>Feature sequence001 586 1056 gene locus_tag LOCUS_00010 gene ureE 586 1056 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_00010 1068 1316 gene locus_tag LOCUS_00020 1068 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1309 2013 gene locus_tag LOCUS_00030 1309 2013 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_00030 2034 2651 gene locus_tag LOCUS_00040 gene ureG 2034 2651 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098772.1 protein_id gnl|my_center|LOCUS_00040 5749 3026 gene locus_tag LOCUS_00050 5749 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6325 7860 gene locus_tag LOCUS_00060 6325 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7853 8554 gene locus_tag LOCUS_00070 7853 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8575 10197 gene locus_tag LOCUS_00080 8575 10197 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_00080 10238 10942 gene locus_tag LOCUS_00090 10238 10942 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_00090 11168 13543 gene locus_tag LOCUS_00100 11168 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13633 14799 gene locus_tag LOCUS_00110 13633 14799 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_00110 15598 14774 gene locus_tag LOCUS_00120 15598 14774 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_00120 16238 15888 gene locus_tag LOCUS_00130 16238 15888 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_00130 17282 16284 gene locus_tag LOCUS_00140 17282 16284 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_00140 17926 17279 gene locus_tag LOCUS_00150 gene tmk 17926 17279 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_00150 19041 17983 gene locus_tag LOCUS_00160 gene mltG 19041 17983 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_00160 19876 19034 gene locus_tag LOCUS_00170 gene pabC 19876 19034 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_00170 21343 19991 gene locus_tag LOCUS_00180 21343 19991 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_00180 21669 23864 gene locus_tag LOCUS_00190 21669 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25340 24099 gene locus_tag LOCUS_00200 gene fabF 25340 24099 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_00200 25760 25524 gene locus_tag LOCUS_00210 gene acpP 25760 25524 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_00210 26727 25969 gene locus_tag LOCUS_00220 gene fabG 26727 25969 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 protein_id gnl|my_center|LOCUS_00220 27677 26727 gene locus_tag LOCUS_00230 gene fabD 27677 26727 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_00230 28754 27762 gene locus_tag LOCUS_00240 28754 27762 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_00240 29794 28751 gene locus_tag LOCUS_00250 gene plsX 29794 28751 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_00250 30105 29923 gene locus_tag LOCUS_00260 gene rpmF 30105 29923 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_00260 30688 30134 gene locus_tag LOCUS_00270 gene yceD 30688 30134 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_00270 31442 30816 gene locus_tag LOCUS_00280 31442 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31806 33737 gene locus_tag LOCUS_00290 31806 33737 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073381.1 protein_id gnl|my_center|LOCUS_00290 34034 34567 gene locus_tag LOCUS_00300 34034 34567 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_00300 34558 35517 gene locus_tag LOCUS_00310 34558 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36555 35494 gene locus_tag LOCUS_00320 36555 35494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_00320 37890 36769 gene locus_tag LOCUS_00330 37890 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39653 37887 gene locus_tag LOCUS_00340 39653 37887 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061627.1 protein_id gnl|my_center|LOCUS_00340 40720 39689 gene locus_tag LOCUS_00350 40720 39689 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_00350 41106 41774 gene locus_tag LOCUS_00360 41106 41774 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_00360 42533 42063 gene locus_tag LOCUS_00370 42533 42063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888810.1 protein_id gnl|my_center|LOCUS_00370 43716 44726 gene locus_tag LOCUS_00380 43716 44726 CDS product IS110-like element IS621 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399648.1 protein_id gnl|my_center|LOCUS_00380 45298 45146 gene locus_tag LOCUS_00390 45298 45146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46534 45314 gene locus_tag LOCUS_00400 46534 45314 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_00400 46915 46676 gene locus_tag LOCUS_00410 46915 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 protein_id gnl|my_center|LOCUS_00410 47659 47045 gene locus_tag LOCUS_00420 47659 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48063 47662 gene locus_tag LOCUS_00430 48063 47662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48447 50084 gene locus_tag LOCUS_00440 48447 50084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50148 51362 gene locus_tag LOCUS_00450 50148 51362 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence002 339 905 gene locus_tag LOCUS_00460 gene yeiP 339 905 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_00460 998 2293 gene locus_tag LOCUS_00470 998 2293 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_00470 2392 4644 gene locus_tag LOCUS_00480 2392 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5312 4695 gene locus_tag LOCUS_00490 5312 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5683 5342 gene locus_tag LOCUS_00500 5683 5342 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_00500 6748 5711 gene locus_tag LOCUS_00510 6748 5711 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_00510 8414 6783 gene locus_tag LOCUS_00520 8414 6783 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_00520 9007 10806 gene locus_tag LOCUS_00530 9007 10806 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_00530 12005 10836 gene locus_tag LOCUS_00540 12005 10836 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_00540 13015 12005 gene locus_tag LOCUS_00550 13015 12005 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_00550 15518 13005 gene locus_tag LOCUS_00560 15518 13005 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_00560 15694 15515 gene locus_tag LOCUS_00570 15694 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 15812 16495 gene locus_tag LOCUS_00580 15812 16495 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 protein_id gnl|my_center|LOCUS_00580 16616 17308 gene locus_tag LOCUS_00590 16616 17308 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073122.1 protein_id gnl|my_center|LOCUS_00590 17386 17772 gene locus_tag LOCUS_00600 17386 17772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 17842 19317 gene locus_tag LOCUS_00610 gene fliD 17842 19317 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146832.1 protein_id gnl|my_center|LOCUS_00610 19409 19795 gene locus_tag LOCUS_00620 gene fliS 19409 19795 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_00620 19822 20145 gene locus_tag LOCUS_00630 19822 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 20215 20805 gene locus_tag LOCUS_00640 20215 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 21013 22446 gene locus_tag LOCUS_00650 gene fleQ 21013 22446 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382141.1 protein_id gnl|my_center|LOCUS_00650 22570 23754 gene locus_tag LOCUS_00660 gene fleS 22570 23754 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_00660 23751 25112 gene locus_tag LOCUS_00670 23751 25112 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_00670 25154 25474 gene locus_tag LOCUS_00680 gene fliE 25154 25474 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073113.1 protein_id gnl|my_center|LOCUS_00680 25524 27161 gene locus_tag LOCUS_00690 gene fliF 25524 27161 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244370.1 protein_id gnl|my_center|LOCUS_00690 27154 28161 gene locus_tag LOCUS_00700 gene fliG 27154 28161 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_00700 28161 28832 gene locus_tag LOCUS_00710 28161 28832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 28829 30310 gene locus_tag LOCUS_00720 gene fliI 28829 30310 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_00720 31752 33125 gene locus_tag LOCUS_00730 31752 33125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 33551 33264 gene locus_tag LOCUS_00740 33551 33264 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_00740 34138 33713 gene locus_tag LOCUS_00750 34138 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 36854 34185 gene locus_tag LOCUS_00760 36854 34185 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_00760 38239 37256 gene locus_tag LOCUS_00770 gene moaA 38239 37256 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 protein_id gnl|my_center|LOCUS_00770 39713 38241 gene locus_tag LOCUS_00780 39713 38241 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_00780 42304 39710 gene locus_tag LOCUS_00790 42304 39710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 42627 42301 gene locus_tag LOCUS_00800 42627 42301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 44058 42643 gene locus_tag LOCUS_00810 gene hemG 44058 42643 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256541.1 protein_id gnl|my_center|LOCUS_00810 <46241 44284 gene locus_tag LOCUS_00820 <46241 44284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392759.1:putative heme d1 biosynthesis radical SAM protein NirJ2 >Feature sequence003 2 844 gene locus_tag LOCUS_00830 2 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 1077 1835 gene locus_tag LOCUS_00840 1077 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1842 2639 gene locus_tag LOCUS_00850 1842 2639 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_00850 3226 2624 gene locus_tag LOCUS_00860 3226 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3308 4141 gene locus_tag LOCUS_00870 3308 4141 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_00870 4198 4707 gene locus_tag LOCUS_00880 4198 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4709 5083 gene locus_tag LOCUS_00890 4709 5083 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_00890 5263 7491 gene locus_tag LOCUS_00900 5263 7491 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_00900 8878 7508 gene locus_tag LOCUS_00910 8878 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9506 9093 gene locus_tag LOCUS_00920 9506 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10114 9710 gene locus_tag LOCUS_00930 10114 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 11508 10147 gene locus_tag LOCUS_00940 11508 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12053 11505 gene locus_tag LOCUS_00950 12053 11505 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_00950 13255 12092 gene locus_tag LOCUS_00960 13255 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 13856 14200 gene locus_tag LOCUS_00970 gene sugE 13856 14200 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_00970 15438 14575 gene locus_tag LOCUS_00980 gene zapE 15438 14575 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 protein_id gnl|my_center|LOCUS_00980 15790 16170 gene locus_tag LOCUS_00990 15790 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 16654 16289 gene locus_tag LOCUS_01000 16654 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_01000 19811 16707 gene locus_tag LOCUS_01010 19811 16707 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_01010 21386 19956 gene locus_tag LOCUS_01020 21386 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 22608 21376 gene locus_tag LOCUS_01030 22608 21376 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_01030 24283 23147 gene locus_tag LOCUS_01040 24283 23147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 24721 24398 gene locus_tag LOCUS_01050 24721 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 25946 25749 gene locus_tag LOCUS_01060 25946 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 25956 28139 gene locus_tag LOCUS_01070 gene rlmKL 25956 28139 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_01070 28093 28263 gene locus_tag LOCUS_01080 28093 28263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 28320 28925 gene locus_tag LOCUS_01090 28320 28925 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_01090 29113 30276 gene locus_tag LOCUS_01100 29113 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 30575 31705 gene locus_tag LOCUS_01110 30575 31705 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_01110 31953 31687 gene locus_tag LOCUS_01120 31953 31687 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 protein_id gnl|my_center|LOCUS_01120 32111 32581 gene locus_tag LOCUS_01130 32111 32581 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 protein_id gnl|my_center|LOCUS_01130 33719 32634 gene locus_tag LOCUS_01140 gene aroG 33719 32634 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_01140 33890 34717 gene locus_tag LOCUS_01150 33890 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 35276 34851 gene locus_tag LOCUS_01160 35276 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 35654 37507 gene locus_tag LOCUS_01170 35654 37507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 37932 37543 gene locus_tag LOCUS_01180 37932 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 38949 38128 gene locus_tag LOCUS_01190 38949 38128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 39347 40246 gene locus_tag LOCUS_01200 39347 40246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_01200 40243 41307 gene locus_tag LOCUS_01210 40243 41307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_01210 41667 44300 gene locus_tag LOCUS_01220 41667 44300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence004 253 618 gene locus_tag LOCUS_01230 253 618 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_01230 905 1366 gene locus_tag LOCUS_01240 905 1366 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_01240 2058 1417 gene locus_tag LOCUS_01250 2058 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2237 3556 gene locus_tag LOCUS_01260 2237 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4495 5691 gene locus_tag LOCUS_01270 4495 5691 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_01270 5820 7193 gene locus_tag LOCUS_01280 gene miaB 5820 7193 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_01280 7230 8234 gene locus_tag LOCUS_01290 7230 8234 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_01290 8235 8726 gene locus_tag LOCUS_01300 gene ybeY 8235 8726 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418185.1 protein_id gnl|my_center|LOCUS_01300 8775 9722 gene locus_tag LOCUS_01310 8775 9722 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_01310 9700 11220 gene locus_tag LOCUS_01320 gene lnt 9700 11220 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_01320 11317 12744 gene locus_tag LOCUS_01330 11317 12744 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_01330 13549 12995 gene locus_tag LOCUS_01340 13549 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 14040 14915 gene locus_tag LOCUS_01350 14040 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 15053 16477 gene locus_tag LOCUS_01360 15053 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_01360 16535 16939 gene locus_tag LOCUS_01370 16535 16939 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633660.1 protein_id gnl|my_center|LOCUS_01370 16942 17583 gene locus_tag LOCUS_01380 gene lpoB 16942 17583 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 protein_id gnl|my_center|LOCUS_01380 18286 17672 gene locus_tag LOCUS_01390 18286 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 20784 18403 gene locus_tag LOCUS_01400 20784 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 21401 23878 gene locus_tag LOCUS_01410 gene leuS 21401 23878 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 protein_id gnl|my_center|LOCUS_01410 26287 24215 gene locus_tag LOCUS_01420 26287 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 26548 26348 gene locus_tag LOCUS_01430 26548 26348 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_01430 27504 26584 gene locus_tag LOCUS_01440 27504 26584 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_01440 30555 27592 gene locus_tag LOCUS_01450 gene glnE 30555 27592 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_01450 30836 31999 gene locus_tag LOCUS_01460 gene tapW 30836 31999 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_01460 34579 32084 gene locus_tag LOCUS_01470 34579 32084 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_01470 34884 35954 gene locus_tag LOCUS_01480 34884 35954 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_01480 35955 36515 gene locus_tag LOCUS_01490 35955 36515 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 protein_id gnl|my_center|LOCUS_01490 36512 37153 gene locus_tag LOCUS_01500 gene pilO 36512 37153 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_01500 37153 37689 gene locus_tag LOCUS_01510 gene pilP 37153 37689 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_01510 37770 40346 gene locus_tag LOCUS_01520 37770 40346 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_01520 40689 40420 gene locus_tag LOCUS_01530 40689 40420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 41294 40686 gene locus_tag LOCUS_01540 41294 40686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 42224 41478 gene locus_tag LOCUS_01550 42224 41478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 43528 42824 gene locus_tag LOCUS_01560 43528 42824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence005 1631 180 gene locus_tag LOCUS_01570 1631 180 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_01570 3122 1749 gene locus_tag LOCUS_01580 gene trkA 3122 1749 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01580 4496 3138 gene locus_tag LOCUS_01590 4496 3138 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719965.1 protein_id gnl|my_center|LOCUS_01590 6752 4527 gene locus_tag LOCUS_01600 6752 4527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_01600 7319 6783 gene locus_tag LOCUS_01610 7319 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 8650 7346 gene locus_tag LOCUS_01620 gene rsmB 8650 7346 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 protein_id gnl|my_center|LOCUS_01620 9712 8774 gene locus_tag LOCUS_01630 gene fmt 9712 8774 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004459.1 protein_id gnl|my_center|LOCUS_01630 10253 9750 gene locus_tag LOCUS_01640 gene def 10253 9750 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_01640 10492 11622 gene locus_tag LOCUS_01650 10492 11622 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01650 11673 12857 gene locus_tag LOCUS_01660 gene dprA 11673 12857 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_01660 12941 13420 gene locus_tag LOCUS_01670 12941 13420 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_01670 14552 13674 gene locus_tag LOCUS_01680 14552 13674 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_01680 15370 14555 gene locus_tag LOCUS_01690 gene ttcA 15370 14555 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_01690 15553 15816 gene locus_tag LOCUS_01700 15553 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 15862 16290 gene locus_tag LOCUS_01710 15862 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 16369 20037 gene locus_tag LOCUS_01720 gene metH 16369 20037 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261140.1 protein_id gnl|my_center|LOCUS_01720 20462 20797 gene locus_tag LOCUS_01730 20462 20797 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533389.1 protein_id gnl|my_center|LOCUS_01730 20787 22091 gene locus_tag LOCUS_01740 20787 22091 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_01740 22408 24855 gene locus_tag LOCUS_01750 22408 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 24918 25295 gene locus_tag LOCUS_01760 24918 25295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_01760 25320 28481 gene locus_tag LOCUS_01770 25320 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 28640 29017 gene locus_tag LOCUS_01780 28640 29017 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_01780 29014 30258 gene locus_tag LOCUS_01790 29014 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 31682 30567 gene locus_tag LOCUS_01800 31682 30567 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_01800 33149 31701 gene locus_tag LOCUS_01810 33149 31701 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_01810 33626 35758 gene locus_tag LOCUS_01820 33626 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 37012 36017 gene locus_tag LOCUS_01830 37012 36017 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444131.1 protein_id gnl|my_center|LOCUS_01830 37934 37311 gene locus_tag LOCUS_01840 37934 37311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 38355 38513 gene locus_tag LOCUS_01850 38355 38513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 40278 40189 gene locus_tag LOCUS_t00010 40278 40189 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 1 390 gene locus_tag LOCUS_01860 1 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 959 606 gene locus_tag LOCUS_01870 959 606 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_01870 1663 983 gene locus_tag LOCUS_01880 gene hflD 1663 983 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 protein_id gnl|my_center|LOCUS_01880 2877 1699 gene locus_tag LOCUS_01890 gene mnmA 2877 1699 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 protein_id gnl|my_center|LOCUS_01890 3416 2859 gene locus_tag LOCUS_01900 3416 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3464 6463 gene locus_tag LOCUS_01910 3464 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6786 7232 gene locus_tag LOCUS_01920 6786 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7359 8807 gene locus_tag LOCUS_01930 7359 8807 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037087.1 protein_id gnl|my_center|LOCUS_01930 9126 9428 gene locus_tag LOCUS_01940 gene hsbA 9126 9428 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_01940 10494 9445 gene locus_tag LOCUS_01950 gene ccpA 10494 9445 CDS product cytochrome-c peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094815.1 protein_id gnl|my_center|LOCUS_01950 10782 11354 gene locus_tag LOCUS_01960 gene fliL 10782 11354 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_01960 11437 12453 gene locus_tag LOCUS_01970 gene fliM 11437 12453 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_01970 12446 12943 gene locus_tag LOCUS_01980 gene fliN 12446 12943 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073104.1 protein_id gnl|my_center|LOCUS_01980 12951 13472 gene locus_tag LOCUS_01990 12951 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 13472 14269 gene locus_tag LOCUS_02000 gene fliP 13472 14269 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_02000 14328 14585 gene locus_tag LOCUS_02010 gene fliQ 14328 14585 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_02010 14601 15380 gene locus_tag LOCUS_02020 gene fliR 14601 15380 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_02020 15394 16536 gene locus_tag LOCUS_02030 gene flhB 15394 16536 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_02030 16533 18614 gene locus_tag LOCUS_02040 gene flhA 16533 18614 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_02040 18668 20104 gene locus_tag LOCUS_02050 gene flhF 18668 20104 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_02050 20091 20975 gene locus_tag LOCUS_02060 gene fleN 20091 20975 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_02060 20972 21727 gene locus_tag LOCUS_02070 gene fliA 20972 21727 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_02070 21780 22172 gene locus_tag LOCUS_02080 gene cheY 21780 22172 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_02080 22175 22939 gene locus_tag LOCUS_02090 22175 22939 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 protein_id gnl|my_center|LOCUS_02090 22970 25030 gene locus_tag LOCUS_02100 22970 25030 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103790.1 protein_id gnl|my_center|LOCUS_02100 25107 26210 gene locus_tag LOCUS_02110 25107 26210 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_02110 26212 26952 gene locus_tag LOCUS_02120 26212 26952 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_02120 27145 28053 gene locus_tag LOCUS_02130 gene motD 27145 28053 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_02130 28111 28881 gene locus_tag LOCUS_02140 28111 28881 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_02140 28886 29590 gene locus_tag LOCUS_02150 28886 29590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 29717 30202 gene locus_tag LOCUS_02160 29717 30202 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073088.1 protein_id gnl|my_center|LOCUS_02160 30260 30652 gene locus_tag LOCUS_02170 30260 30652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 31115 30816 gene locus_tag LOCUS_02180 31115 30816 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_02180 32605 31112 gene locus_tag LOCUS_02190 32605 31112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 32755 33720 gene locus_tag LOCUS_02200 32755 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 33973 33728 gene locus_tag LOCUS_02210 33973 33728 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_02210 34365 34027 gene locus_tag LOCUS_02220 34365 34027 CDS product DUF3622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071103.1 protein_id gnl|my_center|LOCUS_02220 34538 35224 gene locus_tag LOCUS_02230 34538 35224 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_02230 35557 36732 gene locus_tag LOCUS_02240 35557 36732 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_02240 37098 37958 gene locus_tag LOCUS_02250 37098 37958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence007 1123 473 gene locus_tag LOCUS_02260 1123 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1590 1120 gene locus_tag LOCUS_02270 1590 1120 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_02270 2794 1907 gene locus_tag LOCUS_02280 gene prmA 2794 1907 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_02280 3716 6607 gene locus_tag LOCUS_02290 3716 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6882 7706 gene locus_tag LOCUS_02300 6882 7706 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039970.1 protein_id gnl|my_center|LOCUS_02300 7712 8629 gene locus_tag LOCUS_02310 7712 8629 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_02310 8693 10525 gene locus_tag LOCUS_02320 8693 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 10540 10965 gene locus_tag LOCUS_02330 10540 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 11078 12730 gene locus_tag LOCUS_02340 11078 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 19101 12901 gene locus_tag LOCUS_02350 19101 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 20546 19098 gene locus_tag LOCUS_02360 20546 19098 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 protein_id gnl|my_center|LOCUS_02360 22581 21574 gene locus_tag LOCUS_02370 22581 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 23143 22769 gene locus_tag LOCUS_02380 gene tusE 23143 22769 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301417.1 protein_id gnl|my_center|LOCUS_02380 23959 23219 gene locus_tag LOCUS_02390 23959 23219 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_02390 25196 23982 gene locus_tag LOCUS_02400 gene purT 25196 23982 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186479.1 protein_id gnl|my_center|LOCUS_02400 26329 25226 gene locus_tag LOCUS_02410 26329 25226 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_02410 26882 26385 gene locus_tag LOCUS_02420 26882 26385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 28256 27063 gene locus_tag LOCUS_02430 28256 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 29098 30069 gene locus_tag LOCUS_02440 29098 30069 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_02440 30257 32077 gene locus_tag LOCUS_02450 gene typA 30257 32077 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_02450 33243 32083 gene locus_tag LOCUS_02460 33243 32083 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_02460 34460 33249 gene locus_tag LOCUS_02470 34460 33249 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209177.1 protein_id gnl|my_center|LOCUS_02470 <35370 34669 gene locus_tag LOCUS_02480 <35370 34669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958545.1:AMP-binding protein >Feature sequence008 39 1374 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccttcacgggcgcgtggattgaaac 1845 1588 gene locus_tag LOCUS_02490 1845 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1975 1733 gene locus_tag LOCUS_02500 1975 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2713 2036 gene locus_tag LOCUS_02510 2713 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3611 2808 gene locus_tag LOCUS_02520 3611 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4668 3571 gene locus_tag LOCUS_02530 4668 3571 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_02530 5780 4686 gene locus_tag LOCUS_02540 5780 4686 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_02540 8300 5781 gene locus_tag LOCUS_02550 8300 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 9264 8650 gene locus_tag LOCUS_02560 9264 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_02560 10293 9274 gene locus_tag LOCUS_02570 10293 9274 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_02570 10651 10343 gene locus_tag LOCUS_02580 10651 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 11706 10684 gene locus_tag LOCUS_02590 11706 10684 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_02590 12038 11859 gene locus_tag LOCUS_02600 12038 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12339 12067 gene locus_tag LOCUS_02610 12339 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 12827 12369 gene locus_tag LOCUS_02620 12827 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 13171 12875 gene locus_tag LOCUS_02630 13171 12875 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_02630 13527 13225 gene locus_tag LOCUS_02640 13527 13225 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_02640 13848 13579 gene locus_tag LOCUS_02650 13848 13579 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_02650 14099 13854 gene locus_tag LOCUS_02660 14099 13854 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_02660 15553 14099 gene locus_tag LOCUS_02670 15553 14099 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_02670 17608 15716 gene locus_tag LOCUS_02680 17608 15716 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 protein_id gnl|my_center|LOCUS_02680 18035 17697 gene locus_tag LOCUS_02690 18035 17697 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_02690 19482 18070 gene locus_tag LOCUS_02700 19482 18070 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_02700 20644 20051 gene locus_tag LOCUS_02710 20644 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20916 21344 gene locus_tag LOCUS_02720 20916 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 21565 21368 gene locus_tag LOCUS_02730 21565 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 22011 22934 gene locus_tag LOCUS_02740 gene hemF 22011 22934 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070454.1 protein_id gnl|my_center|LOCUS_02740 22838 23521 gene locus_tag LOCUS_02750 gene rsmD 22838 23521 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 protein_id gnl|my_center|LOCUS_02750 23542 24033 gene locus_tag LOCUS_02760 gene coaD 23542 24033 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_02760 24088 24342 gene locus_tag LOCUS_02770 24088 24342 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_02770 24790 25347 gene locus_tag LOCUS_02780 24790 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 25344 25853 gene locus_tag LOCUS_02790 25344 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 26312 25875 gene locus_tag LOCUS_02800 26312 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 26581 26309 gene locus_tag LOCUS_02810 26581 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 27104 26595 gene locus_tag LOCUS_02820 27104 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 28488 27157 gene locus_tag LOCUS_02830 28488 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 31177 28526 gene locus_tag LOCUS_02840 31177 28526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 31606 31235 gene locus_tag LOCUS_02850 31606 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 32901 31840 gene locus_tag LOCUS_02860 32901 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 33405 32911 gene locus_tag LOCUS_02870 33405 32911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 33890 33402 gene locus_tag LOCUS_02880 33890 33402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 34171 33890 gene locus_tag LOCUS_02890 34171 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 34524 34183 gene locus_tag LOCUS_02900 34524 34183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 34887 34756 gene locus_tag LOCUS_02910 34887 34756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence009 544 230 gene locus_tag LOCUS_02920 544 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 800 597 gene locus_tag LOCUS_02930 800 597 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387864.1 protein_id gnl|my_center|LOCUS_02930 1122 1709 gene locus_tag LOCUS_02940 1122 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2676 1723 gene locus_tag LOCUS_02950 gene cysB 2676 1723 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406770.1 protein_id gnl|my_center|LOCUS_02950 2965 3795 gene locus_tag LOCUS_02960 2965 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4743 3889 gene locus_tag LOCUS_02970 4743 3889 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_02970 5229 4795 gene locus_tag LOCUS_02980 5229 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5464 6540 gene locus_tag LOCUS_02990 5464 6540 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_02990 6825 6556 gene locus_tag LOCUS_03000 6825 6556 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218178.1 protein_id gnl|my_center|LOCUS_03000 7250 6849 gene locus_tag LOCUS_03010 7250 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_03010 8121 7264 gene locus_tag LOCUS_03020 gene rapZ 8121 7264 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_03020 9278 8328 gene locus_tag LOCUS_03030 gene hprK 9278 8328 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_03030 9779 9315 gene locus_tag LOCUS_03040 gene ptsN 9779 9315 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_03040 10227 9883 gene locus_tag LOCUS_03050 gene hpf 10227 9883 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 protein_id gnl|my_center|LOCUS_03050 11819 10287 gene locus_tag LOCUS_03060 11819 10287 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_03060 12757 12032 gene locus_tag LOCUS_03070 gene lptB 12757 12032 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098941.1 protein_id gnl|my_center|LOCUS_03070 13278 12754 gene locus_tag LOCUS_03080 gene lptA 13278 12754 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369494.1 protein_id gnl|my_center|LOCUS_03080 13840 13268 gene locus_tag LOCUS_03090 13840 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 14580 14056 gene locus_tag LOCUS_03100 14580 14056 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_03100 15857 14883 gene locus_tag LOCUS_03110 15857 14883 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_03110 16898 15897 gene locus_tag LOCUS_03120 16898 15897 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_03120 17847 16903 gene locus_tag LOCUS_03130 gene ubiA 17847 16903 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104612.1 protein_id gnl|my_center|LOCUS_03130 18250 17867 gene locus_tag LOCUS_03140 18250 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 19825 18617 gene locus_tag LOCUS_03150 19825 18617 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_03150 20388 19951 gene locus_tag LOCUS_03160 20388 19951 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_03160 21791 20400 gene locus_tag LOCUS_03170 gene mgtE 21791 20400 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 protein_id gnl|my_center|LOCUS_03170 22291 22034 gene locus_tag LOCUS_03180 22291 22034 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073988.1 protein_id gnl|my_center|LOCUS_03180 22768 23106 gene locus_tag LOCUS_03190 gene glnK 22768 23106 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_03190 23125 24408 gene locus_tag LOCUS_03200 23125 24408 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_03200 25067 25519 gene locus_tag LOCUS_03210 25067 25519 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_03210 25734 26255 gene locus_tag LOCUS_03220 25734 26255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 30894 26278 gene locus_tag LOCUS_03230 30894 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 31673 31101 gene locus_tag LOCUS_03240 31673 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 <33468 31689 gene locus_tag LOCUS_03250 <33468 31689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947747.1:arginine--tRNA ligase >Feature sequence010 871 557 gene locus_tag LOCUS_03260 871 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1116 1391 gene locus_tag LOCUS_03270 1116 1391 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_03270 1901 1407 gene locus_tag LOCUS_03280 1901 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2213 2440 gene locus_tag LOCUS_03290 2213 2440 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480073.1 protein_id gnl|my_center|LOCUS_03290 2466 2816 gene locus_tag LOCUS_03300 2466 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3081 2872 gene locus_tag LOCUS_03310 3081 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3365 4282 gene locus_tag LOCUS_03320 3365 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4383 7325 gene locus_tag LOCUS_03330 4383 7325 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_03330 8362 7367 gene locus_tag LOCUS_03340 8362 7367 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_03340 11150 8403 gene locus_tag LOCUS_03350 11150 8403 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 protein_id gnl|my_center|LOCUS_03350 13496 11334 gene locus_tag LOCUS_03360 13496 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 13905 13609 gene locus_tag LOCUS_03370 13905 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 17313 13990 gene locus_tag LOCUS_03380 17313 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 19360 20025 gene locus_tag LOCUS_03390 19360 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 20018 21250 gene locus_tag LOCUS_03400 20018 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 21511 21828 gene locus_tag LOCUS_03410 21511 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 21821 22462 gene locus_tag LOCUS_03420 21821 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212574.1 protein_id gnl|my_center|LOCUS_03420 22502 23092 gene locus_tag LOCUS_03430 22502 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 23135 23497 gene locus_tag LOCUS_03440 23135 23497 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 protein_id gnl|my_center|LOCUS_03440 24315 23626 gene locus_tag LOCUS_03450 24315 23626 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_03450 24429 24701 gene locus_tag LOCUS_03460 24429 24701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 24947 24642 gene locus_tag LOCUS_03470 gene nirM 24947 24642 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_03470 26268 25063 gene locus_tag LOCUS_03480 26268 25063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 26712 26296 gene locus_tag LOCUS_03490 26712 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 27941 26724 gene locus_tag LOCUS_03500 gene fabB 27941 26724 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_03500 28529 28014 gene locus_tag LOCUS_03510 gene fabA 28529 28014 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379759.1 protein_id gnl|my_center|LOCUS_03510 31039 28850 gene locus_tag LOCUS_03520 gene relA 31039 28850 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 protein_id gnl|my_center|LOCUS_03520 31729 31082 gene locus_tag LOCUS_03530 31729 31082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_03530 31915 32649 gene locus_tag LOCUS_03540 31915 32649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence011 555 959 gene locus_tag LOCUS_03550 555 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 959 2884 gene locus_tag LOCUS_03560 959 2884 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_03560 2899 3195 gene locus_tag LOCUS_03570 2899 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3277 4506 gene locus_tag LOCUS_03580 3277 4506 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_03580 4539 5642 gene locus_tag LOCUS_03590 4539 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5700 8774 gene locus_tag LOCUS_03600 5700 8774 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_03600 8837 9163 gene locus_tag LOCUS_03610 8837 9163 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941498.1 protein_id gnl|my_center|LOCUS_03610 10206 9298 gene locus_tag LOCUS_03620 10206 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 10548 10210 gene locus_tag LOCUS_03630 10548 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10922 10689 gene locus_tag LOCUS_03640 10922 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11104 11448 gene locus_tag LOCUS_03650 gene arsR 11104 11448 CDS product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008961.1 protein_id gnl|my_center|LOCUS_03650 11570 12568 gene locus_tag LOCUS_03660 11570 12568 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_03660 12569 13777 gene locus_tag LOCUS_03670 gene arsJ 12569 13777 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_03670 13774 14784 gene locus_tag LOCUS_03680 13774 14784 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545026.1 protein_id gnl|my_center|LOCUS_03680 15145 15555 gene locus_tag LOCUS_03690 15145 15555 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_03690 15621 15932 gene locus_tag LOCUS_03700 gene merP 15621 15932 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735441.1 protein_id gnl|my_center|LOCUS_03700 15929 17365 gene locus_tag LOCUS_03710 gene merA 15929 17365 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105636.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 17370 17651 gene locus_tag LOCUS_03720 17370 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 18628 17771 gene locus_tag LOCUS_03730 gene rsmI 18628 17771 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809258.1 protein_id gnl|my_center|LOCUS_03730 18777 20690 gene locus_tag LOCUS_03740 18777 20690 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_03740 20706 21089 gene locus_tag LOCUS_03750 20706 21089 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_03750 21127 21708 gene locus_tag LOCUS_03760 gene dolP 21127 21708 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_03760 21718 23124 gene locus_tag LOCUS_03770 21718 23124 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_03770 23332 23547 gene locus_tag LOCUS_03780 23332 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 23572 25485 gene locus_tag LOCUS_03790 23572 25485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 26484 25777 gene locus_tag LOCUS_03800 gene sfsA 26484 25777 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396044.1 protein_id gnl|my_center|LOCUS_03800 28418 26499 gene locus_tag LOCUS_03810 gene htpG 28418 26499 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_03810 28942 28550 gene locus_tag LOCUS_03820 28942 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 29659 29159 gene locus_tag LOCUS_03830 29659 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 29805 29730 gene locus_tag LOCUS_t00020 29805 29730 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30602 29883 gene locus_tag LOCUS_03840 30602 29883 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_03840 31462 30662 gene locus_tag LOCUS_03850 31462 30662 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_03850 32472 31459 gene locus_tag LOCUS_03860 gene birA 32472 31459 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence012 331 1008 gene locus_tag LOCUS_03870 331 1008 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 protein_id gnl|my_center|LOCUS_03870 1016 2275 gene locus_tag LOCUS_03880 1016 2275 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_03880 2297 3166 gene locus_tag LOCUS_03890 gene aroE 2297 3166 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_03890 3621 6542 gene locus_tag LOCUS_03900 3621 6542 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_03900 6709 7440 gene locus_tag LOCUS_03910 6709 7440 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_03910 7512 8486 gene locus_tag LOCUS_03920 7512 8486 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_03920 8526 9506 gene locus_tag LOCUS_03930 gene moaA 8526 9506 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_03930 10267 9524 gene locus_tag LOCUS_03940 10267 9524 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_03940 10942 11517 gene locus_tag LOCUS_03950 10942 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 11839 11603 gene locus_tag LOCUS_03960 11839 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 12117 12407 gene locus_tag LOCUS_03970 12117 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12586 13764 gene locus_tag LOCUS_03980 12586 13764 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528269.1 protein_id gnl|my_center|LOCUS_03980 14972 14226 gene locus_tag LOCUS_03990 14972 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 15157 15468 gene locus_tag LOCUS_04000 15157 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 15892 15506 gene locus_tag LOCUS_04010 15892 15506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 16040 16249 gene locus_tag LOCUS_04020 16040 16249 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_04020 16501 19209 gene locus_tag LOCUS_04030 gene topA 16501 19209 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 protein_id gnl|my_center|LOCUS_04030 19779 19228 gene locus_tag LOCUS_04040 19779 19228 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_04040 20324 19776 gene locus_tag LOCUS_04050 20324 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20804 22726 gene locus_tag LOCUS_04060 20804 22726 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_04060 22804 24075 gene locus_tag LOCUS_04070 22804 24075 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443933.1 protein_id gnl|my_center|LOCUS_04070 24072 25568 gene locus_tag LOCUS_04080 24072 25568 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_04080 26148 25561 gene locus_tag LOCUS_04090 26148 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 26981 26715 gene locus_tag LOCUS_04100 26981 26715 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_04100 27467 27000 gene locus_tag LOCUS_04110 27467 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 27644 29197 gene locus_tag LOCUS_04120 27644 29197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 29349 29552 gene locus_tag LOCUS_04130 29349 29552 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_04130 29678 29962 gene locus_tag LOCUS_04140 29678 29962 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378666.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence013 413 3565 gene locus_tag LOCUS_04150 413 3565 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388641.1 protein_id gnl|my_center|LOCUS_04150 5422 3746 gene locus_tag LOCUS_04160 gene cysI 5422 3746 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_04160 6906 5422 gene locus_tag LOCUS_04170 6906 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 9101 9592 gene locus_tag LOCUS_04180 9101 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 11662 10046 gene locus_tag LOCUS_04190 gene gshA 11662 10046 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_04190 11792 12199 gene locus_tag LOCUS_04200 gene msrB 11792 12199 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_04200 12272 12754 gene locus_tag LOCUS_04210 12272 12754 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_04210 12717 13271 gene locus_tag LOCUS_04220 12717 13271 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_04220 13864 13301 gene locus_tag LOCUS_04230 13864 13301 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_04230 15619 14576 gene locus_tag LOCUS_04240 15619 14576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_04240 16819 15917 gene locus_tag LOCUS_04250 gene argF 16819 15917 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_04250 18026 16848 gene locus_tag LOCUS_04260 18026 16848 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_04260 18218 18436 gene locus_tag LOCUS_04270 18218 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 18778 18605 gene locus_tag LOCUS_04280 18778 18605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 18977 18765 gene locus_tag LOCUS_04290 18977 18765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19481 18981 gene locus_tag LOCUS_04300 19481 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 19961 22237 gene locus_tag LOCUS_04310 gene cas3 19961 22237 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_04310 22452 22616 gene locus_tag LOCUS_04320 22452 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 22619 23278 gene locus_tag LOCUS_04330 gene cas5c 22619 23278 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_04330 23275 25029 gene locus_tag LOCUS_04340 gene cas8c 23275 25029 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_04340 25032 25892 gene locus_tag LOCUS_04350 gene cas7c 25032 25892 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_04350 26277 26930 gene locus_tag LOCUS_04360 26277 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04360 27012 27302 gene locus_tag LOCUS_04370 27012 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04370 27299 27940 gene locus_tag LOCUS_04380 gene cas4 27299 27940 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 protein_id gnl|my_center|LOCUS_04380 27960 28976 gene locus_tag LOCUS_04390 gene cas1c 27960 28976 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_04390 28979 29272 gene locus_tag LOCUS_04400 gene cas2 28979 29272 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_04400 29448 29867 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccttcacgggcgcgtggattgaaac >Feature sequence014 <1 1100 gene locus_tag LOCUS_04410 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein note possible pseudo, internal stop codon, frameshifted 1100 2152 gene locus_tag LOCUS_04420 1100 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2149 2811 gene locus_tag LOCUS_04430 2149 2811 CDS product DUF3540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533832.1 protein_id gnl|my_center|LOCUS_04430 2836 3243 gene locus_tag LOCUS_04440 2836 3243 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_04440 3462 3767 gene locus_tag LOCUS_04450 3462 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5795 4074 gene locus_tag LOCUS_04460 5795 4074 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_04460 6688 5873 gene locus_tag LOCUS_04470 6688 5873 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_04470 7411 7335 gene locus_tag LOCUS_t00030 7411 7335 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7857 7501 gene locus_tag LOCUS_04480 7857 7501 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04480 8137 7835 gene locus_tag LOCUS_04490 gene ihfA 8137 7835 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_04490 10601 8208 gene locus_tag LOCUS_04500 gene pheT 10601 8208 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_04500 12312 11293 gene locus_tag LOCUS_04510 gene pheS 12312 11293 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_04510 12824 12465 gene locus_tag LOCUS_04520 gene rplT 12824 12465 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_04520 13737 13264 gene locus_tag LOCUS_04530 gene infC 13737 13264 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 protein_id gnl|my_center|LOCUS_04530 15717 13792 gene locus_tag LOCUS_04540 gene thrS 15717 13792 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738829.1 protein_id gnl|my_center|LOCUS_04540 17636 15957 gene locus_tag LOCUS_04550 17636 15957 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_04550 18524 17790 gene locus_tag LOCUS_04560 18524 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 20006 19068 gene locus_tag LOCUS_04570 20006 19068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21654 20944 gene locus_tag LOCUS_04580 21654 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 23405 22542 gene locus_tag LOCUS_04590 23405 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 24465 24701 gene locus_tag LOCUS_04600 24465 24701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 25345 25866 gene locus_tag LOCUS_04610 25345 25866 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462950.1 protein_id gnl|my_center|LOCUS_04610 26265 27326 gene locus_tag LOCUS_04620 26265 27326 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_04620 28054 27659 gene locus_tag LOCUS_04630 gene nsrR 28054 27659 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_04630 28645 28109 gene locus_tag LOCUS_04640 gene mog 28645 28109 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence015 1246 764 gene locus_tag LOCUS_04650 1246 764 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772268.1 protein_id gnl|my_center|LOCUS_04650 2177 1278 gene locus_tag LOCUS_04660 gene xerD 2177 1278 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_04660 2685 2170 gene locus_tag LOCUS_04670 2685 2170 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_04670 3131 2787 gene locus_tag LOCUS_04680 gene rplS 3131 2787 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_04680 4151 3408 gene locus_tag LOCUS_04690 gene trmD 4151 3408 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 protein_id gnl|my_center|LOCUS_04690 4709 4164 gene locus_tag LOCUS_04700 gene rimM 4709 4164 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 protein_id gnl|my_center|LOCUS_04700 5038 4781 gene locus_tag LOCUS_04710 gene rpsP 5038 4781 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260334.1 protein_id gnl|my_center|LOCUS_04710 5705 5496 gene locus_tag LOCUS_04720 5705 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6870 5776 gene locus_tag LOCUS_04730 gene ispG 6870 5776 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_04730 9308 7953 gene locus_tag LOCUS_04740 gene ffh 9308 7953 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 protein_id gnl|my_center|LOCUS_04740 10153 9389 gene locus_tag LOCUS_04750 10153 9389 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_04750 10499 11320 gene locus_tag LOCUS_04760 10499 11320 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_04760 11439 12737 gene locus_tag LOCUS_04770 11439 12737 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_04770 13072 12845 gene locus_tag LOCUS_04780 gene cspD 13072 12845 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_04780 13835 13611 gene locus_tag LOCUS_04790 13835 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 14020 16839 gene locus_tag LOCUS_04800 gene ppc 14020 16839 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_04800 17229 17047 gene locus_tag LOCUS_04810 17229 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 17342 18511 gene locus_tag LOCUS_04820 17342 18511 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_04820 19309 18527 gene locus_tag LOCUS_04830 19309 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 20193 19297 gene locus_tag LOCUS_04840 20193 19297 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_04840 20573 20301 gene locus_tag LOCUS_04850 20573 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_04850 21839 20793 gene locus_tag LOCUS_04860 gene nagZ 21839 20793 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529291.1 protein_id gnl|my_center|LOCUS_04860 22650 22033 gene locus_tag LOCUS_04870 22650 22033 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765411.1 protein_id gnl|my_center|LOCUS_04870 23423 22818 gene locus_tag LOCUS_04880 23423 22818 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_04880 24245 23541 gene locus_tag LOCUS_04890 24245 23541 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_04890 24452 25408 gene locus_tag LOCUS_04900 24452 25408 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_04900 26036 25497 gene locus_tag LOCUS_04910 26036 25497 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_04910 27253 26126 gene locus_tag LOCUS_04920 27253 26126 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463527.1 protein_id gnl|my_center|LOCUS_04920 <29457 27250 gene locus_tag LOCUS_04930 <29457 27250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence016 16146 6544 gene locus_tag LOCUS_04940 16146 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17683 16127 gene locus_tag LOCUS_04950 17683 16127 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_04950 19806 19204 gene locus_tag LOCUS_04960 19806 19204 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_04960 20066 20899 gene locus_tag LOCUS_04970 20066 20899 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_04970 21303 22061 gene locus_tag LOCUS_04980 21303 22061 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_04980 22075 22815 gene locus_tag LOCUS_04990 22075 22815 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_04990 24927 22891 gene locus_tag LOCUS_05000 24927 22891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25920 25189 gene locus_tag LOCUS_05010 gene tsaA 25920 25189 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_05010 25984 26454 gene locus_tag LOCUS_05020 25984 26454 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_05020 27134 26490 gene locus_tag LOCUS_05030 27134 26490 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553800.1 protein_id gnl|my_center|LOCUS_05030 27408 27794 gene locus_tag LOCUS_05040 27408 27794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 28306 27782 gene locus_tag LOCUS_05050 28306 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 28695 28369 gene locus_tag LOCUS_05060 28695 28369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 29262 28828 gene locus_tag LOCUS_05070 29262 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence017 874 1380 gene locus_tag LOCUS_05080 874 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 1867 3666 gene locus_tag LOCUS_05090 1867 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3818 4657 gene locus_tag LOCUS_05100 3818 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4644 5198 gene locus_tag LOCUS_05110 4644 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5218 5760 gene locus_tag LOCUS_05120 5218 5760 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_05120 6282 5848 gene locus_tag LOCUS_05130 6282 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8528 6288 gene locus_tag LOCUS_05140 gene mrcB 8528 6288 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_05140 8948 10540 gene locus_tag LOCUS_05150 8948 10540 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 protein_id gnl|my_center|LOCUS_05150 11210 12079 gene locus_tag LOCUS_05160 11210 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 12100 12927 gene locus_tag LOCUS_05170 12100 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 13719 13516 gene locus_tag LOCUS_05180 gene iscX 13719 13516 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_05180 14072 13734 gene locus_tag LOCUS_05190 gene fdx 14072 13734 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 protein_id gnl|my_center|LOCUS_05190 15980 14094 gene locus_tag LOCUS_05200 gene hscA 15980 14094 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_05200 16615 16070 gene locus_tag LOCUS_05210 gene hscB 16615 16070 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_05210 16962 16633 gene locus_tag LOCUS_05220 gene iscA 16962 16633 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 protein_id gnl|my_center|LOCUS_05220 17437 16988 gene locus_tag LOCUS_05230 gene iscU 17437 16988 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 protein_id gnl|my_center|LOCUS_05230 18740 17502 gene locus_tag LOCUS_05240 18740 17502 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_05240 19961 18798 gene locus_tag LOCUS_05250 19961 18798 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_05250 20482 19985 gene locus_tag LOCUS_05260 gene iscR 20482 19985 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_05260 21627 20803 gene locus_tag LOCUS_05270 gene cysE 21627 20803 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_05270 22997 22224 gene locus_tag LOCUS_05280 gene trmJ 22997 22224 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_05280 24032 24427 gene locus_tag LOCUS_05290 24032 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 24591 26126 gene locus_tag LOCUS_05300 24591 26126 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_05300 26137 26664 gene locus_tag LOCUS_05310 26137 26664 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_05310 26671 27420 gene locus_tag LOCUS_05320 26671 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 27420 28346 gene locus_tag LOCUS_05330 27420 28346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence018 85 1974 gene locus_tag LOCUS_05340 85 1974 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_05340 1992 3377 gene locus_tag LOCUS_05350 1992 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3370 4557 gene locus_tag LOCUS_05360 3370 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4758 6434 gene locus_tag LOCUS_05370 4758 6434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_05370 6561 7310 gene locus_tag LOCUS_05380 6561 7310 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020411.1 protein_id gnl|my_center|LOCUS_05380 7347 7862 gene locus_tag LOCUS_05390 gene ruvC 7347 7862 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_05390 7890 8492 gene locus_tag LOCUS_05400 gene ruvA 7890 8492 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_05400 8520 9104 gene locus_tag LOCUS_05410 8520 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 11446 9725 gene locus_tag LOCUS_05420 11446 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12135 11572 gene locus_tag LOCUS_05430 12135 11572 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_05430 12659 12153 gene locus_tag LOCUS_05440 gene purE 12659 12153 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_05440 14027 12711 gene locus_tag LOCUS_05450 gene purD 14027 12711 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_05450 16197 14167 gene locus_tag LOCUS_05460 16197 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 17113 16301 gene locus_tag LOCUS_05470 17113 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_05470 19330 17243 gene locus_tag LOCUS_05480 19330 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 20847 19327 gene locus_tag LOCUS_05490 20847 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21610 21047 gene locus_tag LOCUS_05500 21610 21047 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464189.1 protein_id gnl|my_center|LOCUS_05500 22576 22046 gene locus_tag LOCUS_05510 22576 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 24520 22814 gene locus_tag LOCUS_05520 24520 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 25135 24728 gene locus_tag LOCUS_05530 25135 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 25534 25304 gene locus_tag LOCUS_05540 25534 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 25701 27098 gene locus_tag LOCUS_05550 25701 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533628.1 protein_id gnl|my_center|LOCUS_05550 27101 27832 gene locus_tag LOCUS_05560 27101 27832 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence019 2 496 gene locus_tag LOCUS_05570 2 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 474 1886 gene locus_tag LOCUS_05580 474 1886 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_05580 3494 1929 gene locus_tag LOCUS_05590 3494 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 3745 3491 gene locus_tag LOCUS_05600 3745 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4942 3755 gene locus_tag LOCUS_05610 4942 3755 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_05610 6005 4917 gene locus_tag LOCUS_05620 gene aroB 6005 4917 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_05620 6548 6030 gene locus_tag LOCUS_05630 gene aroK 6548 6030 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_05630 7156 6740 gene locus_tag LOCUS_05640 7156 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8942 7179 gene locus_tag LOCUS_05650 gene lpdA 8942 7179 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_05650 10229 8946 gene locus_tag LOCUS_05660 gene aceF 10229 8946 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_05660 12922 10247 gene locus_tag LOCUS_05670 gene aceE 12922 10247 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_05670 13800 13171 gene locus_tag LOCUS_05680 13800 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 14039 13869 gene locus_tag LOCUS_05690 14039 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14606 14085 gene locus_tag LOCUS_05700 14606 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15376 14603 gene locus_tag LOCUS_05710 gene rsmE 15376 14603 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 protein_id gnl|my_center|LOCUS_05710 15490 16533 gene locus_tag LOCUS_05720 gene pyrC 15490 16533 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_05720 16530 17234 gene locus_tag LOCUS_05730 gene rnt 16530 17234 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_05730 17793 17464 gene locus_tag LOCUS_05740 gene grxD 17793 17464 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_05740 18411 18647 gene locus_tag LOCUS_05750 18411 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 18655 19536 gene locus_tag LOCUS_05760 18655 19536 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888164.1 protein_id gnl|my_center|LOCUS_05760 19572 20669 gene locus_tag LOCUS_05770 gene thiO 19572 20669 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_05770 20881 21321 gene locus_tag LOCUS_05780 20881 21321 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_05780 21417 21492 gene locus_tag LOCUS_t00040 21417 21492 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24416 21525 gene locus_tag LOCUS_05790 24416 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 24951 24652 gene locus_tag LOCUS_05800 24951 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 25169 27316 gene locus_tag LOCUS_05810 25169 27316 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence020 991 1758 gene locus_tag LOCUS_05820 991 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1861 1788 gene locus_tag LOCUS_t00050 1861 1788 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2027 3007 gene locus_tag LOCUS_05830 2027 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3049 3249 gene locus_tag LOCUS_05840 gene thiS 3049 3249 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_05840 3370 4170 gene locus_tag LOCUS_05850 3370 4170 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_05850 4313 4128 gene locus_tag LOCUS_05860 4313 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4442 5188 gene locus_tag LOCUS_05870 gene trmB 4442 5188 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_05870 5558 7528 gene locus_tag LOCUS_05880 5558 7528 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_05880 7627 8991 gene locus_tag LOCUS_05890 gene nhaD 7627 8991 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_05890 9550 9071 gene locus_tag LOCUS_05900 9550 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 10683 9586 gene locus_tag LOCUS_05910 10683 9586 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_05910 16965 10699 gene locus_tag LOCUS_05920 16965 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 17904 16981 gene locus_tag LOCUS_05930 gene pilK 17904 16981 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_05930 19975 17954 gene locus_tag LOCUS_05940 gene pilJ 19975 17954 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_05940 20606 20067 gene locus_tag LOCUS_05950 20606 20067 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_05950 20999 20634 gene locus_tag LOCUS_05960 gene pilH 20999 20634 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_05960 21481 21071 gene locus_tag LOCUS_05970 gene pilG 21481 21071 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05970 21952 22899 gene locus_tag LOCUS_05980 gene gshB 21952 22899 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_05980 22896 23960 gene locus_tag LOCUS_05990 22896 23960 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_05990 23957 24331 gene locus_tag LOCUS_06000 23957 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 24359 24904 gene locus_tag LOCUS_06010 24359 24904 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869101.1 protein_id gnl|my_center|LOCUS_06010 24996 25862 gene locus_tag LOCUS_06020 24996 25862 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_06020 25930 26493 gene locus_tag LOCUS_06030 25930 26493 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_06030 26499 26945 gene locus_tag LOCUS_06040 gene ruvX 26499 26945 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_06040 26957 27448 gene locus_tag LOCUS_06050 gene pyrR 26957 27448 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence021 237 470 gene locus_tag LOCUS_06060 237 470 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_06060 463 1017 gene locus_tag LOCUS_06070 463 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1022 2203 gene locus_tag LOCUS_06080 1022 2203 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_06080 2256 3404 gene locus_tag LOCUS_06090 gene ispG 2256 3404 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_06090 3428 4708 gene locus_tag LOCUS_06100 gene hisS 3428 4708 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 protein_id gnl|my_center|LOCUS_06100 4749 5399 gene locus_tag LOCUS_06110 4749 5399 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_06110 5399 6664 gene locus_tag LOCUS_06120 gene bamB 5399 6664 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_06120 7329 8720 gene locus_tag LOCUS_06130 gene der 7329 8720 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_06130 9543 8830 gene locus_tag LOCUS_06140 gene fixJ 9543 8830 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_06140 12854 11370 gene locus_tag LOCUS_06150 gene zwf 12854 11370 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_06150 14275 12851 gene locus_tag LOCUS_06160 gene gnd 14275 12851 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 protein_id gnl|my_center|LOCUS_06160 15436 14522 gene locus_tag LOCUS_06170 15436 14522 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_06170 16789 15446 gene locus_tag LOCUS_06180 16789 15446 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_06180 16998 16780 gene locus_tag LOCUS_06190 16998 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 17489 17001 gene locus_tag LOCUS_06200 17489 17001 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_06200 17903 18865 gene locus_tag LOCUS_06210 gene msrP 17903 18865 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_06210 18904 19527 gene locus_tag LOCUS_06220 gene msrQ 18904 19527 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920588.1 protein_id gnl|my_center|LOCUS_06220 20398 22275 gene locus_tag LOCUS_06230 20398 22275 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_06230 22345 23322 gene locus_tag LOCUS_06240 22345 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 23325 24173 gene locus_tag LOCUS_06250 23325 24173 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388248.1 protein_id gnl|my_center|LOCUS_06250 24191 25168 gene locus_tag LOCUS_06260 24191 25168 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_06260 25165 25971 gene locus_tag LOCUS_06270 25165 25971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence022 2007 1174 gene locus_tag LOCUS_06280 gene soxA 2007 1174 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965225.1 protein_id gnl|my_center|LOCUS_06280 2401 2084 gene locus_tag LOCUS_06290 gene soxZ 2401 2084 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_06290 2908 2447 gene locus_tag LOCUS_06300 gene soxY 2908 2447 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_06300 3331 2957 gene locus_tag LOCUS_06310 gene soxX 3331 2957 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172677.1 protein_id gnl|my_center|LOCUS_06310 4977 3559 gene locus_tag LOCUS_06320 4977 3559 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_06320 5443 5673 gene locus_tag LOCUS_06330 5443 5673 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_06330 5731 6198 gene locus_tag LOCUS_06340 5731 6198 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_06340 7502 6285 gene locus_tag LOCUS_06350 7502 6285 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_06350 8054 9370 gene locus_tag LOCUS_06360 8054 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9869 10270 gene locus_tag LOCUS_06370 9869 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 10198 10383 gene locus_tag LOCUS_06380 10198 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11402 10413 gene locus_tag LOCUS_06390 11402 10413 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_06390 11805 13022 gene locus_tag LOCUS_06400 11805 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14408 13041 gene locus_tag LOCUS_06410 14408 13041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 14816 15502 gene locus_tag LOCUS_06420 14816 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 15643 16596 gene locus_tag LOCUS_06430 15643 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 16777 18249 gene locus_tag LOCUS_06440 16777 18249 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_06440 18324 18506 gene locus_tag LOCUS_06450 18324 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 19921 19766 gene locus_tag LOCUS_06460 19921 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 20000 21586 gene locus_tag LOCUS_06470 20000 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence023 <1 669 gene locus_tag LOCUS_06480 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947252.1:type II secretion system F family protein 717 1595 gene locus_tag LOCUS_06490 717 1595 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_06490 1647 2261 gene locus_tag LOCUS_06500 gene coaE 1647 2261 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869082.1 protein_id gnl|my_center|LOCUS_06500 2319 3095 gene locus_tag LOCUS_06510 gene zapD 2319 3095 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 protein_id gnl|my_center|LOCUS_06510 3133 3333 gene locus_tag LOCUS_06520 3133 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5040 3478 gene locus_tag LOCUS_06530 gene murJ 5040 3478 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_06530 6119 6379 gene locus_tag LOCUS_06540 gene rpsT 6119 6379 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_06540 7628 6510 gene locus_tag LOCUS_06550 gene proB 7628 6510 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_06550 9032 8019 gene locus_tag LOCUS_06560 gene xcpX 9032 8019 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_06560 9640 9032 gene locus_tag LOCUS_06570 gene xcpW 9640 9032 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_06570 9981 9643 gene locus_tag LOCUS_06580 9981 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10636 10088 gene locus_tag LOCUS_06590 gene exeH 10636 10088 CDS product GspH family T2SS minor pseudopilin variant ExeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704543.1 protein_id gnl|my_center|LOCUS_06590 11126 10674 gene locus_tag LOCUS_06600 gene xcpT 11126 10674 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_06600 11275 11796 gene locus_tag LOCUS_06610 11275 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12516 12136 gene locus_tag LOCUS_06620 12516 12136 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_06620 13183 12560 gene locus_tag LOCUS_06630 gene sspA 13183 12560 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_06630 14604 13855 gene locus_tag LOCUS_06640 14604 13855 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_06640 15839 14601 gene locus_tag LOCUS_06650 15839 14601 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_06650 16429 15839 gene locus_tag LOCUS_06660 gene petA 16429 15839 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_06660 18103 17069 gene locus_tag LOCUS_06670 18103 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_06670 18697 18170 gene locus_tag LOCUS_06680 18697 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 19230 18718 gene locus_tag LOCUS_06690 19230 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 20658 19246 gene locus_tag LOCUS_06700 gene nrfD 20658 19246 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_06700 21563 20721 gene locus_tag LOCUS_06710 21563 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 23767 21566 gene locus_tag LOCUS_06720 23767 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 24452 23841 gene locus_tag LOCUS_06730 24452 23841 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_06730 25523 25086 gene locus_tag LOCUS_06740 25523 25086 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268338.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence024 1052 2200 gene locus_tag LOCUS_06750 gene dapC 1052 2200 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_06750 2230 3051 gene locus_tag LOCUS_06760 gene dapD 2230 3051 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_06760 3081 3434 gene locus_tag LOCUS_06770 3081 3434 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533673.1 protein_id gnl|my_center|LOCUS_06770 3764 4906 gene locus_tag LOCUS_06780 gene dapE 3764 4906 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132407.1 protein_id gnl|my_center|LOCUS_06780 5258 4899 gene locus_tag LOCUS_06790 5258 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 5866 5483 gene locus_tag LOCUS_06800 5866 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 7145 6027 gene locus_tag LOCUS_06810 7145 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7627 8916 gene locus_tag LOCUS_06820 gene bioA 7627 8916 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_06820 9149 10297 gene locus_tag LOCUS_06830 9149 10297 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938929.1 protein_id gnl|my_center|LOCUS_06830 10294 12459 gene locus_tag LOCUS_06840 10294 12459 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_06840 13141 12830 gene locus_tag LOCUS_06850 13141 12830 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340579.1 protein_id gnl|my_center|LOCUS_06850 13308 13922 gene locus_tag LOCUS_06860 13308 13922 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_06860 15976 14546 gene locus_tag LOCUS_06870 gene lpdA 15976 14546 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225317.1 protein_id gnl|my_center|LOCUS_06870 17279 16041 gene locus_tag LOCUS_06880 gene odhB 17279 16041 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225318.1 protein_id gnl|my_center|LOCUS_06880 20189 17340 gene locus_tag LOCUS_06890 gene sucA 20189 17340 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168018.1 protein_id gnl|my_center|LOCUS_06890 21129 20380 gene locus_tag LOCUS_06900 21129 20380 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_06900 21930 21316 gene locus_tag LOCUS_06910 21930 21316 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_06910 23111 23356 gene locus_tag LOCUS_06920 23111 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 24626 24126 gene locus_tag LOCUS_06930 24626 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 <25722 24713 gene locus_tag LOCUS_06940 <25722 24713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704441.1:serine endoprotease DegP >Feature sequence025 <1 714 gene locus_tag LOCUS_06950 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941581.1:ATP-binding cassette domain-containing protein 1060 1338 gene locus_tag LOCUS_06960 1060 1338 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_06960 1348 1635 gene locus_tag LOCUS_06970 1348 1635 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_06970 2470 2844 gene locus_tag LOCUS_06980 2470 2844 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929671.1 protein_id gnl|my_center|LOCUS_06980 3571 3011 gene locus_tag LOCUS_06990 3571 3011 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071126.1 protein_id gnl|my_center|LOCUS_06990 4147 3581 gene locus_tag LOCUS_07000 4147 3581 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_07000 5271 4918 gene locus_tag LOCUS_07010 5271 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_07010 6852 6145 gene locus_tag LOCUS_07020 6852 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7138 8136 gene locus_tag LOCUS_07030 7138 8136 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_07030 8149 11367 gene locus_tag LOCUS_07040 8149 11367 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_07040 11518 12432 gene locus_tag LOCUS_07050 11518 12432 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_07050 12480 12863 gene locus_tag LOCUS_07060 12480 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12860 13951 gene locus_tag LOCUS_07070 12860 13951 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_07070 15252 13948 gene locus_tag LOCUS_07080 15252 13948 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_07080 15977 15249 gene locus_tag LOCUS_07090 15977 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 16159 16539 gene locus_tag LOCUS_07100 16159 16539 CDS product DUF6463 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750084.1 protein_id gnl|my_center|LOCUS_07100 17523 17056 gene locus_tag LOCUS_07110 17523 17056 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_07110 18114 17584 gene locus_tag LOCUS_07120 18114 17584 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_07120 18303 19178 gene locus_tag LOCUS_07130 gene dapA 18303 19178 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_07130 19265 20350 gene locus_tag LOCUS_07140 gene bamC 19265 20350 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_07140 20383 21141 gene locus_tag LOCUS_07150 20383 21141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_07150 21231 21944 gene locus_tag LOCUS_07160 21231 21944 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_07160 22163 23365 gene locus_tag LOCUS_07170 22163 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 23872 23546 gene locus_tag LOCUS_07180 23872 23546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 24835 24092 gene locus_tag LOCUS_07190 24835 24092 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence026 2174 1248 gene locus_tag LOCUS_07200 2174 1248 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_07200 2312 2761 gene locus_tag LOCUS_07210 2312 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2893 3117 gene locus_tag LOCUS_07220 2893 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3925 3002 gene locus_tag LOCUS_07230 gene lpxC 3925 3002 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_07230 5200 4052 gene locus_tag LOCUS_07240 gene ftsZ 5200 4052 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 protein_id gnl|my_center|LOCUS_07240 6552 5263 gene locus_tag LOCUS_07250 gene ftsA 6552 5263 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_07250 7340 6549 gene locus_tag LOCUS_07260 7340 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 8286 7330 gene locus_tag LOCUS_07270 8286 7330 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_07270 9277 8375 gene locus_tag LOCUS_07280 gene murB 9277 8375 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_07280 10898 9429 gene locus_tag LOCUS_07290 gene murC 10898 9429 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 protein_id gnl|my_center|LOCUS_07290 12003 10891 gene locus_tag LOCUS_07300 gene murG 12003 10891 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_07300 13519 12257 gene locus_tag LOCUS_07310 gene ftsW 13519 12257 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_07310 14979 13516 gene locus_tag LOCUS_07320 gene murD 14979 13516 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_07320 16072 14990 gene locus_tag LOCUS_07330 gene mraY 16072 14990 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_07330 17463 16072 gene locus_tag LOCUS_07340 17463 16072 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_07340 19019 17463 gene locus_tag LOCUS_07350 19019 17463 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_07350 20752 19019 gene locus_tag LOCUS_07360 gene ftsI 20752 19019 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_07360 21123 20848 gene locus_tag LOCUS_07370 gene ftsL 21123 20848 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 protein_id gnl|my_center|LOCUS_07370 22084 21137 gene locus_tag LOCUS_07380 gene rsmH 22084 21137 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769446.1 protein_id gnl|my_center|LOCUS_07380 22545 22090 gene locus_tag LOCUS_07390 gene mraZ 22545 22090 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_07390 23697 23993 gene locus_tag LOCUS_07400 23697 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 23990 24280 gene locus_tag LOCUS_07410 23990 24280 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence027 1598 765 gene locus_tag LOCUS_07420 gene rsmA 1598 765 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 protein_id gnl|my_center|LOCUS_07420 2632 1595 gene locus_tag LOCUS_07430 gene pdxA 2632 1595 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 protein_id gnl|my_center|LOCUS_07430 3882 2632 gene locus_tag LOCUS_07440 3882 2632 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_07440 6592 4445 gene locus_tag LOCUS_07450 6592 4445 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931411.1 protein_id gnl|my_center|LOCUS_07450 8080 6701 gene locus_tag LOCUS_07460 gene mnmE 8080 6701 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981435.1 protein_id gnl|my_center|LOCUS_07460 9778 8087 gene locus_tag LOCUS_07470 gene yidC 9778 8087 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_07470 9981 9814 gene locus_tag LOCUS_07480 9981 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10479 10078 gene locus_tag LOCUS_07490 gene rnpA 10479 10078 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884349.1 protein_id gnl|my_center|LOCUS_07490 11112 12524 gene locus_tag LOCUS_07500 gene dnaA 11112 12524 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_07500 12841 13947 gene locus_tag LOCUS_07510 gene dnaN 12841 13947 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_07510 13991 15061 gene locus_tag LOCUS_07520 gene recF 13991 15061 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070426.1 protein_id gnl|my_center|LOCUS_07520 15323 17743 gene locus_tag LOCUS_07530 gene gyrB 15323 17743 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_07530 18523 18314 gene locus_tag LOCUS_07540 18523 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 18720 18520 gene locus_tag LOCUS_07550 18720 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 19010 18732 gene locus_tag LOCUS_07560 19010 18732 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_07560 20302 19295 gene locus_tag LOCUS_07570 20302 19295 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_07570 20552 21490 gene locus_tag LOCUS_07580 gene hemC 20552 21490 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_07580 21491 22267 gene locus_tag LOCUS_07590 gene hemD 21491 22267 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 protein_id gnl|my_center|LOCUS_07590 22289 23512 gene locus_tag LOCUS_07600 22289 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 23509 24831 gene locus_tag LOCUS_07610 23509 24831 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence028 528 82 gene locus_tag LOCUS_07620 gene dtd 528 82 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 protein_id gnl|my_center|LOCUS_07620 1489 539 gene locus_tag LOCUS_07630 gene pip 1489 539 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_07630 2101 1535 gene locus_tag LOCUS_07640 2101 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2258 2091 gene locus_tag LOCUS_07650 2258 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2693 2929 gene locus_tag LOCUS_07660 2693 2929 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_07660 3106 2945 gene locus_tag LOCUS_07670 3106 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3105 3896 gene locus_tag LOCUS_07680 gene ispA 3105 3896 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_07680 4006 5913 gene locus_tag LOCUS_07690 gene dxs 4006 5913 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_07690 5979 6359 gene locus_tag LOCUS_07700 gene queD 5979 6359 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_07700 6396 7187 gene locus_tag LOCUS_07710 gene folE2 6396 7187 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_07710 7424 8023 gene locus_tag LOCUS_07720 7424 8023 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_07720 8188 9471 gene locus_tag LOCUS_07730 8188 9471 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_07730 10242 9571 gene locus_tag LOCUS_07740 10242 9571 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_07740 10274 11011 gene locus_tag LOCUS_07750 10274 11011 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_07750 11175 10993 gene locus_tag LOCUS_07760 11175 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12317 11352 gene locus_tag LOCUS_07770 12317 11352 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547886.1 protein_id gnl|my_center|LOCUS_07770 13549 12314 gene locus_tag LOCUS_07780 13549 12314 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_07780 13797 16913 gene locus_tag LOCUS_07790 13797 16913 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_07790 17268 18533 gene locus_tag LOCUS_07800 17268 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 19914 18730 gene locus_tag LOCUS_07810 19914 18730 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_07810 21743 20154 gene locus_tag LOCUS_07820 gene purF 21743 20154 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_07820 22215 21706 gene locus_tag LOCUS_07830 22215 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 22873 22232 gene locus_tag LOCUS_07840 22873 22232 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 protein_id gnl|my_center|LOCUS_07840 24225 22933 gene locus_tag LOCUS_07850 gene folC 24225 22933 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence029 1135 143 gene locus_tag LOCUS_07860 1135 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1721 2737 gene locus_tag LOCUS_07870 1721 2737 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_07870 2983 4599 gene locus_tag LOCUS_07880 2983 4599 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_07880 4842 5372 gene locus_tag LOCUS_07890 4842 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6604 5567 gene locus_tag LOCUS_07900 6604 5567 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_07900 7029 6724 gene locus_tag LOCUS_07910 7029 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 9949 7016 gene locus_tag LOCUS_07920 9949 7016 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_07920 11850 9946 gene locus_tag LOCUS_07930 11850 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 12617 11910 gene locus_tag LOCUS_07940 12617 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 13819 12635 gene locus_tag LOCUS_07950 13819 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14024 13797 gene locus_tag LOCUS_07960 14024 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 14536 14024 gene locus_tag LOCUS_07970 14536 14024 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_07970 15230 14610 gene locus_tag LOCUS_07980 15230 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 15988 15254 gene locus_tag LOCUS_07990 15988 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 19224 16345 gene locus_tag LOCUS_08000 19224 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 19819 20946 gene locus_tag LOCUS_08010 gene gcvT 19819 20946 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_08010 20994 21389 gene locus_tag LOCUS_08020 gene gcvH 20994 21389 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_08020 21473 22831 gene locus_tag LOCUS_08030 gene gcvPA 21473 22831 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence030 345 1397 gene locus_tag LOCUS_08040 gene ftsY 345 1397 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128930.1 protein_id gnl|my_center|LOCUS_08040 1588 2274 gene locus_tag LOCUS_08050 gene ftsE 1588 2274 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_08050 2325 3308 gene locus_tag LOCUS_08060 gene ftsX 2325 3308 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_08060 3472 4323 gene locus_tag LOCUS_08070 gene rpoH 3472 4323 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_08070 4642 6849 gene locus_tag LOCUS_08080 4642 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6920 7993 gene locus_tag LOCUS_08090 6920 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 8056 8427 gene locus_tag LOCUS_08100 8056 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9091 8570 gene locus_tag LOCUS_08110 9091 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9872 9165 gene locus_tag LOCUS_08120 9872 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10967 9912 gene locus_tag LOCUS_08130 10967 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 12018 11101 gene locus_tag LOCUS_08140 12018 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 13820 12600 gene locus_tag LOCUS_08150 13820 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_08150 14619 13822 gene locus_tag LOCUS_08160 14619 13822 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_08160 16948 14612 gene locus_tag LOCUS_08170 16948 14612 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_08170 17619 17005 gene locus_tag LOCUS_08180 17619 17005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974635.1 protein_id gnl|my_center|LOCUS_08180 17961 17785 gene locus_tag LOCUS_08190 17961 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 18218 20500 gene locus_tag LOCUS_08200 18218 20500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_08200 20630 21265 gene locus_tag LOCUS_08210 20630 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 21255 21653 gene locus_tag LOCUS_08220 21255 21653 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_08220 21677 22360 gene locus_tag LOCUS_08230 21677 22360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 22528 22986 gene locus_tag LOCUS_08240 22528 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 23120 23821 gene locus_tag LOCUS_08250 23120 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence031 <1 978 gene locus_tag LOCUS_08260 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705145.1:NAD-dependent DNA ligase LigA 1327 1824 gene locus_tag LOCUS_08270 1327 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3245 1884 gene locus_tag LOCUS_08280 3245 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3619 5259 gene locus_tag LOCUS_08290 3619 5259 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944001.1 protein_id gnl|my_center|LOCUS_08290 6044 5517 gene locus_tag LOCUS_08300 6044 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8776 6047 gene locus_tag LOCUS_08310 8776 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9884 9072 gene locus_tag LOCUS_08320 9884 9072 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_08320 10174 9899 gene locus_tag LOCUS_08330 10174 9899 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_08330 10526 10218 gene locus_tag LOCUS_08340 10526 10218 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_08340 11096 10533 gene locus_tag LOCUS_08350 11096 10533 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957880.1 protein_id gnl|my_center|LOCUS_08350 11208 12074 gene locus_tag LOCUS_08360 11208 12074 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_08360 12071 12697 gene locus_tag LOCUS_08370 12071 12697 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351379.1 protein_id gnl|my_center|LOCUS_08370 13339 14436 gene locus_tag LOCUS_08380 13339 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 15310 14543 gene locus_tag LOCUS_08390 gene map 15310 14543 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_08390 15354 15596 gene locus_tag LOCUS_08400 15354 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15600 16412 gene locus_tag LOCUS_08410 gene rpsB 15600 16412 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 protein_id gnl|my_center|LOCUS_08410 16599 17477 gene locus_tag LOCUS_08420 gene tsf 16599 17477 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_08420 17498 18298 gene locus_tag LOCUS_08430 gene pyrH 17498 18298 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_08430 18367 18924 gene locus_tag LOCUS_08440 gene frr 18367 18924 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_08440 19046 19843 gene locus_tag LOCUS_08450 gene uppS 19046 19843 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765985.1 protein_id gnl|my_center|LOCUS_08450 19837 20691 gene locus_tag LOCUS_08460 gene cdsA 19837 20691 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_08460 20691 21923 gene locus_tag LOCUS_08470 gene ispC 20691 21923 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266975.1 protein_id gnl|my_center|LOCUS_08470 21920 23287 gene locus_tag LOCUS_08480 gene rseP 21920 23287 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence032 <1 633 gene locus_tag LOCUS_08490 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000774533.1:elongation factor G 1363 1647 gene locus_tag LOCUS_08500 1363 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2413 3276 gene locus_tag LOCUS_08510 2413 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3546 3911 gene locus_tag LOCUS_08520 3546 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4585 5757 gene locus_tag LOCUS_08530 gene carA 4585 5757 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_08530 5815 9036 gene locus_tag LOCUS_08540 gene carB 5815 9036 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_08540 9033 9512 gene locus_tag LOCUS_08550 gene greA 9033 9512 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_08550 9563 9994 gene locus_tag LOCUS_08560 9563 9994 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941706.1 protein_id gnl|my_center|LOCUS_08560 10329 10036 gene locus_tag LOCUS_08570 gene yhbY 10329 10036 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_08570 10372 10671 gene locus_tag LOCUS_08580 10372 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10668 11294 gene locus_tag LOCUS_08590 gene rlmE 10668 11294 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_08590 11396 13339 gene locus_tag LOCUS_08600 gene ftsH 11396 13339 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_08600 13372 14208 gene locus_tag LOCUS_08610 gene folP 13372 14208 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_08610 14289 15629 gene locus_tag LOCUS_08620 gene glmM 14289 15629 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_08620 18874 15938 gene locus_tag LOCUS_08630 gene rapA 18874 15938 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117023.1 protein_id gnl|my_center|LOCUS_08630 19162 19809 gene locus_tag LOCUS_08640 19162 19809 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_08640 21803 20094 gene locus_tag LOCUS_08650 21803 20094 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_08650 22224 22496 gene locus_tag LOCUS_08660 22224 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 22685 23113 gene locus_tag LOCUS_08670 gene tnpA 22685 23113 CDS product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence033 510 917 gene locus_tag LOCUS_08680 510 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3822 1558 gene locus_tag LOCUS_08690 gene ptsP 3822 1558 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_08690 4459 3965 gene locus_tag LOCUS_08700 gene rppH 4459 3965 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_08700 4613 5293 gene locus_tag LOCUS_08710 4613 5293 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_08710 5448 6353 gene locus_tag LOCUS_08720 5448 6353 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_08720 6350 7129 gene locus_tag LOCUS_08730 6350 7129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388893.1 protein_id gnl|my_center|LOCUS_08730 7867 7148 gene locus_tag LOCUS_08740 7867 7148 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_08740 8188 10170 gene locus_tag LOCUS_08750 gene btuB 8188 10170 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_08750 11125 10235 gene locus_tag LOCUS_08760 11125 10235 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_08760 11173 11727 gene locus_tag LOCUS_08770 gene cobU 11173 11727 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_08770 12144 12392 gene locus_tag LOCUS_08780 12144 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 13423 12461 gene locus_tag LOCUS_08790 13423 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 13933 13427 gene locus_tag LOCUS_08800 13933 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14424 13930 gene locus_tag LOCUS_08810 14424 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 15096 14440 gene locus_tag LOCUS_08820 15096 14440 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_08820 15693 15388 gene locus_tag LOCUS_08830 15693 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 16244 15690 gene locus_tag LOCUS_08840 16244 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19179 16351 gene locus_tag LOCUS_08850 19179 16351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_08850 20681 19176 gene locus_tag LOCUS_08860 20681 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 21242 20682 gene locus_tag LOCUS_08870 21242 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 21679 23271 gene locus_tag LOCUS_08880 21679 23271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence034 319 1380 gene locus_tag LOCUS_08890 319 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2663 1500 gene locus_tag LOCUS_08900 2663 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 3191 2724 gene locus_tag LOCUS_08910 gene fxsA 3191 2724 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_08910 3443 3793 gene locus_tag LOCUS_08920 3443 3793 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_08920 3805 6108 gene locus_tag LOCUS_08930 gene dsbD 3805 6108 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_08930 6127 6690 gene locus_tag LOCUS_08940 6127 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6981 7418 gene locus_tag LOCUS_08950 gene aroQ 6981 7418 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_08950 7485 7928 gene locus_tag LOCUS_08960 gene accB 7485 7928 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_08960 8004 9344 gene locus_tag LOCUS_08970 gene accC 8004 9344 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_08970 11593 9419 gene locus_tag LOCUS_08980 11593 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13000 11963 gene locus_tag LOCUS_08990 gene fba 13000 11963 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687252.1 protein_id gnl|my_center|LOCUS_08990 14544 13096 gene locus_tag LOCUS_09000 gene pyk 14544 13096 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_09000 15777 14593 gene locus_tag LOCUS_09010 15777 14593 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_09010 16948 15953 gene locus_tag LOCUS_09020 gene gap 16948 15953 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_09020 19034 17058 gene locus_tag LOCUS_09030 gene tkt 19034 17058 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261222.1 protein_id gnl|my_center|LOCUS_09030 20046 19486 gene locus_tag LOCUS_09040 20046 19486 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_09040 20254 21615 gene locus_tag LOCUS_09050 gene yegQ 20254 21615 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_09050 22516 21758 gene locus_tag LOCUS_09060 22516 21758 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence035 2123 1155 gene locus_tag LOCUS_09070 2123 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2586 2155 gene locus_tag LOCUS_09080 2586 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3428 2583 gene locus_tag LOCUS_09090 3428 2583 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008487788.1 protein_id gnl|my_center|LOCUS_09090 3955 3428 gene locus_tag LOCUS_09100 3955 3428 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_09100 4404 3952 gene locus_tag LOCUS_09110 4404 3952 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792472.1 protein_id gnl|my_center|LOCUS_09110 8669 4404 gene locus_tag LOCUS_09120 8669 4404 CDS product MSHA biogenesis protein MshQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262977.1 protein_id gnl|my_center|LOCUS_09120 9590 9156 gene locus_tag LOCUS_09130 9590 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11103 9883 gene locus_tag LOCUS_09140 11103 9883 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_09140 12827 11115 gene locus_tag LOCUS_09150 12827 11115 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_09150 13945 12830 gene locus_tag LOCUS_09160 13945 12830 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819183.1 protein_id gnl|my_center|LOCUS_09160 14854 13949 gene locus_tag LOCUS_09170 14854 13949 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_09170 16656 14878 gene locus_tag LOCUS_09180 gene mshL 16656 14878 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_09180 17703 17026 gene locus_tag LOCUS_09190 gene gspM 17703 17026 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 protein_id gnl|my_center|LOCUS_09190 18335 17700 gene locus_tag LOCUS_09200 18335 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 18604 19791 gene locus_tag LOCUS_09210 18604 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 20433 21671 gene locus_tag LOCUS_09220 20433 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence036 <1 693 gene locus_tag LOCUS_09230 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194094.1:class II glutamine amidotransferase 942 1637 gene locus_tag LOCUS_09240 942 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2696 2259 gene locus_tag LOCUS_09250 2696 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5398 3146 gene locus_tag LOCUS_09260 5398 3146 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_09260 5926 6561 gene locus_tag LOCUS_09270 gene nth 5926 6561 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030347.1 protein_id gnl|my_center|LOCUS_09270 6561 6995 gene locus_tag LOCUS_09280 6561 6995 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_09280 9524 7107 gene locus_tag LOCUS_09290 9524 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10982 9765 gene locus_tag LOCUS_09300 10982 9765 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_09300 12581 11244 gene locus_tag LOCUS_09310 12581 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12713 13999 gene locus_tag LOCUS_09320 12713 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 14709 14044 gene locus_tag LOCUS_09330 14709 14044 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 protein_id gnl|my_center|LOCUS_09330 15644 14727 gene locus_tag LOCUS_09340 15644 14727 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_09340 16597 15656 gene locus_tag LOCUS_09350 16597 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_09350 17701 16601 gene locus_tag LOCUS_09360 17701 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18053 17724 gene locus_tag LOCUS_09370 18053 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 18687 18046 gene locus_tag LOCUS_09380 18687 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 19385 18690 gene locus_tag LOCUS_09390 19385 18690 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_09390 19814 19389 gene locus_tag LOCUS_09400 19814 19389 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_09400 21584 19872 gene locus_tag LOCUS_09410 21584 19872 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073540.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence037 474 956 gene locus_tag LOCUS_09420 474 956 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_09420 2553 1237 gene locus_tag LOCUS_09430 2553 1237 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_09430 3113 2553 gene locus_tag LOCUS_09440 3113 2553 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_09440 3338 4687 gene locus_tag LOCUS_09450 3338 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5875 4712 gene locus_tag LOCUS_09460 5875 4712 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822678.1 protein_id gnl|my_center|LOCUS_09460 6710 5880 gene locus_tag LOCUS_09470 gene serB 6710 5880 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 protein_id gnl|my_center|LOCUS_09470 7677 6787 gene locus_tag LOCUS_09480 7677 6787 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_09480 8559 8233 gene locus_tag LOCUS_09490 gene nirM 8559 8233 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_09490 9207 8902 gene locus_tag LOCUS_09500 9207 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 9370 12111 gene locus_tag LOCUS_09510 gene polA 9370 12111 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_09510 13341 12682 gene locus_tag LOCUS_09520 gene yihA 13341 12682 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_09520 13556 13858 gene locus_tag LOCUS_09530 13556 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 13953 14597 gene locus_tag LOCUS_09540 13953 14597 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_09540 15099 14614 gene locus_tag LOCUS_09550 15099 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 15327 15950 gene locus_tag LOCUS_09560 15327 15950 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_09560 16021 17652 gene locus_tag LOCUS_09570 16021 17652 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_09570 17725 18528 gene locus_tag LOCUS_09580 17725 18528 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_09580 18551 20197 gene locus_tag LOCUS_09590 18551 20197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 20209 20631 gene locus_tag LOCUS_09600 gene hslR 20209 20631 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence038 1305 634 gene locus_tag LOCUS_09610 1305 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2133 1531 gene locus_tag LOCUS_09620 2133 1531 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 protein_id gnl|my_center|LOCUS_09620 2358 2954 gene locus_tag LOCUS_09630 gene gmhA 2358 2954 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_09630 3099 5036 gene locus_tag LOCUS_09640 gene mnmG 3099 5036 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500196.1 protein_id gnl|my_center|LOCUS_09640 5036 5560 gene locus_tag LOCUS_09650 5036 5560 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_09650 5576 6265 gene locus_tag LOCUS_09660 gene rsmG 5576 6265 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_09660 6303 7100 gene locus_tag LOCUS_09670 6303 7100 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_09670 7140 8006 gene locus_tag LOCUS_09680 7140 8006 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_09680 8217 8429 gene locus_tag LOCUS_09690 8217 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8465 8872 gene locus_tag LOCUS_09700 8465 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8894 9715 gene locus_tag LOCUS_09710 gene atpB 8894 9715 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_09710 9816 10103 gene locus_tag LOCUS_09720 gene atpE 9816 10103 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005372317.1 protein_id gnl|my_center|LOCUS_09720 10261 10659 gene locus_tag LOCUS_09730 10261 10659 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_09730 10663 11199 gene locus_tag LOCUS_09740 10663 11199 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_09740 11250 12791 gene locus_tag LOCUS_09750 gene atpA 11250 12791 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_09750 12852 13712 gene locus_tag LOCUS_09760 gene atpG 12852 13712 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_09760 13795 15174 gene locus_tag LOCUS_09770 gene atpD 13795 15174 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_09770 15216 15644 gene locus_tag LOCUS_09780 15216 15644 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_09780 15927 15745 gene locus_tag LOCUS_09790 15927 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 15962 17344 gene locus_tag LOCUS_09800 gene glmU 15962 17344 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 protein_id gnl|my_center|LOCUS_09800 17707 19539 gene locus_tag LOCUS_09810 gene glmS 17707 19539 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_09810 20040 19621 gene locus_tag LOCUS_09820 20040 19621 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence039 908 309 gene locus_tag LOCUS_09830 908 309 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_09830 1998 916 gene locus_tag LOCUS_09840 1998 916 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_09840 7233 2758 gene locus_tag LOCUS_09850 7233 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 8151 7792 gene locus_tag LOCUS_09860 8151 7792 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_09860 8812 8555 gene locus_tag LOCUS_09870 8812 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9597 8824 gene locus_tag LOCUS_09880 9597 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 10875 9610 gene locus_tag LOCUS_09890 10875 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 11528 10968 gene locus_tag LOCUS_09900 11528 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 12047 11547 gene locus_tag LOCUS_09910 12047 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12953 12297 gene locus_tag LOCUS_09920 gene uvrY 12953 12297 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 protein_id gnl|my_center|LOCUS_09920 13874 13203 gene locus_tag LOCUS_09930 13874 13203 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_09930 14993 13956 gene locus_tag LOCUS_09940 14993 13956 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_09940 16413 15109 gene locus_tag LOCUS_09950 16413 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17160 16753 gene locus_tag LOCUS_09960 17160 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 18090 17248 gene locus_tag LOCUS_09970 18090 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 18741 18187 gene locus_tag LOCUS_09980 18741 18187 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_09980 18986 20116 gene locus_tag LOCUS_09990 18986 20116 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence040 1118 447 gene locus_tag LOCUS_10000 1118 447 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_10000 2818 1310 gene locus_tag LOCUS_10010 2818 1310 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_10010 3529 2825 gene locus_tag LOCUS_10020 3529 2825 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_10020 4079 3612 gene locus_tag LOCUS_10030 4079 3612 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012501288.1 protein_id gnl|my_center|LOCUS_10030 4794 4138 gene locus_tag LOCUS_10040 gene narL 4794 4138 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 protein_id gnl|my_center|LOCUS_10040 6427 4841 gene locus_tag LOCUS_10050 6427 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 6782 6465 gene locus_tag LOCUS_10060 6782 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 8204 6837 gene locus_tag LOCUS_10070 gene cobB 8204 6837 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_10070 10895 8640 gene locus_tag LOCUS_10080 10895 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 11729 10923 gene locus_tag LOCUS_10090 11729 10923 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_10090 13306 11927 gene locus_tag LOCUS_10100 13306 11927 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_10100 13523 14479 gene locus_tag LOCUS_10110 13523 14479 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_10110 15228 16883 gene locus_tag LOCUS_10120 15228 16883 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_10120 16980 17957 gene locus_tag LOCUS_10130 16980 17957 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_10130 18411 18148 gene locus_tag LOCUS_10140 18411 18148 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_10140 18658 18404 gene locus_tag LOCUS_10150 18658 18404 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_10150 19211 18906 gene locus_tag LOCUS_10160 19211 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 19931 20146 gene locus_tag LOCUS_10170 19931 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence041 1025 843 gene locus_tag LOCUS_10180 1025 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1486 1103 gene locus_tag LOCUS_10190 1486 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1645 1866 gene locus_tag LOCUS_10200 1645 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4231 1976 gene locus_tag LOCUS_10210 4231 1976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263834.1 protein_id gnl|my_center|LOCUS_10210 5724 8057 gene locus_tag LOCUS_10220 5724 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9822 8275 gene locus_tag LOCUS_10230 9822 8275 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263833.1 protein_id gnl|my_center|LOCUS_10230 10563 9856 gene locus_tag LOCUS_10240 10563 9856 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263832.1 protein_id gnl|my_center|LOCUS_10240 12365 10563 gene locus_tag LOCUS_10250 12365 10563 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_10250 13099 12371 gene locus_tag LOCUS_10260 13099 12371 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263830.1 protein_id gnl|my_center|LOCUS_10260 13542 13186 gene locus_tag LOCUS_10270 13542 13186 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263829.1 protein_id gnl|my_center|LOCUS_10270 14176 15303 gene locus_tag LOCUS_10280 14176 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15357 16049 gene locus_tag LOCUS_10290 15357 16049 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337279.1 protein_id gnl|my_center|LOCUS_10290 16820 17074 gene locus_tag LOCUS_10300 16820 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 18021 17089 gene locus_tag LOCUS_10310 18021 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 18428 19681 gene locus_tag LOCUS_10320 18428 19681 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_10320 19674 20360 gene locus_tag LOCUS_10330 gene lolD 19674 20360 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence042 63 1361 gene locus_tag LOCUS_10340 63 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1358 2254 gene locus_tag LOCUS_10350 gene nuoH 1358 2254 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_10350 2251 2787 gene locus_tag LOCUS_10360 2251 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2788 3099 gene locus_tag LOCUS_10370 gene nuoK 2788 3099 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_10370 3096 4901 gene locus_tag LOCUS_10380 3096 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4954 6438 gene locus_tag LOCUS_10390 4954 6438 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886373.1 protein_id gnl|my_center|LOCUS_10390 6438 7811 gene locus_tag LOCUS_10400 6438 7811 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545829.1 protein_id gnl|my_center|LOCUS_10400 8992 7808 gene locus_tag LOCUS_10410 8992 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 protein_id gnl|my_center|LOCUS_10410 9251 10372 gene locus_tag LOCUS_10420 9251 10372 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_10420 10372 12774 gene locus_tag LOCUS_10430 10372 12774 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_10430 13879 12782 gene locus_tag LOCUS_10440 13879 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 16634 14895 gene locus_tag LOCUS_10450 gene cueO 16634 14895 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858205.1 protein_id gnl|my_center|LOCUS_10450 17476 17147 gene locus_tag LOCUS_10460 17476 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 18056 17832 gene locus_tag LOCUS_10470 18056 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18677 18105 gene locus_tag LOCUS_10480 18677 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 19503 18811 gene locus_tag LOCUS_10490 19503 18811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence043 862 461 gene locus_tag LOCUS_10500 gene vapC 862 461 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_10500 1095 862 gene locus_tag LOCUS_10510 1095 862 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_10510 1409 2383 gene locus_tag LOCUS_10520 1409 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2269 2484 gene locus_tag LOCUS_10530 2269 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 2702 2953 gene locus_tag LOCUS_10540 gene hfq 2702 2953 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051875.1 protein_id gnl|my_center|LOCUS_10540 2986 4335 gene locus_tag LOCUS_10550 gene hflX 2986 4335 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 protein_id gnl|my_center|LOCUS_10550 4590 5783 gene locus_tag LOCUS_10560 gene hflK 4590 5783 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_10560 5783 6637 gene locus_tag LOCUS_10570 gene hflC 5783 6637 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_10570 6700 6888 gene locus_tag LOCUS_10580 6700 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6942 8123 gene locus_tag LOCUS_10590 6942 8123 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_10590 8501 9820 gene locus_tag LOCUS_10600 8501 9820 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_10600 9899 10324 gene locus_tag LOCUS_10610 9899 10324 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_10610 13551 10420 gene locus_tag LOCUS_10620 13551 10420 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 protein_id gnl|my_center|LOCUS_10620 14257 13532 gene locus_tag LOCUS_10630 14257 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15607 14405 gene locus_tag LOCUS_10640 15607 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 16880 15624 gene locus_tag LOCUS_10650 16880 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 18605 19222 gene locus_tag LOCUS_10660 gene cobO 18605 19222 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence044 4575 364 gene locus_tag LOCUS_10670 4575 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 6686 4644 gene locus_tag LOCUS_10680 6686 4644 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_10680 6914 7699 gene locus_tag LOCUS_10690 gene fabI 6914 7699 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_10690 9965 8055 gene locus_tag LOCUS_10700 gene ppiD 9965 8055 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_10700 10239 10163 gene locus_tag LOCUS_t00060 10239 10163 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10389 10314 gene locus_tag LOCUS_t00070 10389 10314 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10674 10402 gene locus_tag LOCUS_10710 10674 10402 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_10710 13443 11008 gene locus_tag LOCUS_10720 gene lon 13443 11008 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_10720 15104 13824 gene locus_tag LOCUS_10730 gene clpX 15104 13824 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_10730 15905 15219 gene locus_tag LOCUS_10740 gene clpP 15905 15219 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_10740 17274 15973 gene locus_tag LOCUS_10750 gene tig 17274 15973 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_10750 17419 17335 gene locus_tag LOCUS_t00080 17419 17335 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17597 17522 gene locus_tag LOCUS_t00090 17597 17522 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17733 17658 gene locus_tag LOCUS_t00100 17733 17658 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17892 17816 gene locus_tag LOCUS_t00110 17892 17816 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18021 17945 gene locus_tag LOCUS_t00120 18021 17945 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18254 19108 gene locus_tag LOCUS_10760 gene folD 18254 19108 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 protein_id gnl|my_center|LOCUS_10760 19171 19647 gene locus_tag LOCUS_10770 19171 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 19644 19889 gene locus_tag LOCUS_10780 19644 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence045 1550 381 gene locus_tag LOCUS_10790 1550 381 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_10790 2339 1593 gene locus_tag LOCUS_10800 2339 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3198 2428 gene locus_tag LOCUS_10810 3198 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_10810 3568 3386 gene locus_tag LOCUS_10820 3568 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4320 3727 gene locus_tag LOCUS_10830 4320 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5435 4473 gene locus_tag LOCUS_10840 5435 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5755 5462 gene locus_tag LOCUS_10850 5755 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7099 5786 gene locus_tag LOCUS_10860 gene cfaB 7099 5786 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 protein_id gnl|my_center|LOCUS_10860 7477 7175 gene locus_tag LOCUS_10870 7477 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7790 7467 gene locus_tag LOCUS_10880 7790 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8370 7816 gene locus_tag LOCUS_10890 8370 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11142 8569 gene locus_tag LOCUS_10900 gene silP 11142 8569 CDS product Ag(+)-translocating P-type ATPase SilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001353604.1 protein_id gnl|my_center|LOCUS_10900 11616 11206 gene locus_tag LOCUS_10910 11616 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 12128 11706 gene locus_tag LOCUS_10920 gene zntR 12128 11706 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_10920 13211 12138 gene locus_tag LOCUS_10930 13211 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14281 13289 gene locus_tag LOCUS_10940 14281 13289 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_10940 16050 14290 gene locus_tag LOCUS_10950 16050 14290 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_10950 16283 16966 gene locus_tag LOCUS_10960 16283 16966 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_10960 16975 18369 gene locus_tag LOCUS_10970 16975 18369 CDS product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 protein_id gnl|my_center|LOCUS_10970 20045 18546 gene locus_tag LOCUS_10980 20045 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence046 413 150 gene locus_tag LOCUS_10990 413 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 889 1188 gene locus_tag LOCUS_11000 889 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1233 2342 gene locus_tag LOCUS_11010 gene ruvB 1233 2342 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_11010 2456 2890 gene locus_tag LOCUS_11020 gene ybgC 2456 2890 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_11020 2880 3554 gene locus_tag LOCUS_11030 gene tolQ 2880 3554 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_11030 3555 3992 gene locus_tag LOCUS_11040 gene tolR 3555 3992 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_11040 4035 4925 gene locus_tag LOCUS_11050 gene tolA 4035 4925 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947301.1 protein_id gnl|my_center|LOCUS_11050 4949 6295 gene locus_tag LOCUS_11060 gene tolB 4949 6295 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_11060 6370 6945 gene locus_tag LOCUS_11070 gene pal 6370 6945 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176621.1 protein_id gnl|my_center|LOCUS_11070 7046 7861 gene locus_tag LOCUS_11080 gene ybgF 7046 7861 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351957.1 protein_id gnl|my_center|LOCUS_11080 7963 8655 gene locus_tag LOCUS_11090 gene queE 7963 8655 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_11090 8658 9362 gene locus_tag LOCUS_11100 gene queC 8658 9362 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_11100 9394 10131 gene locus_tag LOCUS_11110 9394 10131 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_11110 10227 11813 gene locus_tag LOCUS_11120 10227 11813 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_11120 11936 13474 gene locus_tag LOCUS_11130 gene gpmI 11936 13474 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_11130 14281 14793 gene locus_tag LOCUS_11140 14281 14793 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_11140 14790 15164 gene locus_tag LOCUS_11150 14790 15164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 15169 15378 gene locus_tag LOCUS_11160 15169 15378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 15368 15958 gene locus_tag LOCUS_11170 15368 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 16636 17421 gene locus_tag LOCUS_11180 16636 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 17551 19485 gene locus_tag LOCUS_11190 17551 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 19609 20025 gene locus_tag LOCUS_11200 19609 20025 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence047 <1 986 gene locus_tag LOCUS_11210 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772336.1:alanine racemase 1349 2722 gene locus_tag LOCUS_11220 gene radA 1349 2722 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 protein_id gnl|my_center|LOCUS_11220 3521 3156 gene locus_tag LOCUS_11230 3521 3156 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707404.1 protein_id gnl|my_center|LOCUS_11230 3939 6392 gene locus_tag LOCUS_11240 3939 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 6426 7211 gene locus_tag LOCUS_11250 6426 7211 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_11250 7304 7654 gene locus_tag LOCUS_11260 7304 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 10744 7691 gene locus_tag LOCUS_11270 10744 7691 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_11270 12268 10904 gene locus_tag LOCUS_11280 12268 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 13641 12490 gene locus_tag LOCUS_11290 13641 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 14272 13946 gene locus_tag LOCUS_11300 14272 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 14867 15349 gene locus_tag LOCUS_11310 14867 15349 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_11310 15402 16853 gene locus_tag LOCUS_11320 15402 16853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_11320 17339 19186 gene locus_tag LOCUS_11330 17339 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 19208 19684 gene locus_tag LOCUS_11340 19208 19684 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence048 443 3697 gene locus_tag LOCUS_11350 443 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5132 3975 gene locus_tag LOCUS_11360 5132 3975 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_11360 5675 5292 gene locus_tag LOCUS_11370 gene erpA 5675 5292 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_11370 6232 5804 gene locus_tag LOCUS_11380 6232 5804 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_11380 7011 6295 gene locus_tag LOCUS_11390 7011 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 8149 7106 gene locus_tag LOCUS_11400 gene argC 8149 7106 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_11400 9679 8270 gene locus_tag LOCUS_11410 9679 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 10389 9937 gene locus_tag LOCUS_11420 10389 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_11420 10607 11182 gene locus_tag LOCUS_11430 10607 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11179 11904 gene locus_tag LOCUS_11440 11179 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12678 11911 gene locus_tag LOCUS_11450 12678 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 14153 12900 gene locus_tag LOCUS_11460 14153 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 14519 15331 gene locus_tag LOCUS_11470 14519 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15307 16428 gene locus_tag LOCUS_11480 15307 16428 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_11480 16702 17661 gene locus_tag LOCUS_11490 16702 17661 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_11490 18218 19522 gene locus_tag LOCUS_11500 18218 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence049 1428 787 gene locus_tag LOCUS_11510 1428 787 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 protein_id gnl|my_center|LOCUS_11510 2682 1480 gene locus_tag LOCUS_11520 2682 1480 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_11520 3763 2684 gene locus_tag LOCUS_11530 3763 2684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 protein_id gnl|my_center|LOCUS_11530 5293 3830 gene locus_tag LOCUS_11540 5293 3830 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_11540 6429 5275 gene locus_tag LOCUS_11550 6429 5275 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 protein_id gnl|my_center|LOCUS_11550 7171 6434 gene locus_tag LOCUS_11560 7171 6434 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 protein_id gnl|my_center|LOCUS_11560 8391 7444 gene locus_tag LOCUS_11570 8391 7444 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_11570 9810 8398 gene locus_tag LOCUS_11580 9810 8398 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_11580 11243 9810 gene locus_tag LOCUS_11590 11243 9810 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263839.1 protein_id gnl|my_center|LOCUS_11590 12391 11240 gene locus_tag LOCUS_11600 12391 11240 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263838.1 protein_id gnl|my_center|LOCUS_11600 13658 12642 gene locus_tag LOCUS_11610 13658 12642 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_11610 14154 15107 gene locus_tag LOCUS_11620 14154 15107 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103232.1 protein_id gnl|my_center|LOCUS_11620 16677 15280 gene locus_tag LOCUS_11630 16677 15280 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_11630 <19359 16667 gene locus_tag LOCUS_11640 <19359 16667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263834.1:response regulator >Feature sequence050 <1 3715 gene locus_tag LOCUS_11650 <1 3715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113821.1:phosphoribosylformylglycinamidine synthase 3907 4860 gene locus_tag LOCUS_11660 3907 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5116 5697 gene locus_tag LOCUS_11670 5116 5697 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_11670 5936 6166 gene locus_tag LOCUS_11680 5936 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6832 8277 gene locus_tag LOCUS_11690 6832 8277 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_11690 8306 8869 gene locus_tag LOCUS_11700 8306 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 8859 10232 gene locus_tag LOCUS_11710 gene glrR 8859 10232 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_11710 10576 11235 gene locus_tag LOCUS_11720 10576 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 11550 12980 gene locus_tag LOCUS_11730 11550 12980 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_11730 14424 13318 gene locus_tag LOCUS_11740 14424 13318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 14707 16743 gene locus_tag LOCUS_11750 14707 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 16789 17499 gene locus_tag LOCUS_11760 16789 17499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631603.1 protein_id gnl|my_center|LOCUS_11760 17496 18743 gene locus_tag LOCUS_11770 17496 18743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence051 1375 296 gene locus_tag LOCUS_11780 gene hisC 1375 296 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_11780 2816 1518 gene locus_tag LOCUS_11790 gene hisD 2816 1518 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_11790 3602 2952 gene locus_tag LOCUS_11800 gene hisG 3602 2952 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_11800 5058 3799 gene locus_tag LOCUS_11810 gene murA 5058 3799 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_11810 5460 5200 gene locus_tag LOCUS_11820 gene ibaG 5460 5200 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 protein_id gnl|my_center|LOCUS_11820 6308 5538 gene locus_tag LOCUS_11830 6308 5538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_11830 7237 6305 gene locus_tag LOCUS_11840 7237 6305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_11840 7708 7388 gene locus_tag LOCUS_11850 7708 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 8346 7708 gene locus_tag LOCUS_11860 8346 7708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_11860 9716 8343 gene locus_tag LOCUS_11870 9716 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10215 9751 gene locus_tag LOCUS_11880 gene mlaD 10215 9751 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_11880 11081 10305 gene locus_tag LOCUS_11890 gene mlaE 11081 10305 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_11890 11935 11081 gene locus_tag LOCUS_11900 gene mlaF 11935 11081 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534228.1 protein_id gnl|my_center|LOCUS_11900 12797 12093 gene locus_tag LOCUS_11910 12797 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 12979 13173 gene locus_tag LOCUS_11920 12979 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 13251 14069 gene locus_tag LOCUS_11930 13251 14069 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_11930 14447 15124 gene locus_tag LOCUS_11940 14447 15124 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_11940 16729 15380 gene locus_tag LOCUS_11950 16729 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17490 17113 gene locus_tag LOCUS_11960 17490 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18407 17634 gene locus_tag LOCUS_11970 18407 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence052 1700 663 gene locus_tag LOCUS_11980 1700 663 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_11980 1760 2623 gene locus_tag LOCUS_11990 1760 2623 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_11990 2669 3580 gene locus_tag LOCUS_12000 gene argB 2669 3580 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_12000 4079 4678 gene locus_tag LOCUS_12010 gene slmA 4079 4678 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_12010 4696 5451 gene locus_tag LOCUS_12020 4696 5451 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_12020 6317 5586 gene locus_tag LOCUS_12030 6317 5586 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_12030 7045 6404 gene locus_tag LOCUS_12040 gene pyrE 7045 6404 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_12040 7187 7972 gene locus_tag LOCUS_12050 7187 7972 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_12050 10645 8267 gene locus_tag LOCUS_12060 10645 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11242 10847 gene locus_tag LOCUS_12070 11242 10847 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_12070 13516 11549 gene locus_tag LOCUS_12080 13516 11549 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_12080 14359 13775 gene locus_tag LOCUS_12090 14359 13775 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 protein_id gnl|my_center|LOCUS_12090 15212 14370 gene locus_tag LOCUS_12100 gene proC 15212 14370 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_12100 16006 15251 gene locus_tag LOCUS_12110 16006 15251 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_12110 16200 17237 gene locus_tag LOCUS_12120 16200 17237 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence053 2270 477 gene locus_tag LOCUS_12130 2270 477 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_12130 3183 2389 gene locus_tag LOCUS_12140 gene gloB 3183 2389 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814736.1 protein_id gnl|my_center|LOCUS_12140 3374 4198 gene locus_tag LOCUS_12150 3374 4198 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_12150 4202 4639 gene locus_tag LOCUS_12160 gene rnhA 4202 4639 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_12160 4866 5588 gene locus_tag LOCUS_12170 gene dnaQ 4866 5588 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770771.1 protein_id gnl|my_center|LOCUS_12170 7968 5614 gene locus_tag LOCUS_12180 7968 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8442 8002 gene locus_tag LOCUS_12190 8442 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9664 8654 gene locus_tag LOCUS_12200 9664 8654 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_12200 10993 9716 gene locus_tag LOCUS_12210 gene tviB 10993 9716 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_12210 12380 11058 gene locus_tag LOCUS_12220 12380 11058 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_12220 12789 14195 gene locus_tag LOCUS_12230 12789 14195 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_12230 14234 16372 gene locus_tag LOCUS_12240 gene prsK 14234 16372 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence054 <1 1139 gene locus_tag LOCUS_12250 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367567.1:ABC-F family ATPase 1182 2570 gene locus_tag LOCUS_12260 gene dbpA 1182 2570 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_12260 3164 4324 gene locus_tag LOCUS_12270 3164 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4565 4810 gene locus_tag LOCUS_12280 4565 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4826 6118 gene locus_tag LOCUS_12290 4826 6118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_12290 6158 6703 gene locus_tag LOCUS_12300 gene napC 6158 6703 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_12300 7385 6732 gene locus_tag LOCUS_12310 7385 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8363 7494 gene locus_tag LOCUS_12320 8363 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8696 11530 gene locus_tag LOCUS_12330 8696 11530 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 protein_id gnl|my_center|LOCUS_12330 12754 11537 gene locus_tag LOCUS_12340 12754 11537 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957362.1 protein_id gnl|my_center|LOCUS_12340 13983 12751 gene locus_tag LOCUS_12350 gene ubiH 13983 12751 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173509.1 protein_id gnl|my_center|LOCUS_12350 15317 13980 gene locus_tag LOCUS_12360 gene pepP 15317 13980 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12360 16924 15401 gene locus_tag LOCUS_12370 16924 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence055 412 2487 gene locus_tag LOCUS_12380 412 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3049 2579 gene locus_tag LOCUS_12390 3049 2579 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_12390 3562 3062 gene locus_tag LOCUS_12400 3562 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4240 3785 gene locus_tag LOCUS_12410 4240 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5182 4346 gene locus_tag LOCUS_12420 5182 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5623 5201 gene locus_tag LOCUS_12430 5623 5201 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_12430 7419 5629 gene locus_tag LOCUS_12440 7419 5629 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_12440 9507 7468 gene locus_tag LOCUS_12450 9507 7468 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_12450 10826 9510 gene locus_tag LOCUS_12460 10826 9510 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_12460 13320 10888 gene locus_tag LOCUS_12470 13320 10888 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_12470 14255 13320 gene locus_tag LOCUS_12480 14255 13320 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083528.1 protein_id gnl|my_center|LOCUS_12480 14295 14474 gene locus_tag LOCUS_12490 14295 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 15105 14494 gene locus_tag LOCUS_12500 15105 14494 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_12500 15825 15106 gene locus_tag LOCUS_12510 15825 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 16639 15971 gene locus_tag LOCUS_12520 gene purN 16639 15971 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_12520 17116 16808 gene locus_tag LOCUS_12530 17116 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence056 1979 534 gene locus_tag LOCUS_12540 gene nuoN 1979 534 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_12540 3511 1985 gene locus_tag LOCUS_12550 3511 1985 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_12550 5532 3580 gene locus_tag LOCUS_12560 gene nuoL 5532 3580 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_12560 5855 5550 gene locus_tag LOCUS_12570 gene nuoK 5855 5550 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_12570 6525 5893 gene locus_tag LOCUS_12580 6525 5893 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_12580 7065 6577 gene locus_tag LOCUS_12590 gene nuoI 7065 6577 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_12590 8230 7145 gene locus_tag LOCUS_12600 gene nuoH 8230 7145 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_12600 10648 8291 gene locus_tag LOCUS_12610 gene nuoG 10648 8291 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_12610 12028 10748 gene locus_tag LOCUS_12620 gene nuoF 12028 10748 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_12620 12549 12046 gene locus_tag LOCUS_12630 gene nuoE 12549 12046 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_12630 13802 12549 gene locus_tag LOCUS_12640 13802 12549 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_12640 14490 13795 gene locus_tag LOCUS_12650 14490 13795 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_12650 15068 14592 gene locus_tag LOCUS_12660 15068 14592 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_12660 15415 15059 gene locus_tag LOCUS_12670 15415 15059 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_12670 15779 15695 gene locus_tag LOCUS_t00130 15779 15695 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16444 16046 gene locus_tag LOCUS_12680 gene secG 16444 16046 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_12680 <17256 16536 gene locus_tag LOCUS_12690 <17256 16536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037661.1:triose-phosphate isomerase >Feature sequence057 1080 1004 gene locus_tag LOCUS_t00140 1080 1004 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3171 1141 gene locus_tag LOCUS_12700 gene uvrB 3171 1141 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 protein_id gnl|my_center|LOCUS_12700 3224 4447 gene locus_tag LOCUS_12710 3224 4447 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_12710 4527 4602 gene locus_tag LOCUS_t00150 4527 4602 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5254 6081 gene locus_tag LOCUS_12720 5254 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6209 6451 gene locus_tag LOCUS_12730 6209 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 8205 6511 gene locus_tag LOCUS_12740 gene hsbR 8205 6511 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_12740 8629 8321 gene locus_tag LOCUS_12750 8629 8321 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408073.1 protein_id gnl|my_center|LOCUS_12750 9492 8935 gene locus_tag LOCUS_12760 9492 8935 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_12760 10485 9604 gene locus_tag LOCUS_12770 10485 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10802 10500 gene locus_tag LOCUS_12780 10802 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 11019 13022 gene locus_tag LOCUS_12790 gene slt 11019 13022 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_12790 <17226 13789 gene locus_tag LOCUS_12800 <17226 13789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149560359.1:ATP-dependent RNA helicase HrpA >Feature sequence058 47 2878 gene locus_tag LOCUS_12810 47 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2875 4959 gene locus_tag LOCUS_12820 2875 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_12820 5004 8294 gene locus_tag LOCUS_12830 5004 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8329 8823 gene locus_tag LOCUS_12840 8329 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9310 10119 gene locus_tag LOCUS_12850 gene suhB 9310 10119 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_12850 10119 10496 gene locus_tag LOCUS_12860 10119 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10502 11203 gene locus_tag LOCUS_12870 10502 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11530 12630 gene locus_tag LOCUS_12880 gene tapW 11530 12630 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_12880 12758 13579 gene locus_tag LOCUS_12890 gene rhdA 12758 13579 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_12890 13672 13833 gene locus_tag LOCUS_12900 13672 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 16865 14250 gene locus_tag LOCUS_12910 16865 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence059 4334 1029 gene locus_tag LOCUS_12920 4334 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 7138 4868 gene locus_tag LOCUS_12930 7138 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7382 7708 gene locus_tag LOCUS_12940 7382 7708 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_12940 7756 8352 gene locus_tag LOCUS_12950 gene recR 7756 8352 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 protein_id gnl|my_center|LOCUS_12950 8508 9224 gene locus_tag LOCUS_12960 8508 9224 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_12960 9261 9716 gene locus_tag LOCUS_12970 9261 9716 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377111.1 protein_id gnl|my_center|LOCUS_12970 9899 9666 gene locus_tag LOCUS_12980 9899 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9911 10894 gene locus_tag LOCUS_12990 9911 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11058 10971 gene locus_tag LOCUS_t00160 11058 10971 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11346 12011 gene locus_tag LOCUS_13000 11346 12011 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_13000 12090 12269 gene locus_tag LOCUS_13010 12090 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 12544 12374 gene locus_tag LOCUS_13020 12544 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 13179 12541 gene locus_tag LOCUS_13030 gene parA 13179 12541 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_13030 15490 13223 gene locus_tag LOCUS_13040 15490 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 16194 16751 gene locus_tag LOCUS_13050 16194 16751 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence060 2962 2042 gene locus_tag LOCUS_13060 gene truB 2962 2042 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 protein_id gnl|my_center|LOCUS_13060 3447 3013 gene locus_tag LOCUS_13070 gene rbfA 3447 3013 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_13070 6020 3480 gene locus_tag LOCUS_13080 gene infB 6020 3480 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_13080 7557 6037 gene locus_tag LOCUS_13090 gene nusA 7557 6037 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_13090 8161 7670 gene locus_tag LOCUS_13100 gene rimP 8161 7670 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_13100 8665 8589 gene locus_tag LOCUS_t00170 8665 8589 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9120 8725 gene locus_tag LOCUS_13110 gene acpS 9120 8725 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_13110 9872 9117 gene locus_tag LOCUS_13120 gene pdxJ 9872 9117 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571773.1 protein_id gnl|my_center|LOCUS_13120 10741 9935 gene locus_tag LOCUS_13130 gene recO 10741 9935 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_13130 11645 10734 gene locus_tag LOCUS_13140 gene era 11645 10734 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_13140 12569 11877 gene locus_tag LOCUS_13150 gene rnc 12569 11877 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_13150 12972 12577 gene locus_tag LOCUS_13160 12972 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 13913 13077 gene locus_tag LOCUS_13170 gene lepB 13913 13077 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_13170 15743 13938 gene locus_tag LOCUS_13180 gene lepA 15743 13938 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_13180 <16507 15888 gene locus_tag LOCUS_13190 <16507 15888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764764.1:DegQ family serine endoprotease >Feature sequence061 2103 1426 gene locus_tag LOCUS_13200 2103 1426 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_13200 2242 3132 gene locus_tag LOCUS_13210 2242 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4113 3193 gene locus_tag LOCUS_13220 gene flgL 4113 3193 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981404.1 protein_id gnl|my_center|LOCUS_13220 5814 4144 gene locus_tag LOCUS_13230 gene flgK 5814 4144 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_13230 6852 5905 gene locus_tag LOCUS_13240 gene flgJ 6852 5905 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_13240 8023 6878 gene locus_tag LOCUS_13250 8023 6878 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_13250 8726 8076 gene locus_tag LOCUS_13260 gene flgH 8726 8076 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_13260 9556 8771 gene locus_tag LOCUS_13270 gene flgG 9556 8771 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_13270 10332 9589 gene locus_tag LOCUS_13280 10332 9589 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_13280 11590 10370 gene locus_tag LOCUS_13290 gene flgE 11590 10370 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_13290 12364 11681 gene locus_tag LOCUS_13300 gene flgD 12364 11681 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_13300 12804 12391 gene locus_tag LOCUS_13310 gene flgC 12804 12391 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_13310 13276 12860 gene locus_tag LOCUS_13320 gene flgB 13276 12860 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_13320 14406 13579 gene locus_tag LOCUS_13330 gene cheR 14406 13579 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_13330 15380 14448 gene locus_tag LOCUS_13340 15380 14448 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420408.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence062 1666 1079 gene locus_tag LOCUS_13350 1666 1079 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_13350 2289 1663 gene locus_tag LOCUS_13360 gene ubiX 2289 1663 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_13360 3730 2360 gene locus_tag LOCUS_13370 gene mpl 3730 2360 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_13370 4248 3730 gene locus_tag LOCUS_13380 4248 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4574 4278 gene locus_tag LOCUS_13390 4574 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4756 4571 gene locus_tag LOCUS_13400 4756 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4908 6065 gene locus_tag LOCUS_13410 gene rnd 4908 6065 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_13410 6139 7305 gene locus_tag LOCUS_13420 6139 7305 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_13420 7773 7381 gene locus_tag LOCUS_13430 gene apaG 7773 7381 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_13430 8715 8191 gene locus_tag LOCUS_13440 8715 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9778 8822 gene locus_tag LOCUS_13450 9778 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11144 9843 gene locus_tag LOCUS_13460 11144 9843 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463563.1 protein_id gnl|my_center|LOCUS_13460 12593 11472 gene locus_tag LOCUS_13470 12593 11472 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_13470 13495 12593 gene locus_tag LOCUS_13480 13495 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 13824 13504 gene locus_tag LOCUS_13490 13824 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 14252 13872 gene locus_tag LOCUS_13500 14252 13872 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943800.1 protein_id gnl|my_center|LOCUS_13500 15406 14414 gene locus_tag LOCUS_13510 15406 14414 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence063 248 1765 gene locus_tag LOCUS_13520 gene lysS 248 1765 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_13520 1812 1994 gene locus_tag LOCUS_13530 1812 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2036 3160 gene locus_tag LOCUS_13540 2036 3160 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_13540 3154 3765 gene locus_tag LOCUS_13550 3154 3765 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_13550 6203 3879 gene locus_tag LOCUS_13560 6203 3879 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_13560 6482 6868 gene locus_tag LOCUS_13570 6482 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6876 7577 gene locus_tag LOCUS_13580 6876 7577 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_13580 7564 8136 gene locus_tag LOCUS_13590 7564 8136 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_13590 8226 8729 gene locus_tag LOCUS_13600 8226 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 9889 12657 gene locus_tag LOCUS_13610 9889 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 14905 13481 gene locus_tag LOCUS_13620 14905 13481 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_13620 15068 15964 gene locus_tag LOCUS_13630 15068 15964 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186089.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence064 <1 848 gene locus_tag LOCUS_13640 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930379.1:3-isopropylmalate dehydratase large subunit 853 1488 gene locus_tag LOCUS_13650 gene leuD 853 1488 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_13650 1603 2673 gene locus_tag LOCUS_13660 gene leuB 1603 2673 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_13660 2796 3908 gene locus_tag LOCUS_13670 gene asd 2796 3908 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263690.1 protein_id gnl|my_center|LOCUS_13670 4238 5272 gene locus_tag LOCUS_13680 4238 5272 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957862.1 protein_id gnl|my_center|LOCUS_13680 5476 5225 gene locus_tag LOCUS_13690 5476 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5409 7952 gene locus_tag LOCUS_13700 gene fimV 5409 7952 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_13700 8060 8812 gene locus_tag LOCUS_13710 8060 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8817 9599 gene locus_tag LOCUS_13720 gene truA 8817 9599 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770596.1 protein_id gnl|my_center|LOCUS_13720 9639 10283 gene locus_tag LOCUS_13730 9639 10283 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_13730 10411 11637 gene locus_tag LOCUS_13740 gene trpB 10411 11637 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_13740 11705 12502 gene locus_tag LOCUS_13750 gene trpA 11705 12502 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_13750 12547 13407 gene locus_tag LOCUS_13760 gene accD 12547 13407 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118593.1 protein_id gnl|my_center|LOCUS_13760 13842 14033 gene locus_tag LOCUS_13770 13842 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence065 2164 266 gene locus_tag LOCUS_13780 2164 266 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_13780 3657 2506 gene locus_tag LOCUS_13790 3657 2506 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_13790 4871 5617 gene locus_tag LOCUS_13800 4871 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5985 7724 gene locus_tag LOCUS_13810 gene asnB 5985 7724 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13810 8869 7901 gene locus_tag LOCUS_13820 8869 7901 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_13820 9658 8906 gene locus_tag LOCUS_13830 9658 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10740 9658 gene locus_tag LOCUS_13840 10740 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12401 11223 gene locus_tag LOCUS_13850 12401 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 14473 12443 gene locus_tag LOCUS_13860 14473 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 <15893 14505 gene locus_tag LOCUS_13870 <15893 14505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942599.1:phenylacetate--CoA ligase family protein >Feature sequence066 227 151 gene locus_tag LOCUS_t00180 227 151 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 417 956 gene locus_tag LOCUS_13880 417 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1040 3031 gene locus_tag LOCUS_13890 gene asnB 1040 3031 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525357.1 protein_id gnl|my_center|LOCUS_13890 3954 3070 gene locus_tag LOCUS_13900 3954 3070 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_13900 4492 4124 gene locus_tag LOCUS_13910 4492 4124 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_13910 4762 5232 gene locus_tag LOCUS_13920 4762 5232 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_13920 5473 6360 gene locus_tag LOCUS_13930 5473 6360 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_13930 8484 6427 gene locus_tag LOCUS_13940 8484 6427 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_13940 9543 8500 gene locus_tag LOCUS_13950 9543 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 9663 10631 gene locus_tag LOCUS_13960 9663 10631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_13960 10631 11383 gene locus_tag LOCUS_13970 10631 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11483 11854 gene locus_tag LOCUS_13980 11483 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11879 13249 gene locus_tag LOCUS_13990 11879 13249 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_13990 13254 14156 gene locus_tag LOCUS_14000 13254 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14159 14974 gene locus_tag LOCUS_14010 gene mutM 14159 14974 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence067 737 282 gene locus_tag LOCUS_14020 737 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923257.1 protein_id gnl|my_center|LOCUS_14020 1212 754 gene locus_tag LOCUS_14030 1212 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1375 1169 gene locus_tag LOCUS_14040 1375 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2118 1423 gene locus_tag LOCUS_14050 2118 1423 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_14050 3013 2177 gene locus_tag LOCUS_14060 3013 2177 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096194.1 protein_id gnl|my_center|LOCUS_14060 3518 3030 gene locus_tag LOCUS_14070 3518 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14070 4863 3505 gene locus_tag LOCUS_14080 4863 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5214 4945 gene locus_tag LOCUS_14090 5214 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7169 5400 gene locus_tag LOCUS_14100 gene sdhA 7169 5400 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_14100 7507 7166 gene locus_tag LOCUS_14110 gene sdhD 7507 7166 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946276.1 protein_id gnl|my_center|LOCUS_14110 7848 7504 gene locus_tag LOCUS_14120 gene sdhC 7848 7504 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_14120 8042 9133 gene locus_tag LOCUS_14130 8042 9133 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_14130 9428 10261 gene locus_tag LOCUS_14140 9428 10261 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_14140 10698 11684 gene locus_tag LOCUS_14150 10698 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11681 15049 gene locus_tag LOCUS_14160 11681 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence068 865 317 gene locus_tag LOCUS_14170 865 317 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_14170 2336 1329 gene locus_tag LOCUS_14180 2336 1329 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_14180 3119 2637 gene locus_tag LOCUS_14190 3119 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3283 3095 gene locus_tag LOCUS_14200 3283 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3460 3284 gene locus_tag LOCUS_14210 3460 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4976 3660 gene locus_tag LOCUS_14220 4976 3660 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_14220 5455 6378 gene locus_tag LOCUS_14230 5455 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6410 6640 gene locus_tag LOCUS_14240 6410 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6681 7388 gene locus_tag LOCUS_14250 6681 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7503 8192 gene locus_tag LOCUS_14260 7503 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 8240 8578 gene locus_tag LOCUS_14270 8240 8578 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_14270 8957 8655 gene locus_tag LOCUS_14280 8957 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9413 12352 gene locus_tag LOCUS_14290 9413 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 12510 13013 gene locus_tag LOCUS_14300 12510 13013 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 protein_id gnl|my_center|LOCUS_14300 12982 13656 gene locus_tag LOCUS_14310 12982 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13826 14326 gene locus_tag LOCUS_14320 13826 14326 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096939.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence069 2177 2025 gene locus_tag LOCUS_14330 2177 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2911 3699 gene locus_tag LOCUS_14340 2911 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3703 4524 gene locus_tag LOCUS_14350 gene cysK 3703 4524 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132521.1 protein_id gnl|my_center|LOCUS_14350 4802 5335 gene locus_tag LOCUS_14360 4802 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6112 6930 gene locus_tag LOCUS_14370 6112 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 7626 8663 gene locus_tag LOCUS_14380 7626 8663 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_14380 9748 9305 gene locus_tag LOCUS_14390 9748 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11906 9897 gene locus_tag LOCUS_14400 gene rep 11906 9897 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773964.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence070 313 403 gene locus_tag LOCUS_t00190 313 403 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 600 938 gene locus_tag LOCUS_14410 600 938 CDS product SaoD/DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258649.1 protein_id gnl|my_center|LOCUS_14410 1265 1047 gene locus_tag LOCUS_14420 1265 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1675 3738 gene locus_tag LOCUS_14430 1675 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3751 5292 gene locus_tag LOCUS_14440 3751 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5855 6304 gene locus_tag LOCUS_14450 5855 6304 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_14450 6307 8010 gene locus_tag LOCUS_14460 6307 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8817 8041 gene locus_tag LOCUS_14470 8817 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9532 9065 gene locus_tag LOCUS_14480 9532 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10863 12239 gene locus_tag LOCUS_14490 10863 12239 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_14490 12267 13094 gene locus_tag LOCUS_14500 12267 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence071 141 893 gene locus_tag LOCUS_14510 141 893 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_14510 2197 1091 gene locus_tag LOCUS_14520 gene hemH 2197 1091 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_14520 2308 2934 gene locus_tag LOCUS_14530 2308 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2996 3454 gene locus_tag LOCUS_14540 2996 3454 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483350.1 protein_id gnl|my_center|LOCUS_14540 3471 4361 gene locus_tag LOCUS_14550 3471 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4848 5045 gene locus_tag LOCUS_14560 4848 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 5488 5129 gene locus_tag LOCUS_14570 5488 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6866 5880 gene locus_tag LOCUS_14580 gene epmA 6866 5880 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_14580 7475 6906 gene locus_tag LOCUS_14590 gene efp 7475 6906 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_14590 7540 8574 gene locus_tag LOCUS_14600 gene epmB 7540 8574 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_14600 8861 10720 gene locus_tag LOCUS_14610 8861 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 10805 12883 gene locus_tag LOCUS_14620 gene fimX 10805 12883 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_14620 14712 12859 gene locus_tag LOCUS_14630 14712 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 14942 14715 gene locus_tag LOCUS_14640 14942 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence072 530 721 gene locus_tag LOCUS_14650 530 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1809 739 gene locus_tag LOCUS_14660 1809 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3089 1809 gene locus_tag LOCUS_14670 gene hemL 3089 1809 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_14670 4620 3367 gene locus_tag LOCUS_14680 4620 3367 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_14680 5287 4742 gene locus_tag LOCUS_14690 5287 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326532.1 protein_id gnl|my_center|LOCUS_14690 5725 5375 gene locus_tag LOCUS_14700 5725 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7238 5718 gene locus_tag LOCUS_14710 7238 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8792 7242 gene locus_tag LOCUS_14720 8792 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 9515 8835 gene locus_tag LOCUS_14730 9515 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10888 9596 gene locus_tag LOCUS_14740 10888 9596 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225119.1 protein_id gnl|my_center|LOCUS_14740 11914 11198 gene locus_tag LOCUS_14750 gene btsR 11914 11198 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388129.1 protein_id gnl|my_center|LOCUS_14750 13638 11911 gene locus_tag LOCUS_14760 13638 11911 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072746.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence073 177 533 gene locus_tag LOCUS_14770 177 533 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_14770 954 697 gene locus_tag LOCUS_14780 954 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2640 1303 gene locus_tag LOCUS_14790 gene rlmD 2640 1303 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_14790 3629 2739 gene locus_tag LOCUS_14800 gene cysM 3629 2739 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_14800 4451 7138 gene locus_tag LOCUS_14810 4451 7138 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268595.1 protein_id gnl|my_center|LOCUS_14810 8061 7174 gene locus_tag LOCUS_14820 gene galU 8061 7174 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_14820 10324 8237 gene locus_tag LOCUS_14830 gene pnp 10324 8237 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_14830 10676 10407 gene locus_tag LOCUS_14840 gene rpsO 10676 10407 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_14840 11887 11399 gene locus_tag LOCUS_14850 gene folK 11887 11399 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_14850 12245 11889 gene locus_tag LOCUS_14860 gene folB 12245 11889 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_14860 12339 12938 gene locus_tag LOCUS_14870 gene plsY 12339 12938 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770791.1 protein_id gnl|my_center|LOCUS_14870 13032 13616 gene locus_tag LOCUS_14880 13032 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14295 13708 gene locus_tag LOCUS_14890 14295 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence074 2520 1942 gene locus_tag LOCUS_14900 2520 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3484 2537 gene locus_tag LOCUS_14910 3484 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4440 3481 gene locus_tag LOCUS_14920 4440 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5140 4835 gene locus_tag LOCUS_14930 5140 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5235 6824 gene locus_tag LOCUS_14940 5235 6824 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_14940 7360 8115 gene locus_tag LOCUS_14950 7360 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 9380 8139 gene locus_tag LOCUS_14960 9380 8139 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_14960 10597 9407 gene locus_tag LOCUS_14970 10597 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 11007 11744 gene locus_tag LOCUS_14980 11007 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 11936 13717 gene locus_tag LOCUS_14990 gene asnB 11936 13717 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14990 13740 14609 gene locus_tag LOCUS_15000 13740 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence075 280 987 gene locus_tag LOCUS_15010 280 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4238 1185 gene locus_tag LOCUS_15020 4238 1185 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_15020 5432 4356 gene locus_tag LOCUS_15030 5432 4356 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_15030 5919 5461 gene locus_tag LOCUS_15040 5919 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7985 6465 gene locus_tag LOCUS_15050 7985 6465 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_15050 9491 8667 gene locus_tag LOCUS_15060 9491 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 11580 9532 gene locus_tag LOCUS_15070 gene prlC 11580 9532 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_15070 11705 12736 gene locus_tag LOCUS_15080 11705 12736 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_15080 12814 14163 gene locus_tag LOCUS_15090 gene gorA 12814 14163 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence076 1618 293 gene locus_tag LOCUS_15100 gene rho 1618 293 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 protein_id gnl|my_center|LOCUS_15100 2252 1926 gene locus_tag LOCUS_15110 gene trxA 2252 1926 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_15110 2425 3726 gene locus_tag LOCUS_15120 gene rhlB 2425 3726 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047500.1 protein_id gnl|my_center|LOCUS_15120 4815 3718 gene locus_tag LOCUS_15130 4815 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6398 4965 gene locus_tag LOCUS_15140 6398 4965 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_15140 9779 6681 gene locus_tag LOCUS_15150 9779 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10478 9834 gene locus_tag LOCUS_15160 10478 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 11588 10551 gene locus_tag LOCUS_15170 11588 10551 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_15170 12499 11741 gene locus_tag LOCUS_15180 12499 11741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_15180 13284 12499 gene locus_tag LOCUS_15190 13284 12499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_15190 14323 13304 gene locus_tag LOCUS_15200 14323 13304 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence077 126 479 gene locus_tag LOCUS_15210 gene rplR 126 479 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993383.1 protein_id gnl|my_center|LOCUS_15210 502 1008 gene locus_tag LOCUS_15220 gene rpsE 502 1008 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_15220 1012 1194 gene locus_tag LOCUS_15230 gene rpmD 1012 1194 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417257.1 protein_id gnl|my_center|LOCUS_15230 1196 1630 gene locus_tag LOCUS_15240 gene rplO 1196 1630 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369426.1 protein_id gnl|my_center|LOCUS_15240 1658 2983 gene locus_tag LOCUS_15250 gene secY 1658 2983 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118855.1 protein_id gnl|my_center|LOCUS_15250 3269 3625 gene locus_tag LOCUS_15260 gene rpsM 3269 3625 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_15260 3720 4103 gene locus_tag LOCUS_15270 gene rpsK 3720 4103 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 protein_id gnl|my_center|LOCUS_15270 4147 4773 gene locus_tag LOCUS_15280 gene rpsD 4147 4773 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_15280 4883 5878 gene locus_tag LOCUS_15290 gene rpoA 4883 5878 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_15290 5959 6378 gene locus_tag LOCUS_15300 gene rplQ 5959 6378 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644470.1 protein_id gnl|my_center|LOCUS_15300 6893 8155 gene locus_tag LOCUS_15310 6893 8155 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_15310 8297 8372 gene locus_tag LOCUS_t00200 8297 8372 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8455 10035 gene locus_tag LOCUS_15320 8455 10035 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_15320 10582 10082 gene locus_tag LOCUS_15330 10582 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11235 10579 gene locus_tag LOCUS_15340 11235 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 11549 12508 gene locus_tag LOCUS_15350 gene exeC 11549 12508 CDS product GspC family type II secretion system variant ExeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704539.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence078 993 1 gene locus_tag LOCUS_15360 993 1 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 protein_id gnl|my_center|LOCUS_15360 1821 1018 gene locus_tag LOCUS_15370 gene pilW 1821 1018 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073190.1 protein_id gnl|my_center|LOCUS_15370 2927 1830 gene locus_tag LOCUS_15380 gene rlmN 2927 1830 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_15380 3417 2986 gene locus_tag LOCUS_15390 gene ndk 3417 2986 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 protein_id gnl|my_center|LOCUS_15390 3603 4877 gene locus_tag LOCUS_15400 3603 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5250 6443 gene locus_tag LOCUS_15410 5250 6443 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_15410 7528 10227 gene locus_tag LOCUS_15420 7528 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10517 11611 gene locus_tag LOCUS_15430 10517 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 12137 13147 gene locus_tag LOCUS_15440 12137 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15440 13157 14080 gene locus_tag LOCUS_15450 13157 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 >Feature sequence079 172 708 gene locus_tag LOCUS_15460 172 708 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_15460 745 1701 gene locus_tag LOCUS_15470 745 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2060 3955 gene locus_tag LOCUS_15480 2060 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5018 4158 gene locus_tag LOCUS_15490 5018 4158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_15490 5947 5015 gene locus_tag LOCUS_15500 5947 5015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_15500 6140 7066 gene locus_tag LOCUS_15510 6140 7066 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973309.1 protein_id gnl|my_center|LOCUS_15510 7066 7503 gene locus_tag LOCUS_15520 7066 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 8652 7975 gene locus_tag LOCUS_15530 8652 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 10253 8799 gene locus_tag LOCUS_15540 10253 8799 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_15540 10589 10795 gene locus_tag LOCUS_15550 10589 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11133 10834 gene locus_tag LOCUS_15560 11133 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11356 11126 gene locus_tag LOCUS_15570 11356 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12733 11861 gene locus_tag LOCUS_15580 gene panC 12733 11861 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209348.1 protein_id gnl|my_center|LOCUS_15580 13552 12758 gene locus_tag LOCUS_15590 gene panB 13552 12758 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_15590 <14236 13587 gene locus_tag LOCUS_15600 <14236 13587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532195.1:deoxynucleoside kinase >Feature sequence080 <1 1113 gene locus_tag LOCUS_15610 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038877.1:AAA family ATPase 1875 1459 gene locus_tag LOCUS_15620 1875 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2499 2137 gene locus_tag LOCUS_tm00010 2499 2137 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2710 2970 gene locus_tag LOCUS_15630 2710 2970 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_15630 2970 3245 gene locus_tag LOCUS_15640 2970 3245 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_15640 3906 3433 gene locus_tag LOCUS_15650 gene smpB 3906 3433 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_15650 4033 5397 gene locus_tag LOCUS_15660 4033 5397 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_15660 5400 5834 gene locus_tag LOCUS_15670 5400 5834 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_15670 5824 6225 gene locus_tag LOCUS_15680 5824 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6644 6219 gene locus_tag LOCUS_15690 6644 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6873 6658 gene locus_tag LOCUS_15700 6873 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6758 7189 gene locus_tag LOCUS_15710 gene fur 6758 7189 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_15710 9171 7474 gene locus_tag LOCUS_15720 gene recN 9171 7474 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073309.1 protein_id gnl|my_center|LOCUS_15720 10096 9206 gene locus_tag LOCUS_15730 10096 9206 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_15730 10332 11402 gene locus_tag LOCUS_15740 gene hrcA 10332 11402 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_15740 11497 12129 gene locus_tag LOCUS_15750 gene grpE 11497 12129 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence081 2243 3175 gene locus_tag LOCUS_15760 2243 3175 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_15760 3266 5254 gene locus_tag LOCUS_15770 3266 5254 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_15770 5558 6391 gene locus_tag LOCUS_15780 5558 6391 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 protein_id gnl|my_center|LOCUS_15780 8425 6368 gene locus_tag LOCUS_15790 8425 6368 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_15790 8717 9916 gene locus_tag LOCUS_15800 8717 9916 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_15800 10601 10200 gene locus_tag LOCUS_15810 10601 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 10795 10598 gene locus_tag LOCUS_15820 10795 10598 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_15820 11061 11396 gene locus_tag LOCUS_15830 11061 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 11407 11688 gene locus_tag LOCUS_15840 11407 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 11685 12164 gene locus_tag LOCUS_15850 11685 12164 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107679.1 protein_id gnl|my_center|LOCUS_15850 <14070 12371 gene locus_tag LOCUS_15860 <14070 12371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104650.1:AAA family ATPase >Feature sequence082 923 1888 gene locus_tag LOCUS_15870 923 1888 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_15870 2943 1948 gene locus_tag LOCUS_15880 2943 1948 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_15880 3043 3927 gene locus_tag LOCUS_15890 3043 3927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_15890 4507 4887 gene locus_tag LOCUS_15900 4507 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4862 5416 gene locus_tag LOCUS_15910 4862 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5858 5782 gene locus_tag LOCUS_t00210 5858 5782 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6081 5994 gene locus_tag LOCUS_t00220 6081 5994 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6553 6365 gene locus_tag LOCUS_15920 gene csrA 6553 6365 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305164.1 protein_id gnl|my_center|LOCUS_15920 7950 6706 gene locus_tag LOCUS_15930 7950 6706 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_15930 10731 8104 gene locus_tag LOCUS_15940 gene alaS 10731 8104 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_15940 11311 10802 gene locus_tag LOCUS_15950 gene recX 11311 10802 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006855.1 protein_id gnl|my_center|LOCUS_15950 12378 11317 gene locus_tag LOCUS_15960 gene recA 12378 11317 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_15960 12586 13467 gene locus_tag LOCUS_15970 12586 13467 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence083 2468 2653 gene locus_tag LOCUS_15980 2468 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3249 2776 gene locus_tag LOCUS_15990 3249 2776 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_15990 3874 4785 gene locus_tag LOCUS_16000 3874 4785 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_16000 6178 4850 gene locus_tag LOCUS_16010 6178 4850 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531931.1 protein_id gnl|my_center|LOCUS_16010 7318 6212 gene locus_tag LOCUS_16020 gene queG 7318 6212 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_16020 7385 7570 gene locus_tag LOCUS_16030 7385 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7558 7812 gene locus_tag LOCUS_16040 7558 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7879 9381 gene locus_tag LOCUS_16050 7879 9381 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_16050 9670 9996 gene locus_tag LOCUS_16060 9670 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10029 10523 gene locus_tag LOCUS_16070 gene tsaE 10029 10523 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_16070 10801 12033 gene locus_tag LOCUS_16080 gene amiB 10801 12033 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_16080 12419 12955 gene locus_tag LOCUS_16090 12419 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390357.1 protein_id gnl|my_center|LOCUS_16090 12960 13238 gene locus_tag LOCUS_16100 12960 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390358.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence084 557 147 gene locus_tag LOCUS_16110 557 147 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_16110 2746 575 gene locus_tag LOCUS_16120 gene spoT 2746 575 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_16120 3169 2882 gene locus_tag LOCUS_16130 3169 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3987 3352 gene locus_tag LOCUS_16140 gene gmk 3987 3352 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515790.1 protein_id gnl|my_center|LOCUS_16140 4943 4062 gene locus_tag LOCUS_16150 4943 4062 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_16150 5063 5992 gene locus_tag LOCUS_16160 5063 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6008 6847 gene locus_tag LOCUS_16170 6008 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7891 7217 gene locus_tag LOCUS_16180 gene radC 7891 7217 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_16180 8031 9230 gene locus_tag LOCUS_16190 gene coaBC 8031 9230 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16190 11185 9506 gene locus_tag LOCUS_16200 gene ubiB 11185 9506 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_16200 11832 11182 gene locus_tag LOCUS_16210 11832 11182 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015961899.1 protein_id gnl|my_center|LOCUS_16210 12308 11829 gene locus_tag LOCUS_16220 12308 11829 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_16220 13075 12305 gene locus_tag LOCUS_16230 gene ubiE 13075 12305 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence085 919 626 gene locus_tag LOCUS_16240 919 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2563 1133 gene locus_tag LOCUS_16250 gene ntrC 2563 1133 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_16250 3693 2560 gene locus_tag LOCUS_16260 gene glnL 3693 2560 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103111.1 protein_id gnl|my_center|LOCUS_16260 4465 3932 gene locus_tag LOCUS_16270 4465 3932 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_16270 4741 4514 gene locus_tag LOCUS_16280 4741 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16280 7157 4713 gene locus_tag LOCUS_16290 7157 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 7756 7157 gene locus_tag LOCUS_16300 7756 7157 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376468.1 protein_id gnl|my_center|LOCUS_16300 8300 8022 gene locus_tag LOCUS_16310 8300 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 9373 9780 gene locus_tag LOCUS_16320 9373 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 10475 9888 gene locus_tag LOCUS_16330 10475 9888 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_16330 10950 10495 gene locus_tag LOCUS_16340 10950 10495 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_16340 11820 13085 gene locus_tag LOCUS_16350 11820 13085 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773754.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence086 33 1718 gene locus_tag LOCUS_16360 33 1718 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212784779.1 protein_id gnl|my_center|LOCUS_16360 1894 3369 gene locus_tag LOCUS_16370 gene glcD 1894 3369 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026104.1 protein_id gnl|my_center|LOCUS_16370 3635 3979 gene locus_tag LOCUS_16380 3635 3979 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_16380 3984 4196 gene locus_tag LOCUS_16390 3984 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4579 5724 gene locus_tag LOCUS_16400 gene glcE 4579 5724 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943059.1 protein_id gnl|my_center|LOCUS_16400 5725 6969 gene locus_tag LOCUS_16410 gene glcF 5725 6969 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_16410 7073 8263 gene locus_tag LOCUS_16420 7073 8263 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_16420 9606 11921 gene locus_tag LOCUS_16430 9606 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11975 13117 gene locus_tag LOCUS_16440 11975 13117 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence087 943 17 gene locus_tag LOCUS_16450 943 17 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_16450 1540 968 gene locus_tag LOCUS_16460 1540 968 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_16460 3394 2675 gene locus_tag LOCUS_16470 3394 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3999 3394 gene locus_tag LOCUS_16480 gene lexA 3999 3394 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_16480 4393 5133 gene locus_tag LOCUS_16490 4393 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5300 5656 gene locus_tag LOCUS_16500 5300 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5656 6408 gene locus_tag LOCUS_16510 5656 6408 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_16510 7363 6665 gene locus_tag LOCUS_16520 7363 6665 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141595.1 protein_id gnl|my_center|LOCUS_16520 8658 7348 gene locus_tag LOCUS_16530 gene eno 8658 7348 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095220.1 protein_id gnl|my_center|LOCUS_16530 9296 8655 gene locus_tag LOCUS_16540 9296 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9780 10034 gene locus_tag LOCUS_16550 9780 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10414 10683 gene locus_tag LOCUS_16560 10414 10683 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179600.1 protein_id gnl|my_center|LOCUS_16560 10680 11225 gene locus_tag LOCUS_16570 10680 11225 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_16570 11797 11390 gene locus_tag LOCUS_16580 11797 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 <13158 11799 gene locus_tag LOCUS_16590 <13158 11799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941469.1:phosphoenolpyruvate synthase >Feature sequence088 2284 1433 gene locus_tag LOCUS_16600 2284 1433 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_16600 2982 2314 gene locus_tag LOCUS_16610 gene ispD 2982 2314 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061951.1 protein_id gnl|my_center|LOCUS_16610 3338 3069 gene locus_tag LOCUS_16620 gene ftsB 3338 3069 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_16620 4639 3356 gene locus_tag LOCUS_16630 gene eno 4639 3356 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_16630 5873 5034 gene locus_tag LOCUS_16640 gene kdsA 5873 5034 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_16640 7502 5877 gene locus_tag LOCUS_16650 7502 5877 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_16650 8131 7631 gene locus_tag LOCUS_16660 8131 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8253 11558 gene locus_tag LOCUS_16670 8253 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11677 12873 gene locus_tag LOCUS_16680 11677 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence089 <1 1079 gene locus_tag LOCUS_16690 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705104.1:lipid-A-disaccharide synthase 1086 1697 gene locus_tag LOCUS_16700 gene rnhB 1086 1697 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_16700 1797 2546 gene locus_tag LOCUS_16710 1797 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2849 6304 gene locus_tag LOCUS_16720 gene dnaE 2849 6304 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_16720 6395 7354 gene locus_tag LOCUS_16730 gene accA 6395 7354 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_16730 10385 7923 gene locus_tag LOCUS_16740 gene ppsA 10385 7923 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_16740 12682 10865 gene locus_tag LOCUS_16750 12682 10865 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence090 1259 726 gene locus_tag LOCUS_16760 1259 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1360 1611 gene locus_tag LOCUS_16770 1360 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2109 1918 gene locus_tag LOCUS_16780 2109 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2633 2106 gene locus_tag LOCUS_16790 2633 2106 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_16790 2921 2646 gene locus_tag LOCUS_16800 2921 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3710 2934 gene locus_tag LOCUS_16810 gene kdsB 3710 2934 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816038.1 protein_id gnl|my_center|LOCUS_16810 3889 3707 gene locus_tag LOCUS_16820 3889 3707 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_16820 4918 3947 gene locus_tag LOCUS_16830 gene lpxK 4918 3947 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957852.1 protein_id gnl|my_center|LOCUS_16830 6770 5037 gene locus_tag LOCUS_16840 gene msbA 6770 5037 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_16840 7233 6811 gene locus_tag LOCUS_16850 7233 6811 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_16850 7898 7251 gene locus_tag LOCUS_16860 7898 7251 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_16860 10436 8055 gene locus_tag LOCUS_16870 10436 8055 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_16870 10561 11115 gene locus_tag LOCUS_16880 10561 11115 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_16880 11322 12287 gene locus_tag LOCUS_16890 11322 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 12287 12673 gene locus_tag LOCUS_16900 12287 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence091 458 712 gene locus_tag LOCUS_16910 458 712 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 protein_id gnl|my_center|LOCUS_16910 827 3697 gene locus_tag LOCUS_16920 827 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3694 3933 gene locus_tag LOCUS_16930 3694 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4586 5806 gene locus_tag LOCUS_16940 4586 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5806 6450 gene locus_tag LOCUS_16950 5806 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6640 6840 gene locus_tag LOCUS_16960 6640 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 6879 7442 gene locus_tag LOCUS_16970 6879 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 7439 8317 gene locus_tag LOCUS_16980 7439 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 8343 9290 gene locus_tag LOCUS_16990 8343 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 9292 10551 gene locus_tag LOCUS_17000 9292 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 10544 11386 gene locus_tag LOCUS_17010 10544 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence092 428 1822 gene locus_tag LOCUS_17020 428 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2160 3950 gene locus_tag LOCUS_17030 2160 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3941 4783 gene locus_tag LOCUS_17040 3941 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4797 5696 gene locus_tag LOCUS_17050 4797 5696 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_17050 7248 5725 gene locus_tag LOCUS_17060 7248 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 7855 7250 gene locus_tag LOCUS_17070 7855 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 8877 7930 gene locus_tag LOCUS_17080 8877 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 9237 9560 gene locus_tag LOCUS_17090 9237 9560 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947640.1 protein_id gnl|my_center|LOCUS_17090 9564 12566 gene locus_tag LOCUS_17100 9564 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence093 948 394 gene locus_tag LOCUS_17110 gene def 948 394 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_17110 1479 955 gene locus_tag LOCUS_17120 1479 955 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_17120 2304 1522 gene locus_tag LOCUS_17130 2304 1522 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_17130 3273 7115 gene locus_tag LOCUS_17140 3273 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7204 7821 gene locus_tag LOCUS_17150 7204 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7886 9118 gene locus_tag LOCUS_17160 7886 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 9669 11384 gene locus_tag LOCUS_17170 9669 11384 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051300116.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence094 <1 619 gene locus_tag LOCUS_17180 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948371.1:pitrilysin family protein 609 1988 gene locus_tag LOCUS_17190 609 1988 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_17190 1997 2425 gene locus_tag LOCUS_17200 1997 2425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_17200 2752 3207 gene locus_tag LOCUS_17210 gene dut 2752 3207 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_17210 3971 3273 gene locus_tag LOCUS_17220 3971 3273 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_17220 6124 4013 gene locus_tag LOCUS_17230 6124 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 6943 6173 gene locus_tag LOCUS_17240 6943 6173 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084305.1 protein_id gnl|my_center|LOCUS_17240 7133 8080 gene locus_tag LOCUS_17250 7133 8080 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_17250 8595 8431 gene locus_tag LOCUS_17260 8595 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8594 9979 gene locus_tag LOCUS_17270 8594 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 10634 10098 gene locus_tag LOCUS_17280 10634 10098 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 protein_id gnl|my_center|LOCUS_17280 11480 10881 gene locus_tag LOCUS_17290 11480 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 12166 11762 gene locus_tag LOCUS_17300 12166 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence095 1130 384 gene locus_tag LOCUS_17310 1130 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3862 1388 gene locus_tag LOCUS_17320 3862 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4699 6618 gene locus_tag LOCUS_17330 4699 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6615 7772 gene locus_tag LOCUS_17340 6615 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 7773 10178 gene locus_tag LOCUS_17350 7773 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 10773 12008 gene locus_tag LOCUS_17360 10773 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence096 760 494 gene locus_tag LOCUS_17370 760 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3624 802 gene locus_tag LOCUS_17380 3624 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5470 4973 gene locus_tag LOCUS_17390 5470 4973 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171857.1 protein_id gnl|my_center|LOCUS_17390 6075 6749 gene locus_tag LOCUS_17400 6075 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8998 6812 gene locus_tag LOCUS_17410 8998 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <11957 10202 gene locus_tag LOCUS_17420 <11957 10202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063172153.1:autotransporter domain-containing protein >Feature sequence097 376 1137 gene locus_tag LOCUS_17430 376 1137 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_17430 1728 1910 gene locus_tag LOCUS_17440 1728 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2565 3455 gene locus_tag LOCUS_17450 2565 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3452 5224 gene locus_tag LOCUS_17460 3452 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5262 6197 gene locus_tag LOCUS_17470 5262 6197 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_17470 7739 6330 gene locus_tag LOCUS_17480 7739 6330 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_17480 9459 8506 gene locus_tag LOCUS_17490 9459 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 9711 10646 gene locus_tag LOCUS_17500 gene lgt 9711 10646 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_17500 10722 11516 gene locus_tag LOCUS_17510 10722 11516 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence098 1601 237 gene locus_tag LOCUS_17520 1601 237 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_17520 1877 1680 gene locus_tag LOCUS_17530 1877 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1955 3106 gene locus_tag LOCUS_17540 1955 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3367 4386 gene locus_tag LOCUS_17550 gene hemB 3367 4386 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_17550 6493 4640 gene locus_tag LOCUS_17560 6493 4640 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_17560 7599 6712 gene locus_tag LOCUS_17570 7599 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7952 7668 gene locus_tag LOCUS_17580 7952 7668 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_17580 9163 8066 gene locus_tag LOCUS_17590 9163 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 9590 9156 gene locus_tag LOCUS_17600 gene tatB 9590 9156 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_17600 10040 9801 gene locus_tag LOCUS_17610 gene tatA 10040 9801 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704119.1 protein_id gnl|my_center|LOCUS_17610 10446 10108 gene locus_tag LOCUS_17620 10446 10108 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_17620 10765 10439 gene locus_tag LOCUS_17630 10765 10439 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_17630 11153 10758 gene locus_tag LOCUS_17640 gene hisI 11153 10758 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence099 958 56 gene locus_tag LOCUS_17650 gene prmC 958 56 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_17650 2033 948 gene locus_tag LOCUS_17660 gene prfA 2033 948 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_17660 3392 2112 gene locus_tag LOCUS_17670 gene hemA 3392 2112 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_17670 3611 5335 gene locus_tag LOCUS_17680 gene lbcA 3611 5335 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_17680 5332 5976 gene locus_tag LOCUS_17690 gene lolB 5332 5976 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_17690 5980 6909 gene locus_tag LOCUS_17700 gene ispE 5980 6909 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_17700 6919 6993 gene locus_tag LOCUS_t00230 6919 6993 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7065 8018 gene locus_tag LOCUS_17710 7065 8018 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_17710 8224 8874 gene locus_tag LOCUS_17720 8224 8874 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_17720 8914 9495 gene locus_tag LOCUS_17730 gene pth 8914 9495 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_17730 9878 10969 gene locus_tag LOCUS_17740 gene ychF 9878 10969 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_17740 11231 11307 gene locus_tag LOCUS_t00240 11231 11307 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 <1 1290 gene locus_tag LOCUS_17750 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965821.1:bifunctional protein-serine/threonine kinase/phosphatase 1880 2722 gene locus_tag LOCUS_17760 1880 2722 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_17760 3436 2753 gene locus_tag LOCUS_17770 3436 2753 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_17770 3636 4076 gene locus_tag LOCUS_17780 3636 4076 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_17780 5624 4188 gene locus_tag LOCUS_17790 gene hemN 5624 4188 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_17790 6639 5713 gene locus_tag LOCUS_17800 gene prmB 6639 5713 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 protein_id gnl|my_center|LOCUS_17800 6742 7161 gene locus_tag LOCUS_17810 6742 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7641 9320 gene locus_tag LOCUS_17820 gene ettA 7641 9320 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_17820 11009 9612 gene locus_tag LOCUS_17830 11009 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 <11595 11006 gene locus_tag LOCUS_17840 <11595 11006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527354.1:response regulator transcription factor >Feature sequence101 471 3551 gene locus_tag LOCUS_17850 471 3551 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_17850 3900 4955 gene locus_tag LOCUS_17860 gene argC 3900 4955 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_17860 5247 5065 gene locus_tag LOCUS_17870 5247 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5968 7920 gene locus_tag LOCUS_17880 5968 7920 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932437.1 protein_id gnl|my_center|LOCUS_17880 8233 8898 gene locus_tag LOCUS_17890 8233 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8914 10122 gene locus_tag LOCUS_17900 8914 10122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_17900 10119 11135 gene locus_tag LOCUS_17910 10119 11135 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence102 1477 626 gene locus_tag LOCUS_17920 gene metF 1477 626 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_17920 1950 1534 gene locus_tag LOCUS_17930 1950 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2320 1940 gene locus_tag LOCUS_17940 2320 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3962 2541 gene locus_tag LOCUS_17950 gene ahcY 3962 2541 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_17950 5280 4120 gene locus_tag LOCUS_17960 gene metK 5280 4120 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_17960 6837 5365 gene locus_tag LOCUS_17970 6837 5365 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_17970 8061 6922 gene locus_tag LOCUS_17980 8061 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8756 8460 gene locus_tag LOCUS_17990 8756 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9567 8857 gene locus_tag LOCUS_18000 gene pyrF 9567 8857 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 protein_id gnl|my_center|LOCUS_18000 10804 9629 gene locus_tag LOCUS_18010 gene lapB 10804 9629 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_18010 11124 10831 gene locus_tag LOCUS_18020 11124 10831 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947151.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence103 1190 978 gene locus_tag LOCUS_18030 1190 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2026 1217 gene locus_tag LOCUS_18040 2026 1217 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045946.1 protein_id gnl|my_center|LOCUS_18040 2362 3630 gene locus_tag LOCUS_18050 2362 3630 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705016.1 protein_id gnl|my_center|LOCUS_18050 4180 3881 gene locus_tag LOCUS_18060 4180 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4453 5079 gene locus_tag LOCUS_18070 4453 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5221 6285 gene locus_tag LOCUS_18080 5221 6285 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_18080 6287 9118 gene locus_tag LOCUS_18090 6287 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 9180 9106 gene locus_tag LOCUS_t00250 9180 9106 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9264 10580 gene locus_tag LOCUS_18100 9264 10580 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_18100 10589 11101 gene locus_tag LOCUS_18110 gene folK 10589 11101 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence104 2892 2287 gene locus_tag LOCUS_18120 2892 2287 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_18120 4224 2923 gene locus_tag LOCUS_18130 4224 2923 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_18130 5354 4242 gene locus_tag LOCUS_18140 5354 4242 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_18140 6305 7675 gene locus_tag LOCUS_18150 6305 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_18150 7675 8130 gene locus_tag LOCUS_18160 7675 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 8130 10016 gene locus_tag LOCUS_18170 8130 10016 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198666.1 protein_id gnl|my_center|LOCUS_18170 10013 10987 gene locus_tag LOCUS_18180 10013 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence105 2147 576 gene locus_tag LOCUS_18190 2147 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3244 2156 gene locus_tag LOCUS_18200 gene alg44 3244 2156 CDS product alginate biosynthesis protein Alg44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092101.1 protein_id gnl|my_center|LOCUS_18200 4861 3326 gene locus_tag LOCUS_18210 gene alg8 4861 3326 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119545.1 protein_id gnl|my_center|LOCUS_18210 5922 4909 gene locus_tag LOCUS_18220 5922 4909 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029034.1 protein_id gnl|my_center|LOCUS_18220 7379 6060 gene locus_tag LOCUS_18230 gene algD 7379 6060 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_18230 8872 8312 gene locus_tag LOCUS_18240 8872 8312 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_18240 9187 8945 gene locus_tag LOCUS_18250 9187 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9419 9781 gene locus_tag LOCUS_18260 gene arsC 9419 9781 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103671.1 protein_id gnl|my_center|LOCUS_18260 9778 10368 gene locus_tag LOCUS_18270 gene wrbA 9778 10368 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence106 2000 348 gene locus_tag LOCUS_18280 gene groL 2000 348 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_18280 2359 2069 gene locus_tag LOCUS_18290 gene groES 2359 2069 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_18290 3128 2850 gene locus_tag LOCUS_18300 3128 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4102 3155 gene locus_tag LOCUS_18310 4102 3155 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_18310 4266 4619 gene locus_tag LOCUS_18320 4266 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5831 4821 gene locus_tag LOCUS_18330 gene gpsA 5831 4821 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_18330 6400 5903 gene locus_tag LOCUS_18340 gene secB 6400 5903 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 protein_id gnl|my_center|LOCUS_18340 6852 6457 gene locus_tag LOCUS_18350 gene trxC 6852 6457 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_18350 7230 6946 gene locus_tag LOCUS_18360 7230 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8027 7227 gene locus_tag LOCUS_18370 8027 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 8590 8279 gene locus_tag LOCUS_18380 8590 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9030 10607 gene locus_tag LOCUS_18390 gene gpmI 9030 10607 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence107 <1 908 gene locus_tag LOCUS_18400 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929622.1:D-amino acid aminotransferase 910 1185 gene locus_tag LOCUS_18410 910 1185 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_18410 1182 1817 gene locus_tag LOCUS_18420 gene lipB 1182 1817 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_18420 5173 2051 gene locus_tag LOCUS_18430 5173 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 5635 5288 gene locus_tag LOCUS_18440 5635 5288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_18440 5883 6842 gene locus_tag LOCUS_18450 gene lipA 5883 6842 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_18450 7043 8260 gene locus_tag LOCUS_18460 gene sat 7043 8260 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_18460 9270 8311 gene locus_tag LOCUS_18470 9270 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 9637 10521 gene locus_tag LOCUS_18480 9637 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence108 141 926 gene locus_tag LOCUS_18490 141 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1513 1088 gene locus_tag LOCUS_18500 1513 1088 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_18500 3298 1547 gene locus_tag LOCUS_18510 3298 1547 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_18510 4900 3545 gene locus_tag LOCUS_18520 gene argA 4900 3545 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_18520 5539 6336 gene locus_tag LOCUS_18530 gene djlA 5539 6336 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_18530 6336 7310 gene locus_tag LOCUS_18540 6336 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8164 7325 gene locus_tag LOCUS_18550 8164 7325 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667176.1 protein_id gnl|my_center|LOCUS_18550 8350 9042 gene locus_tag LOCUS_18560 gene rpe 8350 9042 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_18560 9128 9793 gene locus_tag LOCUS_18570 9128 9793 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence109 3847 2738 gene locus_tag LOCUS_18580 3847 2738 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_18580 4925 3855 gene locus_tag LOCUS_18590 4925 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5439 4909 gene locus_tag LOCUS_18600 5439 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7234 5621 gene locus_tag LOCUS_18610 7234 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 8098 7436 gene locus_tag LOCUS_18620 8098 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8528 8121 gene locus_tag LOCUS_18630 8528 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 10475 8619 gene locus_tag LOCUS_18640 10475 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence110 2121 1840 gene locus_tag LOCUS_18650 2121 1840 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101349.1 protein_id gnl|my_center|LOCUS_18650 3256 2300 gene locus_tag LOCUS_18660 3256 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3749 3399 gene locus_tag LOCUS_18670 3749 3399 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666507.1 protein_id gnl|my_center|LOCUS_18670 4425 3736 gene locus_tag LOCUS_18680 4425 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 5517 4435 gene locus_tag LOCUS_18690 5517 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6351 6881 gene locus_tag LOCUS_18700 gene moaB 6351 6881 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_18700 6885 7511 gene locus_tag LOCUS_18710 6885 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8030 9448 gene locus_tag LOCUS_18720 8030 9448 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105540.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence111 106 1170 gene locus_tag LOCUS_18730 gene ald 106 1170 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_18730 1268 3517 gene locus_tag LOCUS_18740 gene ftsK 1268 3517 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_18740 4317 3604 gene locus_tag LOCUS_18750 4317 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4370 4645 gene locus_tag LOCUS_18760 4370 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4698 5372 gene locus_tag LOCUS_18770 gene lolA 4698 5372 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_18770 5425 6762 gene locus_tag LOCUS_18780 5425 6762 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_18780 6797 7168 gene locus_tag LOCUS_18790 gene crcB 6797 7168 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_18790 7165 7500 gene locus_tag LOCUS_18800 7165 7500 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_18800 7534 8811 gene locus_tag LOCUS_18810 gene serS 7534 8811 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_18810 8860 10251 gene locus_tag LOCUS_18820 gene cysG 8860 10251 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence112 2276 1494 gene locus_tag LOCUS_18830 2276 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3306 2329 gene locus_tag LOCUS_18840 3306 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3992 4717 gene locus_tag LOCUS_18850 3992 4717 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_18850 4920 5561 gene locus_tag LOCUS_18860 4920 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5568 6107 gene locus_tag LOCUS_18870 5568 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 6104 6607 gene locus_tag LOCUS_18880 6104 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 6614 7066 gene locus_tag LOCUS_18890 6614 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 7700 7957 gene locus_tag LOCUS_18900 7700 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 8145 9551 gene locus_tag LOCUS_18910 8145 9551 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_18910 9578 10528 gene locus_tag LOCUS_18920 9578 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence113 <1 1098 gene locus_tag LOCUS_18930 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022265.1:APC family permease 1117 3636 gene locus_tag LOCUS_18940 1117 3636 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_18940 4225 3959 gene locus_tag LOCUS_18950 4225 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5221 4235 gene locus_tag LOCUS_18960 5221 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6371 5205 gene locus_tag LOCUS_18970 6371 5205 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403536.1 protein_id gnl|my_center|LOCUS_18970 8534 7167 gene locus_tag LOCUS_18980 gene purB 8534 7167 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_18980 8746 10032 gene locus_tag LOCUS_18990 8746 10032 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095247.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence114 1273 158 gene locus_tag LOCUS_19000 1273 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_19000 2142 1363 gene locus_tag LOCUS_19010 2142 1363 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_19010 4430 2142 gene locus_tag LOCUS_19020 4430 2142 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_19020 5754 4438 gene locus_tag LOCUS_19030 5754 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 <10409 5774 gene locus_tag LOCUS_19040 <10409 5774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966627.1:type I polyketide synthase >Feature sequence115 1395 280 gene locus_tag LOCUS_19050 gene urtC 1395 280 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972306.1 protein_id gnl|my_center|LOCUS_19050 2973 1399 gene locus_tag LOCUS_19060 gene urtB 2973 1399 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 protein_id gnl|my_center|LOCUS_19060 4654 3359 gene locus_tag LOCUS_19070 gene urtA 4654 3359 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 protein_id gnl|my_center|LOCUS_19070 5809 4679 gene locus_tag LOCUS_19080 5809 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 7237 7542 gene locus_tag LOCUS_19090 7237 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence116 6085 4943 gene locus_tag LOCUS_19100 gene fabD 6085 4943 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204520.1 protein_id gnl|my_center|LOCUS_19100 6891 6142 gene locus_tag LOCUS_19110 6891 6142 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231800.1 protein_id gnl|my_center|LOCUS_19110 7715 6945 gene locus_tag LOCUS_19120 7715 6945 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 protein_id gnl|my_center|LOCUS_19120 8971 7712 gene locus_tag LOCUS_19130 gene pksG 8971 7712 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 protein_id gnl|my_center|LOCUS_19130 <10266 9056 gene locus_tag LOCUS_19140 <10266 9056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245287.1:polyketide biosynthesis malonyl-ACP decarboxylase PksF >Feature sequence117 2371 602 gene locus_tag LOCUS_19150 gene ilvG 2371 602 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703962.1 protein_id gnl|my_center|LOCUS_19150 3289 4428 gene locus_tag LOCUS_19160 3289 4428 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_19160 5138 5605 gene locus_tag LOCUS_19170 5138 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8025 5980 gene locus_tag LOCUS_19180 gene recG 8025 5980 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_19180 8516 8199 gene locus_tag LOCUS_19190 8516 8199 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_19190 9349 8588 gene locus_tag LOCUS_19200 9349 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_19200 9644 10039 gene locus_tag LOCUS_19210 9644 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence118 1361 102 gene locus_tag LOCUS_19220 gene ccmI 1361 102 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_19220 1888 1358 gene locus_tag LOCUS_19230 1888 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2457 1885 gene locus_tag LOCUS_19240 2457 1885 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_19240 4507 2462 gene locus_tag LOCUS_19250 4507 2462 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_19250 5030 4572 gene locus_tag LOCUS_19260 gene ccmE 5030 4572 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_19260 5276 5106 gene locus_tag LOCUS_19270 5276 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6052 5273 gene locus_tag LOCUS_19280 gene ccmC 6052 5273 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_19280 6833 6150 gene locus_tag LOCUS_19290 gene ccmB 6833 6150 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_19290 7483 6857 gene locus_tag LOCUS_19300 gene ccmA 7483 6857 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_19300 <10214 7767 gene locus_tag LOCUS_19310 <10214 7767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102756879.1:BspA family leucine-rich repeat surface protein >Feature sequence119 1682 180 gene locus_tag LOCUS_19320 1682 180 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_19320 2444 1728 gene locus_tag LOCUS_19330 2444 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2942 2610 gene locus_tag LOCUS_19340 2942 2610 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_19340 3302 2994 gene locus_tag LOCUS_19350 gene tusB 3302 2994 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_19350 3722 3315 gene locus_tag LOCUS_19360 gene tusC 3722 3315 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405065.1 protein_id gnl|my_center|LOCUS_19360 4141 3749 gene locus_tag LOCUS_19370 gene tusD 4141 3749 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_19370 5234 4161 gene locus_tag LOCUS_19380 gene dsrB 5234 4161 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_19380 6599 5286 gene locus_tag LOCUS_19390 gene dsrA 6599 5286 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_19390 7211 8140 gene locus_tag LOCUS_19400 gene ribF 7211 8140 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_19400 8589 8158 gene locus_tag LOCUS_19410 8589 8158 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence120 574 6882 gene locus_tag LOCUS_19420 574 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 7933 7010 gene locus_tag LOCUS_19430 7933 7010 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142189.1 protein_id gnl|my_center|LOCUS_19430 9453 7969 gene locus_tag LOCUS_19440 9453 7969 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence121 1294 1653 gene locus_tag LOCUS_19450 1294 1653 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_19450 1650 2957 gene locus_tag LOCUS_19460 1650 2957 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_19460 3133 6234 gene locus_tag LOCUS_19470 3133 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6861 7187 gene locus_tag LOCUS_19480 6861 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7437 8780 gene locus_tag LOCUS_19490 7437 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 9408 8863 gene locus_tag LOCUS_19500 9408 8863 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_19500 <10132 9437 gene locus_tag LOCUS_19510 <10132 9437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918160.1:DNA recombination protein RmuC >Feature sequence122 1700 1371 gene locus_tag LOCUS_19520 1700 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1991 3451 gene locus_tag LOCUS_19530 gene guaB 1991 3451 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_19530 3515 5128 gene locus_tag LOCUS_19540 gene guaA 3515 5128 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_19540 5644 5231 gene locus_tag LOCUS_19550 5644 5231 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_19550 5883 5641 gene locus_tag LOCUS_19560 5883 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6190 7383 gene locus_tag LOCUS_19570 6190 7383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_19570 7380 8546 gene locus_tag LOCUS_19580 7380 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_19580 8543 8851 gene locus_tag LOCUS_19590 8543 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9040 9558 gene locus_tag LOCUS_19600 gene tadA 9040 9558 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 protein_id gnl|my_center|LOCUS_19600 9606 9696 gene locus_tag LOCUS_t00260 9606 9696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 515 159 gene locus_tag LOCUS_19610 515 159 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060873.1 protein_id gnl|my_center|LOCUS_19610 1076 570 gene locus_tag LOCUS_19620 1076 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4312 1145 gene locus_tag LOCUS_19630 4312 1145 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_19630 5821 4322 gene locus_tag LOCUS_19640 5821 4322 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_19640 7211 5868 gene locus_tag LOCUS_19650 7211 5868 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_19650 7978 8379 gene locus_tag LOCUS_19660 7978 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8406 8867 gene locus_tag LOCUS_19670 8406 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8888 9550 gene locus_tag LOCUS_19680 8888 9550 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence124 1399 3222 gene locus_tag LOCUS_19690 1399 3222 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_19690 3884 3480 gene locus_tag LOCUS_19700 gene zntR 3884 3480 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 protein_id gnl|my_center|LOCUS_19700 4173 3898 gene locus_tag LOCUS_19710 4173 3898 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869805.1 protein_id gnl|my_center|LOCUS_19710 5311 4358 gene locus_tag LOCUS_19720 5311 4358 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_19720 5616 5308 gene locus_tag LOCUS_19730 5616 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6491 5667 gene locus_tag LOCUS_19740 6491 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence125 <1 1001 gene locus_tag LOCUS_19750 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943516.1:PKD domain-containing protein 1108 1533 gene locus_tag LOCUS_19760 1108 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1585 3804 gene locus_tag LOCUS_19770 1585 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5615 3876 gene locus_tag LOCUS_19780 5615 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5831 6994 gene locus_tag LOCUS_19790 gene sucC 5831 6994 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_19790 6994 7866 gene locus_tag LOCUS_19800 gene sucD 6994 7866 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_19800 7969 9603 gene locus_tag LOCUS_19810 7969 9603 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence126 <1 2107 gene locus_tag LOCUS_19820 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119443.1:PAS domain-containing protein 2141 3295 gene locus_tag LOCUS_19830 2141 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4689 3331 gene locus_tag LOCUS_19840 gene carS 4689 3331 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_19840 5375 4686 gene locus_tag LOCUS_19850 5375 4686 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_19850 5683 5375 gene locus_tag LOCUS_19860 5683 5375 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_19860 6673 6092 gene locus_tag LOCUS_19870 6673 6092 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_19870 7127 6714 gene locus_tag LOCUS_19880 7127 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7762 7124 gene locus_tag LOCUS_19890 7762 7124 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_19890 7958 9166 gene locus_tag LOCUS_19900 gene dinB 7958 9166 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence127 846 298 gene locus_tag LOCUS_19910 846 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1223 843 gene locus_tag LOCUS_19920 1223 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1810 1271 gene locus_tag LOCUS_19930 1810 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2658 3539 gene locus_tag LOCUS_19940 2658 3539 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444131.1 protein_id gnl|my_center|LOCUS_19940 3814 4182 gene locus_tag LOCUS_19950 3814 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4268 5584 gene locus_tag LOCUS_19960 4268 5584 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_19960 5581 6918 gene locus_tag LOCUS_19970 5581 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence128 807 1886 gene locus_tag LOCUS_19980 807 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2019 2480 gene locus_tag LOCUS_19990 2019 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3244 2579 gene locus_tag LOCUS_20000 3244 2579 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_20000 3710 4426 gene locus_tag LOCUS_20010 3710 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7044 5191 gene locus_tag LOCUS_20020 gene ilvD 7044 5191 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087307.1 protein_id gnl|my_center|LOCUS_20020 7555 7163 gene locus_tag LOCUS_20030 7555 7163 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_20030 8949 7975 gene locus_tag LOCUS_20040 8949 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence129 60 536 gene locus_tag LOCUS_20050 60 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1404 1030 gene locus_tag LOCUS_20060 1404 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1892 1740 gene locus_tag LOCUS_20070 1892 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2526 3212 gene locus_tag LOCUS_20080 2526 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4163 3435 gene locus_tag LOCUS_20090 4163 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4567 4776 gene locus_tag LOCUS_20100 4567 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6336 5272 gene locus_tag LOCUS_20110 gene hemW 6336 5272 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_20110 6460 6783 gene locus_tag LOCUS_20120 gene cdd1 6460 6783 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_20120 6756 7379 gene locus_tag LOCUS_20130 6756 7379 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_20130 7376 8173 gene locus_tag LOCUS_20140 gene fetB 7376 8173 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence130 950 1837 gene locus_tag LOCUS_20150 950 1837 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206478.1 protein_id gnl|my_center|LOCUS_20150 1946 4264 gene locus_tag LOCUS_20160 1946 4264 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_20160 4299 5951 gene locus_tag LOCUS_20170 gene pstA 4299 5951 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_20170 5977 6843 gene locus_tag LOCUS_20180 gene pstB 5977 6843 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_20180 7026 7739 gene locus_tag LOCUS_20190 gene phoU 7026 7739 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 protein_id gnl|my_center|LOCUS_20190 7814 8197 gene locus_tag LOCUS_20200 7814 8197 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 protein_id gnl|my_center|LOCUS_20200 8267 8530 gene locus_tag LOCUS_20210 8267 8530 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_20210 8924 8697 gene locus_tag LOCUS_20220 8924 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence131 <1 1314 gene locus_tag LOCUS_20230 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096489.1:TonB-dependent receptor PqqU 2588 1506 gene locus_tag LOCUS_20240 2588 1506 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_20240 3472 2615 gene locus_tag LOCUS_20250 3472 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_20250 3818 4084 gene locus_tag LOCUS_20260 3818 4084 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_20260 4066 4377 gene locus_tag LOCUS_20270 4066 4377 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_20270 5232 4423 gene locus_tag LOCUS_20280 gene tcdA 5232 4423 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_20280 6005 5229 gene locus_tag LOCUS_20290 6005 5229 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463568.1 protein_id gnl|my_center|LOCUS_20290 6171 6899 gene locus_tag LOCUS_20300 6171 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8059 6983 gene locus_tag LOCUS_20310 8059 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 8501 8262 gene locus_tag LOCUS_20320 8501 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 8984 9166 gene locus_tag LOCUS_20330 8984 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence132 1104 196 gene locus_tag LOCUS_20340 1104 196 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046860082.1 protein_id gnl|my_center|LOCUS_20340 1889 1143 gene locus_tag LOCUS_20350 1889 1143 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_20350 2474 1905 gene locus_tag LOCUS_20360 gene gmhB 2474 1905 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769732.1 protein_id gnl|my_center|LOCUS_20360 4864 2780 gene locus_tag LOCUS_20370 gene glyS 4864 2780 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_20370 5811 4861 gene locus_tag LOCUS_20380 gene glyQ 5811 4861 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_20380 6181 6912 gene locus_tag LOCUS_20390 6181 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8408 6999 gene locus_tag LOCUS_20400 gene glnA 8408 6999 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence133 183 455 gene locus_tag LOCUS_20410 183 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 648 1877 gene locus_tag LOCUS_20420 648 1877 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_20420 2576 2112 gene locus_tag LOCUS_20430 2576 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2917 3138 gene locus_tag LOCUS_20440 2917 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3194 3724 gene locus_tag LOCUS_20450 3194 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3776 5191 gene locus_tag LOCUS_20460 3776 5191 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_20460 5229 7682 gene locus_tag LOCUS_20470 5229 7682 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_20470 <9107 8248 gene locus_tag LOCUS_20480 <9107 8248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008460272.1:HupE/UreJ family protein >Feature sequence134 <1 1098 gene locus_tag LOCUS_20490 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098698.1:poly-beta-1,6-N-acetyl-D-glucosamine synthase 1095 1547 gene locus_tag LOCUS_20500 1095 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2944 1631 gene locus_tag LOCUS_20510 2944 1631 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_20510 3645 2983 gene locus_tag LOCUS_20520 3645 2983 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947023.1 protein_id gnl|my_center|LOCUS_20520 5020 4166 gene locus_tag LOCUS_20530 gene nadC 5020 4166 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_20530 5915 5013 gene locus_tag LOCUS_20540 5915 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6103 6522 gene locus_tag LOCUS_20550 6103 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7194 6814 gene locus_tag LOCUS_20560 7194 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20560 7357 7154 gene locus_tag LOCUS_20570 7357 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7533 8177 gene locus_tag LOCUS_20580 7533 8177 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073875.1 protein_id gnl|my_center|LOCUS_20580 9043 8282 gene locus_tag LOCUS_20590 gene rquA 9043 8282 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence135 678 998 gene locus_tag LOCUS_20600 678 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1067 1429 gene locus_tag LOCUS_20610 1067 1429 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_20610 1434 3524 gene locus_tag LOCUS_20620 1434 3524 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_20620 3602 4120 gene locus_tag LOCUS_20630 3602 4120 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_20630 4174 4938 gene locus_tag LOCUS_20640 4174 4938 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_20640 4955 5140 gene locus_tag LOCUS_20650 4955 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence136 955 2 gene locus_tag LOCUS_20660 955 2 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260111.1 protein_id gnl|my_center|LOCUS_20660 1529 1750 gene locus_tag LOCUS_20670 1529 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2245 2838 gene locus_tag LOCUS_20680 2245 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3825 3076 gene locus_tag LOCUS_20690 3825 3076 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268260.1 protein_id gnl|my_center|LOCUS_20690 4670 4263 gene locus_tag LOCUS_20700 gene merR 4670 4263 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_20700 4898 4764 gene locus_tag LOCUS_20710 4898 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20710 6469 5465 gene locus_tag LOCUS_20720 gene sohB 6469 5465 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_20720 7383 7105 gene locus_tag LOCUS_20730 7383 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 7672 7355 gene locus_tag LOCUS_20740 7672 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 <8956 7799 gene locus_tag LOCUS_20750 <8956 7799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099109.1:glycogen synthase GlgA >Feature sequence137 1322 474 gene locus_tag LOCUS_20760 gene gluQRS 1322 474 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_20760 1628 1464 gene locus_tag LOCUS_20770 1628 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1681 2046 gene locus_tag LOCUS_20780 1681 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2681 2160 gene locus_tag LOCUS_20790 gene dksA 2681 2160 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_20790 3079 3840 gene locus_tag LOCUS_20800 3079 3840 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_20800 3864 5039 gene locus_tag LOCUS_20810 3864 5039 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_20810 6012 5284 gene locus_tag LOCUS_20820 gene cysZ 6012 5284 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_20820 7331 6009 gene locus_tag LOCUS_20830 7331 6009 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_20830 7911 7648 gene locus_tag LOCUS_20840 7911 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 8261 8890 gene locus_tag LOCUS_20850 8261 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence138 485 1198 gene locus_tag LOCUS_20860 485 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926888.1 protein_id gnl|my_center|LOCUS_20860 1495 1965 gene locus_tag LOCUS_20870 1495 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2061 2339 gene locus_tag LOCUS_20880 2061 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2556 2314 gene locus_tag LOCUS_20890 2556 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2826 2557 gene locus_tag LOCUS_20900 2826 2557 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_20900 3438 3229 gene locus_tag LOCUS_20910 3438 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3952 4959 gene locus_tag LOCUS_20920 3952 4959 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_20920 4961 5998 gene locus_tag LOCUS_20930 4961 5998 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_20930 5995 6477 gene locus_tag LOCUS_20940 5995 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 6493 7512 gene locus_tag LOCUS_20950 6493 7512 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence139 1267 338 gene locus_tag LOCUS_20960 1267 338 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_20960 2510 1752 gene locus_tag LOCUS_20970 2510 1752 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_20970 3865 2507 gene locus_tag LOCUS_20980 gene hpnE 3865 2507 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_20980 4743 3862 gene locus_tag LOCUS_20990 gene hpnD 4743 3862 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_20990 4852 6834 gene locus_tag LOCUS_21000 4852 6834 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_21000 7251 8282 gene locus_tag LOCUS_21010 7251 8282 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_21010 <8838 8299 gene locus_tag LOCUS_21020 <8838 8299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040123.1:squalene synthase HpnC >Feature sequence140 403 1548 gene locus_tag LOCUS_21030 403 1548 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264255.1 protein_id gnl|my_center|LOCUS_21030 1577 2773 gene locus_tag LOCUS_21040 1577 2773 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_21040 3059 4261 gene locus_tag LOCUS_21050 gene lhgO 3059 4261 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_21050 5865 4720 gene locus_tag LOCUS_21060 5865 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_21060 5914 6750 gene locus_tag LOCUS_21070 5914 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6902 7153 gene locus_tag LOCUS_21080 6902 7153 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_21080 8683 7445 gene locus_tag LOCUS_21090 8683 7445 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence141 904 101 gene locus_tag LOCUS_21100 904 101 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_21100 4050 922 gene locus_tag LOCUS_21110 4050 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5437 4073 gene locus_tag LOCUS_21120 5437 4073 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_21120 6952 6002 gene locus_tag LOCUS_21130 6952 6002 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_21130 7093 8310 gene locus_tag LOCUS_21140 7093 8310 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence142 <1 524 gene locus_tag LOCUS_21150 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258027.1:ATP-binding protein 521 778 gene locus_tag LOCUS_21160 521 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 841 2253 gene locus_tag LOCUS_21170 841 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2408 3064 gene locus_tag LOCUS_21180 2408 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_21180 3119 3484 gene locus_tag LOCUS_21190 3119 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_21190 3481 4623 gene locus_tag LOCUS_21200 3481 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_21200 4620 5129 gene locus_tag LOCUS_21210 4620 5129 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_21210 5130 5450 gene locus_tag LOCUS_21220 5130 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_21220 5516 5890 gene locus_tag LOCUS_21230 5516 5890 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_21230 5887 8442 gene locus_tag LOCUS_21240 5887 8442 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence143 2122 899 gene locus_tag LOCUS_21250 2122 899 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_21250 3115 2135 gene locus_tag LOCUS_21260 3115 2135 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_21260 4361 3168 gene locus_tag LOCUS_21270 4361 3168 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986806.1 protein_id gnl|my_center|LOCUS_21270 5446 4361 gene locus_tag LOCUS_21280 gene pdhA 5446 4361 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928801.1 protein_id gnl|my_center|LOCUS_21280 5768 5427 gene locus_tag LOCUS_21290 5768 5427 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_21290 5944 6267 gene locus_tag LOCUS_21300 5944 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 8053 6659 gene locus_tag LOCUS_21310 8053 6659 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_21310 8689 8135 gene locus_tag LOCUS_21320 8689 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence144 1920 1531 gene locus_tag LOCUS_21330 1920 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5309 2109 gene locus_tag LOCUS_21340 5309 2109 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_21340 6631 5402 gene locus_tag LOCUS_21350 6631 5402 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_21350 7580 6870 gene locus_tag LOCUS_21360 7580 6870 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_21360 7798 8664 gene locus_tag LOCUS_21370 7798 8664 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence145 <1 1148 gene locus_tag LOCUS_21380 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123086488.1:transcription-repair coupling factor 2764 1145 gene locus_tag LOCUS_21390 2764 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3815 3387 gene locus_tag LOCUS_21400 3815 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4910 3828 gene locus_tag LOCUS_21410 4910 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5257 6066 gene locus_tag LOCUS_21420 5257 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6102 6758 gene locus_tag LOCUS_21430 6102 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7800 6781 gene locus_tag LOCUS_21440 gene zipA 7800 6781 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478499.1 protein_id gnl|my_center|LOCUS_21440 8659 7994 gene locus_tag LOCUS_21450 8659 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence146 1118 3694 gene locus_tag LOCUS_21460 gene gyrA 1118 3694 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_21460 3879 4964 gene locus_tag LOCUS_21470 gene serC 3879 4964 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_21470 5054 6229 gene locus_tag LOCUS_21480 5054 6229 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_21480 6401 7480 gene locus_tag LOCUS_21490 gene pheA 6401 7480 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_21490 7506 8615 gene locus_tag LOCUS_21500 gene hisC 7506 8615 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence147 1288 689 gene locus_tag LOCUS_21510 1288 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2392 1583 gene locus_tag LOCUS_21520 2392 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3292 2882 gene locus_tag LOCUS_21530 3292 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3780 3295 gene locus_tag LOCUS_21540 3780 3295 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_21540 4748 3777 gene locus_tag LOCUS_21550 gene thiL 4748 3777 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_21550 5249 4782 gene locus_tag LOCUS_21560 gene nusB 5249 4782 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_21560 5738 5265 gene locus_tag LOCUS_21570 gene ribE 5738 5265 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_21570 7150 6392 gene locus_tag LOCUS_21580 7150 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 7813 7187 gene locus_tag LOCUS_21590 7813 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8338 7856 gene locus_tag LOCUS_21600 8338 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence148 695 333 gene locus_tag LOCUS_21610 695 333 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_21610 2107 728 gene locus_tag LOCUS_21620 gene hslU 2107 728 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_21620 2673 2107 gene locus_tag LOCUS_21630 gene hslV 2673 2107 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_21630 3682 2744 gene locus_tag LOCUS_21640 gene xerC 3682 2744 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_21640 4424 3702 gene locus_tag LOCUS_21650 4424 3702 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_21650 5286 4477 gene locus_tag LOCUS_21660 gene dapF 5286 4477 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_21660 5403 6107 gene locus_tag LOCUS_21670 5403 6107 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_21670 6800 6297 gene locus_tag LOCUS_21680 gene moaC 6800 6297 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_21680 7372 7605 gene locus_tag LOCUS_21690 gene moaD 7372 7605 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 protein_id gnl|my_center|LOCUS_21690 7608 8045 gene locus_tag LOCUS_21700 gene moaE 7608 8045 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_21700 8083 8349 gene locus_tag LOCUS_21710 8083 8349 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777585.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence149 399 235 gene locus_tag LOCUS_21720 399 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 930 478 gene locus_tag LOCUS_21730 930 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1408 983 gene locus_tag LOCUS_21740 1408 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1799 1401 gene locus_tag LOCUS_21750 1799 1401 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812220.1 protein_id gnl|my_center|LOCUS_21750 2214 3743 gene locus_tag LOCUS_21760 2214 3743 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_21760 4284 6614 gene locus_tag LOCUS_21770 gene pgaA 4284 6614 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 protein_id gnl|my_center|LOCUS_21770 6617 8017 gene locus_tag LOCUS_21780 6617 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence150 <1 924 gene locus_tag LOCUS_21790 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105555.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1594 1091 gene locus_tag LOCUS_21800 1594 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3699 2227 gene locus_tag LOCUS_21810 gene sbcB 3699 2227 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_21810 4356 3964 gene locus_tag LOCUS_21820 4356 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5157 4432 gene locus_tag LOCUS_21830 5157 4432 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_21830 7425 5365 gene locus_tag LOCUS_21840 7425 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7649 8176 gene locus_tag LOCUS_21850 7649 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence151 835 2 gene locus_tag LOCUS_21860 835 2 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_21860 1440 1754 gene locus_tag LOCUS_21870 1440 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1954 2724 gene locus_tag LOCUS_21880 1954 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2737 3486 gene locus_tag LOCUS_21890 2737 3486 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_21890 3559 4854 gene locus_tag LOCUS_21900 3559 4854 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_21900 5075 5449 gene locus_tag LOCUS_21910 gene rpsL 5075 5449 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_21910 5504 5974 gene locus_tag LOCUS_21920 gene rpsG 5504 5974 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806901.1 protein_id gnl|my_center|LOCUS_21920 6138 8237 gene locus_tag LOCUS_21930 gene fusA 6138 8237 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence152 <1 1382 gene locus_tag LOCUS_21940 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932055.1:glycosyltransferase family 39 protein 1885 1388 gene locus_tag LOCUS_21950 1885 1388 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_21950 2066 1878 gene locus_tag LOCUS_21960 2066 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2281 2997 gene locus_tag LOCUS_21970 2281 2997 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_21970 3145 3333 gene locus_tag LOCUS_21980 3145 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4509 4096 gene locus_tag LOCUS_21990 4509 4096 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_21990 4730 4509 gene locus_tag LOCUS_22000 4730 4509 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_22000 6262 5696 gene locus_tag LOCUS_22010 6262 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 6642 6274 gene locus_tag LOCUS_22020 6642 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 7530 8240 gene locus_tag LOCUS_22030 7530 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence153 610 323 gene locus_tag LOCUS_22040 610 323 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_22040 2415 730 gene locus_tag LOCUS_22050 gene rpsA 2415 730 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_22050 3428 2733 gene locus_tag LOCUS_22060 gene cmk 3428 2733 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072382.1 protein_id gnl|my_center|LOCUS_22060 4787 3744 gene locus_tag LOCUS_22070 gene mtnA 4787 3744 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_22070 5131 4877 gene locus_tag LOCUS_22080 5131 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 5274 6632 gene locus_tag LOCUS_22090 5274 6632 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_22090 7937 6624 gene locus_tag LOCUS_22100 gene yjjJ 7937 6624 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815521.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence154 1422 601 gene locus_tag LOCUS_22110 1422 601 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_22110 2898 1510 gene locus_tag LOCUS_22120 2898 1510 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_22120 3336 5234 gene locus_tag LOCUS_22130 gene thiC 3336 5234 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_22130 5237 5695 gene locus_tag LOCUS_22140 5237 5695 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_22140 5708 6682 gene locus_tag LOCUS_22150 5708 6682 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_22150 6803 7066 gene locus_tag LOCUS_22160 6803 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 7391 8080 gene locus_tag LOCUS_22170 7391 8080 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence155 <1 558 gene locus_tag LOCUS_22180 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039228.1:DUF4194 domain-containing protein 551 3949 gene locus_tag LOCUS_22190 551 3949 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_22190 3927 5087 gene locus_tag LOCUS_22200 3927 5087 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_22200 5914 6960 gene locus_tag LOCUS_22210 5914 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7198 8121 gene locus_tag LOCUS_22220 7198 8121 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529918.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence156 574 41 gene locus_tag LOCUS_22230 gene rplF 574 41 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_22230 981 586 gene locus_tag LOCUS_22240 gene rpsH 981 586 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174622.1 protein_id gnl|my_center|LOCUS_22240 1370 1065 gene locus_tag LOCUS_22250 gene rpsN 1370 1065 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_22250 1925 1386 gene locus_tag LOCUS_22260 gene rplE 1925 1386 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946090.1 protein_id gnl|my_center|LOCUS_22260 2292 1975 gene locus_tag LOCUS_22270 gene rplX 2292 1975 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_22270 2751 2383 gene locus_tag LOCUS_22280 gene rplN 2751 2383 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_22280 3192 2935 gene locus_tag LOCUS_22290 gene rpsQ 3192 2935 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_22290 3392 3189 gene locus_tag LOCUS_22300 gene rpmC 3392 3189 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_22300 3805 3392 gene locus_tag LOCUS_22310 gene rplP 3805 3392 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_22310 4493 3825 gene locus_tag LOCUS_22320 gene rpsC 4493 3825 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_22320 4840 4508 gene locus_tag LOCUS_22330 gene rplV 4840 4508 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_22330 5124 4852 gene locus_tag LOCUS_22340 gene rpsS 5124 4852 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_22340 5996 5166 gene locus_tag LOCUS_22350 gene rplB 5996 5166 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397049.1 protein_id gnl|my_center|LOCUS_22350 6345 6049 gene locus_tag LOCUS_22360 gene rplW 6345 6049 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_22360 6962 6342 gene locus_tag LOCUS_22370 gene rplD 6962 6342 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_22370 7615 6974 gene locus_tag LOCUS_22380 gene rplC 7615 6974 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 protein_id gnl|my_center|LOCUS_22380 8034 7720 gene locus_tag LOCUS_22390 gene rpsJ 8034 7720 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence157 884 603 gene locus_tag LOCUS_22400 884 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1888 881 gene locus_tag LOCUS_22410 1888 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_22410 3523 2129 gene locus_tag LOCUS_22420 3523 2129 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480179.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22420 3934 5898 gene locus_tag LOCUS_22430 gene acs 3934 5898 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_22430 7263 6313 gene locus_tag LOCUS_22440 7263 6313 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_22440 <8283 7454 gene locus_tag LOCUS_22450 <8283 7454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392169.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence158 967 1764 gene locus_tag LOCUS_22460 967 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1871 4897 gene locus_tag LOCUS_22470 1871 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5261 5431 gene locus_tag LOCUS_22480 5261 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5791 6669 gene locus_tag LOCUS_22490 5791 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6666 7529 gene locus_tag LOCUS_22500 6666 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 7890 7492 gene locus_tag LOCUS_22510 7890 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence159 236 856 gene locus_tag LOCUS_22520 236 856 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105015.1 protein_id gnl|my_center|LOCUS_22520 865 2352 gene locus_tag LOCUS_22530 gene rng 865 2352 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_22530 2489 6310 gene locus_tag LOCUS_22540 2489 6310 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_22540 6400 7224 gene locus_tag LOCUS_22550 6400 7224 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_22550 7295 7768 gene locus_tag LOCUS_22560 7295 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence160 266 57 gene locus_tag LOCUS_22570 gene copZ 266 57 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723406.1 protein_id gnl|my_center|LOCUS_22570 2727 241 gene locus_tag LOCUS_22580 gene copA1 2727 241 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_22580 4444 3305 gene locus_tag LOCUS_22590 4444 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5363 4479 gene locus_tag LOCUS_22600 gene htpX 5363 4479 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_22600 6111 5764 gene locus_tag LOCUS_22610 6111 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6318 6638 gene locus_tag LOCUS_22620 6318 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6857 7189 gene locus_tag LOCUS_22630 6857 7189 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_22630 <8151 7502 gene locus_tag LOCUS_22640 <8151 7502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263049.1:DEAD/DEAH box helicase >Feature sequence161 1517 453 gene locus_tag LOCUS_22650 gene hemE 1517 453 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_22650 3034 1628 gene locus_tag LOCUS_22660 3034 1628 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_22660 7641 3154 gene locus_tag LOCUS_22670 gene gltB 7641 3154 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_22670 7869 7705 gene locus_tag LOCUS_22680 7869 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence162 895 503 gene locus_tag LOCUS_22690 895 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1672 1025 gene locus_tag LOCUS_22700 1672 1025 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_22700 3406 2030 gene locus_tag LOCUS_22710 gene ppnN 3406 2030 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_22710 4204 3407 gene locus_tag LOCUS_22720 4204 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 5941 4232 gene locus_tag LOCUS_22730 gene ggt 5941 4232 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_22730 6557 7072 gene locus_tag LOCUS_22740 6557 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence163 1484 2782 gene locus_tag LOCUS_22750 1484 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2772 3611 gene locus_tag LOCUS_22760 2772 3611 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_22760 4644 3706 gene locus_tag LOCUS_22770 gene secF 4644 3706 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_22770 6571 4697 gene locus_tag LOCUS_22780 gene secD 6571 4697 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_22780 6988 6620 gene locus_tag LOCUS_22790 gene yajC 6988 6620 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809416.1 protein_id gnl|my_center|LOCUS_22790 <8036 7086 gene locus_tag LOCUS_22800 <8036 7086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073009.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence164 2529 127 gene locus_tag LOCUS_22810 2529 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2974 3663 gene locus_tag LOCUS_22820 gene phoB 2974 3663 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_22820 3679 4995 gene locus_tag LOCUS_22830 gene phoR 3679 4995 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_22830 5110 6108 gene locus_tag LOCUS_22840 gene pstS 5110 6108 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_22840 6290 6667 gene locus_tag LOCUS_22850 6290 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 6565 7560 gene locus_tag LOCUS_22860 6565 7560 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 >Feature sequence165 1612 422 gene locus_tag LOCUS_22870 1612 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2428 2237 gene locus_tag LOCUS_22880 2428 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2925 2734 gene locus_tag LOCUS_22890 2925 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3103 2879 gene locus_tag LOCUS_22900 3103 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3730 6894 gene locus_tag LOCUS_22910 3730 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence166 808 161 gene locus_tag LOCUS_22920 808 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 893 1762 gene locus_tag LOCUS_22930 893 1762 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_22930 2573 2217 gene locus_tag LOCUS_22940 2573 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5513 2613 gene locus_tag LOCUS_22950 5513 2613 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_22950 5599 6513 gene locus_tag LOCUS_22960 5599 6513 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_22960 6639 6941 gene locus_tag LOCUS_22970 6639 6941 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_22970 6941 7318 gene locus_tag LOCUS_22980 6941 7318 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence167 415 1647 gene locus_tag LOCUS_22990 415 1647 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_22990 1644 3296 gene locus_tag LOCUS_23000 gene xrtA 1644 3296 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_23000 3293 4501 gene locus_tag LOCUS_23010 3293 4501 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_23010 4827 6725 gene locus_tag LOCUS_23020 4827 6725 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence168 445 2688 gene locus_tag LOCUS_23030 445 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2850 3365 gene locus_tag LOCUS_23040 2850 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3362 4381 gene locus_tag LOCUS_23050 gene holA 3362 4381 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_23050 4398 5696 gene locus_tag LOCUS_23060 4398 5696 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_23060 5758 6477 gene locus_tag LOCUS_23070 gene nadD 5758 6477 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_23070 6474 6827 gene locus_tag LOCUS_23080 gene rsfS 6474 6827 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_23080 6854 7321 gene locus_tag LOCUS_23090 gene rlmH 6854 7321 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence169 433 1176 gene locus_tag LOCUS_23100 433 1176 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_23100 1274 1996 gene locus_tag LOCUS_23110 1274 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2895 3731 gene locus_tag LOCUS_23120 2895 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 4096 4320 gene locus_tag LOCUS_23130 4096 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23130 4504 7623 gene locus_tag LOCUS_23140 4504 7623 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence170 1216 248 gene locus_tag LOCUS_23150 1216 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 4102 1220 gene locus_tag LOCUS_23160 4102 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 5046 4120 gene locus_tag LOCUS_23170 5046 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5625 7220 gene locus_tag LOCUS_23180 5625 7220 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence171 3452 1566 gene locus_tag LOCUS_23190 3452 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4366 3449 gene locus_tag LOCUS_23200 4366 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4597 5301 gene locus_tag LOCUS_23210 4597 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 6200 5838 gene locus_tag LOCUS_23220 6200 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 <7737 6205 gene locus_tag LOCUS_23230 <7737 6205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001043985.1:GlyGly-anchored extracellular serine protease VesC >Feature sequence172 455 168 gene locus_tag LOCUS_23240 gene gatC 455 168 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_23240 730 1782 gene locus_tag LOCUS_23250 gene mreB 730 1782 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_23250 2064 2870 gene locus_tag LOCUS_23260 gene mreC 2064 2870 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23260 2881 3375 gene locus_tag LOCUS_23270 gene mreD 2881 3375 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364106.1 protein_id gnl|my_center|LOCUS_23270 3415 5292 gene locus_tag LOCUS_23280 gene mrdA 3415 5292 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_23280 5289 6416 gene locus_tag LOCUS_23290 gene rodA 5289 6416 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_23290 6434 7516 gene locus_tag LOCUS_23300 gene mltB 6434 7516 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence173 3477 1237 gene locus_tag LOCUS_23310 3477 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4023 4997 gene locus_tag LOCUS_23320 gene mltC 4023 4997 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_23320 5216 7138 gene locus_tag LOCUS_23330 5216 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence174 75 593 gene locus_tag LOCUS_23340 75 593 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423511.1 protein_id gnl|my_center|LOCUS_23340 667 1323 gene locus_tag LOCUS_23350 667 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1345 2730 gene locus_tag LOCUS_23360 gene tssK 1345 2730 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_23360 2734 3411 gene locus_tag LOCUS_23370 2734 3411 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044923.1 protein_id gnl|my_center|LOCUS_23370 3432 6887 gene locus_tag LOCUS_23380 3432 6887 CDS product type VI secretion protein IcmF/TssM N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence175 <1 503 gene locus_tag LOCUS_23390 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705807.1:type VI secretion system tip protein TssI/VgrG 510 1055 gene locus_tag LOCUS_23400 510 1055 CDS product DUF6484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101196.1 protein_id gnl|my_center|LOCUS_23400 1119 2111 gene locus_tag LOCUS_23410 1119 2111 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_23410 2194 2511 gene locus_tag LOCUS_23420 2194 2511 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943800.1 protein_id gnl|my_center|LOCUS_23420 2566 3792 gene locus_tag LOCUS_23430 2566 3792 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895495.1 protein_id gnl|my_center|LOCUS_23430 3789 4850 gene locus_tag LOCUS_23440 3789 4850 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525296.1 protein_id gnl|my_center|LOCUS_23440 4895 5755 gene locus_tag LOCUS_23450 4895 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5768 6358 gene locus_tag LOCUS_23460 5768 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 7029 7490 gene locus_tag LOCUS_23470 7029 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence176 342 776 gene locus_tag LOCUS_23480 342 776 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 protein_id gnl|my_center|LOCUS_23480 1100 1300 gene locus_tag LOCUS_23490 1100 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1350 1634 gene locus_tag LOCUS_23500 1350 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1997 2482 gene locus_tag LOCUS_23510 1997 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 3230 6043 gene locus_tag LOCUS_23520 3230 6043 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_23520 6043 6375 gene locus_tag LOCUS_23530 6043 6375 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence177 134 1225 gene locus_tag LOCUS_23540 134 1225 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_23540 1225 2532 gene locus_tag LOCUS_23550 1225 2532 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_23550 2532 3305 gene locus_tag LOCUS_23560 gene cobI 2532 3305 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_23560 3372 4133 gene locus_tag LOCUS_23570 3372 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23570 4145 4546 gene locus_tag LOCUS_23580 4145 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23580 5028 6383 gene locus_tag LOCUS_23590 5028 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6786 7130 gene locus_tag LOCUS_23600 6786 7130 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence178 <1 672 gene locus_tag LOCUS_23610 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815864.1:glutamate--tRNA ligase 683 2398 gene locus_tag LOCUS_23620 683 2398 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_23620 2438 2513 gene locus_tag LOCUS_t00270 2438 2513 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2574 2649 gene locus_tag LOCUS_t00280 2574 2649 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2831 3199 gene locus_tag LOCUS_23630 2831 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 3367 3531 gene locus_tag LOCUS_23640 3367 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 6871 4043 gene locus_tag LOCUS_23650 6871 4043 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence179 2655 472 gene locus_tag LOCUS_23660 2655 472 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_23660 3016 2690 gene locus_tag LOCUS_23670 gene nirD 3016 2690 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_23670 5454 3016 gene locus_tag LOCUS_23680 gene nirB 5454 3016 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence180 1390 467 gene locus_tag LOCUS_23690 gene mdh 1390 467 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_23690 2837 1677 gene locus_tag LOCUS_23700 gene algW 2837 1677 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_23700 3238 3996 gene locus_tag LOCUS_23710 3238 3996 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_23710 4581 5969 gene locus_tag LOCUS_23720 4581 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 6094 6378 gene locus_tag LOCUS_23730 6094 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 6636 7310 gene locus_tag LOCUS_23740 6636 7310 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence181 2458 2138 gene locus_tag LOCUS_23750 gene clpS 2458 2138 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_23750 3813 2560 gene locus_tag LOCUS_23760 gene icd 3813 2560 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_23760 4767 3949 gene locus_tag LOCUS_23770 4767 3949 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 protein_id gnl|my_center|LOCUS_23770 5352 4864 gene locus_tag LOCUS_23780 gene gspM 5352 4864 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661339.1 protein_id gnl|my_center|LOCUS_23780 6656 5349 gene locus_tag LOCUS_23790 gene gspL 6656 5349 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262825.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence182 3110 5275 gene locus_tag LOCUS_23800 3110 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 5413 6117 gene locus_tag LOCUS_23810 5413 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence183 329 877 gene locus_tag LOCUS_23820 329 877 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_23820 1035 3365 gene locus_tag LOCUS_23830 1035 3365 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_23830 3797 5497 gene locus_tag LOCUS_23840 3797 5497 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_23840 6871 5822 gene locus_tag LOCUS_23850 gene truD 6871 5822 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence184 <1 1718 gene locus_tag LOCUS_23860 <1 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041271984.1:beta-propeller domain-containing protein 2927 1860 gene locus_tag LOCUS_23870 2927 1860 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_23870 3834 2992 gene locus_tag LOCUS_23880 3834 2992 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_23880 4975 3839 gene locus_tag LOCUS_23890 gene wecB 4975 3839 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_23890 6570 5056 gene locus_tag LOCUS_23900 6570 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence185 685 470 gene locus_tag LOCUS_23910 685 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1275 712 gene locus_tag LOCUS_23920 1275 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1786 2166 gene locus_tag LOCUS_23930 1786 2166 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943800.1 protein_id gnl|my_center|LOCUS_23930 2291 3472 gene locus_tag LOCUS_23940 2291 3472 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895495.1 protein_id gnl|my_center|LOCUS_23940 3469 4551 gene locus_tag LOCUS_23950 3469 4551 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_23950 4748 5515 gene locus_tag LOCUS_23960 4748 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5556 6125 gene locus_tag LOCUS_23970 5556 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110347.1 protein_id gnl|my_center|LOCUS_23970 6742 6317 gene locus_tag LOCUS_23980 6742 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence186 2989 686 gene locus_tag LOCUS_23990 2989 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 3620 6148 gene locus_tag LOCUS_24000 3620 6148 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170304.1 protein_id gnl|my_center|LOCUS_24000 6387 6166 gene locus_tag LOCUS_24010 6387 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24010 >Feature sequence187 3111 3392 gene locus_tag LOCUS_24020 3111 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3858 5564 gene locus_tag LOCUS_24030 3858 5564 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_24030 6122 5736 gene locus_tag LOCUS_24040 6122 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24040 6487 6119 gene locus_tag LOCUS_24050 6487 6119 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217159161.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence188 3610 341 gene locus_tag LOCUS_24060 3610 341 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_24060 4262 3744 gene locus_tag LOCUS_24070 4262 3744 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_24070 5705 4476 gene locus_tag LOCUS_24080 5705 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5880 5695 gene locus_tag LOCUS_24090 5880 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 6719 5877 gene locus_tag LOCUS_24100 gene dinD 6719 5877 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297374.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence189 1444 782 gene locus_tag LOCUS_24110 1444 782 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_24110 2763 1756 gene locus_tag LOCUS_24120 gene rluC 2763 1756 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_24120 3155 6115 gene locus_tag LOCUS_24130 gene rne 3155 6115 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence190 702 1805 gene locus_tag LOCUS_24140 702 1805 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_24140 1828 2598 gene locus_tag LOCUS_24150 1828 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2636 3688 gene locus_tag LOCUS_24160 2636 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 3688 4734 gene locus_tag LOCUS_24170 3688 4734 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_24170 4792 5004 gene locus_tag LOCUS_24180 4792 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 5463 5065 gene locus_tag LOCUS_24190 5463 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 6454 6200 gene locus_tag LOCUS_24200 6454 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 6910 6617 gene locus_tag LOCUS_24210 6910 6617 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence191 2526 739 gene locus_tag LOCUS_24220 2526 739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948104.1 protein_id gnl|my_center|LOCUS_24220 3486 2965 gene locus_tag LOCUS_24230 3486 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 4615 3473 gene locus_tag LOCUS_24240 4615 3473 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_24240 4978 5577 gene locus_tag LOCUS_24250 4978 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939815.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence192 <1 1359 gene locus_tag LOCUS_24260 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162471698.1:copper-translocating P-type ATPase 1359 1595 gene locus_tag LOCUS_24270 gene ccoS 1359 1595 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_24270 2580 1867 gene locus_tag LOCUS_24280 2580 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2638 3387 gene locus_tag LOCUS_24290 2638 3387 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_24290 3951 4670 gene locus_tag LOCUS_24300 3951 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4846 5220 gene locus_tag LOCUS_24310 4846 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 5217 5537 gene locus_tag LOCUS_24320 5217 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 5652 5882 gene locus_tag LOCUS_24330 5652 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 5882 6277 gene locus_tag LOCUS_24340 5882 6277 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence193 2596 884 gene locus_tag LOCUS_24350 2596 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2747 4417 gene locus_tag LOCUS_24360 2747 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4421 4912 gene locus_tag LOCUS_24370 gene tssB 4421 4912 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418723.1 protein_id gnl|my_center|LOCUS_24370 4972 6450 gene locus_tag LOCUS_24380 gene tssC 4972 6450 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104072.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence194 1190 147 gene locus_tag LOCUS_24390 1190 147 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_24390 1942 1193 gene locus_tag LOCUS_24400 gene pgl 1942 1193 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_24400 2805 2095 gene locus_tag LOCUS_24410 2805 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3421 2879 gene locus_tag LOCUS_24420 3421 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3917 3660 gene locus_tag LOCUS_24430 3917 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 4331 6736 gene locus_tag LOCUS_24440 4331 6736 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence195 785 12 gene locus_tag LOCUS_24450 785 12 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268269.1 protein_id gnl|my_center|LOCUS_24450 1507 782 gene locus_tag LOCUS_24460 gene aat 1507 782 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_24460 2733 1594 gene locus_tag LOCUS_24470 2733 1594 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_24470 2783 3460 gene locus_tag LOCUS_24480 2783 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4417 3461 gene locus_tag LOCUS_24490 gene trxB 4417 3461 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_24490 5718 4936 gene locus_tag LOCUS_24500 5718 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 6515 5715 gene locus_tag LOCUS_24510 6515 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence196 1412 1047 gene locus_tag LOCUS_24520 1412 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3148 1736 gene locus_tag LOCUS_24530 3148 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 6234 3358 gene locus_tag LOCUS_24540 gene uvrA 6234 3358 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence197 1551 196 gene locus_tag LOCUS_24550 1551 196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_24550 3052 1757 gene locus_tag LOCUS_24560 gene gltA 3052 1757 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_24560 3204 3049 gene locus_tag LOCUS_24570 3204 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4501 3527 gene locus_tag LOCUS_24580 4501 3527 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 protein_id gnl|my_center|LOCUS_24580 4847 4524 gene locus_tag LOCUS_24590 4847 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 5800 4844 gene locus_tag LOCUS_24600 5800 4844 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence198 1260 3383 gene locus_tag LOCUS_24610 1260 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4408 3701 gene locus_tag LOCUS_24620 gene bioD 4408 3701 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763772.1 protein_id gnl|my_center|LOCUS_24620 5331 4408 gene locus_tag LOCUS_24630 gene bioC 5331 4408 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_24630 6114 5350 gene locus_tag LOCUS_24640 gene bioH 6114 5350 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_24640 6683 6111 gene locus_tag LOCUS_24650 6683 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence199 2189 1707 gene locus_tag LOCUS_24660 2189 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4599 2794 gene locus_tag LOCUS_24670 4599 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 5876 4941 gene locus_tag LOCUS_24680 5876 4941 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 protein_id gnl|my_center|LOCUS_24680 <6624 5941 gene locus_tag LOCUS_24690 <6624 5941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770635.1:S49 family peptidase >Feature sequence200 20 4249 gene locus_tag LOCUS_24700 20 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5750 4611 gene locus_tag LOCUS_24710 5750 4611 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_24710 6111 6359 gene locus_tag LOCUS_24720 6111 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence201 1619 2224 gene locus_tag LOCUS_24730 1619 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2607 3830 gene locus_tag LOCUS_24740 2607 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4124 3861 gene locus_tag LOCUS_24750 4124 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence202 93 1109 gene locus_tag LOCUS_24760 93 1109 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693834.1 protein_id gnl|my_center|LOCUS_24760 1093 3876 gene locus_tag LOCUS_24770 1093 3876 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_24770 4251 5021 gene locus_tag LOCUS_24780 gene ppk2 4251 5021 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_24780 5151 5471 gene locus_tag LOCUS_24790 5151 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 6378 5968 gene locus_tag LOCUS_24800 6378 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24800 >Feature sequence203 735 202 gene locus_tag LOCUS_24810 gene ogt 735 202 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816337.1 protein_id gnl|my_center|LOCUS_24810 2236 713 gene locus_tag LOCUS_24820 2236 713 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_24820 2715 2449 gene locus_tag LOCUS_24830 2715 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3401 2829 gene locus_tag LOCUS_24840 3401 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3755 3600 gene locus_tag LOCUS_24850 gene rpmG 3755 3600 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_24850 4004 3768 gene locus_tag LOCUS_24860 gene rpmB 4004 3768 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 protein_id gnl|my_center|LOCUS_24860 4206 4922 gene locus_tag LOCUS_24870 gene rph 4206 4922 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_24870 4949 5530 gene locus_tag LOCUS_24880 4949 5530 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_24880 5778 5942 gene locus_tag LOCUS_24890 5778 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence204 335 559 gene locus_tag LOCUS_24900 335 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1016 1237 gene locus_tag LOCUS_24910 1016 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1983 1393 gene locus_tag LOCUS_24920 1983 1393 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_24920 2140 2349 gene locus_tag LOCUS_24930 2140 2349 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_24930 2346 2678 gene locus_tag LOCUS_24940 2346 2678 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_24940 3040 2786 gene locus_tag LOCUS_24950 3040 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2933 3538 gene locus_tag LOCUS_24960 2933 3538 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_24960 5683 4019 gene locus_tag LOCUS_24970 5683 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence205 1566 235 gene locus_tag LOCUS_24980 1566 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2221 2514 gene locus_tag LOCUS_24990 2221 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2540 3523 gene locus_tag LOCUS_25000 2540 3523 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_25000 3565 4068 gene locus_tag LOCUS_25010 3565 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4658 4143 gene locus_tag LOCUS_25020 4658 4143 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_25020 5442 4975 gene locus_tag LOCUS_25030 5442 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 6242 5436 gene locus_tag LOCUS_25040 6242 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence206 1425 184 gene locus_tag LOCUS_25050 1425 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1800 2087 gene locus_tag LOCUS_25060 1800 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4339 2615 gene locus_tag LOCUS_25070 4339 2615 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_25070 <6445 5105 gene locus_tag LOCUS_25080 <6445 5105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257106.1:PQQ-dependent sugar dehydrogenase >Feature sequence207 76 432 gene locus_tag LOCUS_25090 76 432 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_25090 419 1429 gene locus_tag LOCUS_25100 gene rsgA 419 1429 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_25100 1764 2498 gene locus_tag LOCUS_25110 1764 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3073 2708 gene locus_tag LOCUS_25120 3073 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 4319 3120 gene locus_tag LOCUS_25130 4319 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5102 4431 gene locus_tag LOCUS_25140 gene tsaB 5102 4431 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_25140 <6432 5099 gene locus_tag LOCUS_25150 <6432 5099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192700.1:ATP-dependent DNA helicase >Feature sequence208 2068 1142 gene locus_tag LOCUS_25160 2068 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4099 2186 gene locus_tag LOCUS_25170 4099 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4536 5930 gene locus_tag LOCUS_25180 4536 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence209 34 366 gene locus_tag LOCUS_25190 34 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1984 740 gene locus_tag LOCUS_25200 gene lplT 1984 740 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816987.1 protein_id gnl|my_center|LOCUS_25200 4128 1987 gene locus_tag LOCUS_25210 4128 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 4408 4593 gene locus_tag LOCUS_25220 4408 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 5006 5614 gene locus_tag LOCUS_25230 5006 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence210 732 4 gene locus_tag LOCUS_25240 732 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 1892 780 gene locus_tag LOCUS_25250 gene nadA 1892 780 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_25250 2339 2109 gene locus_tag LOCUS_25260 2339 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4310 2514 gene locus_tag LOCUS_25270 gene aspS 4310 2514 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_25270 5062 4406 gene locus_tag LOCUS_25280 5062 4406 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_25280 5392 5090 gene locus_tag LOCUS_25290 5392 5090 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_25290 5569 5997 gene locus_tag LOCUS_25300 5569 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence211 1101 1844 gene locus_tag LOCUS_25310 1101 1844 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_25310 2104 3147 gene locus_tag LOCUS_25320 2104 3147 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_25320 3467 3285 gene locus_tag LOCUS_25330 3467 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4540 3515 gene locus_tag LOCUS_25340 4540 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5254 4553 gene locus_tag LOCUS_25350 5254 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence212 <1 1170 gene locus_tag LOCUS_25360 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943793.1:type VI secretion system contractile sheath large subunit 1193 1675 gene locus_tag LOCUS_25370 1193 1675 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_25370 1684 2097 gene locus_tag LOCUS_25380 gene tssE 1684 2097 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480585.1 protein_id gnl|my_center|LOCUS_25380 2444 4171 gene locus_tag LOCUS_25390 gene tssF 2444 4171 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_25390 4375 5172 gene locus_tag LOCUS_25400 4375 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 >Feature sequence213 1105 281 gene locus_tag LOCUS_25410 1105 281 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_25410 1614 1105 gene locus_tag LOCUS_25420 1614 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2193 1642 gene locus_tag LOCUS_25430 2193 1642 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_25430 2942 2169 gene locus_tag LOCUS_25440 2942 2169 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407320.1 protein_id gnl|my_center|LOCUS_25440 4369 3041 gene locus_tag LOCUS_25450 gene cptA 4369 3041 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_25450 4708 4508 gene locus_tag LOCUS_25460 4708 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5273 5506 gene locus_tag LOCUS_25470 5273 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 5493 5780 gene locus_tag LOCUS_25480 5493 5780 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence214 1279 782 gene locus_tag LOCUS_25490 1279 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1973 1407 gene locus_tag LOCUS_25500 1973 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2277 3080 gene locus_tag LOCUS_25510 2277 3080 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_25510 5408 3207 gene locus_tag LOCUS_25520 5408 3207 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022286.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence215 <1 829 gene locus_tag LOCUS_25530 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036883.1:5'/3'-nucleotidase SurE 826 1482 gene locus_tag LOCUS_25540 826 1482 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_25540 1634 2182 gene locus_tag LOCUS_25550 1634 2182 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_25550 2264 3148 gene locus_tag LOCUS_25560 gene nlpD 2264 3148 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209396.1 protein_id gnl|my_center|LOCUS_25560 3214 4269 gene locus_tag LOCUS_25570 gene rpoS 3214 4269 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_25570 5030 4461 gene locus_tag LOCUS_25580 5030 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5815 5267 gene locus_tag LOCUS_25590 5815 5267 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence216 1988 5347 gene locus_tag LOCUS_25600 1988 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5736 5533 gene locus_tag LOCUS_25610 5736 5533 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence217 702 1460 gene locus_tag LOCUS_25620 702 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1728 2276 gene locus_tag LOCUS_25630 gene ppa 1728 2276 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence218 4177 305 gene locus_tag LOCUS_25640 4177 305 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence219 830 2494 gene locus_tag LOCUS_25650 gene lidL 830 2494 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_25650 2692 3096 gene locus_tag LOCUS_25660 2692 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4710 3184 gene locus_tag LOCUS_25670 4710 3184 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_25670 5233 5317 gene locus_tag LOCUS_t00290 5233 5317 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5435 5508 gene locus_tag LOCUS_t00300 5435 5508 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5584 5658 gene locus_tag LOCUS_t00310 5584 5658 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence220 682 245 gene locus_tag LOCUS_25680 682 245 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311273.1 protein_id gnl|my_center|LOCUS_25680 784 1116 gene locus_tag LOCUS_25690 784 1116 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226697.1 protein_id gnl|my_center|LOCUS_25690 1125 1544 gene locus_tag LOCUS_25700 1125 1544 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_25700 3620 1665 gene locus_tag LOCUS_25710 3620 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3949 4581 gene locus_tag LOCUS_25720 3949 4581 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021338.1 protein_id gnl|my_center|LOCUS_25720 5822 4851 gene locus_tag LOCUS_25730 gene tal 5822 4851 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463537.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence221 1131 340 gene locus_tag LOCUS_25740 1131 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2234 1212 gene locus_tag LOCUS_25750 2234 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2900 2241 gene locus_tag LOCUS_25760 2900 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3978 2911 gene locus_tag LOCUS_25770 3978 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 5243 3975 gene locus_tag LOCUS_25780 5243 3975 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895495.1 protein_id gnl|my_center|LOCUS_25780 5550 5296 gene locus_tag LOCUS_25790 5550 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence222 888 2276 gene locus_tag LOCUS_25800 888 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2356 4419 gene locus_tag LOCUS_25810 2356 4419 CDS product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_25810 4432 5562 gene locus_tag LOCUS_25820 4432 5562 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence223 637 266 gene locus_tag LOCUS_25830 637 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 874 1461 gene locus_tag LOCUS_25840 gene coq7 874 1461 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_25840 1780 1541 gene locus_tag LOCUS_25850 1780 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2318 1929 gene locus_tag LOCUS_25860 2318 1929 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_25860 2738 2322 gene locus_tag LOCUS_25870 2738 2322 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_25870 2891 3544 gene locus_tag LOCUS_25880 gene crp 2891 3544 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_25880 4505 3705 gene locus_tag LOCUS_25890 gene trpC 4505 3705 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_25890 5621 4602 gene locus_tag LOCUS_25900 gene trpD 5621 4602 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence224 787 149 gene locus_tag LOCUS_25910 787 149 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_25910 1687 797 gene locus_tag LOCUS_25920 gene rluB 1687 797 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_25920 2616 1684 gene locus_tag LOCUS_25930 2616 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3479 2640 gene locus_tag LOCUS_25940 3479 2640 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_25940 3912 4238 gene locus_tag LOCUS_25950 3912 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4551 4240 gene locus_tag LOCUS_25960 4551 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5392 5009 gene locus_tag LOCUS_25970 5392 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 5682 5398 gene locus_tag LOCUS_25980 5682 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence225 1052 633 gene locus_tag LOCUS_25990 1052 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1784 1708 gene locus_tag LOCUS_t00320 1784 1708 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3710 1851 gene locus_tag LOCUS_26000 gene rpoD 3710 1851 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_26000 <5560 3825 gene locus_tag LOCUS_26010 <5560 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038900.1:DNA primase >Feature sequence226 229 14 gene locus_tag LOCUS_26020 gene rpsU 229 14 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 protein_id gnl|my_center|LOCUS_26020 400 1443 gene locus_tag LOCUS_26030 gene tsaD 400 1443 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_26030 1922 1530 gene locus_tag LOCUS_26040 1922 1530 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_26040 2411 2992 gene locus_tag LOCUS_26050 gene nudE 2411 2992 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_26050 3035 3841 gene locus_tag LOCUS_26060 gene cysQ 3035 3841 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_26060 3896 4573 gene locus_tag LOCUS_26070 3896 4573 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_26070 4640 5236 gene locus_tag LOCUS_26080 4640 5236 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence227 4129 2816 gene locus_tag LOCUS_26090 4129 2816 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_26090 4670 4332 gene locus_tag LOCUS_26100 4670 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 5038 5166 gene locus_tag LOCUS_26110 5038 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence228 511 308 gene locus_tag LOCUS_26120 511 308 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_26120 785 4357 gene locus_tag LOCUS_26130 785 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4437 5363 gene locus_tag LOCUS_26140 4437 5363 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence229 1423 404 gene locus_tag LOCUS_26150 gene bioB 1423 404 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_26150 1700 2242 gene locus_tag LOCUS_26160 1700 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2923 3306 gene locus_tag LOCUS_26170 2923 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3396 4112 gene locus_tag LOCUS_26180 3396 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 5015 4125 gene locus_tag LOCUS_26190 5015 4125 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882591.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence230 <1 1211 gene locus_tag LOCUS_26200 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528327.1:double-strand break repair helicase AddA 1339 1791 gene locus_tag LOCUS_26210 1339 1791 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_26210 3314 2010 gene locus_tag LOCUS_26220 3314 2010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_26220 3386 5077 gene locus_tag LOCUS_26230 3386 5077 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence231 <1 675 gene locus_tag LOCUS_26240 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317112.1:50S ribosomal protein L1 963 1490 gene locus_tag LOCUS_26250 gene rplJ 963 1490 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_26250 1614 1991 gene locus_tag LOCUS_26260 gene rplL 1614 1991 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence232 2203 1202 gene locus_tag LOCUS_26270 2203 1202 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245818.1 protein_id gnl|my_center|LOCUS_26270 3642 2284 gene locus_tag LOCUS_26280 gene opmH 3642 2284 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_26280 4388 3717 gene locus_tag LOCUS_26290 4388 3717 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_26290 5190 4717 gene locus_tag LOCUS_26300 5190 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence233 <1 1133 gene locus_tag LOCUS_26310 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938562.1:type II secretion system protein 1130 1795 gene locus_tag LOCUS_26320 1130 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2436 2867 gene locus_tag LOCUS_26330 2436 2867 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_26330 2857 3639 gene locus_tag LOCUS_26340 2857 3639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522426.1 protein_id gnl|my_center|LOCUS_26340 4082 4444 gene locus_tag LOCUS_26350 gene ndhC 4082 4444 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence234 2876 387 gene locus_tag LOCUS_26360 gene rnr 2876 387 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_26360 3085 3171 gene locus_tag LOCUS_t00330 3085 3171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4704 4940 gene locus_tag LOCUS_26370 4704 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence235 528 1505 gene locus_tag LOCUS_26380 528 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3778 1916 gene locus_tag LOCUS_26390 3778 1916 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_26390 3899 4366 gene locus_tag LOCUS_26400 3899 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4422 4814 gene locus_tag LOCUS_26410 4422 4814 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence236 <1 624 gene locus_tag LOCUS_26420 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057223.1:ABC transporter permease 1021 632 gene locus_tag LOCUS_26430 1021 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1105 1323 gene locus_tag LOCUS_26440 1105 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1448 1750 gene locus_tag LOCUS_26450 1448 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1804 2601 gene locus_tag LOCUS_26460 1804 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2607 4058 gene locus_tag LOCUS_26470 2607 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4091 4504 gene locus_tag LOCUS_26480 gene arfB 4091 4504 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence237 516 1202 gene locus_tag LOCUS_26490 516 1202 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_26490 2313 1498 gene locus_tag LOCUS_26500 2313 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2889 2524 gene locus_tag LOCUS_26510 2889 2524 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_26510 3275 2898 gene locus_tag LOCUS_26520 3275 2898 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_26520 3556 3284 gene locus_tag LOCUS_26530 3556 3284 CDS product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073455.1 protein_id gnl|my_center|LOCUS_26530 <5309 4435 gene locus_tag LOCUS_26540 <5309 4435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483054.1:lipase family protein >Feature sequence238 1854 736 gene locus_tag LOCUS_26550 gene algZ 1854 736 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_26550 2014 3405 gene locus_tag LOCUS_26560 gene argH 2014 3405 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_26560 3459 4409 gene locus_tag LOCUS_26570 3459 4409 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence239 788 3082 gene locus_tag LOCUS_26580 788 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3159 3758 gene locus_tag LOCUS_26590 3159 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence240 170 1267 gene locus_tag LOCUS_26600 gene cas7e 170 1267 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942036.1 protein_id gnl|my_center|LOCUS_26600 1273 1935 gene locus_tag LOCUS_26610 gene cas5e 1273 1935 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942037.1 protein_id gnl|my_center|LOCUS_26610 1925 2521 gene locus_tag LOCUS_26620 gene cas6e 1925 2521 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281400.1 protein_id gnl|my_center|LOCUS_26620 2603 2926 gene locus_tag LOCUS_26630 2603 2926 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_26630 2919 3425 gene locus_tag LOCUS_26640 2919 3425 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_26640 3450 4364 gene locus_tag LOCUS_26650 gene cas1e 3450 4364 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_26650 4366 4659 gene locus_tag LOCUS_26660 gene cas2e 4366 4659 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_26660 4763 5280 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacatgcgtggggatgaaccg >Feature sequence241 617 1435 gene locus_tag LOCUS_26670 617 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1432 2271 gene locus_tag LOCUS_26680 1432 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2279 3841 gene locus_tag LOCUS_26690 2279 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 4212 4469 gene locus_tag LOCUS_26700 4212 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 4470 4655 gene locus_tag LOCUS_26710 4470 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence242 1492 2643 gene locus_tag LOCUS_26720 1492 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3519 2839 gene locus_tag LOCUS_26730 3519 2839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_26730 4753 3560 gene locus_tag LOCUS_26740 4753 3560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_26740 5199 4798 gene locus_tag LOCUS_26750 5199 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence243 1886 948 gene locus_tag LOCUS_26760 gene ispH 1886 948 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_26760 2639 2175 gene locus_tag LOCUS_26770 2639 2175 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318786.1 protein_id gnl|my_center|LOCUS_26770 3168 2641 gene locus_tag LOCUS_26780 gene lspA 3168 2641 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_26780 <5115 3178 gene locus_tag LOCUS_26790 <5115 3178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704643.1:isoleucine--tRNA ligase >Feature sequence244 618 1397 gene locus_tag LOCUS_26800 618 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2486 1908 gene locus_tag LOCUS_26810 2486 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3564 2494 gene locus_tag LOCUS_26820 gene amrS 3564 2494 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_26820 3694 3769 gene locus_tag LOCUS_t00340 3694 3769 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4179 4601 gene locus_tag LOCUS_26830 4179 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence245 1542 580 gene locus_tag LOCUS_26840 gene arsS 1542 580 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_26840 1813 2424 gene locus_tag LOCUS_26850 1813 2424 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_26850 2421 2675 gene locus_tag LOCUS_26860 2421 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2768 2843 gene locus_tag LOCUS_t00350 2768 2843 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3059 3442 gene locus_tag LOCUS_26870 3059 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3742 3818 gene locus_tag LOCUS_t00360 3742 3818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3851 4192 gene locus_tag LOCUS_26880 3851 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4511 4197 gene locus_tag LOCUS_26890 4511 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence246 838 1290 gene locus_tag LOCUS_26900 838 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1330 1557 gene locus_tag LOCUS_26910 gene rpsR 1330 1557 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_26910 1634 2542 gene locus_tag LOCUS_26920 1634 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_26920 2605 3054 gene locus_tag LOCUS_26930 gene rplI 2605 3054 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421134.1 protein_id gnl|my_center|LOCUS_26930 3328 4746 gene locus_tag LOCUS_26940 gene dnaB 3328 4746 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence247 350 694 gene locus_tag LOCUS_26950 350 694 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_26950 739 1230 gene locus_tag LOCUS_26960 739 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4210 1622 gene locus_tag LOCUS_26970 4210 1622 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_26970 4960 4211 gene locus_tag LOCUS_26980 4960 4211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence248 1555 1085 gene locus_tag LOCUS_26990 1555 1085 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670174.1 protein_id gnl|my_center|LOCUS_26990 2484 1552 gene locus_tag LOCUS_27000 2484 1552 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_27000 3218 2556 gene locus_tag LOCUS_27010 3218 2556 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_27010 3826 3245 gene locus_tag LOCUS_27020 gene rpoE 3826 3245 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence249 3540 2359 gene locus_tag LOCUS_27030 3540 2359 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_27030 4938 3541 gene locus_tag LOCUS_27040 4938 3541 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence250 654 523 gene locus_tag LOCUS_27050 654 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1057 662 gene locus_tag LOCUS_27060 1057 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1300 1070 gene locus_tag LOCUS_27070 1300 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1464 3059 gene locus_tag LOCUS_27080 1464 3059 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_27080 3096 3356 gene locus_tag LOCUS_27090 3096 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4197 3394 gene locus_tag LOCUS_27100 4197 3394 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_27100 4771 4373 gene locus_tag LOCUS_27110 4771 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence251 2594 3346 gene locus_tag LOCUS_27120 2594 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence252 174 446 gene locus_tag LOCUS_27130 174 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 443 1297 gene locus_tag LOCUS_27140 gene ccoP 443 1297 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_27140 1581 3008 gene locus_tag LOCUS_27150 gene ccoG 1581 3008 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085552.1 protein_id gnl|my_center|LOCUS_27150 3031 3606 gene locus_tag LOCUS_27160 3031 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence253 982 518 gene locus_tag LOCUS_27170 982 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2032 2346 gene locus_tag LOCUS_27180 2032 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2381 2959 gene locus_tag LOCUS_27190 2381 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 <4891 3049 gene locus_tag LOCUS_27200 <4891 3049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038070.1:DNA helicase RecQ >Feature sequence254 1135 2253 gene locus_tag LOCUS_27210 gene lptF 1135 2253 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375972.1 protein_id gnl|my_center|LOCUS_27210 2256 3320 gene locus_tag LOCUS_27220 gene lptG 2256 3320 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_27220 <4861 3514 gene locus_tag LOCUS_27230 <4861 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086299.1:thiosulfohydrolase SoxB >Feature sequence255 306 1376 gene locus_tag LOCUS_27240 306 1376 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_27240 3295 2069 gene locus_tag LOCUS_27250 3295 2069 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_27250 4091 3288 gene locus_tag LOCUS_27260 4091 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence256 390 668 gene locus_tag LOCUS_27270 390 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 682 1917 gene locus_tag LOCUS_27280 682 1917 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 protein_id gnl|my_center|LOCUS_27280 2538 1957 gene locus_tag LOCUS_27290 2538 1957 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 protein_id gnl|my_center|LOCUS_27290 2742 3062 gene locus_tag LOCUS_27300 2742 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3583 3056 gene locus_tag LOCUS_27310 3583 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3742 4542 gene locus_tag LOCUS_27320 gene mazG 3742 4542 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence257 767 2953 gene locus_tag LOCUS_27330 gene uvrD 767 2953 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383400.1 protein_id gnl|my_center|LOCUS_27330 3255 4352 gene locus_tag LOCUS_27340 gene dctP 3255 4352 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence258 <1 659 gene locus_tag LOCUS_27350 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115557.1:tRNA glutamyl-Q(34) synthetase GluQRS 1156 704 gene locus_tag LOCUS_27360 1156 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1979 1170 gene locus_tag LOCUS_27370 gene dapB 1979 1170 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_27370 2549 2127 gene locus_tag LOCUS_27380 2549 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 4116 2977 gene locus_tag LOCUS_27390 gene dnaJ 4116 2977 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_27390 <4813 4304 gene locus_tag LOCUS_27400 <4813 4304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770882.1:molecular chaperone DnaK >Feature sequence259 805 302 gene locus_tag LOCUS_27410 805 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 914 792 gene locus_tag LOCUS_27420 914 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1642 914 gene locus_tag LOCUS_27430 1642 914 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_27430 2012 1734 gene locus_tag LOCUS_27440 2012 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2876 2094 gene locus_tag LOCUS_27450 2876 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 4269 3061 gene locus_tag LOCUS_27460 4269 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence260 1351 494 gene locus_tag LOCUS_27470 1351 494 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_27470 3771 1567 gene locus_tag LOCUS_27480 3771 1567 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_27480 4326 3814 gene locus_tag LOCUS_27490 4326 3814 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence261 1340 1921 gene locus_tag LOCUS_27500 gene rsxA 1340 1921 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_27500 1932 2504 gene locus_tag LOCUS_27510 gene rsxB 1932 2504 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_27510 2504 4201 gene locus_tag LOCUS_27520 gene rsxC 2504 4201 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144393375.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence262 624 499 gene locus_tag LOCUS_27530 624 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1300 590 gene locus_tag LOCUS_27540 1300 590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_27540 2507 1302 gene locus_tag LOCUS_27550 2507 1302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_27550 3655 2504 gene locus_tag LOCUS_27560 3655 2504 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_27560 4260 3652 gene locus_tag LOCUS_27570 gene slmA 4260 3652 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence263 3418 674 gene locus_tag LOCUS_27580 3418 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 4541 3621 gene locus_tag LOCUS_27590 4541 3621 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046860082.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence264 1166 870 gene locus_tag LOCUS_27600 gene lsrG 1166 870 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_27600 2964 1264 gene locus_tag LOCUS_27610 2964 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4176 2968 gene locus_tag LOCUS_27620 4176 2968 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261901.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence265 939 670 gene locus_tag LOCUS_27630 939 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1541 1047 gene locus_tag LOCUS_27640 1541 1047 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 protein_id gnl|my_center|LOCUS_27640 1916 1710 gene locus_tag LOCUS_27650 1916 1710 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 protein_id gnl|my_center|LOCUS_27650 2132 1965 gene locus_tag LOCUS_27660 2132 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3055 2759 gene locus_tag LOCUS_27670 3055 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence266 1298 315 gene locus_tag LOCUS_27680 1298 315 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_27680 2088 1336 gene locus_tag LOCUS_27690 2088 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3425 2088 gene locus_tag LOCUS_27700 3425 2088 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_27700 <4644 3517 gene locus_tag LOCUS_27710 <4644 3517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038780.1:glycosyltransferase family 1 protein >Feature sequence267 746 3070 gene locus_tag LOCUS_27720 746 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence268 2299 584 gene locus_tag LOCUS_27730 2299 584 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_27730 4006 3023 gene locus_tag LOCUS_27740 4006 3023 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence269 1010 1642 gene locus_tag LOCUS_27750 1010 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1832 3652 gene locus_tag LOCUS_27760 1832 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence270 <1 2549 gene locus_tag LOCUS_27770 <1 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004184913.1:type VI secretion system tip protein TssI/VgrG >Feature sequence271 472 753 gene locus_tag LOCUS_27780 472 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 969 1532 gene locus_tag LOCUS_27790 969 1532 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_27790 1561 2622 gene locus_tag LOCUS_27800 gene lpxD 1561 2622 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_27800 2622 3098 gene locus_tag LOCUS_27810 gene fabZ 2622 3098 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_27810 3111 3881 gene locus_tag LOCUS_27820 gene lpxA 3111 3881 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946259.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence272 <1 916 gene locus_tag LOCUS_27830 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704561.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 907 1065 gene locus_tag LOCUS_27840 907 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1081 1521 gene locus_tag LOCUS_27850 1081 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1661 1870 gene locus_tag LOCUS_27860 1661 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1891 2643 gene locus_tag LOCUS_27870 1891 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2702 3352 gene locus_tag LOCUS_27880 2702 3352 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence273 272 1453 gene locus_tag LOCUS_27890 272 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1535 1459 gene locus_tag LOCUS_t00370 1535 1459 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2609 1572 gene locus_tag LOCUS_27900 gene ispB 2609 1572 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_27900 2836 3147 gene locus_tag LOCUS_27910 gene rplU 2836 3147 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_27910 3192 3449 gene locus_tag LOCUS_27920 gene rpmA 3192 3449 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence274 1750 443 gene locus_tag LOCUS_27930 1750 443 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_27930 2264 2395 gene locus_tag LOCUS_27940 2264 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 <4424 3052 gene locus_tag LOCUS_27950 <4424 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704419.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase >Feature sequence275 1783 329 gene locus_tag LOCUS_27960 1783 329 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_27960 2417 1950 gene locus_tag LOCUS_27970 2417 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4336 2483 gene locus_tag LOCUS_27980 4336 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence276 1481 87 gene locus_tag LOCUS_27990 1481 87 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_27990 1836 1453 gene locus_tag LOCUS_28000 1836 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2384 4234 gene locus_tag LOCUS_28010 2384 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence277 31 1020 gene locus_tag LOCUS_28020 31 1020 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_28020 1017 2294 gene locus_tag LOCUS_28030 1017 2294 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 protein_id gnl|my_center|LOCUS_28030 2336 3211 gene locus_tag LOCUS_28040 2336 3211 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence278 <1 904 gene locus_tag LOCUS_28050 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113354.1:excinuclease ABC subunit UvrC 924 1499 gene locus_tag LOCUS_28060 gene pgsA 924 1499 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_28060 1570 1645 gene locus_tag LOCUS_t00380 1570 1645 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1780 1853 gene locus_tag LOCUS_t00390 1780 1853 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1927 2013 gene locus_tag LOCUS_t00400 1927 2013 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence279 <1 1401 gene locus_tag LOCUS_28070 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064848.1:AAA family ATPase 1952 3451 gene locus_tag LOCUS_28080 1952 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence280 1690 311 gene locus_tag LOCUS_28090 1690 311 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105208.1 protein_id gnl|my_center|LOCUS_28090 3363 1723 gene locus_tag LOCUS_28100 3363 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3648 3968 gene locus_tag LOCUS_28110 3648 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence281 3552 1936 gene locus_tag LOCUS_28120 3552 1936 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_28120 <4133 3560 gene locus_tag LOCUS_28130 <4133 3560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025862491.1:exodeoxyribonuclease III >Feature sequence282 798 91 gene locus_tag LOCUS_28140 798 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_28140 3030 877 gene locus_tag LOCUS_28150 3030 877 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_28150 3494 3940 gene locus_tag LOCUS_28160 3494 3940 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence283 1352 903 gene locus_tag LOCUS_28170 1352 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28170 1573 1415 gene locus_tag LOCUS_28180 1573 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2249 2058 gene locus_tag LOCUS_28190 2249 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence284 47 454 gene locus_tag LOCUS_28200 47 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1564 653 gene locus_tag LOCUS_28210 1564 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1926 3914 gene locus_tag LOCUS_28220 1926 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence285 1076 408 gene locus_tag LOCUS_28230 gene cbiC 1076 408 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_28230 1960 1073 gene locus_tag LOCUS_28240 1960 1073 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_28240 2791 1997 gene locus_tag LOCUS_28250 gene cobM 2791 1997 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_28250 3506 2793 gene locus_tag LOCUS_28260 3506 2793 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091061.1 protein_id gnl|my_center|LOCUS_28260 3724 3521 gene locus_tag LOCUS_28270 3724 3521 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766274.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence286 1630 317 gene locus_tag LOCUS_28280 1630 317 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_28280 2308 1781 gene locus_tag LOCUS_28290 2308 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2662 2312 gene locus_tag LOCUS_28300 2662 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2784 2659 gene locus_tag LOCUS_28310 2784 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 <3914 2947 gene locus_tag LOCUS_28320 <3914 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005739631.1:alanine transaminase >Feature sequence287 676 1806 gene locus_tag LOCUS_28330 676 1806 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_28330 1833 2390 gene locus_tag LOCUS_28340 1833 2390 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_28340 2441 3499 gene locus_tag LOCUS_28350 2441 3499 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence288 3869 1071 gene locus_tag LOCUS_28360 3869 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence289 3399 1564 gene locus_tag LOCUS_28370 3399 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence290 422 1408 gene locus_tag LOCUS_28380 gene dusB 422 1408 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_28380 1405 1704 gene locus_tag LOCUS_28390 gene fis 1405 1704 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_28390 1819 3384 gene locus_tag LOCUS_28400 gene purH 1819 3384 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187534.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence291 <1 3015 gene locus_tag LOCUS_28410 <1 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086886.1:CusA/CzcA family heavy metal efflux RND transporter 3012 3320 gene locus_tag LOCUS_28420 3012 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence292 1475 384 gene locus_tag LOCUS_28430 gene apbC 1475 384 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence293 <3793 1067 gene locus_tag LOCUS_28440 <3793 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459807.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence294 <1 727 gene locus_tag LOCUS_28450 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947958.1:GMP synthase 2063 1221 gene locus_tag LOCUS_28460 gene fghA 2063 1221 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072128.1 protein_id gnl|my_center|LOCUS_28460 3188 2079 gene locus_tag LOCUS_28470 3188 2079 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence295 147 356 gene locus_tag LOCUS_28480 147 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 356 1201 gene locus_tag LOCUS_28490 356 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1917 1198 gene locus_tag LOCUS_28500 gene lpxH 1917 1198 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 protein_id gnl|my_center|LOCUS_28500 2472 1972 gene locus_tag LOCUS_28510 2472 1972 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_28510 3143 2520 gene locus_tag LOCUS_28520 3143 2520 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence296 202 468 gene locus_tag LOCUS_28530 202 468 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_28530 455 700 gene locus_tag LOCUS_28540 455 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1877 762 gene locus_tag LOCUS_28550 1877 762 CDS product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_28550 2192 2509 gene locus_tag LOCUS_28560 2192 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3175 2567 gene locus_tag LOCUS_28570 gene alkA 3175 2567 CDS product 3-methyladenine DNA glycosylase AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889208.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence297 1334 243 gene locus_tag LOCUS_28580 gene modC 1334 243 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_28580 2011 1331 gene locus_tag LOCUS_28590 gene modB 2011 1331 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence298 683 366 gene locus_tag LOCUS_28600 683 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 925 683 gene locus_tag LOCUS_28610 925 683 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_28610 1651 1884 gene locus_tag LOCUS_28620 1651 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1871 2134 gene locus_tag LOCUS_28630 1871 2134 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_28630 2918 2208 gene locus_tag LOCUS_28640 2918 2208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210766.1 protein_id gnl|my_center|LOCUS_28640 <3609 2911 gene locus_tag LOCUS_28650 <3609 2911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003376420.1:urea ABC transporter ATP-binding protein UrtD >Feature sequence299 828 1052 gene locus_tag LOCUS_28660 828 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence300 1734 460 gene locus_tag LOCUS_28670 1734 460 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_28670 3256 2093 gene locus_tag LOCUS_28680 3256 2093 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990623.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence301 1192 2061 gene locus_tag LOCUS_28690 1192 2061 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_28690 2554 2117 gene locus_tag LOCUS_28700 2554 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2702 3379 gene locus_tag LOCUS_28710 2702 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence302 1614 955 gene locus_tag LOCUS_28720 1614 955 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 protein_id gnl|my_center|LOCUS_28720 2716 1745 gene locus_tag LOCUS_28730 2716 1745 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_28730 3017 2802 gene locus_tag LOCUS_28740 3017 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3367 3014 gene locus_tag LOCUS_28750 3367 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence303 861 205 gene locus_tag LOCUS_28760 gene rpiA 861 205 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_28760 1044 2561 gene locus_tag LOCUS_28770 gene ilvA 1044 2561 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082739.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence304 52 282 gene locus_tag LOCUS_28780 52 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 279 1136 gene locus_tag LOCUS_28790 279 1136 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_28790 1261 1563 gene locus_tag LOCUS_28800 gene ureA 1261 1563 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_28800 1587 1916 gene locus_tag LOCUS_28810 1587 1916 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence305 <1 1287 gene locus_tag LOCUS_28820 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060993346.1:DUF3413 domain-containing protein 1293 2804 gene locus_tag LOCUS_28830 gene gcvPB 1293 2804 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_28830 2801 3163 gene locus_tag LOCUS_28840 2801 3163 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence306 1872 3335 gene locus_tag LOCUS_28850 1872 3335 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787346.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence307 1750 1628 gene locus_tag LOCUS_28860 1750 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2388 1921 gene locus_tag LOCUS_28870 2388 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2969 2382 gene locus_tag LOCUS_28880 2969 2382 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence308 412 5 gene locus_tag LOCUS_28890 412 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28890 922 1095 gene locus_tag LOCUS_28900 922 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1116 1403 gene locus_tag LOCUS_28910 1116 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1461 1940 gene locus_tag LOCUS_28920 1461 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 1944 2471 gene locus_tag LOCUS_28930 1944 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3166 3026 gene locus_tag LOCUS_28940 3166 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28940 >Feature sequence309 1173 496 gene locus_tag LOCUS_28950 1173 496 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_28950 1493 1170 gene locus_tag LOCUS_28960 gene cyaY 1493 1170 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_28960 1735 2988 gene locus_tag LOCUS_28970 gene lysA 1735 2988 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence310 <1 1622 gene locus_tag LOCUS_28980 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter 2173 3195 gene locus_tag LOCUS_28990 2173 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence311 1134 1910 gene locus_tag LOCUS_29000 1134 1910 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_29000 2188 2805 gene locus_tag LOCUS_29010 2188 2805 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_29010 <3366 2812 gene locus_tag LOCUS_29020 <3366 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391767.1:GGDEF domain-containing protein >Feature sequence312 <1 2769 gene locus_tag LOCUS_29030 <1 2769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392027.1:SbcC/MukB-like Walker B domain-containing protein >Feature sequence313 2582 1536 gene locus_tag LOCUS_29040 2582 1536 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_29040 <3344 2564 gene locus_tag LOCUS_29050 <3344 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004435696.1:glucose-1-phosphate cytidylyltransferase >Feature sequence314 584 1237 gene locus_tag LOCUS_29060 584 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 1234 2580 gene locus_tag LOCUS_29070 1234 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence315 421 131 gene locus_tag LOCUS_29080 421 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 995 1561 gene locus_tag LOCUS_29090 995 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1558 1839 gene locus_tag LOCUS_29100 1558 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 2728 2405 gene locus_tag LOCUS_29110 2728 2405 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_29110 3010 2741 gene locus_tag LOCUS_29120 3010 2741 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence316 1877 549 gene locus_tag LOCUS_29130 1877 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2893 2033 gene locus_tag LOCUS_29140 2893 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence317 238 783 gene locus_tag LOCUS_29150 238 783 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021102.1 protein_id gnl|my_center|LOCUS_29150 790 1005 gene locus_tag LOCUS_29160 790 1005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 protein_id gnl|my_center|LOCUS_29160 1002 1349 gene locus_tag LOCUS_29170 1002 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence318 <1 580 gene locus_tag LOCUS_29180 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811896.1:flagellar basal body P-ring formation chaperone FlgA 671 1003 gene locus_tag LOCUS_29190 671 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1052 1564 gene locus_tag LOCUS_29200 1052 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1596 2351 gene locus_tag LOCUS_29210 1596 2351 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404320.1 protein_id gnl|my_center|LOCUS_29210 3015 2359 gene locus_tag LOCUS_29220 3015 2359 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence319 <1 1013 gene locus_tag LOCUS_29230 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044393613.1:ATP-binding protein 1013 1945 gene locus_tag LOCUS_29240 1013 1945 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_29240 2412 2666 gene locus_tag LOCUS_29250 2412 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence320 <1 682 gene locus_tag LOCUS_29260 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082226.1:diguanylate cyclase RoeA 2186 750 gene locus_tag LOCUS_29270 gene gatB 2186 750 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_29270 <3238 2322 gene locus_tag LOCUS_29280 <3238 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766477.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence321 >Feature sequence322 160 1488 gene locus_tag LOCUS_29290 160 1488 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137931707.1 protein_id gnl|my_center|LOCUS_29290 1966 2964 gene locus_tag LOCUS_29300 gene galE 1966 2964 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence323 263 577 gene locus_tag LOCUS_29310 263 577 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_29310 583 1053 gene locus_tag LOCUS_29320 583 1053 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_29320 1143 1943 gene locus_tag LOCUS_29330 1143 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2005 2778 gene locus_tag LOCUS_29340 gene yaaA 2005 2778 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence324 2513 591 gene locus_tag LOCUS_29350 2513 591 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_29350 2736 3014 gene locus_tag LOCUS_29360 2736 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence325 228 500 gene locus_tag LOCUS_29370 228 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1075 1626 gene locus_tag LOCUS_29380 1075 1626 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 protein_id gnl|my_center|LOCUS_29380 1634 2389 gene locus_tag LOCUS_29390 1634 2389 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_29390 <3137 2600 gene locus_tag LOCUS_29400 <3137 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000825630.1:peptidoglycan binding protein CsiV >Feature sequence326 129 539 gene locus_tag LOCUS_29410 129 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 576 1352 gene locus_tag LOCUS_29420 576 1352 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_29420 1785 2714 gene locus_tag LOCUS_29430 1785 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence327 1317 553 gene locus_tag LOCUS_29440 1317 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1419 2399 gene locus_tag LOCUS_29450 gene rluD 1419 2399 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence328 3003 904 gene locus_tag LOCUS_29460 gene secA 3003 904 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence329 704 1336 gene locus_tag LOCUS_29470 704 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1323 1745 gene locus_tag LOCUS_29480 1323 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 1729 2451 gene locus_tag LOCUS_29490 1729 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence330 1210 1413 gene locus_tag LOCUS_29500 1210 1413 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_29500 1388 1738 gene locus_tag LOCUS_29510 1388 1738 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_29510 <2951 2183 gene locus_tag LOCUS_29520 <2951 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004184814.1:MFS transporter >Feature sequence331 <2886 2186 gene locus_tag LOCUS_29530 <2886 2186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947958.1:GMP synthase >Feature sequence332 813 1292 gene locus_tag LOCUS_29540 813 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1499 1302 gene locus_tag LOCUS_29550 1499 1302 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_29550 2237 1569 gene locus_tag LOCUS_29560 2237 1569 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_29560 2693 2274 gene locus_tag LOCUS_29570 2693 2274 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence333 1550 684 gene locus_tag LOCUS_29580 1550 684 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072110.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence334 1028 2464 gene locus_tag LOCUS_29590 gene hldE 1028 2464 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence335 <1 979 gene locus_tag LOCUS_29600 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel 1408 1007 gene locus_tag LOCUS_29610 1408 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence336 941 6 gene locus_tag LOCUS_29620 941 6 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_29620 1982 1002 gene locus_tag LOCUS_29630 1982 1002 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231814.1 protein_id gnl|my_center|LOCUS_29630 <2726 2016 gene locus_tag LOCUS_29640 <2726 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530131.1:3-oxoadipate enol-lactonase >Feature sequence337 372 995 gene locus_tag LOCUS_29650 gene cas4 372 995 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 protein_id gnl|my_center|LOCUS_29650 992 2008 gene locus_tag LOCUS_29660 gene cas1c 992 2008 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_29660 2011 2304 gene locus_tag LOCUS_29670 gene cas2 2011 2304 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_29670 2479 2703 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccttcacgggcgcgtggattgaaac >Feature sequence338 101 26 gene locus_tag LOCUS_t00410 101 26 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 238 163 gene locus_tag LOCUS_t00420 238 163 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1996 278 gene locus_tag LOCUS_29680 1996 278 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_29680 <2678 2007 gene locus_tag LOCUS_29690 <2678 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815864.1:glutamate--tRNA ligase >Feature sequence339 1551 475 gene locus_tag LOCUS_29700 1551 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_29700 2600 1557 gene locus_tag LOCUS_29710 gene queA 2600 1557 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_29710 >Feature sequence340 2115 1384 gene locus_tag LOCUS_29720 gene bfmR 2115 1384 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence341 2026 140 gene locus_tag LOCUS_29730 2026 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925887.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence342 571 1008 gene locus_tag LOCUS_29740 571 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1136 2383 gene locus_tag LOCUS_29750 1136 2383 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence343 419 1498 gene locus_tag LOCUS_29760 419 1498 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence344 888 2153 gene locus_tag LOCUS_29770 888 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence345 872 330 gene locus_tag LOCUS_29780 872 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 1103 1936 gene locus_tag LOCUS_29790 1103 1936 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence346 616 1167 gene locus_tag LOCUS_29800 gene def 616 1167 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence347 2211 1831 gene locus_tag LOCUS_29810 2211 1831 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940111.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence348 774 25 gene locus_tag LOCUS_29820 gene modA 774 25 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_29820