4164 4973 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence255 1036 374 gene locus_tag LOCUS_19310 gene rpsC 1036 374 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_19310 1424 1065 gene locus_tag LOCUS_19320 gene rplV 1424 1065 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894484.1 protein_id gnl|my_center|LOCUS_19320 1732 1451 gene locus_tag LOCUS_19330 gene rpsS 1732 1451 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_19330 2592 1759 gene locus_tag LOCUS_19340 gene rplB 2592 1759 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_19340 3009 2719 gene locus_tag LOCUS_19350 3009 2719 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_19350 3640 3020 gene locus_tag LOCUS_19360 gene rplD 3640 3020 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_19360 4325 3645 gene locus_tag LOCUS_19370 gene rplC 4325 3645 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_19370 4779 4468 gene locus_tag LOCUS_19380 gene rpsJ 4779 4468 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence256 356 1972 gene locus_tag LOCUS_19390 356 1972 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879525.1 protein_id gnl|my_center|LOCUS_19390 2159 3295 gene locus_tag LOCUS_19400 2159 3295 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064772.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence257 >Feature sequence258 1766 720 gene locus_tag LOCUS_19410 gene hrcA 1766 720 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_19410 2121 3059 gene locus_tag LOCUS_19420 2121 3059 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_19420 3063 4391 gene locus_tag LOCUS_19430 3063 4391 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence259 2091 133 gene locus_tag LOCUS_19440 2091 133 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_19440 2603 2205 gene locus_tag LOCUS_19450 2603 2205 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_19450 4748 3006 gene locus_tag LOCUS_19460 4748 3006 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence260 128 1114 gene locus_tag LOCUS_19470 128 1114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_19470 1151 1930 gene locus_tag LOCUS_19480 1151 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2290 2640 gene locus_tag LOCUS_19490 2290 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2910 3059 gene locus_tag LOCUS_19500 2910 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4658 4807 gene locus_tag LOCUS_19510 4658 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence261 <1 1087 gene locus_tag LOCUS_19520 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942883.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) 1242 2153 gene locus_tag LOCUS_19530 1242 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2093 2695 gene locus_tag LOCUS_19540 2093 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3890 4015 gene locus_tag LOCUS_19550 3890 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4094 4264 gene locus_tag LOCUS_19560 4094 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4644 4823 gene locus_tag LOCUS_19570 4644 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence262 450 1304 gene locus_tag LOCUS_19580 gene cyoE 450 1304 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_19580 1393 1998 gene locus_tag LOCUS_19590 1393 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 4349 2148 gene locus_tag LOCUS_19600 gene glgX 4349 2148 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence263 2550 130 gene locus_tag LOCUS_19610 2550 130 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_19610 3154 3624 gene locus_tag LOCUS_19620 gene greA 3154 3624 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179966.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence264 716 387 gene locus_tag LOCUS_19630 716 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1777 713 gene locus_tag LOCUS_19640 1777 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2034 1765 gene locus_tag LOCUS_19650 2034 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3362 2031 gene locus_tag LOCUS_19660 3362 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4310 3387 gene locus_tag LOCUS_19670 4310 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence265 324 1547 gene locus_tag LOCUS_19680 324 1547 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_19680 1659 2372 gene locus_tag LOCUS_19690 1659 2372 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_19690 3775 2543 gene locus_tag LOCUS_19700 3775 2543 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444448.1 protein_id gnl|my_center|LOCUS_19700 4469 3780 gene locus_tag LOCUS_19710 4469 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence266 318 761 gene locus_tag LOCUS_19720 318 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1034 1600 gene locus_tag LOCUS_19730 1034 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1707 2210 gene locus_tag LOCUS_19740 1707 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2336 3037 gene locus_tag LOCUS_19750 2336 3037 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_19750 3027 4391 gene locus_tag LOCUS_19760 3027 4391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence267 505 1419 gene locus_tag LOCUS_19770 505 1419 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_19770 3741 1525 gene locus_tag LOCUS_19780 3741 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3978 4062 gene locus_tag LOCUS_t00170 3978 4062 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence268 356 165 gene locus_tag LOCUS_19790 356 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2124 613 gene locus_tag LOCUS_19800 2124 613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_19800 4058 2418 gene locus_tag LOCUS_19810 4058 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence269 775 224 gene locus_tag LOCUS_19820 775 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1708 920 gene locus_tag LOCUS_19830 1708 920 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_19830 2616 1705 gene locus_tag LOCUS_19840 2616 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 <4752 2775 gene locus_tag LOCUS_19850 <4752 2775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920783.1:transglycosylase SLT domain-containing protein >Feature sequence270 978 628 gene locus_tag LOCUS_19860 978 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1545 2831 gene locus_tag LOCUS_19870 1545 2831 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_19870 2964 4643 gene locus_tag LOCUS_19880 2964 4643 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence271 92 1342 gene locus_tag LOCUS_19890 92 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 1344 1625 gene locus_tag LOCUS_19900 1344 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1625 2731 gene locus_tag LOCUS_19910 gene qmoC 1625 2731 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932549.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence272 720 1421 gene locus_tag LOCUS_19920 720 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1422 2435 gene locus_tag LOCUS_19930 1422 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3111 2578 gene locus_tag LOCUS_19940 3111 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4719 3649 gene locus_tag LOCUS_19950 4719 3649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080938.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence273 613 1257 gene locus_tag LOCUS_19960 613 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1205 1804 gene locus_tag LOCUS_19970 1205 1804 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930436.1 protein_id gnl|my_center|LOCUS_19970 1815 3821 gene locus_tag LOCUS_19980 1815 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence274 62 1387 gene locus_tag LOCUS_19990 62 1387 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_19990 1396 2697 gene locus_tag LOCUS_20000 1396 2697 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_20000 2690 3973 gene locus_tag LOCUS_20010 2690 3973 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_20010 3977 4351 gene locus_tag LOCUS_20020 3977 4351 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817437.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence275 1774 803 gene locus_tag LOCUS_20030 1774 803 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_20030 2999 1785 gene locus_tag LOCUS_20040 gene recF 2999 1785 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_20040 3829 3365 gene locus_tag LOCUS_20050 3829 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3822 4091 gene locus_tag LOCUS_20060 3822 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence276 <1 1154 gene locus_tag LOCUS_20070 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869430.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme 1180 2124 gene locus_tag LOCUS_20080 1180 2124 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_20080 2175 3167 gene locus_tag LOCUS_20090 gene pseG 2175 3167 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_20090 3160 4095 gene locus_tag LOCUS_20100 3160 4095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence277 1031 555 gene locus_tag LOCUS_20110 1031 555 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_20110 1689 1375 gene locus_tag LOCUS_20120 1689 1375 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_20120 2151 1750 gene locus_tag LOCUS_20130 2151 1750 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_20130 3432 2170 gene locus_tag LOCUS_20140 3432 2170 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_20140 3762 4646 gene locus_tag LOCUS_20150 gene pdxS 3762 4646 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence278 89 2 gene locus_tag LOCUS_t00180 89 2 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1006 272 gene locus_tag LOCUS_20160 1006 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1876 1043 gene locus_tag LOCUS_20170 1876 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3400 2129 gene locus_tag LOCUS_20180 gene serS 3400 2129 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_20180 4415 3975 gene locus_tag LOCUS_20190 4415 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence279 2155 1517 gene locus_tag LOCUS_20200 2155 1517 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_20200 3357 2578 gene locus_tag LOCUS_20210 3357 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4274 3561 gene locus_tag LOCUS_20220 4274 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence280 1141 839 gene locus_tag LOCUS_20230 1141 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1287 1159 gene locus_tag LOCUS_20240 1287 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1716 1363 gene locus_tag LOCUS_20250 1716 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2012 1713 gene locus_tag LOCUS_20260 2012 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2634 2074 gene locus_tag LOCUS_20270 2634 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3102 2710 gene locus_tag LOCUS_20280 3102 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3974 3132 gene locus_tag LOCUS_20290 3974 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence281 122 195 gene locus_tag LOCUS_t00190 122 195 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 231 301 gene locus_tag LOCUS_t00200 231 301 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 348 423 gene locus_tag LOCUS_t00210 348 423 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 682 1227 gene locus_tag LOCUS_20300 682 1227 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_20300 1648 1295 gene locus_tag LOCUS_20310 1648 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2267 1662 gene locus_tag LOCUS_20320 2267 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3171 2257 gene locus_tag LOCUS_20330 3171 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3807 3178 gene locus_tag LOCUS_20340 3807 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence282 2928 487 gene locus_tag LOCUS_20350 2928 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4464 4282 gene locus_tag LOCUS_20360 4464 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence283 2673 1636 gene locus_tag LOCUS_20370 2673 1636 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_20370 3834 3052 gene locus_tag LOCUS_20380 3834 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4445 3918 gene locus_tag LOCUS_20390 4445 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence284 591 1574 gene locus_tag LOCUS_20400 591 1574 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_20400 1564 2535 gene locus_tag LOCUS_20410 gene gmd 1564 2535 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_20410 2696 4132 gene locus_tag LOCUS_20420 2696 4132 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence285 >Feature sequence286 160 1092 gene locus_tag LOCUS_20430 160 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1428 1691 gene locus_tag LOCUS_20440 1428 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1821 2057 gene locus_tag LOCUS_20450 1821 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2425 2228 gene locus_tag LOCUS_20460 2425 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3624 4001 gene locus_tag LOCUS_20470 3624 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence287 2096 909 gene locus_tag LOCUS_20480 gene sat 2096 909 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_20480 2997 2638 gene locus_tag LOCUS_20490 2997 2638 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_20490 4266 3142 gene locus_tag LOCUS_20500 4266 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence288 272 63 gene locus_tag LOCUS_20510 272 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 574 269 gene locus_tag LOCUS_20520 574 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 695 1816 gene locus_tag LOCUS_20530 695 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258216.1 protein_id gnl|my_center|LOCUS_20530 1813 2628 gene locus_tag LOCUS_20540 1813 2628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259020.1 protein_id gnl|my_center|LOCUS_20540 3122 3817 gene locus_tag LOCUS_20550 3122 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3814 4062 gene locus_tag LOCUS_20560 3814 4062 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870071.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence289 2360 1170 gene locus_tag LOCUS_20570 2360 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 <4509 2372 gene locus_tag LOCUS_20580 <4509 2372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256618.1:ATP-dependent helicase note possible pseudo, internal stop codon, frameshifted >Feature sequence290 102 626 gene locus_tag LOCUS_20590 102 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 631 2601 gene locus_tag LOCUS_20600 gene mrdA 631 2601 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_20600 2902 3498 gene locus_tag LOCUS_20610 2902 3498 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582483.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence291 4335 2521 gene locus_tag LOCUS_20620 4335 2521 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258584.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence292 1055 291 gene locus_tag LOCUS_20630 1055 291 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_20630 1997 1437 gene locus_tag LOCUS_20640 1997 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2190 1954 gene locus_tag LOCUS_20650 2190 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2426 2187 gene locus_tag LOCUS_20660 2426 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2992 2870 gene locus_tag LOCUS_20670 2992 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3465 3043 gene locus_tag LOCUS_20680 3465 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 4043 3627 gene locus_tag LOCUS_20690 4043 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence293 827 270 gene locus_tag LOCUS_20700 827 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2407 1703 gene locus_tag LOCUS_20710 2407 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3998 2616 gene locus_tag LOCUS_20720 3998 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence294 301 1635 gene locus_tag LOCUS_20730 301 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1583 2788 gene locus_tag LOCUS_20740 1583 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3343 4353 gene locus_tag LOCUS_20750 3343 4353 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence295 <1 1080 gene locus_tag LOCUS_20760 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940008.1:branched-chain amino acid ABC transporter permease 1084 1854 gene locus_tag LOCUS_20770 1084 1854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_20770 1854 2567 gene locus_tag LOCUS_20780 1854 2567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_20780 2567 3751 gene locus_tag LOCUS_20790 gene alr 2567 3751 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence296 843 295 gene locus_tag LOCUS_20800 843 295 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257214.1 protein_id gnl|my_center|LOCUS_20800 1409 858 gene locus_tag LOCUS_20810 1409 858 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257215.1 protein_id gnl|my_center|LOCUS_20810 1974 1531 gene locus_tag LOCUS_20820 1974 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2257 1985 gene locus_tag LOCUS_20830 2257 1985 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257210.1 protein_id gnl|my_center|LOCUS_20830 3659 2283 gene locus_tag LOCUS_20840 3659 2283 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257217.1 protein_id gnl|my_center|LOCUS_20840 4404 3667 gene locus_tag LOCUS_20850 4404 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence297 828 169 gene locus_tag LOCUS_20860 828 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 1450 956 gene locus_tag LOCUS_20870 1450 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2353 1466 gene locus_tag LOCUS_20880 2353 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2902 4227 gene locus_tag LOCUS_20890 gene ffh 2902 4227 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257918.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence298 58 495 gene locus_tag LOCUS_20900 gene tsaE 58 495 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_20900 492 1148 gene locus_tag LOCUS_20910 gene tsaB 492 1148 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_20910 1270 1863 gene locus_tag LOCUS_20920 1270 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2106 3998 gene locus_tag LOCUS_20930 2106 3998 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence299 2614 506 gene locus_tag LOCUS_20940 2614 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3663 2770 gene locus_tag LOCUS_20950 3663 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 <4412 3660 gene locus_tag LOCUS_20960 <4412 3660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase >Feature sequence300 305 1633 gene locus_tag LOCUS_20970 305 1633 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_20970 2514 1687 gene locus_tag LOCUS_20980 2514 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2977 4053 gene locus_tag LOCUS_20990 2977 4053 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence301 3523 518 gene locus_tag LOCUS_21000 3523 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence302 506 760 gene locus_tag LOCUS_21010 506 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 774 1085 gene locus_tag LOCUS_21020 774 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21020 1082 2491 gene locus_tag LOCUS_21030 1082 2491 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 protein_id gnl|my_center|LOCUS_21030 2488 3636 gene locus_tag LOCUS_21040 2488 3636 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence303 1717 446 gene locus_tag LOCUS_21050 1717 446 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_21050 3378 2101 gene locus_tag LOCUS_21060 gene ahbC 3378 2101 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_21060 4310 3432 gene locus_tag LOCUS_21070 gene hemB 4310 3432 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258455.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence304 962 747 gene locus_tag LOCUS_21080 962 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 906 1616 gene locus_tag LOCUS_21090 906 1616 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_21090 1621 3366 gene locus_tag LOCUS_21100 gene phoR 1621 3366 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence305 <1 594 gene locus_tag LOCUS_21110 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721337.1:PTS glucitol/sorbitol transporter subunit IIB 1252 1620 gene locus_tag LOCUS_21120 1252 1620 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257212.1 protein_id gnl|my_center|LOCUS_21120 1617 2915 gene locus_tag LOCUS_21130 1617 2915 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257211.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence306 492 7 gene locus_tag LOCUS_21140 492 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 781 506 gene locus_tag LOCUS_21150 781 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2145 1915 gene locus_tag LOCUS_21160 2145 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence307 608 1414 gene locus_tag LOCUS_21170 608 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3346 1421 gene locus_tag LOCUS_21180 3346 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 <4319 3468 gene locus_tag LOCUS_21190 <4319 3468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545085.1:tyrosine recombinase XerC >Feature sequence308 1754 165 gene locus_tag LOCUS_21200 1754 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1893 1774 gene locus_tag LOCUS_21210 1893 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 <4319 1964 gene locus_tag LOCUS_21220 <4319 1964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056879.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence309 3627 382 gene locus_tag LOCUS_21230 3627 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21230 4226 4062 gene locus_tag LOCUS_21240 4226 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence310 2238 3545 gene locus_tag LOCUS_21250 2238 3545 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence311 897 478 gene locus_tag LOCUS_21260 897 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2772 1093 gene locus_tag LOCUS_21270 2772 1093 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931740.1 protein_id gnl|my_center|LOCUS_21270 3445 3230 gene locus_tag LOCUS_21280 3445 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence312 1608 76 gene locus_tag LOCUS_21290 1608 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1816 2157 gene locus_tag LOCUS_21300 1816 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2187 2825 gene locus_tag LOCUS_21310 2187 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3317 2934 gene locus_tag LOCUS_21320 gene rplL 3317 2934 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_21320 4120 3596 gene locus_tag LOCUS_21330 gene rplJ 4120 3596 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222529.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence313 <1 911 gene locus_tag LOCUS_21340 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080230.1:ABC transporter ATP-binding protein 3501 955 gene locus_tag LOCUS_21350 gene glgP 3501 955 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_21350 4264 3545 gene locus_tag LOCUS_21360 4264 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence314 367 155 gene locus_tag LOCUS_21370 367 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2453 348 gene locus_tag LOCUS_21380 2453 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3804 3547 gene locus_tag LOCUS_21390 3804 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3773 4129 gene locus_tag LOCUS_21400 3773 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence315 389 3748 gene locus_tag LOCUS_21410 389 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4098 4250 gene locus_tag LOCUS_21420 4098 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence316 1324 2718 gene locus_tag LOCUS_21430 1324 2718 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528261.1 protein_id gnl|my_center|LOCUS_21430 2845 3834 gene locus_tag LOCUS_21440 2845 3834 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence317 411 602 gene locus_tag LOCUS_21450 411 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 905 1786 gene locus_tag LOCUS_21460 905 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 <4230 2098 gene locus_tag LOCUS_21470 <4230 2098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228702.1:glutamate synthase-related protein >Feature sequence318 160 390 gene locus_tag LOCUS_21480 160 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 402 650 gene locus_tag LOCUS_21490 402 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_21490 1750 2385 gene locus_tag LOCUS_21500 1750 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2560 3441 gene locus_tag LOCUS_21510 2560 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764034.1 protein_id gnl|my_center|LOCUS_21510 3630 3890 gene locus_tag LOCUS_21520 3630 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence319 983 189 gene locus_tag LOCUS_21530 983 189 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_21530 1940 1029 gene locus_tag LOCUS_21540 1940 1029 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_21540 3945 1972 gene locus_tag LOCUS_21550 3945 1972 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence320 81 1250 gene locus_tag LOCUS_21560 81 1250 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_21560 1276 2334 gene locus_tag LOCUS_21570 1276 2334 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence321 216 2093 gene locus_tag LOCUS_21580 gene dnaG 216 2093 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_21580 2135 2323 gene locus_tag LOCUS_21590 2135 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2456 3622 gene locus_tag LOCUS_21600 gene rpoD 2456 3622 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_21600 3868 3941 gene locus_tag LOCUS_t00220 3868 3941 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence322 <1 1226 gene locus_tag LOCUS_21610 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259098.1:sugar transferase 1372 2559 gene locus_tag LOCUS_21620 1372 2559 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_21620 2564 3703 gene locus_tag LOCUS_21630 2564 3703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence323 759 85 gene locus_tag LOCUS_21640 759 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence324 86 307 gene locus_tag LOCUS_21650 86 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 300 563 gene locus_tag LOCUS_21660 300 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1071 1742 gene locus_tag LOCUS_21670 1071 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1810 2148 gene locus_tag LOCUS_21680 1810 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2145 2651 gene locus_tag LOCUS_21690 2145 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2651 3673 gene locus_tag LOCUS_21700 2651 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3696 3851 gene locus_tag LOCUS_21710 3696 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence325 >Feature sequence326 443 1009 gene locus_tag LOCUS_21720 443 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1116 1961 gene locus_tag LOCUS_21730 1116 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1976 2701 gene locus_tag LOCUS_21740 1976 2701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_21740 2694 3374 gene locus_tag LOCUS_21750 2694 3374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941338.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence327 326 1561 gene locus_tag LOCUS_21760 326 1561 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_21760 1573 2463 gene locus_tag LOCUS_21770 1573 2463 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_21770 2473 3075 gene locus_tag LOCUS_21780 2473 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence328 1629 613 gene locus_tag LOCUS_21790 1629 613 CDS product PseG/SpsG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244190.1 protein_id gnl|my_center|LOCUS_21790 2624 1680 gene locus_tag LOCUS_21800 2624 1680 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_21800 3956 2649 gene locus_tag LOCUS_21810 3956 2649 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence329 224 412 gene locus_tag LOCUS_21820 224 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 418 813 gene locus_tag LOCUS_21830 418 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 806 1366 gene locus_tag LOCUS_21840 806 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1363 2574 gene locus_tag LOCUS_21850 1363 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2622 2792 gene locus_tag LOCUS_21860 2622 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3309 3473 gene locus_tag LOCUS_21870 3309 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3570 3824 gene locus_tag LOCUS_21880 3570 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence330 2922 2284 gene locus_tag LOCUS_21890 2922 2284 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence331 3375 3235 gene locus_tag LOCUS_21900 3375 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence332 564 1607 gene locus_tag LOCUS_21910 564 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1778 2401 gene locus_tag LOCUS_21920 1778 2401 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence333 1608 304 gene locus_tag LOCUS_21930 1608 304 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_21930 2702 1608 gene locus_tag LOCUS_21940 gene ald 2702 1608 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583412.1 protein_id gnl|my_center|LOCUS_21940 3307 2840 gene locus_tag LOCUS_21950 3307 2840 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_21950 <3967 3330 gene locus_tag LOCUS_21960 <3967 3330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257403.1:uracil phosphoribosyltransferase >Feature sequence334 3370 3173 gene locus_tag LOCUS_21970 3370 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence335 940 779 gene locus_tag LOCUS_21980 940 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2068 1070 gene locus_tag LOCUS_21990 2068 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2881 2099 gene locus_tag LOCUS_22000 2881 2099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_22000 <3920 3213 gene locus_tag LOCUS_22010 <3920 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887604.1:ABC transporter permease >Feature sequence336 2324 2004 gene locus_tag LOCUS_22020 2324 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2721 2311 gene locus_tag LOCUS_22030 2721 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3121 2723 gene locus_tag LOCUS_22040 3121 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 <3914 3108 gene locus_tag LOCUS_22050 <3914 3108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763227.1:glycosyltransferase family 1 protein >Feature sequence337 <1 890 gene locus_tag LOCUS_22060 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024414.1:restriction endonuclease 1397 2233 gene locus_tag LOCUS_22070 1397 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3316 2441 gene locus_tag LOCUS_22080 gene xerC 3316 2441 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence338 1191 337 gene locus_tag LOCUS_22090 1191 337 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_22090 2120 1188 gene locus_tag LOCUS_22100 2120 1188 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_22100 3535 2192 gene locus_tag LOCUS_22110 3535 2192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence339 1633 743 gene locus_tag LOCUS_22120 1633 743 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_22120 2849 1647 gene locus_tag LOCUS_22130 2849 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3175 2867 gene locus_tag LOCUS_22140 3175 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22140 3875 3165 gene locus_tag LOCUS_22150 3875 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22150 >Feature sequence340 <1 1030 gene locus_tag LOCUS_22160 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875575.1:DUF1887 family CARF protein 1027 1497 gene locus_tag LOCUS_22170 1027 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1494 2213 gene locus_tag LOCUS_22180 1494 2213 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 protein_id gnl|my_center|LOCUS_22180 2206 3567 gene locus_tag LOCUS_22190 2206 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence341 <1 515 gene locus_tag LOCUS_22200 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257228.1:prolipoprotein diacylglyceryl transferase 512 1855 gene locus_tag LOCUS_22210 gene trmFO 512 1855 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213003.1 protein_id gnl|my_center|LOCUS_22210 2084 2530 gene locus_tag LOCUS_22220 gene nrdR 2084 2530 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence342 1079 75 gene locus_tag LOCUS_22230 gene trxB 1079 75 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_22230 2650 1451 gene locus_tag LOCUS_22240 2650 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3615 2770 gene locus_tag LOCUS_22250 3615 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence343 700 843 gene locus_tag LOCUS_22260 700 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 869 1042 gene locus_tag LOCUS_22270 869 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1539 1336 gene locus_tag LOCUS_22280 1539 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2015 1692 gene locus_tag LOCUS_22290 2015 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 <3788 2064 gene locus_tag LOCUS_22300 <3788 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943880.1:ferrous iron transport protein B >Feature sequence344 517 179 gene locus_tag LOCUS_22310 517 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1379 534 gene locus_tag LOCUS_22320 1379 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1715 2650 gene locus_tag LOCUS_22330 1715 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence345 1 324 gene locus_tag LOCUS_22340 1 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 387 1697 gene locus_tag LOCUS_22350 387 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3214 1850 gene locus_tag LOCUS_22360 3214 1850 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_22360 <3774 3211 gene locus_tag LOCUS_22370 <3774 3211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250780.1:MFS transporter >Feature sequence346 264 100 gene locus_tag LOCUS_22380 264 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2287 653 gene locus_tag LOCUS_22390 2287 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence347 261 91 gene locus_tag LOCUS_22400 261 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 758 261 gene locus_tag LOCUS_22410 758 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 745 897 gene locus_tag LOCUS_22420 745 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 910 1038 gene locus_tag LOCUS_22430 910 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22430 2011 1568 gene locus_tag LOCUS_22440 2011 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2210 2139 gene locus_tag LOCUS_t00230 2210 2139 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3620 2493 gene locus_tag LOCUS_22450 3620 2493 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence348 337 1455 gene locus_tag LOCUS_22460 337 1455 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_22460 1733 2485 gene locus_tag LOCUS_22470 1733 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2500 3447 gene locus_tag LOCUS_22480 2500 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence349 1345 284 gene locus_tag LOCUS_22490 1345 284 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_22490 2198 1353 gene locus_tag LOCUS_22500 gene rsmI 2198 1353 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_22500 3466 2249 gene locus_tag LOCUS_22510 3466 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence350 1 1023 gene locus_tag LOCUS_22520 1 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2541 1066 gene locus_tag LOCUS_22530 2541 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2571 3146 gene locus_tag LOCUS_22540 2571 3146 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence351 746 132 gene locus_tag LOCUS_22550 746 132 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_22550 1982 774 gene locus_tag LOCUS_22560 1982 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 <3669 1985 gene locus_tag LOCUS_22570 <3669 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258027.1:ATP-binding protein >Feature sequence352 213 2633 gene locus_tag LOCUS_22580 213 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2793 3617 gene locus_tag LOCUS_22590 2793 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence353 1493 93 gene locus_tag LOCUS_22600 1493 93 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_22600 <3649 1490 gene locus_tag LOCUS_22610 <3649 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255996.1:endopeptidase La >Feature sequence354 679 38 gene locus_tag LOCUS_22620 679 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1737 694 gene locus_tag LOCUS_22630 1737 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22630 2435 1734 gene locus_tag LOCUS_22640 2435 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 3617 2925 gene locus_tag LOCUS_22650 3617 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence355 358 164 gene locus_tag LOCUS_22660 358 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence356 902 1744 gene locus_tag LOCUS_22670 902 1744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_22670 1741 2514 gene locus_tag LOCUS_22680 1741 2514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226153.1 protein_id gnl|my_center|LOCUS_22680 2642 3589 gene locus_tag LOCUS_22690 2642 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence357 59 985 gene locus_tag LOCUS_22700 59 985 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_22700 972 1724 gene locus_tag LOCUS_22710 972 1724 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_22710 2000 2773 gene locus_tag LOCUS_22720 2000 2773 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence358 888 1634 gene locus_tag LOCUS_22730 888 1634 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence359 1960 1445 gene locus_tag LOCUS_22740 1960 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence360 136 627 gene locus_tag LOCUS_22750 136 627 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259311.1 protein_id gnl|my_center|LOCUS_22750 1004 2173 gene locus_tag LOCUS_22760 gene tgt 1004 2173 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_22760 2177 2992 gene locus_tag LOCUS_22770 gene uppP 2177 2992 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence361 1771 758 gene locus_tag LOCUS_22780 gene gap 1771 758 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_22780 3231 1936 gene locus_tag LOCUS_22790 3231 1936 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence362 219 548 gene locus_tag LOCUS_22800 219 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1249 3204 gene locus_tag LOCUS_22810 1249 3204 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_22810 3220 3456 gene locus_tag LOCUS_22820 3220 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence363 408 1034 gene locus_tag LOCUS_22830 408 1034 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_22830 1313 2977 gene locus_tag LOCUS_22840 1313 2977 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence364 2710 1379 gene locus_tag LOCUS_22850 2710 1379 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_22850 3118 3276 gene locus_tag LOCUS_22860 3118 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22860 >Feature sequence365 1102 455 gene locus_tag LOCUS_22870 1102 455 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_22870 2856 1534 gene locus_tag LOCUS_22880 2856 1534 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence366 945 82 gene locus_tag LOCUS_22890 945 82 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963647.1 protein_id gnl|my_center|LOCUS_22890 1783 932 gene locus_tag LOCUS_22900 1783 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3314 2049 gene locus_tag LOCUS_22910 3314 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence367 918 148 gene locus_tag LOCUS_22920 918 148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_22920 1948 977 gene locus_tag LOCUS_22930 gene pfkA 1948 977 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393368.1 protein_id gnl|my_center|LOCUS_22930 2046 2119 gene locus_tag LOCUS_t00240 2046 2119 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3534 2122 gene locus_tag LOCUS_22940 3534 2122 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258565.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence368 522 250 gene locus_tag LOCUS_22950 522 250 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480082.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence369 430 191 gene locus_tag LOCUS_22960 430 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1307 1837 gene locus_tag LOCUS_22970 1307 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1866 2720 gene locus_tag LOCUS_22980 1866 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2690 3349 gene locus_tag LOCUS_22990 2690 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence370 47 580 gene locus_tag LOCUS_23000 47 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 609 1850 gene locus_tag LOCUS_23010 609 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1860 2990 gene locus_tag LOCUS_23020 1860 2990 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence371 771 367 gene locus_tag LOCUS_23030 771 367 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 protein_id gnl|my_center|LOCUS_23030 2158 995 gene locus_tag LOCUS_23040 2158 995 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_23040 3217 2168 gene locus_tag LOCUS_23050 3217 2168 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence372 713 468 gene locus_tag LOCUS_23060 gene infA 713 468 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_23060 2010 784 gene locus_tag LOCUS_23070 gene dinB 2010 784 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_23070 2435 2064 gene locus_tag LOCUS_23080 2435 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3258 2548 gene locus_tag LOCUS_23090 3258 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3426 3271 gene locus_tag LOCUS_23100 3426 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence373 2044 1043 gene locus_tag LOCUS_23110 2044 1043 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_23110 3194 2202 gene locus_tag LOCUS_23120 3194 2202 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259573.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence374 483 91 gene locus_tag LOCUS_23130 483 91 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_23130 1757 546 gene locus_tag LOCUS_23140 1757 546 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868011.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence375 1578 382 gene locus_tag LOCUS_23150 1578 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2949 1702 gene locus_tag LOCUS_23160 gene rho 2949 1702 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence376 2209 734 gene locus_tag LOCUS_23170 2209 734 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_23170 2544 2323 gene locus_tag LOCUS_23180 2544 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2914 3405 gene locus_tag LOCUS_23190 2914 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence377 217 62 gene locus_tag LOCUS_23200 217 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 477 202 gene locus_tag LOCUS_23210 477 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2593 1082 gene locus_tag LOCUS_23220 2593 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3089 2970 gene locus_tag LOCUS_23230 3089 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3246 3398 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtccacccccacgcgtgtggggaaaac >Feature sequence378 1236 250 gene locus_tag LOCUS_23240 1236 250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_23240 2520 1780 gene locus_tag LOCUS_23250 2520 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence379 683 531 gene locus_tag LOCUS_23260 683 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1085 774 gene locus_tag LOCUS_23270 1085 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1779 1063 gene locus_tag LOCUS_23280 1779 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2128 1793 gene locus_tag LOCUS_23290 2128 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2273 2118 gene locus_tag LOCUS_23300 2273 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2465 2304 gene locus_tag LOCUS_23310 2465 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3217 2786 gene locus_tag LOCUS_23320 gene tnpA 3217 2786 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence380 107 2257 gene locus_tag LOCUS_23330 107 2257 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_23330 2254 2454 gene locus_tag LOCUS_23340 2254 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2606 2472 gene locus_tag LOCUS_23350 2606 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence381 2942 1065 gene locus_tag LOCUS_23360 gene uvrC 2942 1065 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_23360 3388 3128 gene locus_tag LOCUS_23370 3388 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence382 276 926 gene locus_tag LOCUS_23380 276 926 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_23380 945 2204 gene locus_tag LOCUS_23390 gene trpB 945 2204 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_23390 2201 3019 gene locus_tag LOCUS_23400 gene trpA 2201 3019 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence383 1309 506 gene locus_tag LOCUS_23410 gene mtnP 1309 506 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_23410 3206 1656 gene locus_tag LOCUS_23420 3206 1656 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence384 <1 971 gene locus_tag LOCUS_23430 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531072.1:efflux RND transporter periplasmic adaptor subunit 973 1671 gene locus_tag LOCUS_23440 973 1671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_23440 1700 2959 gene locus_tag LOCUS_23450 1700 2959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence385 1051 407 gene locus_tag LOCUS_23460 1051 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1249 1055 gene locus_tag LOCUS_23470 1249 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1427 1227 gene locus_tag LOCUS_23480 1427 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2733 1936 gene locus_tag LOCUS_23490 2733 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2842 2769 gene locus_tag LOCUS_t00250 2842 2769 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence386 1055 1468 gene locus_tag LOCUS_23500 1055 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1791 1528 gene locus_tag LOCUS_23510 1791 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 <3352 1959 gene locus_tag LOCUS_23520 <3352 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259187.1:argininosuccinate lyase >Feature sequence387 2293 248 gene locus_tag LOCUS_23530 2293 248 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_23530 2787 2290 gene locus_tag LOCUS_23540 2787 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence388 3 1229 gene locus_tag LOCUS_23550 3 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1647 1465 gene locus_tag LOCUS_23560 gene rpmB 1647 1465 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_23560 <3324 1939 gene locus_tag LOCUS_23570 <3324 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258322.1:O-antigen ligase family protein >Feature sequence389 <3321 748 gene locus_tag LOCUS_23580 <3321 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388269.1:DEAD/DEAH box helicase >Feature sequence390 >Feature sequence391 <3291 655 gene locus_tag LOCUS_23590 <3291 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256507.1:O-antigen ligase family protein >Feature sequence392 776 423 gene locus_tag LOCUS_23600 776 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1080 1364 gene locus_tag LOCUS_23610 gene rpsT 1080 1364 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_23610 2980 1451 gene locus_tag LOCUS_23620 2980 1451 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257663.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence393 <1 964 gene locus_tag LOCUS_23630 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256314.1:glycosyltransferase family 2 protein 957 1334 gene locus_tag LOCUS_23640 957 1334 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence394 <1 2761 gene locus_tag LOCUS_23650 <1 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037396539.1:PAS domain-containing sensor histidine kinase >Feature sequence395 <1 1058 gene locus_tag LOCUS_23660 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975721.1:ABC transporter permease 1200 2390 gene locus_tag LOCUS_23670 1200 2390 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_23670 2697 2560 gene locus_tag LOCUS_23680 2697 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence396 283 1515 gene locus_tag LOCUS_23690 283 1515 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 protein_id gnl|my_center|LOCUS_23690 1512 3170 gene locus_tag LOCUS_23700 1512 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence397 1502 144 gene locus_tag LOCUS_23710 1502 144 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_23710 2011 3003 gene locus_tag LOCUS_23720 2011 3003 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence398 <1 1563 gene locus_tag LOCUS_23730 <1 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208974886.1:thiol reductant ABC exporter subunit CydC 1817 2710 gene locus_tag LOCUS_23740 gene rarD 1817 2710 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_23740 2667 2990 gene locus_tag LOCUS_23750 2667 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence399 1778 288 gene locus_tag LOCUS_23760 1778 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2404 2889 gene locus_tag LOCUS_23770 2404 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence400 866 474 gene locus_tag LOCUS_23780 866 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1364 963 gene locus_tag LOCUS_23790 1364 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1797 1967 gene locus_tag LOCUS_23800 1797 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2180 2317 gene locus_tag LOCUS_23810 2180 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2520 2771 gene locus_tag LOCUS_23820 2520 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2768 2980 gene locus_tag LOCUS_23830 2768 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence401 <1 1616 gene locus_tag LOCUS_23840 <1 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940193.1:response regulator 2111 1884 gene locus_tag LOCUS_23850 2111 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2488 2084 gene locus_tag LOCUS_23860 2488 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2629 2871 gene locus_tag LOCUS_23870 2629 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence402 >Feature sequence403 1657 1187 gene locus_tag LOCUS_23880 1657 1187 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence404 259 1296 gene locus_tag LOCUS_23890 259 1296 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_23890 2414 2632 gene locus_tag LOCUS_23900 2414 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence405 614 342 gene locus_tag LOCUS_23910 614 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1272 778 gene locus_tag LOCUS_23920 1272 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1871 1347 gene locus_tag LOCUS_23930 1871 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2859 2695 gene locus_tag LOCUS_23940 2859 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence406 1505 618 gene locus_tag LOCUS_23950 1505 618 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942741.1 protein_id gnl|my_center|LOCUS_23950 3050 2313 gene locus_tag LOCUS_23960 3050 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence407 <1 1102 gene locus_tag LOCUS_23970 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582952.1:ATP-grasp domain-containing protein 1102 1800 gene locus_tag LOCUS_23980 1102 1800 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_23980 1805 2911 gene locus_tag LOCUS_23990 1805 2911 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937643.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence408 1086 40 gene locus_tag LOCUS_24000 1086 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2791 1418 gene locus_tag LOCUS_24010 2791 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence409 2190 1903 gene locus_tag LOCUS_24020 2190 1903 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_24020 2441 2905 gene locus_tag LOCUS_24030 2441 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24030 >Feature sequence410 <1 1208 gene locus_tag LOCUS_24040 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056511.1:UDP-glucose/GDP-mannose dehydrogenase family protein 1205 2170 gene locus_tag LOCUS_24050 1205 2170 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence411 852 142 gene locus_tag LOCUS_24060 gene rplA 852 142 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_24060 1342 914 gene locus_tag LOCUS_24070 gene rplK 1342 914 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_24070 1999 1343 gene locus_tag LOCUS_24080 gene nusG 1999 1343 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_24080 2414 2202 gene locus_tag LOCUS_24090 gene secE 2414 2202 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_24090 2578 2503 gene locus_tag LOCUS_t00260 2578 2503 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence412 614 901 gene locus_tag LOCUS_24100 614 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2274 1042 gene locus_tag LOCUS_24110 2274 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2511 2377 gene locus_tag LOCUS_24120 2511 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence413 30 1124 gene locus_tag LOCUS_24130 gene rodA 30 1124 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_24130 1310 2818 gene locus_tag LOCUS_24140 gene gltX 1310 2818 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence414 797 441 gene locus_tag LOCUS_24150 gene rplT 797 441 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355799.1 protein_id gnl|my_center|LOCUS_24150 1122 913 gene locus_tag LOCUS_24160 1122 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1771 1247 gene locus_tag LOCUS_24170 1771 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1748 1870 gene locus_tag LOCUS_24180 1748 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence415 1801 1361 gene locus_tag LOCUS_24190 gene tnpA 1801 1361 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_24190 2999 1977 gene locus_tag LOCUS_24200 2999 1977 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence416 <1 1283 gene locus_tag LOCUS_24210 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886991.1:heme lyase CcmF/NrfE family subunit 1294 1776 gene locus_tag LOCUS_24220 1294 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence417 >Feature sequence418 930 658 gene locus_tag LOCUS_24230 930 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 947 1942 gene locus_tag LOCUS_24240 947 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2001 2222 gene locus_tag LOCUS_24250 2001 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022956.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence419 1322 333 gene locus_tag LOCUS_24260 1322 333 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_24260 2536 1319 gene locus_tag LOCUS_24270 2536 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence420 1051 2838 gene locus_tag LOCUS_24280 gene metG 1051 2838 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence421 2962 1883 gene locus_tag LOCUS_24290 gene hisC 2962 1883 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence422 1500 193 gene locus_tag LOCUS_24300 gene asnS 1500 193 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_24300 <2955 2093 gene locus_tag LOCUS_24310 <2955 2093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228155.1:hemolysin family protein >Feature sequence423 2883 1867 gene locus_tag LOCUS_24320 2883 1867 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence424 <1 742 gene locus_tag LOCUS_24330 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258123.1:dipeptide ABC transporter ATP-binding protein 977 2833 gene locus_tag LOCUS_24340 977 2833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence425 1104 148 gene locus_tag LOCUS_24350 gene pfkB 1104 148 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_24350 1514 1377 gene locus_tag LOCUS_24360 1514 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2399 1554 gene locus_tag LOCUS_24370 2399 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence426 3 578 gene locus_tag LOCUS_24380 3 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 583 1503 gene locus_tag LOCUS_24390 583 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1493 2425 gene locus_tag LOCUS_24400 1493 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence427 <1 908 gene locus_tag LOCUS_24410 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257578.1:glycosyltransferase family 1 protein >Feature sequence428 2802 1504 gene locus_tag LOCUS_24420 2802 1504 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257211.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence429 659 339 gene locus_tag LOCUS_24430 659 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 <2911 954 gene locus_tag LOCUS_24440 <2911 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272544.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence430 <1 561 gene locus_tag LOCUS_24450 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257166.1:signal peptidase I 592 2451 gene locus_tag LOCUS_24460 592 2451 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence431 247 175 gene locus_tag LOCUS_t00270 247 175 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 377 294 gene locus_tag LOCUS_t00280 377 294 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 483 411 gene locus_tag LOCUS_t00290 483 411 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 831 2618 gene locus_tag LOCUS_24470 831 2618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence432 >Feature sequence433 >Feature sequence434 2770 1505 gene locus_tag LOCUS_24480 2770 1505 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence435 1921 578 gene locus_tag LOCUS_24490 gene ssnA 1921 578 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_24490 2544 2353 gene locus_tag LOCUS_24500 gene rpmF 2544 2353 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631660.1 protein_id gnl|my_center|LOCUS_24500 2878 2552 gene locus_tag LOCUS_24510 2878 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence436 <1 558 gene locus_tag LOCUS_24520 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052292.1:FHA domain-containing protein 571 1371 gene locus_tag LOCUS_24530 571 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence437 1186 599 gene locus_tag LOCUS_24540 1186 599 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_24540 1784 1206 gene locus_tag LOCUS_24550 1784 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2839 1784 gene locus_tag LOCUS_24560 2839 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence438 <2838 1539 gene locus_tag LOCUS_24570 <2838 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258140.1:TIGR03986 family CRISPR-associated RAMP protein >Feature sequence439 7 1953 gene locus_tag LOCUS_24580 7 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence440 1909 179 gene locus_tag LOCUS_24590 gene cydD 1909 179 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_24590 <2809 2184 gene locus_tag LOCUS_24600 <2809 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933479.1:cytochrome d ubiquinol oxidase subunit II >Feature sequence441 332 610 gene locus_tag LOCUS_24610 332 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 681 1100 gene locus_tag LOCUS_24620 681 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1543 2043 gene locus_tag LOCUS_24630 1543 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2354 2563 gene locus_tag LOCUS_24640 2354 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence442 1784 1074 gene locus_tag LOCUS_24650 1784 1074 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_24650 2263 1781 gene locus_tag LOCUS_24660 2263 1781 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_24660 <2777 2260 gene locus_tag LOCUS_24670 <2777 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403364.1:dTDP-glucose 4,6-dehydratase >Feature sequence443 1651 362 gene locus_tag LOCUS_24680 1651 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 <2767 1765 gene locus_tag LOCUS_24690 <2767 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022106.1:restriction endonuclease subunit S >Feature sequence444 2080 467 gene locus_tag LOCUS_24700 2080 467 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence445 <2744 1764 gene locus_tag LOCUS_24710 <2744 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814645.1:MraY family glycosyltransferase >Feature sequence446 712 191 gene locus_tag LOCUS_24720 712 191 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259071.1 protein_id gnl|my_center|LOCUS_24720 1392 712 gene locus_tag LOCUS_24730 1392 712 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811062.1 protein_id gnl|my_center|LOCUS_24730 <2744 1402 gene locus_tag LOCUS_24740 <2744 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA >Feature sequence447 1033 503 gene locus_tag LOCUS_24750 1033 503 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_24750 1110 1370 gene locus_tag LOCUS_24760 1110 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2068 1577 gene locus_tag LOCUS_24770 2068 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence448 152 1054 gene locus_tag LOCUS_24780 152 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1594 2385 gene locus_tag LOCUS_24790 1594 2385 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence449 985 305 gene locus_tag LOCUS_24800 985 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2093 1593 gene locus_tag LOCUS_24810 2093 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence450 1703 1263 gene locus_tag LOCUS_24820 1703 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1875 1726 gene locus_tag LOCUS_24830 1875 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2361 2233 gene locus_tag LOCUS_24840 2361 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence451 1271 51 gene locus_tag LOCUS_24850 gene ftsW 1271 51 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_24850 <2698 1390 gene locus_tag LOCUS_24860 <2698 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392360.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence452 160 897 gene locus_tag LOCUS_24870 160 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24870 1368 2099 gene locus_tag LOCUS_24880 1368 2099 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933920.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence453 <1 658 gene locus_tag LOCUS_24890 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259189.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 698 1600 gene locus_tag LOCUS_24900 698 1600 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_24900 <2686 1725 gene locus_tag LOCUS_24910 <2686 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257970.1:molybdopterin molybdotransferase MoeA >Feature sequence454 45 911 gene locus_tag LOCUS_24920 45 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 929 1693 gene locus_tag LOCUS_24930 929 1693 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_24930 2291 1854 gene locus_tag LOCUS_24940 2291 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence455 <1 1224 gene locus_tag LOCUS_24950 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1235 2620 gene locus_tag LOCUS_24960 1235 2620 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence456 65 1342 gene locus_tag LOCUS_24970 65 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1385 1834 gene locus_tag LOCUS_24980 1385 1834 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_24980 1836 2201 gene locus_tag LOCUS_24990 1836 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_24990 2198 2353 gene locus_tag LOCUS_25000 2198 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence457 423 674 gene locus_tag LOCUS_25010 423 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 698 1081 gene locus_tag LOCUS_25020 698 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2505 1270 gene locus_tag LOCUS_25030 2505 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence458 >Feature sequence459 >Feature sequence460 486 647 gene locus_tag LOCUS_25040 486 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 928 1191 gene locus_tag LOCUS_25050 928 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1191 1460 gene locus_tag LOCUS_25060 1191 1460 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence461 682 119 gene locus_tag LOCUS_25070 682 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25070 1238 672 gene locus_tag LOCUS_25080 1238 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 1773 1609 gene locus_tag LOCUS_25090 1773 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2372 1770 gene locus_tag LOCUS_25100 2372 1770 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence462 300 1106 gene locus_tag LOCUS_25110 300 1106 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_25110 1099 1581 gene locus_tag LOCUS_25120 1099 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence463 3 404 gene locus_tag LOCUS_25130 3 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1224 742 gene locus_tag LOCUS_25140 1224 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence464 2353 359 gene locus_tag LOCUS_25150 2353 359 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence465 201 1148 gene locus_tag LOCUS_25160 201 1148 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_25160 1400 1936 gene locus_tag LOCUS_25170 1400 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence466 1511 531 gene locus_tag LOCUS_25180 1511 531 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_25180 2515 1526 gene locus_tag LOCUS_25190 2515 1526 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence467 1149 211 gene locus_tag LOCUS_25200 1149 211 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123503.1 protein_id gnl|my_center|LOCUS_25200 2445 1333 gene locus_tag LOCUS_25210 2445 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence468 496 269 gene locus_tag LOCUS_25220 496 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1023 1667 gene locus_tag LOCUS_25230 1023 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2017 1790 gene locus_tag LOCUS_25240 2017 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2276 2004 gene locus_tag LOCUS_25250 2276 2004 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence469 <1 684 gene locus_tag LOCUS_25260 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543942.1:error-prone DNA polymerase 819 1460 gene locus_tag LOCUS_25270 819 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1457 2263 gene locus_tag LOCUS_25280 1457 2263 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence470 1215 1964 gene locus_tag LOCUS_25290 1215 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence471 <1 1591 gene locus_tag LOCUS_25300 <1 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389334.1:glycoside hydrolase family 20 zincin-like fold domain-containing protein <2548 1842 gene locus_tag LOCUS_25310 <2548 1842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393148.1:YgeY family selenium metabolism-linked hydrolase >Feature sequence472 1072 353 gene locus_tag LOCUS_25320 1072 353 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence473 1047 2060 gene locus_tag LOCUS_25330 1047 2060 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence474 1042 242 gene locus_tag LOCUS_25340 1042 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25340 <2513 1039 gene locus_tag LOCUS_25350 <2513 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043629981.1:PAS domain S-box protein >Feature sequence475 2363 372 gene locus_tag LOCUS_25360 2363 372 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence476 806 318 gene locus_tag LOCUS_25370 806 318 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986848.1 protein_id gnl|my_center|LOCUS_25370 1814 1491 gene locus_tag LOCUS_25380 1814 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence477 1008 1991 gene locus_tag LOCUS_25390 1008 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence478 1582 794 gene locus_tag LOCUS_25400 1582 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2498 1599 gene locus_tag LOCUS_25410 2498 1599 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence479 1 588 gene locus_tag LOCUS_25420 1 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1798 989 gene locus_tag LOCUS_25430 1798 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence480 1905 688 gene locus_tag LOCUS_25440 1905 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence481 1482 148 gene locus_tag LOCUS_25450 1482 148 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_25450 1849 1700 gene locus_tag LOCUS_25460 1849 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1898 2170 gene locus_tag LOCUS_25470 1898 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2171 2416 gene locus_tag LOCUS_25480 2171 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence482 >Feature sequence483 434 1435 gene locus_tag LOCUS_25490 gene meaB 434 1435 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_25490 1533 2180 gene locus_tag LOCUS_25500 1533 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence484 1881 481 gene locus_tag LOCUS_25510 1881 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2413 1862 gene locus_tag LOCUS_25520 gene hpt 2413 1862 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence485 32 793 gene locus_tag LOCUS_25530 32 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 787 1875 gene locus_tag LOCUS_25540 787 1875 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258420.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence486 2297 291 gene locus_tag LOCUS_25550 gene tkt 2297 291 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence487 90 17 gene locus_tag LOCUS_t00300 90 17 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 259 186 gene locus_tag LOCUS_t00310 259 186 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1057 353 gene locus_tag LOCUS_25560 1057 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 <2438 1463 gene locus_tag LOCUS_25570 <2438 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:S-layer homology domain-containing protein >Feature sequence488 1579 707 gene locus_tag LOCUS_25580 gene lysX 1579 707 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_25580 2051 1812 gene locus_tag LOCUS_25590 2051 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence489 <1 627 gene locus_tag LOCUS_25600 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937579.1:PAS domain S-box protein 624 1424 gene locus_tag LOCUS_25610 624 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25610 >Feature sequence490 1563 598 gene locus_tag LOCUS_25620 gene hemC 1563 598 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_25620 <2426 1560 gene locus_tag LOCUS_25630 <2426 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392764.1:glutamyl-tRNA reductase >Feature sequence491 434 1135 gene locus_tag LOCUS_25640 434 1135 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_25640 1271 1756 gene locus_tag LOCUS_25650 1271 1756 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_25650 1753 2178 gene locus_tag LOCUS_25660 1753 2178 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_25660 2292 2219 gene locus_tag LOCUS_t00320 2292 2219 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence492 192 797 gene locus_tag LOCUS_25670 192 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 981 1103 gene locus_tag LOCUS_25680 981 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence493 1341 418 gene locus_tag LOCUS_25690 1341 418 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_25690 2103 1432 gene locus_tag LOCUS_25700 2103 1432 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975914.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence494 212 799 gene locus_tag LOCUS_25710 212 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence495 2002 275 gene locus_tag LOCUS_25720 2002 275 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence496 175 660 gene locus_tag LOCUS_25730 175 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1526 2104 gene locus_tag LOCUS_25740 1526 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence497 >Feature sequence498 101 847 gene locus_tag LOCUS_25750 101 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 <2327 1367 gene locus_tag LOCUS_25760 <2327 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000597478.1:ABC transporter substrate-binding protein >Feature sequence499 252 1058 gene locus_tag LOCUS_25770 252 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1258 1518 gene locus_tag LOCUS_25780 1258 1518 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_25780 1531 1815 gene locus_tag LOCUS_25790 1531 1815 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence500 <1 1627 gene locus_tag LOCUS_25800 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942518.1:M3 family oligoendopeptidase >Feature sequence501 472 254 gene locus_tag LOCUS_25810 472 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1319 741 gene locus_tag LOCUS_25820 1319 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1556 1640 gene locus_tag LOCUS_t00330 1556 1640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1698 2072 gene locus_tag LOCUS_25830 1698 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2150 2222 gene locus_tag LOCUS_t00340 2150 2222 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2231 2303 gene locus_tag LOCUS_t00350 2231 2303 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence502 1321 533 gene locus_tag LOCUS_25840 1321 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 <2299 1353 gene locus_tag LOCUS_25850 <2299 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyltransferase family 4 protein >Feature sequence503 881 2176 gene locus_tag LOCUS_25860 gene eno 881 2176 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence504 <1 1325 gene locus_tag LOCUS_25870 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023591458.1:DNA translocase FtsK 1406 2182 gene locus_tag LOCUS_25880 1406 2182 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868408.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence505 1113 178 gene locus_tag LOCUS_25890 1113 178 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_25890 1712 1110 gene locus_tag LOCUS_25900 1712 1110 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_25900 2198 2124 gene locus_tag LOCUS_t00360 2198 2124 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence506 1379 45 gene locus_tag LOCUS_25910 1379 45 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_25910 1748 2155 gene locus_tag LOCUS_25920 gene ndhC 1748 2155 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence507 <1 2053 gene locus_tag LOCUS_25930 <1 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057320.1:DEAD/DEAH box helicase family protein >Feature sequence508 497 1900 gene locus_tag LOCUS_25940 497 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence509 838 2181 gene locus_tag LOCUS_25950 838 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence510 253 696 gene locus_tag LOCUS_25960 253 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 818 1369 gene locus_tag LOCUS_25970 818 1369 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257215.1 protein_id gnl|my_center|LOCUS_25970 1381 1932 gene locus_tag LOCUS_25980 1381 1932 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257214.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence511 <1 519 gene locus_tag LOCUS_25990 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870579.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 516 1379 gene locus_tag LOCUS_26000 516 1379 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073144.1 protein_id gnl|my_center|LOCUS_26000 1376 2185 gene locus_tag LOCUS_26010 1376 2185 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence512 585 163 gene locus_tag LOCUS_26020 585 163 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence513 418 1782 gene locus_tag LOCUS_26030 418 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence514 386 625 gene locus_tag LOCUS_26040 386 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 893 705 gene locus_tag LOCUS_26050 893 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1125 958 gene locus_tag LOCUS_26060 1125 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence515 <1 1133 gene locus_tag LOCUS_26070 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250668.1:glycosyltransferase 1140 1724 gene locus_tag LOCUS_26080 1140 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1768 1971 gene locus_tag LOCUS_26090 1768 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence516 3 353 gene locus_tag LOCUS_26100 3 353 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876989.1 protein_id gnl|my_center|LOCUS_26100 1727 681 gene locus_tag LOCUS_26110 1727 681 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_26110 2188 1730 gene locus_tag LOCUS_26120 2188 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence517 1815 424 gene locus_tag LOCUS_26130 1815 424 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence518 570 70 gene locus_tag LOCUS_26140 570 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2160 664 gene locus_tag LOCUS_26150 2160 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence519 1 120 gene locus_tag LOCUS_26160 1 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 120 509 gene locus_tag LOCUS_26170 120 509 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_26170 514 2037 gene locus_tag LOCUS_26180 gene secY 514 2037 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence520 279 1598 gene locus_tag LOCUS_26190 279 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence521 1723 188 gene locus_tag LOCUS_26200 gene cobA 1723 188 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence522 1746 679 gene locus_tag LOCUS_26210 1746 679 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_26210 2083 1754 gene locus_tag LOCUS_26220 2083 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence523 <1 876 gene locus_tag LOCUS_26230 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879265.1:ABC transporter permease 938 1957 gene locus_tag LOCUS_26240 938 1957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence524 >Feature sequence525 <1 859 gene locus_tag LOCUS_26250 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879591.1:thiamine pyrophosphate-binding protein 962 1804 gene locus_tag LOCUS_26260 962 1804 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086454.1 protein_id gnl|my_center|LOCUS_26260 1832 1960 gene locus_tag LOCUS_26270 1832 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence526 <2057 641 gene locus_tag LOCUS_26280 <2057 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813282.1:type I DNA topoisomerase >Feature sequence527 71 1234 gene locus_tag LOCUS_26290 71 1234 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257412.1 protein_id gnl|my_center|LOCUS_26290 2007 1570 gene locus_tag LOCUS_26300 2007 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence528 1299 7 gene locus_tag LOCUS_26310 1299 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence529 311 985 gene locus_tag LOCUS_26320 gene pdxT 311 985 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_26320 982 2022 gene locus_tag LOCUS_26330 982 2022 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence530 <1 1026 gene locus_tag LOCUS_26340 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256654.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence531 185 409 gene locus_tag LOCUS_26350 185 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 419 646 gene locus_tag LOCUS_26360 419 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 643 1143 gene locus_tag LOCUS_26370 643 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1773 1315 gene locus_tag LOCUS_26380 1773 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence532 1486 191 gene locus_tag LOCUS_26390 1486 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1605 1727 gene locus_tag LOCUS_26400 1605 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400