>Feature sequence001 1056 133 gene locus_tag LOCUS_00010 1056 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2326 1037 gene locus_tag LOCUS_00020 gene spoVE 2326 1037 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_00020 2897 2430 gene locus_tag LOCUS_00030 2897 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4408 3080 gene locus_tag LOCUS_00040 gene mnmE 4408 3080 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528733.1 protein_id gnl|my_center|LOCUS_00040 6587 4419 gene locus_tag LOCUS_00050 6587 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7422 6643 gene locus_tag LOCUS_00060 7422 6643 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_00060 7619 8203 gene locus_tag LOCUS_00070 7619 8203 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_00070 8224 8847 gene locus_tag LOCUS_00080 gene clpP 8224 8847 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_00080 10212 8923 gene locus_tag LOCUS_00090 10212 8923 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_00090 11444 10233 gene locus_tag LOCUS_00100 11444 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12296 11448 gene locus_tag LOCUS_00110 12296 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12863 12423 gene locus_tag LOCUS_00120 12863 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13857 12973 gene locus_tag LOCUS_00130 13857 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14760 13870 gene locus_tag LOCUS_00140 14760 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15542 14940 gene locus_tag LOCUS_00150 15542 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17172 15886 gene locus_tag LOCUS_00160 17172 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17333 17986 gene locus_tag LOCUS_00170 17333 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18108 19427 gene locus_tag LOCUS_00180 18108 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19595 22021 gene locus_tag LOCUS_00190 19595 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22117 22341 gene locus_tag LOCUS_00200 22117 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24139 22373 gene locus_tag LOCUS_00210 24139 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24642 24136 gene locus_tag LOCUS_00220 24642 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24821 25282 gene locus_tag LOCUS_00230 24821 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25311 25595 gene locus_tag LOCUS_00240 25311 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25585 25953 gene locus_tag LOCUS_00250 25585 25953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27485 26049 gene locus_tag LOCUS_00260 gene mgtE 27485 26049 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_00260 27590 29839 gene locus_tag LOCUS_00270 27590 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30046 30780 gene locus_tag LOCUS_00280 30046 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32285 30840 gene locus_tag LOCUS_00290 32285 30840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32529 32966 gene locus_tag LOCUS_00300 gene rplM 32529 32966 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_00300 33023 33568 gene locus_tag LOCUS_00310 33023 33568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33695 34405 gene locus_tag LOCUS_00320 33695 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35202 34408 gene locus_tag LOCUS_00330 35202 34408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35890 35213 gene locus_tag LOCUS_00340 35890 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36477 35911 gene locus_tag LOCUS_00350 36477 35911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36762 37346 gene locus_tag LOCUS_00360 36762 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37343 38023 gene locus_tag LOCUS_00370 37343 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38121 38387 gene locus_tag LOCUS_00380 38121 38387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38387 40405 gene locus_tag LOCUS_00390 38387 40405 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_00390 40402 40587 gene locus_tag LOCUS_00400 40402 40587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42076 40910 gene locus_tag LOCUS_00410 gene sat 42076 40910 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_00410 43013 42216 gene locus_tag LOCUS_00420 43013 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43155 43553 gene locus_tag LOCUS_00430 43155 43553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43571 44512 gene locus_tag LOCUS_00440 43571 44512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 44852 45700 gene locus_tag LOCUS_00450 gene kdsA 44852 45700 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_00450 45757 46446 gene locus_tag LOCUS_00460 45757 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47138 46443 gene locus_tag LOCUS_00470 47138 46443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47758 47246 gene locus_tag LOCUS_00480 47758 47246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48410 47769 gene locus_tag LOCUS_00490 48410 47769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49838 48666 gene locus_tag LOCUS_00500 49838 48666 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_00500 51321 50005 gene locus_tag LOCUS_00510 51321 50005 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_00510 52914 51394 gene locus_tag LOCUS_00520 52914 51394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54197 53130 gene locus_tag LOCUS_00530 54197 53130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54309 54959 gene locus_tag LOCUS_00540 54309 54959 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_00540 55086 56069 gene locus_tag LOCUS_00550 55086 56069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 protein_id gnl|my_center|LOCUS_00550 56505 56230 gene locus_tag LOCUS_00560 gene rpmA 56505 56230 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056021.1 protein_id gnl|my_center|LOCUS_00560 57263 56556 gene locus_tag LOCUS_00570 57263 56556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57755 57546 gene locus_tag LOCUS_00580 57755 57546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57675 58343 gene locus_tag LOCUS_00590 57675 58343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 58837 60429 gene locus_tag LOCUS_00600 gene dnaA 58837 60429 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_00600 60530 61684 gene locus_tag LOCUS_00610 60530 61684 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_00610 61755 62114 gene locus_tag LOCUS_00620 61755 62114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62424 63944 gene locus_tag LOCUS_00630 62424 63944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65699 64071 gene locus_tag LOCUS_00640 65699 64071 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_00640 65930 66730 gene locus_tag LOCUS_00650 65930 66730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66890 69835 gene locus_tag LOCUS_00660 66890 69835 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123442.1 protein_id gnl|my_center|LOCUS_00660 70043 71779 gene locus_tag LOCUS_00670 70043 71779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71875 72789 gene locus_tag LOCUS_00680 gene folP 71875 72789 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227766.1 protein_id gnl|my_center|LOCUS_00680 72843 73172 gene locus_tag LOCUS_00690 gene trxA 72843 73172 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_00690 73212 74252 gene locus_tag LOCUS_00700 73212 74252 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_00700 74347 75846 gene locus_tag LOCUS_00710 74347 75846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75862 76572 gene locus_tag LOCUS_00720 75862 76572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77081 76632 gene locus_tag LOCUS_00730 gene dut 77081 76632 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_00730 77482 77108 gene locus_tag LOCUS_00740 77482 77108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79013 77499 gene locus_tag LOCUS_00750 79013 77499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79080 79727 gene locus_tag LOCUS_00760 gene ruvA 79080 79727 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804997.1 protein_id gnl|my_center|LOCUS_00760 79749 80846 gene locus_tag LOCUS_00770 79749 80846 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_00770 80846 81283 gene locus_tag LOCUS_00780 gene ruvX 80846 81283 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214669.1 protein_id gnl|my_center|LOCUS_00780 81425 82459 gene locus_tag LOCUS_00790 81425 82459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 82456 85068 gene locus_tag LOCUS_00800 82456 85068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85816 85070 gene locus_tag LOCUS_00810 85816 85070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85946 87289 gene locus_tag LOCUS_00820 85946 87289 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_00820 87292 87873 gene locus_tag LOCUS_00830 87292 87873 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_00830 87910 89127 gene locus_tag LOCUS_00840 87910 89127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 89310 91970 gene locus_tag LOCUS_00850 89310 91970 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247075.1 protein_id gnl|my_center|LOCUS_00850 92219 93286 gene locus_tag LOCUS_00860 92219 93286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93457 94572 gene locus_tag LOCUS_00870 93457 94572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94640 95494 gene locus_tag LOCUS_00880 94640 95494 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391395.1 protein_id gnl|my_center|LOCUS_00880 95688 95491 gene locus_tag LOCUS_00890 95688 95491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 96359 95829 gene locus_tag LOCUS_00900 gene trmL 96359 95829 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_00900 97687 96359 gene locus_tag LOCUS_00910 97687 96359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98714 97845 gene locus_tag LOCUS_00920 98714 97845 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_00920 98778 99674 gene locus_tag LOCUS_00930 98778 99674 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_00930 100626 99676 gene locus_tag LOCUS_00940 100626 99676 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_00940 101464 100688 gene locus_tag LOCUS_00950 101464 100688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 102248 101484 gene locus_tag LOCUS_00960 102248 101484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 103045 102263 gene locus_tag LOCUS_00970 103045 102263 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001626196.1 protein_id gnl|my_center|LOCUS_00970 103097 104035 gene locus_tag LOCUS_00980 103097 104035 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_00980 104129 106594 gene locus_tag LOCUS_00990 104129 106594 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_00990 107762 106626 gene locus_tag LOCUS_01000 107762 106626 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122832.1 protein_id gnl|my_center|LOCUS_01000 108751 107744 gene locus_tag LOCUS_01010 108751 107744 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_01010 108810 111305 gene locus_tag LOCUS_01020 108810 111305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111308 112996 gene locus_tag LOCUS_01030 gene gspE 111308 112996 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_01030 113306 113578 gene locus_tag LOCUS_01040 113306 113578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115488 114307 gene locus_tag LOCUS_01050 gene aroC 115488 114307 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_01050 115487 116269 gene locus_tag LOCUS_01060 115487 116269 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838205.1 protein_id gnl|my_center|LOCUS_01060 116324 116620 gene locus_tag LOCUS_01070 116324 116620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 116715 116627 gene locus_tag LOCUS_t00010 116715 116627 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 117867 116938 gene locus_tag LOCUS_01080 117867 116938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 119456 117900 gene locus_tag LOCUS_01090 119456 117900 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118668.1 protein_id gnl|my_center|LOCUS_01090 120510 119506 gene locus_tag LOCUS_01100 gene pdxA 120510 119506 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 protein_id gnl|my_center|LOCUS_01100 120665 120949 gene locus_tag LOCUS_01110 120665 120949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 122786 120999 gene locus_tag LOCUS_01120 122786 120999 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_01120 124154 122796 gene locus_tag LOCUS_01130 124154 122796 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_01130 124471 124836 gene locus_tag LOCUS_01140 124471 124836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 125033 125878 gene locus_tag LOCUS_01150 gene phhA 125033 125878 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195799.1 protein_id gnl|my_center|LOCUS_01150 126391 125936 gene locus_tag LOCUS_01160 126391 125936 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_01160 126517 126936 gene locus_tag LOCUS_01170 126517 126936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 126955 129075 gene locus_tag LOCUS_01180 126955 129075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 129072 130214 gene locus_tag LOCUS_01190 129072 130214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 130147 131832 gene locus_tag LOCUS_01200 130147 131832 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_01200 132648 131839 gene locus_tag LOCUS_01210 132648 131839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 133170 132652 gene locus_tag LOCUS_01220 133170 132652 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 protein_id gnl|my_center|LOCUS_01220 133690 133115 gene locus_tag LOCUS_01230 133690 133115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 134401 133700 gene locus_tag LOCUS_01240 134401 133700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135850 134525 gene locus_tag LOCUS_01250 135850 134525 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123790.1 protein_id gnl|my_center|LOCUS_01250 136256 136163 gene locus_tag LOCUS_r00010 136256 136163 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA 139122 136364 gene locus_tag LOCUS_r00020 139122 136364 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence002 482 703 gene locus_tag LOCUS_01260 482 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 965 891 gene locus_tag LOCUS_t00020 965 891 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1388 3283 gene locus_tag LOCUS_01270 1388 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4160 3489 gene locus_tag LOCUS_01280 4160 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4933 4298 gene locus_tag LOCUS_01290 4933 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5304 5546 gene locus_tag LOCUS_01300 5304 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5607 6455 gene locus_tag LOCUS_01310 5607 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6564 8087 gene locus_tag LOCUS_01320 6564 8087 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_01320 8202 8987 gene locus_tag LOCUS_01330 8202 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9611 8997 gene locus_tag LOCUS_01340 9611 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10153 9608 gene locus_tag LOCUS_01350 10153 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 11700 10150 gene locus_tag LOCUS_01360 11700 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 12572 11697 gene locus_tag LOCUS_01370 12572 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13451 12591 gene locus_tag LOCUS_01380 13451 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14323 13448 gene locus_tag LOCUS_01390 14323 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 14859 14338 gene locus_tag LOCUS_01400 14859 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15287 14892 gene locus_tag LOCUS_01410 gene exeG 15287 14892 CDS product GspG family T2SS major pseudopilin variant ExeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_01410 16263 15391 gene locus_tag LOCUS_01420 gene truA 16263 15391 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 protein_id gnl|my_center|LOCUS_01420 16688 16404 gene locus_tag LOCUS_01430 16688 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 17406 16912 gene locus_tag LOCUS_01440 17406 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 18313 17489 gene locus_tag LOCUS_01450 18313 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 18559 19617 gene locus_tag LOCUS_01460 18559 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 19665 19973 gene locus_tag LOCUS_01470 19665 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 20004 20480 gene locus_tag LOCUS_01480 20004 20480 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_01480 20507 20782 gene locus_tag LOCUS_01490 20507 20782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 22131 20779 gene locus_tag LOCUS_01500 gene murA 22131 20779 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_01500 22411 23307 gene locus_tag LOCUS_01510 22411 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 24468 23371 gene locus_tag LOCUS_01520 24468 23371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 25858 24482 gene locus_tag LOCUS_01530 25858 24482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 26015 27691 gene locus_tag LOCUS_01540 26015 27691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 27688 28716 gene locus_tag LOCUS_01550 27688 28716 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_01550 28754 29950 gene locus_tag LOCUS_01560 28754 29950 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 protein_id gnl|my_center|LOCUS_01560 30007 31416 gene locus_tag LOCUS_01570 30007 31416 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_01570 31838 31431 gene locus_tag LOCUS_01580 31838 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 33665 31842 gene locus_tag LOCUS_01590 33665 31842 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_01590 33813 34595 gene locus_tag LOCUS_01600 33813 34595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 34732 35661 gene locus_tag LOCUS_01610 34732 35661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 35737 36147 gene locus_tag LOCUS_01620 35737 36147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37635 36199 gene locus_tag LOCUS_01630 gene glmM 37635 36199 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_01630 37709 38089 gene locus_tag LOCUS_01640 gene queD 37709 38089 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_01640 38086 40263 gene locus_tag LOCUS_01650 gene ppk1 38086 40263 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_01650 41214 40285 gene locus_tag LOCUS_01660 gene atpG 41214 40285 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_01660 42072 41254 gene locus_tag LOCUS_01670 42072 41254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_01670 42535 42149 gene locus_tag LOCUS_01680 42535 42149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 44756 42705 gene locus_tag LOCUS_01690 gene acs 44756 42705 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_01690 46101 44827 gene locus_tag LOCUS_01700 46101 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 47243 46098 gene locus_tag LOCUS_01710 47243 46098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 49437 47431 gene locus_tag LOCUS_01720 49437 47431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 50141 49464 gene locus_tag LOCUS_01730 50141 49464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 50683 50138 gene locus_tag LOCUS_01740 50683 50138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 51520 50687 gene locus_tag LOCUS_01750 51520 50687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 52738 51533 gene locus_tag LOCUS_01760 52738 51533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 53523 52822 gene locus_tag LOCUS_01770 gene mqnB 53523 52822 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_01770 53729 55387 gene locus_tag LOCUS_01780 53729 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 56646 55411 gene locus_tag LOCUS_01790 56646 55411 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813028.1 protein_id gnl|my_center|LOCUS_01790 57789 56770 gene locus_tag LOCUS_01800 57789 56770 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 protein_id gnl|my_center|LOCUS_01800 58697 57792 gene locus_tag LOCUS_01810 58697 57792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 59812 58694 gene locus_tag LOCUS_01820 59812 58694 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922313.1 protein_id gnl|my_center|LOCUS_01820 63980 59850 gene locus_tag LOCUS_01830 63980 59850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 64927 64181 gene locus_tag LOCUS_01840 64927 64181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 65462 64980 gene locus_tag LOCUS_01850 65462 64980 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_01850 65352 66824 gene locus_tag LOCUS_01860 65352 66824 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942945.1 protein_id gnl|my_center|LOCUS_01860 68945 66831 gene locus_tag LOCUS_01870 68945 66831 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_01870 69229 69936 gene locus_tag LOCUS_01880 gene trmB 69229 69936 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262605.1 protein_id gnl|my_center|LOCUS_01880 69936 70904 gene locus_tag LOCUS_01890 69936 70904 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_01890 70936 72429 gene locus_tag LOCUS_01900 70936 72429 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_01900 72628 73350 gene locus_tag LOCUS_01910 72628 73350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 73360 74229 gene locus_tag LOCUS_01920 73360 74229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_01920 74219 75640 gene locus_tag LOCUS_01930 74219 75640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 75627 78731 gene locus_tag LOCUS_01940 75627 78731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 78767 81391 gene locus_tag LOCUS_01950 78767 81391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 83490 81388 gene locus_tag LOCUS_01960 83490 81388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 83891 85924 gene locus_tag LOCUS_01970 83891 85924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 85921 86955 gene locus_tag LOCUS_01980 85921 86955 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814720.1 protein_id gnl|my_center|LOCUS_01980 86927 87748 gene locus_tag LOCUS_01990 86927 87748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 87809 89098 gene locus_tag LOCUS_02000 gene nuoD 87809 89098 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_02000 89272 89577 gene locus_tag LOCUS_02010 89272 89577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 89593 90537 gene locus_tag LOCUS_02020 89593 90537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 90959 90591 gene locus_tag LOCUS_02030 90959 90591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 91107 91856 gene locus_tag LOCUS_02040 91107 91856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 93134 91917 gene locus_tag LOCUS_02050 93134 91917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 93370 94008 gene locus_tag LOCUS_02060 93370 94008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 98587 94031 gene locus_tag LOCUS_02070 98587 94031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 98766 99293 gene locus_tag LOCUS_02080 gene nuoE 98766 99293 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 protein_id gnl|my_center|LOCUS_02080 99551 99306 gene locus_tag LOCUS_02090 99551 99306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 99620 100054 gene locus_tag LOCUS_02100 99620 100054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 100693 100046 gene locus_tag LOCUS_02110 100693 100046 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_02110 100810 101649 gene locus_tag LOCUS_02120 100810 101649 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_02120 101782 103428 gene locus_tag LOCUS_02130 101782 103428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 105044 103425 gene locus_tag LOCUS_02140 gene cysS 105044 103425 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_02140 106399 105065 gene locus_tag LOCUS_02150 106399 105065 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_02150 106902 106396 gene locus_tag LOCUS_02160 106902 106396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 107902 107318 gene locus_tag LOCUS_02170 107902 107318 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_02170 107956 108339 gene locus_tag LOCUS_02180 107956 108339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 108346 109467 gene locus_tag LOCUS_02190 108346 109467 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_02190 110705 109464 gene locus_tag LOCUS_02200 110705 109464 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_02200 110798 110929 gene locus_tag LOCUS_02210 110798 110929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 110934 113021 gene locus_tag LOCUS_02220 110934 113021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <114248 113073 gene locus_tag LOCUS_02230 <114248 113073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838122.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence003 3354 6104 gene locus_tag LOCUS_02240 3354 6104 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120395.1 protein_id gnl|my_center|LOCUS_02240 6101 9193 gene locus_tag LOCUS_02250 6101 9193 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_02250 9190 9999 gene locus_tag LOCUS_02260 gene hisN 9190 9999 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_02260 10450 9962 gene locus_tag LOCUS_02270 10450 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11873 10761 gene locus_tag LOCUS_02280 11873 10761 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_02280 12904 11975 gene locus_tag LOCUS_02290 12904 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15413 12906 gene locus_tag LOCUS_02300 15413 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 17246 15522 gene locus_tag LOCUS_02310 17246 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 18676 17549 gene locus_tag LOCUS_02320 18676 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 19245 18676 gene locus_tag LOCUS_02330 gene hpt 19245 18676 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_02330 19863 19300 gene locus_tag LOCUS_02340 19863 19300 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_02340 19905 21356 gene locus_tag LOCUS_02350 19905 21356 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_02350 22360 23580 gene locus_tag LOCUS_02360 22360 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 24815 23661 gene locus_tag LOCUS_02370 24815 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 25403 24918 gene locus_tag LOCUS_02380 gene rpsG 25403 24918 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_02380 25867 25496 gene locus_tag LOCUS_02390 gene rpsL 25867 25496 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_02390 26239 25934 gene locus_tag LOCUS_02400 26239 25934 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_02400 27651 26257 gene locus_tag LOCUS_02410 27651 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 28261 27674 gene locus_tag LOCUS_02420 28261 27674 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 protein_id gnl|my_center|LOCUS_02420 28260 30050 gene locus_tag LOCUS_02430 gene recJ 28260 30050 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_02430 31387 30143 gene locus_tag LOCUS_02440 31387 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 34643 31446 gene locus_tag LOCUS_02450 34643 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 35102 34884 gene locus_tag LOCUS_02460 35102 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 35662 35123 gene locus_tag LOCUS_02470 35662 35123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 35994 35689 gene locus_tag LOCUS_02480 35994 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 36587 36114 gene locus_tag LOCUS_02490 36587 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 37069 36662 gene locus_tag LOCUS_02500 37069 36662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 39763 37451 gene locus_tag LOCUS_02510 39763 37451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 40056 40634 gene locus_tag LOCUS_02520 40056 40634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_02520 40762 41238 gene locus_tag LOCUS_02530 gene dps 40762 41238 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326579.1 protein_id gnl|my_center|LOCUS_02530 42289 41240 gene locus_tag LOCUS_02540 42289 41240 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_02540 42376 43485 gene locus_tag LOCUS_02550 42376 43485 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_02550 44176 43487 gene locus_tag LOCUS_02560 44176 43487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 44290 45447 gene locus_tag LOCUS_02570 44290 45447 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_02570 45818 45456 gene locus_tag LOCUS_02580 45818 45456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 45938 47095 gene locus_tag LOCUS_02590 gene ribD 45938 47095 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02590 47732 47046 gene locus_tag LOCUS_02600 gene lipB 47732 47046 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_02600 47798 48616 gene locus_tag LOCUS_02610 gene lpxA 47798 48616 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 protein_id gnl|my_center|LOCUS_02610 48613 49410 gene locus_tag LOCUS_02620 48613 49410 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_02620 49397 50044 gene locus_tag LOCUS_02630 49397 50044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 50049 50444 gene locus_tag LOCUS_02640 50049 50444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 50441 51604 gene locus_tag LOCUS_02650 gene aroB 50441 51604 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_02650 51721 53151 gene locus_tag LOCUS_02660 51721 53151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 53167 54522 gene locus_tag LOCUS_02670 53167 54522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 55929 54622 gene locus_tag LOCUS_02680 gene clpX 55929 54622 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_02680 56562 56107 gene locus_tag LOCUS_02690 56562 56107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 57302 56562 gene locus_tag LOCUS_02700 57302 56562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_02700 57645 57391 gene locus_tag LOCUS_02710 57645 57391 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122030.1 protein_id gnl|my_center|LOCUS_02710 57723 59489 gene locus_tag LOCUS_02720 gene dnaG 57723 59489 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_02720 59486 61351 gene locus_tag LOCUS_02730 59486 61351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_02730 64902 61366 gene locus_tag LOCUS_02740 64902 61366 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_02740 66210 64909 gene locus_tag LOCUS_02750 66210 64909 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_02750 66526 66233 gene locus_tag LOCUS_02760 66526 66233 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_02760 67206 66568 gene locus_tag LOCUS_02770 67206 66568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 69403 67220 gene locus_tag LOCUS_02780 69403 67220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 69623 69414 gene locus_tag LOCUS_02790 69623 69414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 70040 69645 gene locus_tag LOCUS_02800 70040 69645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 72190 70046 gene locus_tag LOCUS_02810 gene vgrG1b 72190 70046 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_02810 73011 72187 gene locus_tag LOCUS_02820 73011 72187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 75833 73071 gene locus_tag LOCUS_02830 gene tssH 75833 73071 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_02830 76964 75906 gene locus_tag LOCUS_02840 gene tssG 76964 75906 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_02840 78886 76961 gene locus_tag LOCUS_02850 gene tssF 78886 76961 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_02850 79517 78888 gene locus_tag LOCUS_02860 79517 78888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 80320 79517 gene locus_tag LOCUS_02870 gene tagJ 80320 79517 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_02870 80927 80430 gene locus_tag LOCUS_02880 80927 80430 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318810.1 protein_id gnl|my_center|LOCUS_02880 82501 81005 gene locus_tag LOCUS_02890 gene tssC 82501 81005 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190849.1 protein_id gnl|my_center|LOCUS_02890 83042 82494 gene locus_tag LOCUS_02900 gene tssB 83042 82494 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_02900 84161 83112 gene locus_tag LOCUS_02910 gene tssA 84161 83112 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340532.1 protein_id gnl|my_center|LOCUS_02910 <90930 84219 gene locus_tag LOCUS_02920 <90930 84219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111741559.1:EntS/YbdA MFS transporter >Feature sequence004 2418 1510 gene locus_tag LOCUS_02930 2418 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3536 2415 gene locus_tag LOCUS_02940 3536 2415 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_02940 4075 3533 gene locus_tag LOCUS_02950 4075 3533 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_02950 4420 4139 gene locus_tag LOCUS_02960 4420 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4975 4454 gene locus_tag LOCUS_02970 4975 4454 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946466.1 protein_id gnl|my_center|LOCUS_02970 5646 4972 gene locus_tag LOCUS_02980 gene pgsA 5646 4972 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330879.1 protein_id gnl|my_center|LOCUS_02980 5854 6840 gene locus_tag LOCUS_02990 5854 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6837 7205 gene locus_tag LOCUS_03000 gene nuoK 6837 7205 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_03000 7251 9521 gene locus_tag LOCUS_03010 7251 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9532 11166 gene locus_tag LOCUS_03020 9532 11166 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_03020 11163 12770 gene locus_tag LOCUS_03030 11163 12770 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_03030 13703 12777 gene locus_tag LOCUS_03040 13703 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 13800 14978 gene locus_tag LOCUS_03050 gene pheA 13800 14978 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_03050 15256 25059 gene locus_tag LOCUS_03060 15256 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 26622 25162 gene locus_tag LOCUS_03070 26622 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 26633 27454 gene locus_tag LOCUS_03080 26633 27454 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_03080 27510 27959 gene locus_tag LOCUS_03090 27510 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 28016 28585 gene locus_tag LOCUS_03100 28016 28585 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_03100 28605 30062 gene locus_tag LOCUS_03110 gene cls 28605 30062 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 protein_id gnl|my_center|LOCUS_03110 30968 30072 gene locus_tag LOCUS_03120 30968 30072 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808659.1 protein_id gnl|my_center|LOCUS_03120 31218 31069 gene locus_tag LOCUS_03130 31218 31069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 31468 32190 gene locus_tag LOCUS_03140 31468 32190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 33789 32203 gene locus_tag LOCUS_03150 33789 32203 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839414.1 protein_id gnl|my_center|LOCUS_03150 33889 34530 gene locus_tag LOCUS_03160 33889 34530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 34523 36631 gene locus_tag LOCUS_03170 34523 36631 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163175.1 protein_id gnl|my_center|LOCUS_03170 36628 37629 gene locus_tag LOCUS_03180 36628 37629 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_03180 37629 37853 gene locus_tag LOCUS_03190 37629 37853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 38720 37857 gene locus_tag LOCUS_03200 38720 37857 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_03200 40017 38782 gene locus_tag LOCUS_03210 40017 38782 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_03210 40192 40437 gene locus_tag LOCUS_03220 40192 40437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03220 40576 40800 gene locus_tag LOCUS_03230 40576 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 41093 40797 gene locus_tag LOCUS_03240 41093 40797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 41747 41121 gene locus_tag LOCUS_03250 41747 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 42037 41744 gene locus_tag LOCUS_03260 42037 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 42886 42155 gene locus_tag LOCUS_03270 42886 42155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 43171 42914 gene locus_tag LOCUS_03280 43171 42914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 43456 43361 gene locus_tag LOCUS_t00030 43456 43361 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 43773 43519 gene locus_tag LOCUS_03290 43773 43519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 43660 44139 gene locus_tag LOCUS_03300 43660 44139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 45530 44136 gene locus_tag LOCUS_03310 gene selA 45530 44136 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_03310 47431 45527 gene locus_tag LOCUS_03320 gene selB 47431 45527 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_03320 48450 47491 gene locus_tag LOCUS_03330 gene selD 48450 47491 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_03330 48724 48651 gene locus_tag LOCUS_t00040 48724 48651 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 48864 49214 gene locus_tag LOCUS_03340 48864 49214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 49285 49983 gene locus_tag LOCUS_03350 gene nadD 49285 49983 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_03350 51216 50002 gene locus_tag LOCUS_03360 gene metK 51216 50002 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_03360 51349 52428 gene locus_tag LOCUS_03370 gene purM 51349 52428 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_03370 52616 52434 gene locus_tag LOCUS_03380 52616 52434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 53558 52635 gene locus_tag LOCUS_03390 53558 52635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 53785 55773 gene locus_tag LOCUS_03400 53785 55773 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_03400 56178 55822 gene locus_tag LOCUS_03410 56178 55822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 57518 56226 gene locus_tag LOCUS_03420 gene fabF 57518 56226 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_03420 57803 57552 gene locus_tag LOCUS_03430 gene acpP 57803 57552 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928985.1 protein_id gnl|my_center|LOCUS_03430 58131 58928 gene locus_tag LOCUS_03440 58131 58928 CDS product DUF1444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259204.1 protein_id gnl|my_center|LOCUS_03440 58991 59716 gene locus_tag LOCUS_03450 gene pabA 58991 59716 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601853.1 protein_id gnl|my_center|LOCUS_03450 59744 60187 gene locus_tag LOCUS_03460 59744 60187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 60297 60836 gene locus_tag LOCUS_03470 60297 60836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 60880 61713 gene locus_tag LOCUS_03480 60880 61713 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_03480 61850 62221 gene locus_tag LOCUS_03490 61850 62221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 62885 62433 gene locus_tag LOCUS_03500 62885 62433 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_03500 62908 63702 gene locus_tag LOCUS_03510 62908 63702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 64021 63749 gene locus_tag LOCUS_03520 64021 63749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 64892 64440 gene locus_tag LOCUS_03530 gene mraZ 64892 64440 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620303.1 protein_id gnl|my_center|LOCUS_03530 65138 65614 gene locus_tag LOCUS_03540 65138 65614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 66840 65647 gene locus_tag LOCUS_03550 66840 65647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_03550 66846 67961 gene locus_tag LOCUS_03560 66846 67961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 68580 67975 gene locus_tag LOCUS_03570 68580 67975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 68995 68636 gene locus_tag LOCUS_03580 68995 68636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 68897 69652 gene locus_tag LOCUS_03590 68897 69652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 69865 70293 gene locus_tag LOCUS_03600 gene rplK 69865 70293 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_03600 70298 70987 gene locus_tag LOCUS_03610 gene rplA 70298 70987 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_03610 71010 71555 gene locus_tag LOCUS_03620 gene rplJ 71010 71555 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_03620 71687 72094 gene locus_tag LOCUS_03630 gene rplL 71687 72094 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_03630 72347 76264 gene locus_tag LOCUS_03640 gene rpoB 72347 76264 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_03640 76362 80747 gene locus_tag LOCUS_03650 gene rpoC 76362 80747 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_03650 80915 81940 gene locus_tag LOCUS_03660 80915 81940 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_03660 82054 83571 gene locus_tag LOCUS_03670 82054 83571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 85521 83584 gene locus_tag LOCUS_03680 85521 83584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 86147 85518 gene locus_tag LOCUS_03690 gene rlmE 86147 85518 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_03690 87850 86234 gene locus_tag LOCUS_03700 87850 86234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 <89311 87907 gene locus_tag LOCUS_03710 <89311 87907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921709.1:cyclic dehypoxanthinyl futalosine synthase >Feature sequence005 1257 520 gene locus_tag LOCUS_03720 1257 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 1775 1254 gene locus_tag LOCUS_03730 1775 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2626 1772 gene locus_tag LOCUS_03740 2626 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 3146 2646 gene locus_tag LOCUS_03750 gene gspG 3146 2646 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_03750 4604 3414 gene locus_tag LOCUS_03760 4604 3414 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_03760 4767 4624 gene locus_tag LOCUS_03770 4767 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5147 4770 gene locus_tag LOCUS_03780 5147 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5237 6055 gene locus_tag LOCUS_03790 5237 6055 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_03790 6179 7852 gene locus_tag LOCUS_03800 6179 7852 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_03800 7918 8427 gene locus_tag LOCUS_03810 7918 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9494 8424 gene locus_tag LOCUS_03820 9494 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 11602 9716 gene locus_tag LOCUS_03830 11602 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11712 12752 gene locus_tag LOCUS_03840 gene waaC 11712 12752 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_03840 13809 12721 gene locus_tag LOCUS_03850 gene serC 13809 12721 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_03850 14826 13831 gene locus_tag LOCUS_03860 14826 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 16026 14965 gene locus_tag LOCUS_03870 16026 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 17447 16383 gene locus_tag LOCUS_03880 17447 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 18799 17669 gene locus_tag LOCUS_03890 18799 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 18864 19811 gene locus_tag LOCUS_03900 18864 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 19830 20672 gene locus_tag LOCUS_03910 19830 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 22295 20703 gene locus_tag LOCUS_03920 gene rny 22295 20703 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_03920 22726 23583 gene locus_tag LOCUS_03930 22726 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 24030 23602 gene locus_tag LOCUS_03940 24030 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 25641 24040 gene locus_tag LOCUS_03950 gene aroE 25641 24040 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_03950 27182 25737 gene locus_tag LOCUS_03960 27182 25737 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_03960 28376 27279 gene locus_tag LOCUS_03970 gene prfA 28376 27279 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144404.1 protein_id gnl|my_center|LOCUS_03970 28573 29547 gene locus_tag LOCUS_03980 28573 29547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_03980 29544 31073 gene locus_tag LOCUS_03990 29544 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 32500 31178 gene locus_tag LOCUS_04000 32500 31178 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_04000 32537 33316 gene locus_tag LOCUS_04010 32537 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 33635 33958 gene locus_tag LOCUS_04020 33635 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 34583 35359 gene locus_tag LOCUS_04030 34583 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 35375 36325 gene locus_tag LOCUS_04040 35375 36325 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826360.1 protein_id gnl|my_center|LOCUS_04040 38401 36365 gene locus_tag LOCUS_04050 gene asnB 38401 36365 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_04050 38995 38459 gene locus_tag LOCUS_04060 38995 38459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 39735 38938 gene locus_tag LOCUS_04070 39735 38938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 41121 39763 gene locus_tag LOCUS_04080 41121 39763 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_04080 41236 42087 gene locus_tag LOCUS_04090 41236 42087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 42242 42066 gene locus_tag LOCUS_04100 42242 42066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 42264 43100 gene locus_tag LOCUS_04110 42264 43100 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_04110 43795 43094 gene locus_tag LOCUS_04120 43795 43094 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268476.1 protein_id gnl|my_center|LOCUS_04120 43937 43809 gene locus_tag LOCUS_04130 43937 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 44593 45930 gene locus_tag LOCUS_04140 gene tyrS 44593 45930 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830858.1 protein_id gnl|my_center|LOCUS_04140 46112 46546 gene locus_tag LOCUS_04150 46112 46546 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_04150 46807 48369 gene locus_tag LOCUS_04160 46807 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 48370 50073 gene locus_tag LOCUS_04170 48370 50073 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_04170 50070 50987 gene locus_tag LOCUS_04180 gene prmC 50070 50987 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_04180 52607 50988 gene locus_tag LOCUS_04190 52607 50988 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_04190 52737 53693 gene locus_tag LOCUS_04200 52737 53693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_04200 53690 54412 gene locus_tag LOCUS_04210 53690 54412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 54409 56661 gene locus_tag LOCUS_04220 54409 56661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 57776 56712 gene locus_tag LOCUS_04230 57776 56712 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 protein_id gnl|my_center|LOCUS_04230 57900 58682 gene locus_tag LOCUS_04240 57900 58682 CDS product flagellar hook basal-body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671297.1 protein_id gnl|my_center|LOCUS_04240 58699 59496 gene locus_tag LOCUS_04250 gene flgG 58699 59496 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329888.1 protein_id gnl|my_center|LOCUS_04250 59501 60547 gene locus_tag LOCUS_04260 59501 60547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 60562 61224 gene locus_tag LOCUS_04270 60562 61224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 61270 62358 gene locus_tag LOCUS_04280 61270 62358 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545167.1 protein_id gnl|my_center|LOCUS_04280 62367 62774 gene locus_tag LOCUS_04290 62367 62774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 62767 63291 gene locus_tag LOCUS_04300 62767 63291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 63304 65040 gene locus_tag LOCUS_04310 63304 65040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 65043 67121 gene locus_tag LOCUS_04320 65043 67121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 67273 67716 gene locus_tag LOCUS_04330 67273 67716 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_04330 67832 68164 gene locus_tag LOCUS_04340 67832 68164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 68214 69758 gene locus_tag LOCUS_04350 68214 69758 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121196.1 protein_id gnl|my_center|LOCUS_04350 70073 71593 gene locus_tag LOCUS_04360 70073 71593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 71692 72618 gene locus_tag LOCUS_04370 gene xerD 71692 72618 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_04370 75114 72622 gene locus_tag LOCUS_04380 75114 72622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 75487 76464 gene locus_tag LOCUS_04390 75487 76464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence006 592 1830 gene locus_tag LOCUS_04400 592 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1830 2240 gene locus_tag LOCUS_04410 1830 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2337 3110 gene locus_tag LOCUS_04420 gene xdhC 2337 3110 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_04420 3107 3667 gene locus_tag LOCUS_04430 3107 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3879 3655 gene locus_tag LOCUS_04440 gene infA 3879 3655 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_04440 4479 4066 gene locus_tag LOCUS_04450 4479 4066 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_04450 4942 4460 gene locus_tag LOCUS_04460 4942 4460 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_04460 6284 5067 gene locus_tag LOCUS_04470 6284 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6553 8985 gene locus_tag LOCUS_04480 6553 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8969 9517 gene locus_tag LOCUS_04490 8969 9517 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_04490 9577 11433 gene locus_tag LOCUS_04500 9577 11433 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974789.1 protein_id gnl|my_center|LOCUS_04500 11501 12319 gene locus_tag LOCUS_04510 11501 12319 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665509.1 protein_id gnl|my_center|LOCUS_04510 12326 12859 gene locus_tag LOCUS_04520 12326 12859 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965521.1 protein_id gnl|my_center|LOCUS_04520 12894 13277 gene locus_tag LOCUS_04530 12894 13277 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_04530 13274 13714 gene locus_tag LOCUS_04540 13274 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 13724 14794 gene locus_tag LOCUS_04550 13724 14794 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_04550 15870 14872 gene locus_tag LOCUS_04560 15870 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17029 16043 gene locus_tag LOCUS_04570 17029 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 17258 17184 gene locus_tag LOCUS_t00050 17258 17184 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17790 17719 gene locus_tag LOCUS_t00060 17790 17719 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19890 17878 gene locus_tag LOCUS_04580 19890 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20057 21061 gene locus_tag LOCUS_04590 gene fliM 20057 21061 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334519.1 protein_id gnl|my_center|LOCUS_04590 21406 22824 gene locus_tag LOCUS_04600 gene nusA 21406 22824 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_04600 22885 25632 gene locus_tag LOCUS_04610 gene infB 22885 25632 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_04610 25645 26019 gene locus_tag LOCUS_04620 25645 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 26016 26414 gene locus_tag LOCUS_04630 26016 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26411 27070 gene locus_tag LOCUS_04640 26411 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 27070 30453 gene locus_tag LOCUS_04650 27070 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 30496 31242 gene locus_tag LOCUS_04660 30496 31242 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_04660 31931 31311 gene locus_tag LOCUS_04670 31931 31311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 33071 31974 gene locus_tag LOCUS_04680 33071 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 33893 33135 gene locus_tag LOCUS_04690 33893 33135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 33956 34564 gene locus_tag LOCUS_04700 33956 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 34557 35273 gene locus_tag LOCUS_04710 34557 35273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 36086 35274 gene locus_tag LOCUS_04720 36086 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 36473 36399 gene locus_tag LOCUS_t00070 36473 36399 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36853 39015 gene locus_tag LOCUS_04730 36853 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 39091 40212 gene locus_tag LOCUS_04740 gene pdhA 39091 40212 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_04740 40205 40489 gene locus_tag LOCUS_04750 40205 40489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 41393 40548 gene locus_tag LOCUS_04760 41393 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 42565 41543 gene locus_tag LOCUS_04770 42565 41543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 43922 42867 gene locus_tag LOCUS_04780 43922 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 44245 45282 gene locus_tag LOCUS_04790 44245 45282 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_04790 45282 46163 gene locus_tag LOCUS_04800 45282 46163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 46227 47546 gene locus_tag LOCUS_04810 46227 47546 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_04810 47649 48500 gene locus_tag LOCUS_04820 47649 48500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 48418 48840 gene locus_tag LOCUS_04830 48418 48840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 49832 48837 gene locus_tag LOCUS_04840 gene prfB 49832 48837 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141233.1 protein_id gnl|my_center|LOCUS_04840 49892 50311 gene locus_tag LOCUS_04850 49892 50311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 51534 50335 gene locus_tag LOCUS_04860 51534 50335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 51579 52301 gene locus_tag LOCUS_04870 51579 52301 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_04870 52316 52801 gene locus_tag LOCUS_04880 52316 52801 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_04880 52802 54136 gene locus_tag LOCUS_04890 gene truD 52802 54136 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_04890 54133 54777 gene locus_tag LOCUS_04900 54133 54777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 54878 55231 gene locus_tag LOCUS_04910 54878 55231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 56621 55383 gene locus_tag LOCUS_04920 56621 55383 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_04920 56791 57465 gene locus_tag LOCUS_04930 56791 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 57648 60785 gene locus_tag LOCUS_04940 57648 60785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 60811 62190 gene locus_tag LOCUS_04950 60811 62190 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_04950 63474 62203 gene locus_tag LOCUS_04960 63474 62203 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_04960 63952 63434 gene locus_tag LOCUS_04970 63952 63434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 64506 64252 gene locus_tag LOCUS_04980 64506 64252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 64390 64971 gene locus_tag LOCUS_04990 64390 64971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 66762 64975 gene locus_tag LOCUS_05000 gene aspS 66762 64975 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881092.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence007 2351 1020 gene locus_tag LOCUS_05010 2351 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4369 2351 gene locus_tag LOCUS_05020 4369 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5819 4581 gene locus_tag LOCUS_05030 5819 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6035 6346 gene locus_tag LOCUS_05040 6035 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6479 6805 gene locus_tag LOCUS_05050 6479 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6798 8009 gene locus_tag LOCUS_05060 6798 8009 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_05060 8057 8866 gene locus_tag LOCUS_05070 8057 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 9521 9063 gene locus_tag LOCUS_05080 9521 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 10778 9744 gene locus_tag LOCUS_05090 10778 9744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_05090 12433 10847 gene locus_tag LOCUS_05100 12433 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 14214 12649 gene locus_tag LOCUS_05110 gene atpA 14214 12649 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_05110 13918 13826 gene locus_tag LOCUS_t00080 13918 13826 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15427 14375 gene locus_tag LOCUS_05120 15427 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 16361 15432 gene locus_tag LOCUS_05130 gene cdaA 16361 15432 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_05130 16436 17500 gene locus_tag LOCUS_05140 gene mutY 16436 17500 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974745.1 protein_id gnl|my_center|LOCUS_05140 17500 18225 gene locus_tag LOCUS_05150 17500 18225 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_05150 19495 18245 gene locus_tag LOCUS_05160 19495 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19602 20930 gene locus_tag LOCUS_05170 19602 20930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 21865 20918 gene locus_tag LOCUS_05180 21865 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22202 21852 gene locus_tag LOCUS_05190 22202 21852 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_05190 23016 22336 gene locus_tag LOCUS_05200 23016 22336 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_05200 24612 23032 gene locus_tag LOCUS_05210 gene trpE 24612 23032 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_05210 24651 26594 gene locus_tag LOCUS_05220 24651 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 29115 26560 gene locus_tag LOCUS_05230 29115 26560 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229052.1 protein_id gnl|my_center|LOCUS_05230 30370 29159 gene locus_tag LOCUS_05240 30370 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 30501 30968 gene locus_tag LOCUS_05250 30501 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 30965 31426 gene locus_tag LOCUS_05260 gene rpiB 30965 31426 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122948.1 protein_id gnl|my_center|LOCUS_05260 35708 31428 gene locus_tag LOCUS_05270 35708 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 35665 36072 gene locus_tag LOCUS_05280 35665 36072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 36091 36549 gene locus_tag LOCUS_05290 36091 36549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 37697 36546 gene locus_tag LOCUS_05300 37697 36546 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036219.1 protein_id gnl|my_center|LOCUS_05300 37768 38676 gene locus_tag LOCUS_05310 37768 38676 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640212.1 protein_id gnl|my_center|LOCUS_05310 38721 39761 gene locus_tag LOCUS_05320 38721 39761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_05320 39797 40792 gene locus_tag LOCUS_05330 39797 40792 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_05330 41075 40773 gene locus_tag LOCUS_05340 41075 40773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 41259 42209 gene locus_tag LOCUS_05350 41259 42209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 42231 43949 gene locus_tag LOCUS_05360 42231 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 43949 45640 gene locus_tag LOCUS_05370 43949 45640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 45655 46392 gene locus_tag LOCUS_05380 45655 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 46389 47531 gene locus_tag LOCUS_05390 46389 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 47615 48877 gene locus_tag LOCUS_05400 47615 48877 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_05400 49651 48881 gene locus_tag LOCUS_05410 49651 48881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 50311 49667 gene locus_tag LOCUS_05420 50311 49667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 50824 50483 gene locus_tag LOCUS_05430 50824 50483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51272 50835 gene locus_tag LOCUS_05440 51272 50835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 51562 52215 gene locus_tag LOCUS_05450 51562 52215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 52552 54612 gene locus_tag LOCUS_05460 52552 54612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 54994 57051 gene locus_tag LOCUS_05470 54994 57051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 57778 57149 gene locus_tag LOCUS_05480 57778 57149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 57934 61485 gene locus_tag LOCUS_05490 57934 61485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 61482 62222 gene locus_tag LOCUS_05500 61482 62222 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_05500 62231 63292 gene locus_tag LOCUS_05510 gene neuB 62231 63292 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088733.1 protein_id gnl|my_center|LOCUS_05510 63289 64473 gene locus_tag LOCUS_05520 gene neuC 63289 64473 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_05520 64841 64485 gene locus_tag LOCUS_05530 64841 64485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 66341 64965 gene locus_tag LOCUS_05540 66341 64965 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence008 3315 3761 gene locus_tag LOCUS_05550 3315 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4482 3790 gene locus_tag LOCUS_05560 4482 3790 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_05560 4572 5075 gene locus_tag LOCUS_05570 4572 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5124 6380 gene locus_tag LOCUS_05580 5124 6380 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 protein_id gnl|my_center|LOCUS_05580 6377 7351 gene locus_tag LOCUS_05590 6377 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7446 7910 gene locus_tag LOCUS_05600 7446 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7974 9041 gene locus_tag LOCUS_05610 7974 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 9106 10725 gene locus_tag LOCUS_05620 9106 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10742 11284 gene locus_tag LOCUS_05630 10742 11284 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_05630 12645 11329 gene locus_tag LOCUS_05640 12645 11329 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_05640 13159 12707 gene locus_tag LOCUS_05650 13159 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13727 13164 gene locus_tag LOCUS_05660 gene lpcA 13727 13164 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 protein_id gnl|my_center|LOCUS_05660 13829 13912 gene locus_tag LOCUS_t00090 13829 13912 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 14731 13934 gene locus_tag LOCUS_05670 14731 13934 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_05670 14882 18724 gene locus_tag LOCUS_05680 14882 18724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 19058 19831 gene locus_tag LOCUS_05690 19058 19831 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_05690 19828 20343 gene locus_tag LOCUS_05700 19828 20343 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242881.1 protein_id gnl|my_center|LOCUS_05700 20340 21230 gene locus_tag LOCUS_05710 gene rfbD 20340 21230 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807150.1 protein_id gnl|my_center|LOCUS_05710 21227 22282 gene locus_tag LOCUS_05720 gene rfbB 21227 22282 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_05720 22988 22353 gene locus_tag LOCUS_05730 22988 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 23986 23243 gene locus_tag LOCUS_05740 23986 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 24811 24176 gene locus_tag LOCUS_05750 24811 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 29435 25125 gene locus_tag LOCUS_05760 29435 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 30872 29439 gene locus_tag LOCUS_05770 30872 29439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 33202 30869 gene locus_tag LOCUS_05780 33202 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 33894 33199 gene locus_tag LOCUS_05790 33894 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 34763 33894 gene locus_tag LOCUS_05800 34763 33894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 35701 34760 gene locus_tag LOCUS_05810 35701 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 37180 35837 gene locus_tag LOCUS_05820 37180 35837 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_05820 38064 37177 gene locus_tag LOCUS_05830 38064 37177 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_05830 39035 38061 gene locus_tag LOCUS_05840 39035 38061 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_05840 40306 39032 gene locus_tag LOCUS_05850 40306 39032 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_05850 41333 40326 gene locus_tag LOCUS_05860 41333 40326 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_05860 42340 41333 gene locus_tag LOCUS_05870 42340 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 43410 42337 gene locus_tag LOCUS_05880 43410 42337 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_05880 44297 43407 gene locus_tag LOCUS_05890 44297 43407 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660376.1 protein_id gnl|my_center|LOCUS_05890 45262 44294 gene locus_tag LOCUS_05900 45262 44294 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532216.1 protein_id gnl|my_center|LOCUS_05900 46344 45358 gene locus_tag LOCUS_05910 46344 45358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 47683 46334 gene locus_tag LOCUS_05920 47683 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 49274 47775 gene locus_tag LOCUS_05930 49274 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 50410 49271 gene locus_tag LOCUS_05940 50410 49271 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_05940 51213 50407 gene locus_tag LOCUS_05950 51213 50407 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233805.1 protein_id gnl|my_center|LOCUS_05950 52331 51210 gene locus_tag LOCUS_05960 52331 51210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 53656 52328 gene locus_tag LOCUS_05970 53656 52328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 54915 53656 gene locus_tag LOCUS_05980 54915 53656 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_05980 56856 54943 gene locus_tag LOCUS_05990 56856 54943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 58047 57301 gene locus_tag LOCUS_06000 58047 57301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_06000 58092 59024 gene locus_tag LOCUS_06010 gene panB 58092 59024 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869215.1 protein_id gnl|my_center|LOCUS_06010 59218 60621 gene locus_tag LOCUS_06020 59218 60621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 61346 60618 gene locus_tag LOCUS_06030 61346 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 62629 61349 gene locus_tag LOCUS_06040 gene murD 62629 61349 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863046.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence009 1592 2407 gene locus_tag LOCUS_06050 1592 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2407 2745 gene locus_tag LOCUS_06060 2407 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3156 3680 gene locus_tag LOCUS_06070 3156 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4129 3896 gene locus_tag LOCUS_06080 4129 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5716 4250 gene locus_tag LOCUS_06090 5716 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6006 8084 gene locus_tag LOCUS_06100 6006 8084 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113078.1 protein_id gnl|my_center|LOCUS_06100 8118 9173 gene locus_tag LOCUS_06110 gene hflC 8118 9173 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_06110 9163 10581 gene locus_tag LOCUS_06120 9163 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 10581 11825 gene locus_tag LOCUS_06130 10581 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 11825 13768 gene locus_tag LOCUS_06140 11825 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 13824 15869 gene locus_tag LOCUS_06150 13824 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 16027 17463 gene locus_tag LOCUS_06160 16027 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 18915 17482 gene locus_tag LOCUS_06170 18915 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 19153 19842 gene locus_tag LOCUS_06180 19153 19842 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_06180 19961 23509 gene locus_tag LOCUS_06190 19961 23509 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_06190 23506 25032 gene locus_tag LOCUS_06200 gene nrfD 23506 25032 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_06200 25032 25661 gene locus_tag LOCUS_06210 25032 25661 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_06210 25666 26490 gene locus_tag LOCUS_06220 25666 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 26487 27770 gene locus_tag LOCUS_06230 26487 27770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_06230 27846 28253 gene locus_tag LOCUS_06240 27846 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 28246 29157 gene locus_tag LOCUS_06250 28246 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 29154 30257 gene locus_tag LOCUS_06260 gene coxB 29154 30257 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_06260 30293 32164 gene locus_tag LOCUS_06270 30293 32164 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_06270 32212 32889 gene locus_tag LOCUS_06280 32212 32889 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_06280 32905 33651 gene locus_tag LOCUS_06290 32905 33651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 34178 33558 gene locus_tag LOCUS_06300 34178 33558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 34059 34478 gene locus_tag LOCUS_06310 34059 34478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 36040 34457 gene locus_tag LOCUS_06320 36040 34457 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_06320 37046 36189 gene locus_tag LOCUS_06330 37046 36189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 37193 38584 gene locus_tag LOCUS_06340 37193 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 38665 41208 gene locus_tag LOCUS_06350 38665 41208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 41205 42938 gene locus_tag LOCUS_06360 41205 42938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 43007 43576 gene locus_tag LOCUS_06370 43007 43576 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_06370 43646 44059 gene locus_tag LOCUS_06380 43646 44059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 44122 45570 gene locus_tag LOCUS_06390 44122 45570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 47761 46022 gene locus_tag LOCUS_06400 47761 46022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 48687 47758 gene locus_tag LOCUS_06410 48687 47758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_06410 49652 48774 gene locus_tag LOCUS_06420 gene pyrF 49652 48774 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_06420 49724 50065 gene locus_tag LOCUS_06430 49724 50065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 50052 52151 gene locus_tag LOCUS_06440 gene recG 50052 52151 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_06440 52192 53988 gene locus_tag LOCUS_06450 gene polX 52192 53988 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_06450 54560 53970 gene locus_tag LOCUS_06460 54560 53970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 54937 54557 gene locus_tag LOCUS_06470 54937 54557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 55239 54940 gene locus_tag LOCUS_06480 55239 54940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 55402 56277 gene locus_tag LOCUS_06490 55402 56277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 56441 57946 gene locus_tag LOCUS_06500 gene ffh 56441 57946 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_06500 58014 58565 gene locus_tag LOCUS_06510 58014 58565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 59533 58718 gene locus_tag LOCUS_06520 59533 58718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 59492 59665 gene locus_tag LOCUS_06530 59492 59665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 60316 59951 gene locus_tag LOCUS_06540 60316 59951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 61457 60357 gene locus_tag LOCUS_06550 61457 60357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence010 469 1053 gene locus_tag LOCUS_06560 gene dcd 469 1053 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_06560 1124 4588 gene locus_tag LOCUS_06570 1124 4588 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_06570 6743 5085 gene locus_tag LOCUS_06580 6743 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7432 7040 gene locus_tag LOCUS_06590 7432 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8569 7436 gene locus_tag LOCUS_06600 8569 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10027 8591 gene locus_tag LOCUS_06610 10027 8591 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_06610 11046 10024 gene locus_tag LOCUS_06620 11046 10024 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_06620 13212 11053 gene locus_tag LOCUS_06630 13212 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 17915 13368 gene locus_tag LOCUS_06640 17915 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 18836 17955 gene locus_tag LOCUS_06650 18836 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 19771 18833 gene locus_tag LOCUS_06660 19771 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 21509 20037 gene locus_tag LOCUS_06670 21509 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 21924 22970 gene locus_tag LOCUS_06680 gene lipA 21924 22970 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938204.1 protein_id gnl|my_center|LOCUS_06680 23597 22992 gene locus_tag LOCUS_06690 23597 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 25575 24277 gene locus_tag LOCUS_06700 25575 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 26165 25740 gene locus_tag LOCUS_06710 26165 25740 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_06710 26340 29309 gene locus_tag LOCUS_06720 26340 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 30200 29379 gene locus_tag LOCUS_06730 30200 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 30766 30200 gene locus_tag LOCUS_06740 30766 30200 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_06740 31139 31933 gene locus_tag LOCUS_06750 31139 31933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 32016 33119 gene locus_tag LOCUS_06760 32016 33119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 34267 33236 gene locus_tag LOCUS_06770 34267 33236 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327198.1 protein_id gnl|my_center|LOCUS_06770 34424 35341 gene locus_tag LOCUS_06780 34424 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 35373 35939 gene locus_tag LOCUS_06790 35373 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 36960 35947 gene locus_tag LOCUS_06800 gene floA 36960 35947 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_06800 37511 37023 gene locus_tag LOCUS_06810 37511 37023 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_06810 39232 37511 gene locus_tag LOCUS_06820 39232 37511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 39895 39356 gene locus_tag LOCUS_06830 39895 39356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 39961 41550 gene locus_tag LOCUS_06840 gene murC 39961 41550 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_06840 41556 42467 gene locus_tag LOCUS_06850 gene murB 41556 42467 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_06850 42464 43387 gene locus_tag LOCUS_06860 42464 43387 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_06860 43384 44331 gene locus_tag LOCUS_06870 43384 44331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 44333 45289 gene locus_tag LOCUS_06880 44333 45289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 45177 45644 gene locus_tag LOCUS_06890 gene greA 45177 45644 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 protein_id gnl|my_center|LOCUS_06890 45736 46545 gene locus_tag LOCUS_06900 45736 46545 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903603.1 protein_id gnl|my_center|LOCUS_06900 46748 47500 gene locus_tag LOCUS_06910 46748 47500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 47510 49114 gene locus_tag LOCUS_06920 47510 49114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 49044 50504 gene locus_tag LOCUS_06930 49044 50504 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_06930 50501 52063 gene locus_tag LOCUS_06940 50501 52063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 52400 53659 gene locus_tag LOCUS_06950 52400 53659 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140716.1 protein_id gnl|my_center|LOCUS_06950 54262 53792 gene locus_tag LOCUS_06960 54262 53792 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969484.1 protein_id gnl|my_center|LOCUS_06960 54310 55701 gene locus_tag LOCUS_06970 54310 55701 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_06970 56964 55708 gene locus_tag LOCUS_06980 gene mqnE 56964 55708 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence011 1757 477 gene locus_tag LOCUS_06990 1757 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3588 1741 gene locus_tag LOCUS_07000 3588 1741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_07000 4757 3588 gene locus_tag LOCUS_07010 4757 3588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_07010 5980 4757 gene locus_tag LOCUS_07020 5980 4757 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_07020 7220 5967 gene locus_tag LOCUS_07030 7220 5967 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061529.1 protein_id gnl|my_center|LOCUS_07030 8286 7432 gene locus_tag LOCUS_07040 8286 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 8666 10798 gene locus_tag LOCUS_07050 8666 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12001 10859 gene locus_tag LOCUS_07060 12001 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12105 12686 gene locus_tag LOCUS_07070 12105 12686 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704892.1 protein_id gnl|my_center|LOCUS_07070 12693 13919 gene locus_tag LOCUS_07080 12693 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 15808 14045 gene locus_tag LOCUS_07090 15808 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 16163 15948 gene locus_tag LOCUS_07100 16163 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 16199 16633 gene locus_tag LOCUS_07110 16199 16633 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974224.1 protein_id gnl|my_center|LOCUS_07110 17610 16558 gene locus_tag LOCUS_07120 17610 16558 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 protein_id gnl|my_center|LOCUS_07120 18128 17637 gene locus_tag LOCUS_07130 gene ogt 18128 17637 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_07130 18369 19034 gene locus_tag LOCUS_07140 18369 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 19057 19911 gene locus_tag LOCUS_07150 19057 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 20041 20868 gene locus_tag LOCUS_07160 20041 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 20956 21750 gene locus_tag LOCUS_07170 20956 21750 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036023.1 protein_id gnl|my_center|LOCUS_07170 21786 22289 gene locus_tag LOCUS_07180 gene folA 21786 22289 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_07180 22286 22699 gene locus_tag LOCUS_07190 22286 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 22979 23923 gene locus_tag LOCUS_07200 22979 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 23939 24532 gene locus_tag LOCUS_07210 23939 24532 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_07210 24529 24990 gene locus_tag LOCUS_07220 24529 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 25022 26086 gene locus_tag LOCUS_07230 25022 26086 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_07230 26096 27127 gene locus_tag LOCUS_07240 26096 27127 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_07240 27525 28361 gene locus_tag LOCUS_07250 27525 28361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 28416 30008 gene locus_tag LOCUS_07260 28416 30008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 30005 30820 gene locus_tag LOCUS_07270 30005 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 31721 30897 gene locus_tag LOCUS_07280 31721 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 31932 31859 gene locus_tag LOCUS_t00100 31932 31859 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32041 32727 gene locus_tag LOCUS_07290 32041 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 32734 33000 gene locus_tag LOCUS_07300 32734 33000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 34339 33017 gene locus_tag LOCUS_07310 gene nuoH 34339 33017 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_07310 35154 34414 gene locus_tag LOCUS_07320 35154 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 35675 35163 gene locus_tag LOCUS_07330 35675 35163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 36804 36016 gene locus_tag LOCUS_07340 36804 36016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 37182 36868 gene locus_tag LOCUS_07350 37182 36868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 38999 37317 gene locus_tag LOCUS_07360 38999 37317 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_07360 39853 39023 gene locus_tag LOCUS_07370 39853 39023 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403300.1 protein_id gnl|my_center|LOCUS_07370 40715 39987 gene locus_tag LOCUS_07380 40715 39987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_07380 42267 40708 gene locus_tag LOCUS_07390 42267 40708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 42351 43442 gene locus_tag LOCUS_07400 gene dusB 42351 43442 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_07400 43624 45444 gene locus_tag LOCUS_07410 43624 45444 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07410 45591 47366 gene locus_tag LOCUS_07420 45591 47366 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07420 47621 49447 gene locus_tag LOCUS_07430 47621 49447 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07430 49696 50157 gene locus_tag LOCUS_07440 49696 50157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 50282 51532 gene locus_tag LOCUS_07450 gene gdhA 50282 51532 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_07450 51790 52944 gene locus_tag LOCUS_07460 51790 52944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence012 <1 2824 gene locus_tag LOCUS_07470 <1 2824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023174415.1:VCBS repeat-containing protein 4142 2808 gene locus_tag LOCUS_07480 4142 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4986 4153 gene locus_tag LOCUS_07490 4986 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5172 6512 gene locus_tag LOCUS_07500 5172 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6822 8009 gene locus_tag LOCUS_07510 6822 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8193 9929 gene locus_tag LOCUS_07520 8193 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10025 11683 gene locus_tag LOCUS_07530 10025 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 11840 13828 gene locus_tag LOCUS_07540 11840 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 16648 13919 gene locus_tag LOCUS_07550 gene topA 16648 13919 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931749.1 protein_id gnl|my_center|LOCUS_07550 17878 16913 gene locus_tag LOCUS_07560 gene miaA 17878 16913 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_07560 18636 17893 gene locus_tag LOCUS_07570 18636 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 19040 18636 gene locus_tag LOCUS_07580 19040 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 20356 19199 gene locus_tag LOCUS_07590 20356 19199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 20759 22357 gene locus_tag LOCUS_07600 gene der 20759 22357 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_07600 23081 22344 gene locus_tag LOCUS_07610 23081 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24247 23123 gene locus_tag LOCUS_07620 24247 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 26390 24249 gene locus_tag LOCUS_07630 26390 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 27011 26400 gene locus_tag LOCUS_07640 27011 26400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_07640 27853 27149 gene locus_tag LOCUS_07650 27853 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 28293 27850 gene locus_tag LOCUS_07660 gene arfB 28293 27850 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_07660 28315 29181 gene locus_tag LOCUS_07670 28315 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 29410 29829 gene locus_tag LOCUS_07680 29410 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 30129 29818 gene locus_tag LOCUS_07690 30129 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 30231 31244 gene locus_tag LOCUS_07700 30231 31244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 32754 31177 gene locus_tag LOCUS_07710 32754 31177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 33512 32757 gene locus_tag LOCUS_07720 33512 32757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 34748 33528 gene locus_tag LOCUS_07730 34748 33528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 34747 35289 gene locus_tag LOCUS_07740 34747 35289 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525272.1 protein_id gnl|my_center|LOCUS_07740 37176 35281 gene locus_tag LOCUS_07750 37176 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 37853 37173 gene locus_tag LOCUS_07760 37853 37173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 37934 39145 gene locus_tag LOCUS_07770 37934 39145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 40398 39106 gene locus_tag LOCUS_07780 40398 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 42821 40395 gene locus_tag LOCUS_07790 42821 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 42884 44479 gene locus_tag LOCUS_07800 42884 44479 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163445.1 protein_id gnl|my_center|LOCUS_07800 44476 45576 gene locus_tag LOCUS_07810 44476 45576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 46699 45650 gene locus_tag LOCUS_07820 46699 45650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 46999 49842 gene locus_tag LOCUS_07830 gene ppdK 46999 49842 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921479.1 protein_id gnl|my_center|LOCUS_07830 49839 50909 gene locus_tag LOCUS_07840 49839 50909 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_07840 52228 50915 gene locus_tag LOCUS_07850 52228 50915 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence013 875 72 gene locus_tag LOCUS_07860 875 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1009 1419 gene locus_tag LOCUS_07870 1009 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1416 2075 gene locus_tag LOCUS_07880 1416 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2041 2775 gene locus_tag LOCUS_07890 2041 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2762 4252 gene locus_tag LOCUS_07900 2762 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4516 4262 gene locus_tag LOCUS_07910 4516 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5082 4513 gene locus_tag LOCUS_07920 5082 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5218 5424 gene locus_tag LOCUS_07930 5218 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5471 5914 gene locus_tag LOCUS_07940 5471 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6201 5935 gene locus_tag LOCUS_07950 6201 5935 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_07950 7759 6362 gene locus_tag LOCUS_07960 7759 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10038 7852 gene locus_tag LOCUS_07970 10038 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 11800 10325 gene locus_tag LOCUS_07980 11800 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13496 11967 gene locus_tag LOCUS_07990 13496 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 15124 13724 gene locus_tag LOCUS_08000 15124 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15282 16220 gene locus_tag LOCUS_08010 15282 16220 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805075.1 protein_id gnl|my_center|LOCUS_08010 16242 16820 gene locus_tag LOCUS_08020 gene gmk 16242 16820 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_08020 18034 16895 gene locus_tag LOCUS_08030 18034 16895 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_08030 18162 19355 gene locus_tag LOCUS_08040 18162 19355 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 protein_id gnl|my_center|LOCUS_08040 20535 19348 gene locus_tag LOCUS_08050 20535 19348 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533658.1 protein_id gnl|my_center|LOCUS_08050 20663 21610 gene locus_tag LOCUS_08060 20663 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 21923 22927 gene locus_tag LOCUS_08070 21923 22927 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_08070 22924 24267 gene locus_tag LOCUS_08080 22924 24267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 24591 25973 gene locus_tag LOCUS_08090 24591 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 25973 27469 gene locus_tag LOCUS_08100 25973 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 29032 27476 gene locus_tag LOCUS_08110 29032 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 29856 29029 gene locus_tag LOCUS_08120 29856 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 31031 29853 gene locus_tag LOCUS_08130 31031 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 31993 31034 gene locus_tag LOCUS_08140 31993 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 31992 32657 gene locus_tag LOCUS_08150 31992 32657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 32738 33712 gene locus_tag LOCUS_08160 32738 33712 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_08160 33728 34570 gene locus_tag LOCUS_08170 33728 34570 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_08170 35512 34631 gene locus_tag LOCUS_08180 35512 34631 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_08180 36413 35514 gene locus_tag LOCUS_08190 36413 35514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 37714 36410 gene locus_tag LOCUS_08200 37714 36410 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_08200 38330 37800 gene locus_tag LOCUS_08210 38330 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 39369 38302 gene locus_tag LOCUS_08220 39369 38302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 39400 39576 gene locus_tag LOCUS_08230 39400 39576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 40750 39770 gene locus_tag LOCUS_08240 40750 39770 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_08240 40948 42000 gene locus_tag LOCUS_08250 gene gmd 40948 42000 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_08250 42636 42007 gene locus_tag LOCUS_08260 gene coaD 42636 42007 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_08260 43314 42784 gene locus_tag LOCUS_08270 43314 42784 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_08270 43398 46010 gene locus_tag LOCUS_08280 43398 46010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_08280 46636 46058 gene locus_tag LOCUS_08290 46636 46058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence014 <1 1425 gene locus_tag LOCUS_08300 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583645.1:Ig-like domain-containing protein 1981 1514 gene locus_tag LOCUS_08310 1981 1514 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776604.1 protein_id gnl|my_center|LOCUS_08310 1980 2279 gene locus_tag LOCUS_08320 1980 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2435 3457 gene locus_tag LOCUS_08330 2435 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3640 4131 gene locus_tag LOCUS_08340 3640 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4217 4639 gene locus_tag LOCUS_08350 4217 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4778 4705 gene locus_tag LOCUS_t00110 4778 4705 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4933 5916 gene locus_tag LOCUS_08360 4933 5916 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_08360 5909 6727 gene locus_tag LOCUS_08370 5909 6727 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_08370 6724 7593 gene locus_tag LOCUS_08380 6724 7593 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_08380 7675 7869 gene locus_tag LOCUS_08390 7675 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 9359 7866 gene locus_tag LOCUS_08400 9359 7866 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_08400 11105 9363 gene locus_tag LOCUS_08410 11105 9363 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_08410 12527 11214 gene locus_tag LOCUS_08420 12527 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14010 12571 gene locus_tag LOCUS_08430 14010 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15563 14211 gene locus_tag LOCUS_08440 15563 14211 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_08440 15682 17892 gene locus_tag LOCUS_08450 15682 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18139 19047 gene locus_tag LOCUS_08460 18139 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 19532 20557 gene locus_tag LOCUS_08470 19532 20557 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_08470 22060 20597 gene locus_tag LOCUS_08480 22060 20597 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_08480 22184 23464 gene locus_tag LOCUS_08490 22184 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 24306 23491 gene locus_tag LOCUS_08500 24306 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 25017 24382 gene locus_tag LOCUS_08510 25017 24382 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_08510 27352 25241 gene locus_tag LOCUS_08520 gene fusA 27352 25241 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_08520 30255 27778 gene locus_tag LOCUS_08530 30255 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 31372 30248 gene locus_tag LOCUS_08540 31372 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 33069 31846 gene locus_tag LOCUS_08550 33069 31846 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_08550 35085 33082 gene locus_tag LOCUS_08560 gene top6B 35085 33082 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867718.1 protein_id gnl|my_center|LOCUS_08560 35145 35615 gene locus_tag LOCUS_08570 gene ndk 35145 35615 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_08570 36017 35646 gene locus_tag LOCUS_08580 36017 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 36297 36046 gene locus_tag LOCUS_08590 36297 36046 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_08590 36453 37907 gene locus_tag LOCUS_08600 36453 37907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 37939 39363 gene locus_tag LOCUS_08610 37939 39363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 39422 40168 gene locus_tag LOCUS_08620 39422 40168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 42558 40204 gene locus_tag LOCUS_08630 42558 40204 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120638.1 protein_id gnl|my_center|LOCUS_08630 42763 42678 gene locus_tag LOCUS_t00120 42763 42678 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43541 42903 gene locus_tag LOCUS_08640 gene upp 43541 42903 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_08640 43586 44056 gene locus_tag LOCUS_08650 43586 44056 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048393.1 protein_id gnl|my_center|LOCUS_08650 44590 44063 gene locus_tag LOCUS_08660 44590 44063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 <45943 44587 gene locus_tag LOCUS_08670 <45943 44587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368911.1:argininosuccinate lyase >Feature sequence015 1767 1105 gene locus_tag LOCUS_08680 1767 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1951 3054 gene locus_tag LOCUS_08690 gene ychF 1951 3054 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_08690 4009 3155 gene locus_tag LOCUS_08700 4009 3155 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_08700 5602 4121 gene locus_tag LOCUS_08710 gene guaB 5602 4121 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_08710 5820 7907 gene locus_tag LOCUS_08720 5820 7907 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_08720 7978 8349 gene locus_tag LOCUS_08730 7978 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8599 8252 gene locus_tag LOCUS_08740 8599 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 11041 8669 gene locus_tag LOCUS_08750 11041 8669 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_08750 11260 12048 gene locus_tag LOCUS_08760 11260 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 12146 12628 gene locus_tag LOCUS_08770 12146 12628 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792177.1 protein_id gnl|my_center|LOCUS_08770 12781 13392 gene locus_tag LOCUS_08780 12781 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 13621 13923 gene locus_tag LOCUS_08790 13621 13923 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_08790 14418 13990 gene locus_tag LOCUS_08800 gene apaG 14418 13990 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920100.1 protein_id gnl|my_center|LOCUS_08800 14627 15394 gene locus_tag LOCUS_08810 14627 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 15460 16392 gene locus_tag LOCUS_08820 15460 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 16491 17735 gene locus_tag LOCUS_08830 16491 17735 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_08830 18625 17714 gene locus_tag LOCUS_08840 gene folD 18625 17714 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_08840 18693 20909 gene locus_tag LOCUS_08850 gene ligA 18693 20909 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_08850 21093 21773 gene locus_tag LOCUS_08860 21093 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 24736 21893 gene locus_tag LOCUS_08870 gene acnA 24736 21893 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238573.1 protein_id gnl|my_center|LOCUS_08870 24824 25357 gene locus_tag LOCUS_08880 24824 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 25933 26202 gene locus_tag LOCUS_08890 25933 26202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 27706 26213 gene locus_tag LOCUS_08900 27706 26213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 28308 27703 gene locus_tag LOCUS_08910 28308 27703 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403113.1 protein_id gnl|my_center|LOCUS_08910 28695 28345 gene locus_tag LOCUS_08920 28695 28345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 30750 28717 gene locus_tag LOCUS_08930 gene ftsH 30750 28717 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_08930 31420 30893 gene locus_tag LOCUS_08940 31420 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 32391 31417 gene locus_tag LOCUS_08950 32391 31417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 33071 32457 gene locus_tag LOCUS_08960 gene lexA 33071 32457 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_08960 34804 33671 gene locus_tag LOCUS_08970 gene dprA 34804 33671 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_08970 35225 34848 gene locus_tag LOCUS_08980 35225 34848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 35399 36493 gene locus_tag LOCUS_08990 gene queA 35399 36493 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_08990 36591 38066 gene locus_tag LOCUS_09000 36591 38066 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_09000 38063 39460 gene locus_tag LOCUS_09010 gene murF 38063 39460 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_09010 39464 40633 gene locus_tag LOCUS_09020 gene mraY 39464 40633 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_09020 42621 40645 gene locus_tag LOCUS_09030 42621 40645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 <43690 42563 gene locus_tag LOCUS_09040 <43690 42563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121802.1:glycosyltransferase family 4 protein >Feature sequence016 23 3283 gene locus_tag LOCUS_09050 23 3283 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_09050 3280 4359 gene locus_tag LOCUS_09060 3280 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6322 4346 gene locus_tag LOCUS_09070 6322 4346 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403331.1 protein_id gnl|my_center|LOCUS_09070 6609 6319 gene locus_tag LOCUS_09080 6609 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7578 6631 gene locus_tag LOCUS_09090 7578 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8612 7641 gene locus_tag LOCUS_09100 gene rsmH 8612 7641 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_09100 8770 9642 gene locus_tag LOCUS_09110 8770 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 10673 9720 gene locus_tag LOCUS_09120 10673 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_09120 10746 11699 gene locus_tag LOCUS_09130 10746 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 12481 11696 gene locus_tag LOCUS_09140 12481 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 13730 12492 gene locus_tag LOCUS_09150 13730 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14638 13727 gene locus_tag LOCUS_09160 14638 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15969 14638 gene locus_tag LOCUS_09170 15969 14638 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_09170 16173 17009 gene locus_tag LOCUS_09180 16173 17009 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_09180 17006 18034 gene locus_tag LOCUS_09190 17006 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 18106 18588 gene locus_tag LOCUS_09200 18106 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 19066 18611 gene locus_tag LOCUS_09210 19066 18611 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_09210 20353 19118 gene locus_tag LOCUS_09220 20353 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 21275 20373 gene locus_tag LOCUS_09230 21275 20373 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_09230 21422 22234 gene locus_tag LOCUS_09240 21422 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 22271 22963 gene locus_tag LOCUS_09250 22271 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 24282 23005 gene locus_tag LOCUS_09260 24282 23005 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_09260 25668 24316 gene locus_tag LOCUS_09270 25668 24316 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_09270 26527 25655 gene locus_tag LOCUS_09280 26527 25655 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_09280 26481 27572 gene locus_tag LOCUS_09290 26481 27572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 28498 27461 gene locus_tag LOCUS_09300 28498 27461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 28626 29849 gene locus_tag LOCUS_09310 28626 29849 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_09310 29846 32068 gene locus_tag LOCUS_09320 29846 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 33273 32107 gene locus_tag LOCUS_09330 33273 32107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_09330 34315 33317 gene locus_tag LOCUS_09340 34315 33317 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_09340 34410 35744 gene locus_tag LOCUS_09350 34410 35744 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_09350 37151 35811 gene locus_tag LOCUS_09360 37151 35811 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_09360 40245 37237 gene locus_tag LOCUS_09370 40245 37237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 41805 40363 gene locus_tag LOCUS_09380 41805 40363 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence017 100 1446 gene locus_tag LOCUS_09390 gene dnaA 100 1446 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_09390 2631 1912 gene locus_tag LOCUS_09400 gene mutM 2631 1912 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114647.1 protein_id gnl|my_center|LOCUS_09400 3305 2775 gene locus_tag LOCUS_09410 gene tadA 3305 2775 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_09410 4240 3302 gene locus_tag LOCUS_09420 4240 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4330 4950 gene locus_tag LOCUS_09430 4330 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4947 5570 gene locus_tag LOCUS_09440 4947 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5671 6858 gene locus_tag LOCUS_09450 5671 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7105 8157 gene locus_tag LOCUS_09460 7105 8157 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_09460 8321 8767 gene locus_tag LOCUS_09470 8321 8767 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_09470 8808 10376 gene locus_tag LOCUS_09480 gene lysS 8808 10376 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_09480 10541 11041 gene locus_tag LOCUS_09490 10541 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11415 11149 gene locus_tag LOCUS_09500 11415 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 11954 14605 gene locus_tag LOCUS_09510 gene clpB 11954 14605 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_09510 14679 14990 gene locus_tag LOCUS_09520 14679 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 15007 15909 gene locus_tag LOCUS_09530 gene ilvE 15007 15909 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 protein_id gnl|my_center|LOCUS_09530 16463 15900 gene locus_tag LOCUS_09540 gene pyrE 16463 15900 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_09540 16600 17583 gene locus_tag LOCUS_09550 16600 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 18177 17587 gene locus_tag LOCUS_09560 18177 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18290 18889 gene locus_tag LOCUS_09570 18290 18889 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948569.1 protein_id gnl|my_center|LOCUS_09570 22818 18913 gene locus_tag LOCUS_09580 22818 18913 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_09580 22998 23237 gene locus_tag LOCUS_09590 22998 23237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 23247 23930 gene locus_tag LOCUS_09600 23247 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 25097 23946 gene locus_tag LOCUS_09610 25097 23946 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839746.1 protein_id gnl|my_center|LOCUS_09610 26473 25094 gene locus_tag LOCUS_09620 26473 25094 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_09620 26531 27349 gene locus_tag LOCUS_09630 gene surE 26531 27349 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_09630 28371 27490 gene locus_tag LOCUS_09640 28371 27490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 28991 28467 gene locus_tag LOCUS_09650 28991 28467 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_09650 29050 29511 gene locus_tag LOCUS_09660 29050 29511 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_09660 29547 30812 gene locus_tag LOCUS_09670 29547 30812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 30945 31649 gene locus_tag LOCUS_09680 30945 31649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143132.1 protein_id gnl|my_center|LOCUS_09680 31646 33403 gene locus_tag LOCUS_09690 31646 33403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 34058 33381 gene locus_tag LOCUS_09700 34058 33381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 34423 34055 gene locus_tag LOCUS_09710 34423 34055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 34715 34413 gene locus_tag LOCUS_09720 34715 34413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 36070 34904 gene locus_tag LOCUS_09730 36070 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 36157 37371 gene locus_tag LOCUS_09740 36157 37371 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_09740 37593 38996 gene locus_tag LOCUS_09750 37593 38996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence018 209 667 gene locus_tag LOCUS_09760 209 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2885 750 gene locus_tag LOCUS_09770 2885 750 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_09770 3931 2969 gene locus_tag LOCUS_09780 3931 2969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_09780 6331 3941 gene locus_tag LOCUS_09790 6331 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 6540 6370 gene locus_tag LOCUS_09800 6540 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6497 6775 gene locus_tag LOCUS_09810 6497 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7711 6746 gene locus_tag LOCUS_09820 7711 6746 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_09820 8251 7754 gene locus_tag LOCUS_09830 8251 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8491 12189 gene locus_tag LOCUS_09840 8491 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 12316 14193 gene locus_tag LOCUS_09850 12316 14193 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038616.1 protein_id gnl|my_center|LOCUS_09850 14226 15206 gene locus_tag LOCUS_09860 gene speB 14226 15206 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_09860 15709 15203 gene locus_tag LOCUS_09870 15709 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 15974 16867 gene locus_tag LOCUS_09880 15974 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 16864 17256 gene locus_tag LOCUS_09890 16864 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 17879 17283 gene locus_tag LOCUS_09900 17879 17283 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703230.1 protein_id gnl|my_center|LOCUS_09900 19400 17967 gene locus_tag LOCUS_09910 19400 17967 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838082.1 protein_id gnl|my_center|LOCUS_09910 20291 19485 gene locus_tag LOCUS_09920 20291 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 20370 21053 gene locus_tag LOCUS_09930 20370 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 22753 21056 gene locus_tag LOCUS_09940 22753 21056 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_09940 22892 22819 gene locus_tag LOCUS_t00130 22892 22819 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24644 23031 gene locus_tag LOCUS_09950 gene miaB 24644 23031 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_09950 24710 26383 gene locus_tag LOCUS_09960 24710 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 26453 26797 gene locus_tag LOCUS_09970 26453 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 28103 26751 gene locus_tag LOCUS_09980 28103 26751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 28118 28675 gene locus_tag LOCUS_09990 28118 28675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 28746 29567 gene locus_tag LOCUS_10000 28746 29567 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922342.1 protein_id gnl|my_center|LOCUS_10000 29560 31551 gene locus_tag LOCUS_10010 gene sdhA 29560 31551 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_10010 31569 32396 gene locus_tag LOCUS_10020 gene sdhB 31569 32396 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122819.1 protein_id gnl|my_center|LOCUS_10020 32511 33896 gene locus_tag LOCUS_10030 32511 33896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 35206 33893 gene locus_tag LOCUS_10040 35206 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 37365 35338 gene locus_tag LOCUS_10050 37365 35338 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_10050 38383 37613 gene locus_tag LOCUS_10060 38383 37613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence019 868 410 gene locus_tag LOCUS_10070 868 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1578 871 gene locus_tag LOCUS_10080 1578 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4020 1918 gene locus_tag LOCUS_10090 4020 1918 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_10090 4964 4017 gene locus_tag LOCUS_10100 4964 4017 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_10100 6011 4983 gene locus_tag LOCUS_10110 6011 4983 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_10110 8996 6015 gene locus_tag LOCUS_10120 8996 6015 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_10120 10093 8993 gene locus_tag LOCUS_10130 10093 8993 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_10130 11657 10116 gene locus_tag LOCUS_10140 11657 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 11799 12281 gene locus_tag LOCUS_10150 gene accB 11799 12281 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_10150 12310 13662 gene locus_tag LOCUS_10160 gene accC 12310 13662 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_10160 13963 14757 gene locus_tag LOCUS_10170 13963 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 15028 16179 gene locus_tag LOCUS_10180 15028 16179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 17259 16270 gene locus_tag LOCUS_10190 17259 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 17974 17252 gene locus_tag LOCUS_10200 17974 17252 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932199.1 protein_id gnl|my_center|LOCUS_10200 18633 17992 gene locus_tag LOCUS_10210 18633 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 19561 18641 gene locus_tag LOCUS_10220 19561 18641 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_10220 20585 19650 gene locus_tag LOCUS_10230 20585 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 21211 20582 gene locus_tag LOCUS_10240 21211 20582 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_10240 22384 21224 gene locus_tag LOCUS_10250 22384 21224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 24165 22420 gene locus_tag LOCUS_10260 24165 22420 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_10260 25949 24165 gene locus_tag LOCUS_10270 gene gltX 25949 24165 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 protein_id gnl|my_center|LOCUS_10270 26663 25989 gene locus_tag LOCUS_10280 26663 25989 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_10280 26800 27858 gene locus_tag LOCUS_10290 26800 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 28044 30734 gene locus_tag LOCUS_10300 28044 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 31512 30670 gene locus_tag LOCUS_10310 31512 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 31560 32072 gene locus_tag LOCUS_10320 31560 32072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 32110 32619 gene locus_tag LOCUS_10330 32110 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 32638 33369 gene locus_tag LOCUS_10340 32638 33369 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_10340 34092 33376 gene locus_tag LOCUS_10350 34092 33376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 34192 34280 gene locus_tag LOCUS_t00140 34192 34280 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35651 34344 gene locus_tag LOCUS_10360 35651 34344 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_10360 35838 36710 gene locus_tag LOCUS_10370 35838 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 37165 36707 gene locus_tag LOCUS_10380 37165 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 37788 37291 gene locus_tag LOCUS_10390 37788 37291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence020 68 364 gene locus_tag LOCUS_10400 68 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 369 1391 gene locus_tag LOCUS_10410 gene fliG 369 1391 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_10410 1404 2120 gene locus_tag LOCUS_10420 1404 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2117 3457 gene locus_tag LOCUS_10430 gene fliI 2117 3457 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_10430 3457 3900 gene locus_tag LOCUS_10440 3457 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3900 4658 gene locus_tag LOCUS_10450 3900 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4655 5746 gene locus_tag LOCUS_10460 4655 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5767 6222 gene locus_tag LOCUS_10470 5767 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 6219 6656 gene locus_tag LOCUS_10480 6219 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6694 8445 gene locus_tag LOCUS_10490 6694 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8488 8685 gene locus_tag LOCUS_10500 8488 8685 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816224.1 protein_id gnl|my_center|LOCUS_10500 8803 9588 gene locus_tag LOCUS_10510 8803 9588 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_10510 9602 10339 gene locus_tag LOCUS_10520 9602 10339 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326459.1 protein_id gnl|my_center|LOCUS_10520 10356 10883 gene locus_tag LOCUS_10530 10356 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11077 11808 gene locus_tag LOCUS_10540 11077 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 11857 12582 gene locus_tag LOCUS_10550 11857 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12579 13595 gene locus_tag LOCUS_10560 gene fliP 12579 13595 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118329.1 protein_id gnl|my_center|LOCUS_10560 13605 13871 gene locus_tag LOCUS_10570 gene fliQ 13605 13871 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_10570 13925 14707 gene locus_tag LOCUS_10580 gene fliR 13925 14707 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_10580 14697 15770 gene locus_tag LOCUS_10590 gene flhB 14697 15770 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_10590 15784 17925 gene locus_tag LOCUS_10600 gene flhA 15784 17925 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_10600 17993 19603 gene locus_tag LOCUS_10610 17993 19603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 19600 20580 gene locus_tag LOCUS_10620 19600 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 20719 21003 gene locus_tag LOCUS_10630 20719 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 21141 22010 gene locus_tag LOCUS_10640 21141 22010 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_10640 22085 22612 gene locus_tag LOCUS_10650 gene folK 22085 22612 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_10650 22609 23826 gene locus_tag LOCUS_10660 22609 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 24895 23867 gene locus_tag LOCUS_10670 gene xerC 24895 23867 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_10670 25805 25062 gene locus_tag LOCUS_10680 25805 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 27208 25943 gene locus_tag LOCUS_10690 27208 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 27817 28566 gene locus_tag LOCUS_10700 27817 28566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 28606 29154 gene locus_tag LOCUS_10710 28606 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 32493 29227 gene locus_tag LOCUS_10720 32493 29227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 33020 32511 gene locus_tag LOCUS_10730 33020 32511 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_10730 34070 33030 gene locus_tag LOCUS_10740 34070 33030 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_10740 34166 35032 gene locus_tag LOCUS_10750 34166 35032 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296973.1 protein_id gnl|my_center|LOCUS_10750 36174 35173 gene locus_tag LOCUS_10760 36174 35173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 38064 36601 gene locus_tag LOCUS_10770 38064 36601 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence021 2975 315 gene locus_tag LOCUS_10780 2975 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3553 2972 gene locus_tag LOCUS_10790 3553 2972 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_10790 3744 5288 gene locus_tag LOCUS_10800 3744 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5285 5692 gene locus_tag LOCUS_10810 5285 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5781 5853 gene locus_tag LOCUS_t00150 5781 5853 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6016 6537 gene locus_tag LOCUS_10820 6016 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10298 6525 gene locus_tag LOCUS_10830 10298 6525 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922114.1 protein_id gnl|my_center|LOCUS_10830 11308 10298 gene locus_tag LOCUS_10840 gene argC 11308 10298 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_10840 12465 11305 gene locus_tag LOCUS_10850 12465 11305 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393522.1 protein_id gnl|my_center|LOCUS_10850 14021 12453 gene locus_tag LOCUS_10860 gene xylB 14021 12453 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_10860 14807 14025 gene locus_tag LOCUS_10870 14807 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 16684 14840 gene locus_tag LOCUS_10880 gene mutL 16684 14840 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_10880 16723 17139 gene locus_tag LOCUS_10890 16723 17139 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983376.1 protein_id gnl|my_center|LOCUS_10890 17696 17136 gene locus_tag LOCUS_10900 17696 17136 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 protein_id gnl|my_center|LOCUS_10900 18214 17711 gene locus_tag LOCUS_10910 gene mog 18214 17711 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_10910 18693 18211 gene locus_tag LOCUS_10920 gene moaC 18693 18211 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013475.1 protein_id gnl|my_center|LOCUS_10920 19859 18702 gene locus_tag LOCUS_10930 19859 18702 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117835.1 protein_id gnl|my_center|LOCUS_10930 19928 20206 gene locus_tag LOCUS_10940 19928 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 20203 20631 gene locus_tag LOCUS_10950 20203 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 21681 20614 gene locus_tag LOCUS_10960 gene moaA 21681 20614 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_10960 22024 21683 gene locus_tag LOCUS_10970 22024 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 22094 24991 gene locus_tag LOCUS_10980 22094 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 25214 28921 gene locus_tag LOCUS_10990 25214 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 29520 28975 gene locus_tag LOCUS_11000 29520 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 30755 29592 gene locus_tag LOCUS_11010 30755 29592 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_11010 31810 31007 gene locus_tag LOCUS_11020 31810 31007 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_11020 31872 32429 gene locus_tag LOCUS_11030 31872 32429 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_11030 33834 32551 gene locus_tag LOCUS_11040 33834 32551 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_11040 33952 34566 gene locus_tag LOCUS_11050 gene udk 33952 34566 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172663.1 protein_id gnl|my_center|LOCUS_11050 34643 36478 gene locus_tag LOCUS_11060 34643 36478 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524104.1 protein_id gnl|my_center|LOCUS_11060 <37875 36486 gene locus_tag LOCUS_11070 <37875 36486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142253.1:AbgT family transporter >Feature sequence022 1215 808 gene locus_tag LOCUS_11080 1215 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3350 2055 gene locus_tag LOCUS_11090 3350 2055 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_11090 4745 3360 gene locus_tag LOCUS_11100 4745 3360 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_11100 5997 4783 gene locus_tag LOCUS_11110 5997 4783 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_11110 7203 6052 gene locus_tag LOCUS_11120 gene recA 7203 6052 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_11120 7458 8249 gene locus_tag LOCUS_11130 7458 8249 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_11130 10111 8255 gene locus_tag LOCUS_11140 10111 8255 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_11140 12963 10255 gene locus_tag LOCUS_11150 12963 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 17693 13056 gene locus_tag LOCUS_11160 17693 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 18111 17698 gene locus_tag LOCUS_11170 18111 17698 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760582.1 protein_id gnl|my_center|LOCUS_11170 18873 18112 gene locus_tag LOCUS_11180 18873 18112 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_11180 22047 18919 gene locus_tag LOCUS_11190 22047 18919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 24691 22247 gene locus_tag LOCUS_11200 24691 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 25089 24688 gene locus_tag LOCUS_11210 25089 24688 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640294.1 protein_id gnl|my_center|LOCUS_11210 26715 25279 gene locus_tag LOCUS_11220 26715 25279 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257259.1 protein_id gnl|my_center|LOCUS_11220 26787 28733 gene locus_tag LOCUS_11230 gene speA 26787 28733 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_11230 28733 29605 gene locus_tag LOCUS_11240 gene speB 28733 29605 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_11240 31079 29583 gene locus_tag LOCUS_11250 31079 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 32518 31073 gene locus_tag LOCUS_11260 32518 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 34091 32529 gene locus_tag LOCUS_11270 gene pyk 34091 32529 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_11270 35717 34107 gene locus_tag LOCUS_11280 35717 34107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 36851 35739 gene locus_tag LOCUS_11290 gene mnmA 36851 35739 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_11290 37638 36916 gene locus_tag LOCUS_11300 37638 36916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence023 4070 975 gene locus_tag LOCUS_11310 4070 975 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_11310 5590 4088 gene locus_tag LOCUS_11320 5590 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6954 5587 gene locus_tag LOCUS_11330 6954 5587 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_11330 8274 7582 gene locus_tag LOCUS_11340 8274 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8927 8316 gene locus_tag LOCUS_11350 8927 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9100 11979 gene locus_tag LOCUS_11360 gene fliD 9100 11979 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119371.1 protein_id gnl|my_center|LOCUS_11360 12023 12487 gene locus_tag LOCUS_11370 12023 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12793 14250 gene locus_tag LOCUS_11380 12793 14250 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_11380 14247 15278 gene locus_tag LOCUS_11390 gene cydB 14247 15278 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_11390 15497 16384 gene locus_tag LOCUS_11400 15497 16384 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_11400 16365 17159 gene locus_tag LOCUS_11410 16365 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17156 18349 gene locus_tag LOCUS_11420 17156 18349 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_11420 18593 20386 gene locus_tag LOCUS_11430 18593 20386 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_11430 20844 22919 gene locus_tag LOCUS_11440 20844 22919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 22983 23915 gene locus_tag LOCUS_11450 22983 23915 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975575.1 protein_id gnl|my_center|LOCUS_11450 23912 24661 gene locus_tag LOCUS_11460 23912 24661 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721140.1 protein_id gnl|my_center|LOCUS_11460 24924 30290 gene locus_tag LOCUS_11470 24924 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 30391 31143 gene locus_tag LOCUS_11480 30391 31143 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_11480 31257 32135 gene locus_tag LOCUS_11490 31257 32135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 32220 34193 gene locus_tag LOCUS_11500 32220 34193 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_11500 34222 35346 gene locus_tag LOCUS_11510 gene pdhA 34222 35346 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_11510 35383 36357 gene locus_tag LOCUS_11520 35383 36357 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence024 30 779 gene locus_tag LOCUS_11530 30 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 781 1584 gene locus_tag LOCUS_11540 781 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1701 2108 gene locus_tag LOCUS_11550 1701 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2030 3544 gene locus_tag LOCUS_11560 gene hutH 2030 3544 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_11560 3541 4242 gene locus_tag LOCUS_11570 3541 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4820 4146 gene locus_tag LOCUS_11580 4820 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5733 4993 gene locus_tag LOCUS_11590 5733 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6012 6374 gene locus_tag LOCUS_11600 6012 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6414 7559 gene locus_tag LOCUS_11610 6414 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9260 7578 gene locus_tag LOCUS_11620 gene hutU 9260 7578 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_11620 10020 9529 gene locus_tag LOCUS_11630 10020 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9913 10350 gene locus_tag LOCUS_11640 9913 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10347 11582 gene locus_tag LOCUS_11650 gene hutI 10347 11582 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_11650 11622 12449 gene locus_tag LOCUS_11660 gene map 11622 12449 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233851.1 protein_id gnl|my_center|LOCUS_11660 12442 13281 gene locus_tag LOCUS_11670 gene trpA 12442 13281 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124727.1 protein_id gnl|my_center|LOCUS_11670 13352 15547 gene locus_tag LOCUS_11680 13352 15547 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_11680 16332 15559 gene locus_tag LOCUS_11690 16332 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 17339 16362 gene locus_tag LOCUS_11700 gene nadC 17339 16362 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921990.1 protein_id gnl|my_center|LOCUS_11700 17354 18139 gene locus_tag LOCUS_11710 17354 18139 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941673.1 protein_id gnl|my_center|LOCUS_11710 18200 18475 gene locus_tag LOCUS_11720 18200 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 20533 18476 gene locus_tag LOCUS_11730 gene prlC 20533 18476 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266147.1 protein_id gnl|my_center|LOCUS_11730 21452 20625 gene locus_tag LOCUS_11740 21452 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 21613 21395 gene locus_tag LOCUS_11750 21613 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 24718 21716 gene locus_tag LOCUS_11760 24718 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 25035 24961 gene locus_tag LOCUS_t00160 25035 24961 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25244 26548 gene locus_tag LOCUS_11770 25244 26548 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_11770 26576 27868 gene locus_tag LOCUS_11780 26576 27868 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_11780 27885 31589 gene locus_tag LOCUS_11790 27885 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 33367 31586 gene locus_tag LOCUS_11800 33367 31586 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_11800 33279 34724 gene locus_tag LOCUS_11810 33279 34724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 <35608 34679 gene locus_tag LOCUS_11820 <35608 34679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616105.1:DUF1080 domain-containing protein >Feature sequence025 <1 922 gene locus_tag LOCUS_11830 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122798.1:DUF58 domain-containing protein 919 3096 gene locus_tag LOCUS_11840 919 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3208 4035 gene locus_tag LOCUS_11850 3208 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4062 4889 gene locus_tag LOCUS_11860 4062 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5201 4911 gene locus_tag LOCUS_11870 5201 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5280 6527 gene locus_tag LOCUS_11880 5280 6527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_11880 6524 7816 gene locus_tag LOCUS_11890 gene trpB 6524 7816 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_11890 9226 7862 gene locus_tag LOCUS_11900 9226 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 9615 9223 gene locus_tag LOCUS_11910 9615 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 9553 11499 gene locus_tag LOCUS_11920 9553 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 12308 11496 gene locus_tag LOCUS_11930 12308 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 12571 14073 gene locus_tag LOCUS_11940 12571 14073 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_11940 14177 15376 gene locus_tag LOCUS_11950 gene hppD 14177 15376 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_11950 15540 15468 gene locus_tag LOCUS_t00170 15540 15468 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15660 15570 gene locus_tag LOCUS_t00180 15660 15570 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16011 15748 gene locus_tag LOCUS_11960 16011 15748 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_11960 16751 16212 gene locus_tag LOCUS_11970 16751 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 16848 17078 gene locus_tag LOCUS_11980 16848 17078 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_11980 17091 17708 gene locus_tag LOCUS_11990 17091 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 17705 18814 gene locus_tag LOCUS_12000 17705 18814 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_12000 18811 19872 gene locus_tag LOCUS_12010 18811 19872 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122037.1 protein_id gnl|my_center|LOCUS_12010 19919 20006 gene locus_tag LOCUS_t00190 19919 20006 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20471 20028 gene locus_tag LOCUS_12020 20471 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 21340 20468 gene locus_tag LOCUS_12030 21340 20468 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527105.1 protein_id gnl|my_center|LOCUS_12030 22215 21337 gene locus_tag LOCUS_12040 22215 21337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_12040 23582 22212 gene locus_tag LOCUS_12050 23582 22212 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_12050 24261 23587 gene locus_tag LOCUS_12060 24261 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 26320 24341 gene locus_tag LOCUS_12070 gene nosZ 26320 24341 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_12070 27249 26395 gene locus_tag LOCUS_12080 27249 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 27840 27319 gene locus_tag LOCUS_12090 27840 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 29181 28000 gene locus_tag LOCUS_12100 29181 28000 CDS product VLRF1 family aeRF1-type release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256216.1 protein_id gnl|my_center|LOCUS_12100 29568 29655 gene locus_tag LOCUS_t00200 29568 29655 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29938 30495 gene locus_tag LOCUS_12110 29938 30495 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 protein_id gnl|my_center|LOCUS_12110 30541 31689 gene locus_tag LOCUS_12120 30541 31689 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_12120 31686 33005 gene locus_tag LOCUS_12130 gene kynU 31686 33005 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_12130 33275 33006 gene locus_tag LOCUS_12140 33275 33006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 33294 34472 gene locus_tag LOCUS_12150 33294 34472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence026 1291 614 gene locus_tag LOCUS_12160 1291 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2469 1777 gene locus_tag LOCUS_12170 2469 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2870 4423 gene locus_tag LOCUS_12180 2870 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5052 4513 gene locus_tag LOCUS_12190 5052 4513 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_12190 5070 5426 gene locus_tag LOCUS_12200 5070 5426 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_12200 5438 6847 gene locus_tag LOCUS_12210 5438 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6844 9855 gene locus_tag LOCUS_12220 gene gcvP 6844 9855 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_12220 9895 10701 gene locus_tag LOCUS_12230 9895 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10658 11950 gene locus_tag LOCUS_12240 gene ispG 10658 11950 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903303.1 protein_id gnl|my_center|LOCUS_12240 12789 11968 gene locus_tag LOCUS_12250 12789 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 13607 12792 gene locus_tag LOCUS_12260 13607 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14225 13815 gene locus_tag LOCUS_12270 14225 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 14355 14891 gene locus_tag LOCUS_12280 gene ispF 14355 14891 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921639.1 protein_id gnl|my_center|LOCUS_12280 15721 14903 gene locus_tag LOCUS_12290 15721 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 16647 15784 gene locus_tag LOCUS_12300 16647 15784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_12300 16853 16653 gene locus_tag LOCUS_12310 16853 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 18529 16922 gene locus_tag LOCUS_12320 gene murJ 18529 16922 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_12320 20341 18548 gene locus_tag LOCUS_12330 20341 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 20901 21998 gene locus_tag LOCUS_12340 20901 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 22134 22754 gene locus_tag LOCUS_12350 22134 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 22803 24257 gene locus_tag LOCUS_12360 gene xseA 22803 24257 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_12360 24250 24522 gene locus_tag LOCUS_12370 24250 24522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 24538 26106 gene locus_tag LOCUS_12380 24538 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 26234 26899 gene locus_tag LOCUS_12390 26234 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 27617 27027 gene locus_tag LOCUS_12400 27617 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 28558 27617 gene locus_tag LOCUS_12410 gene fmt 28558 27617 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_12410 29116 28562 gene locus_tag LOCUS_12420 gene def 29116 28562 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883700.1 protein_id gnl|my_center|LOCUS_12420 29271 30785 gene locus_tag LOCUS_12430 29271 30785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 30786 31526 gene locus_tag LOCUS_12440 gene kdsB 30786 31526 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011599.1 protein_id gnl|my_center|LOCUS_12440 31523 32443 gene locus_tag LOCUS_12450 31523 32443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_12450 32477 33196 gene locus_tag LOCUS_12460 32477 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 33209 33700 gene locus_tag LOCUS_12470 gene smpB 33209 33700 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_12470 34187 33735 gene locus_tag LOCUS_12480 34187 33735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence027 348 1973 gene locus_tag LOCUS_12490 348 1973 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 protein_id gnl|my_center|LOCUS_12490 2702 1989 gene locus_tag LOCUS_12500 2702 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3413 2709 gene locus_tag LOCUS_12510 3413 2709 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_12510 3839 3459 gene locus_tag LOCUS_12520 gene rplT 3839 3459 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_12520 4211 3921 gene locus_tag LOCUS_12530 4211 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5500 4322 gene locus_tag LOCUS_12540 5500 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6166 5507 gene locus_tag LOCUS_12550 6166 5507 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_12550 6507 6166 gene locus_tag LOCUS_12560 6507 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6629 7174 gene locus_tag LOCUS_12570 6629 7174 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_12570 7171 7632 gene locus_tag LOCUS_12580 7171 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7632 8513 gene locus_tag LOCUS_12590 7632 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8915 8544 gene locus_tag LOCUS_12600 8915 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9938 8973 gene locus_tag LOCUS_12610 9938 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12680 9942 gene locus_tag LOCUS_12620 12680 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 15349 12677 gene locus_tag LOCUS_12630 15349 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 15746 15333 gene locus_tag LOCUS_12640 15746 15333 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_12640 16177 15743 gene locus_tag LOCUS_12650 16177 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 16920 16174 gene locus_tag LOCUS_12660 16920 16174 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_12660 17969 16920 gene locus_tag LOCUS_12670 17969 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18922 17969 gene locus_tag LOCUS_12680 18922 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 19188 19913 gene locus_tag LOCUS_12690 gene pyrH 19188 19913 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179852.1 protein_id gnl|my_center|LOCUS_12690 19959 20531 gene locus_tag LOCUS_12700 gene frr 19959 20531 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_12700 20638 22710 gene locus_tag LOCUS_12710 20638 22710 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_12710 22703 23323 gene locus_tag LOCUS_12720 22703 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 23374 24294 gene locus_tag LOCUS_12730 23374 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 26094 24304 gene locus_tag LOCUS_12740 gene sppA 26094 24304 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 protein_id gnl|my_center|LOCUS_12740 26630 26211 gene locus_tag LOCUS_12750 26630 26211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 27591 26617 gene locus_tag LOCUS_12760 27591 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 27712 28638 gene locus_tag LOCUS_12770 27712 28638 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_12770 28657 28869 gene locus_tag LOCUS_12780 28657 28869 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_12780 29377 30783 gene locus_tag LOCUS_12790 29377 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 33671 30846 gene locus_tag LOCUS_12800 33671 30846 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence028 <1 962 gene locus_tag LOCUS_12810 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584015.1:sugar-binding protein 966 2540 gene locus_tag LOCUS_12820 966 2540 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 protein_id gnl|my_center|LOCUS_12820 4728 2548 gene locus_tag LOCUS_12830 4728 2548 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269243.1 protein_id gnl|my_center|LOCUS_12830 4888 7617 gene locus_tag LOCUS_12840 4888 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9086 7593 gene locus_tag LOCUS_12850 9086 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9601 9218 gene locus_tag LOCUS_12860 9601 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 9641 10009 gene locus_tag LOCUS_12870 9641 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10023 11750 gene locus_tag LOCUS_12880 10023 11750 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_12880 11800 12921 gene locus_tag LOCUS_12890 11800 12921 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_12890 13210 14949 gene locus_tag LOCUS_12900 13210 14949 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_12900 14975 16282 gene locus_tag LOCUS_12910 14975 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16305 17324 gene locus_tag LOCUS_12920 16305 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 17321 18370 gene locus_tag LOCUS_12930 17321 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 18367 19647 gene locus_tag LOCUS_12940 18367 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 19644 21506 gene locus_tag LOCUS_12950 19644 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 21556 27765 gene locus_tag LOCUS_12960 21556 27765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 27858 27932 gene locus_tag LOCUS_t00210 27858 27932 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27983 29425 gene locus_tag LOCUS_12970 27983 29425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 31560 29422 gene locus_tag LOCUS_12980 31560 29422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 31679 33115 gene locus_tag LOCUS_12990 31679 33115 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence029 <1 1326 gene locus_tag LOCUS_13000 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403933.1:gamma-glutamyltranspeptidase GgtA 1597 2307 gene locus_tag LOCUS_13010 1597 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3225 2317 gene locus_tag LOCUS_13020 gene prpB 3225 2317 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013822.1 protein_id gnl|my_center|LOCUS_13020 3322 4236 gene locus_tag LOCUS_13030 3322 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4642 4547 gene locus_tag LOCUS_t00220 4642 4547 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5737 5000 gene locus_tag LOCUS_13040 gene cmk 5737 5000 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 protein_id gnl|my_center|LOCUS_13040 6591 5758 gene locus_tag LOCUS_13050 6591 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6727 7110 gene locus_tag LOCUS_13060 gene gcvH 6727 7110 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_13060 7157 7900 gene locus_tag LOCUS_13070 7157 7900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123055.1 protein_id gnl|my_center|LOCUS_13070 7851 10781 gene locus_tag LOCUS_13080 7851 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 10840 12270 gene locus_tag LOCUS_13090 10840 12270 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_13090 12455 13219 gene locus_tag LOCUS_13100 12455 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 13212 13529 gene locus_tag LOCUS_13110 13212 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14559 13639 gene locus_tag LOCUS_13120 14559 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15492 14620 gene locus_tag LOCUS_13130 15492 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 17580 16249 gene locus_tag LOCUS_13140 17580 16249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_13140 17689 17994 gene locus_tag LOCUS_13150 17689 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 18193 18432 gene locus_tag LOCUS_13160 18193 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 18605 18928 gene locus_tag LOCUS_13170 gene rplU 18605 18928 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_13170 19064 20059 gene locus_tag LOCUS_13180 19064 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 20976 20068 gene locus_tag LOCUS_13190 20976 20068 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 protein_id gnl|my_center|LOCUS_13190 21202 22581 gene locus_tag LOCUS_13200 21202 22581 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816030.1 protein_id gnl|my_center|LOCUS_13200 22895 23866 gene locus_tag LOCUS_13210 22895 23866 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226358.1 protein_id gnl|my_center|LOCUS_13210 24477 23935 gene locus_tag LOCUS_13220 24477 23935 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_13220 24983 24474 gene locus_tag LOCUS_13230 24983 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 25051 26532 gene locus_tag LOCUS_13240 25051 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 27680 26634 gene locus_tag LOCUS_13250 27680 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 28116 28340 gene locus_tag LOCUS_13260 28116 28340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324903.1 protein_id gnl|my_center|LOCUS_13260 28631 29437 gene locus_tag LOCUS_13270 28631 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 31616 29613 gene locus_tag LOCUS_13280 31616 29613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 <32312 31769 gene locus_tag LOCUS_13290 <32312 31769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941014.1:NADH-quinone oxidoreductase subunit NuoI >Feature sequence030 1057 410 gene locus_tag LOCUS_13300 gene fsa 1057 410 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_13300 2623 1106 gene locus_tag LOCUS_13310 2623 1106 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_13310 2833 3843 gene locus_tag LOCUS_13320 2833 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4253 3816 gene locus_tag LOCUS_13330 gene acpS 4253 3816 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_13330 4525 4226 gene locus_tag LOCUS_13340 4525 4226 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_13340 5120 4530 gene locus_tag LOCUS_13350 5120 4530 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332711.1 protein_id gnl|my_center|LOCUS_13350 6297 5152 gene locus_tag LOCUS_13360 gene dnaJ 6297 5152 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 protein_id gnl|my_center|LOCUS_13360 7960 6344 gene locus_tag LOCUS_13370 gene groL 7960 6344 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_13370 8997 7996 gene locus_tag LOCUS_13380 8997 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 9295 9005 gene locus_tag LOCUS_13390 gene groES 9295 9005 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393620.1 protein_id gnl|my_center|LOCUS_13390 10153 9350 gene locus_tag LOCUS_13400 10153 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11999 10293 gene locus_tag LOCUS_13410 gene groL 11999 10293 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_13410 12320 12700 gene locus_tag LOCUS_13420 12320 12700 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728125.1 protein_id gnl|my_center|LOCUS_13420 12976 13707 gene locus_tag LOCUS_13430 12976 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13759 14217 gene locus_tag LOCUS_13440 13759 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 14196 14834 gene locus_tag LOCUS_13450 14196 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 14860 15462 gene locus_tag LOCUS_13460 14860 15462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 15466 16581 gene locus_tag LOCUS_13470 15466 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 16578 17060 gene locus_tag LOCUS_13480 16578 17060 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_13480 17236 19503 gene locus_tag LOCUS_13490 17236 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 20236 19598 gene locus_tag LOCUS_13500 20236 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 21069 20233 gene locus_tag LOCUS_13510 21069 20233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_13510 21179 21574 gene locus_tag LOCUS_13520 21179 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21896 23953 gene locus_tag LOCUS_13530 21896 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 24058 26244 gene locus_tag LOCUS_13540 gene uvrB 24058 26244 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_13540 26319 27338 gene locus_tag LOCUS_13550 26319 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 27348 27584 gene locus_tag LOCUS_13560 27348 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 27630 30665 gene locus_tag LOCUS_13570 gene uvrA 27630 30665 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_13570 31941 30682 gene locus_tag LOCUS_13580 31941 30682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence031 1046 3 gene locus_tag LOCUS_13590 1046 3 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_13590 1148 2251 gene locus_tag LOCUS_13600 1148 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2317 2697 gene locus_tag LOCUS_13610 2317 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2732 3811 gene locus_tag LOCUS_13620 2732 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4190 4963 gene locus_tag LOCUS_13630 4190 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5116 6552 gene locus_tag LOCUS_13640 5116 6552 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_13640 7778 6549 gene locus_tag LOCUS_13650 7778 6549 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204118.1 protein_id gnl|my_center|LOCUS_13650 7817 9802 gene locus_tag LOCUS_13660 7817 9802 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_13660 9812 10675 gene locus_tag LOCUS_13670 9812 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 11108 10614 gene locus_tag LOCUS_13680 gene bcp 11108 10614 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_13680 11740 11222 gene locus_tag LOCUS_13690 11740 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11858 12334 gene locus_tag LOCUS_13700 11858 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 14225 12405 gene locus_tag LOCUS_13710 14225 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 14377 15081 gene locus_tag LOCUS_13720 14377 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 16198 15053 gene locus_tag LOCUS_13730 gene lpxB 16198 15053 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_13730 16938 16294 gene locus_tag LOCUS_13740 16938 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 18364 16901 gene locus_tag LOCUS_13750 18364 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 18509 19825 gene locus_tag LOCUS_13760 gene rsmB 18509 19825 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560556.1 protein_id gnl|my_center|LOCUS_13760 19917 20378 gene locus_tag LOCUS_13770 19917 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 20399 21241 gene locus_tag LOCUS_13780 20399 21241 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_13780 21327 23288 gene locus_tag LOCUS_13790 gene dxs 21327 23288 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_13790 23293 24168 gene locus_tag LOCUS_13800 23293 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 24279 25118 gene locus_tag LOCUS_13810 24279 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 26664 25120 gene locus_tag LOCUS_13820 gene astD 26664 25120 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919481.1 protein_id gnl|my_center|LOCUS_13820 27827 26661 gene locus_tag LOCUS_13830 gene astA 27827 26661 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527438.1 protein_id gnl|my_center|LOCUS_13830 29308 27854 gene locus_tag LOCUS_13840 29308 27854 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338764.1 protein_id gnl|my_center|LOCUS_13840 30578 29373 gene locus_tag LOCUS_13850 30578 29373 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence032 109 1644 gene locus_tag LOCUS_13860 109 1644 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_13860 1755 3146 gene locus_tag LOCUS_13870 1755 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3197 3916 gene locus_tag LOCUS_13880 3197 3916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_13880 3919 5181 gene locus_tag LOCUS_13890 3919 5181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928529.1 protein_id gnl|my_center|LOCUS_13890 5201 6853 gene locus_tag LOCUS_13900 5201 6853 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_13900 8045 6816 gene locus_tag LOCUS_13910 8045 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9097 8072 gene locus_tag LOCUS_13920 9097 8072 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_13920 9744 9109 gene locus_tag LOCUS_13930 9744 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 13310 9741 gene locus_tag LOCUS_13940 13310 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 15873 13465 gene locus_tag LOCUS_13950 15873 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_13950 18053 15870 gene locus_tag LOCUS_13960 18053 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 19095 18094 gene locus_tag LOCUS_13970 19095 18094 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_13970 20151 19147 gene locus_tag LOCUS_13980 20151 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 21605 20364 gene locus_tag LOCUS_13990 21605 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 22486 21599 gene locus_tag LOCUS_14000 22486 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 24408 23011 gene locus_tag LOCUS_14010 gene asnS 24408 23011 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211301.1 protein_id gnl|my_center|LOCUS_14010 24829 24904 gene locus_tag LOCUS_t00230 24829 24904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26977 24959 gene locus_tag LOCUS_14020 26977 24959 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_14020 27134 27499 gene locus_tag LOCUS_14030 27134 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 28597 27560 gene locus_tag LOCUS_14040 gene tdh 28597 27560 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_14040 28744 29940 gene locus_tag LOCUS_14050 gene gspF 28744 29940 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_14050 30212 29931 gene locus_tag LOCUS_14060 30212 29931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence033 568 281 gene locus_tag LOCUS_14070 568 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2979 787 gene locus_tag LOCUS_14080 gene pnp 2979 787 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_14080 3490 3212 gene locus_tag LOCUS_14090 gene rpsO 3490 3212 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_14090 3783 3553 gene locus_tag LOCUS_14100 3783 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3692 4903 gene locus_tag LOCUS_14110 3692 4903 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403699.1 protein_id gnl|my_center|LOCUS_14110 4916 6736 gene locus_tag LOCUS_14120 4916 6736 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_14120 6733 8529 gene locus_tag LOCUS_14130 6733 8529 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_14130 9507 8536 gene locus_tag LOCUS_14140 9507 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 10110 9598 gene locus_tag LOCUS_14150 10110 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11443 10148 gene locus_tag LOCUS_14160 gene odhB 11443 10148 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388969.1 protein_id gnl|my_center|LOCUS_14160 14305 11465 gene locus_tag LOCUS_14170 14305 11465 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_14170 14998 14504 gene locus_tag LOCUS_14180 14998 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 28826 15018 gene locus_tag LOCUS_14190 28826 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence034 274 2181 gene locus_tag LOCUS_14200 gene dnaK 274 2181 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_14200 2264 3262 gene locus_tag LOCUS_14210 2264 3262 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_14210 3922 3263 gene locus_tag LOCUS_14220 gene rdgB 3922 3263 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940412.1 protein_id gnl|my_center|LOCUS_14220 3974 5500 gene locus_tag LOCUS_14230 3974 5500 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_14230 5490 6206 gene locus_tag LOCUS_14240 gene rpiA 5490 6206 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396641.1 protein_id gnl|my_center|LOCUS_14240 7718 6234 gene locus_tag LOCUS_14250 7718 6234 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_14250 8723 7761 gene locus_tag LOCUS_14260 8723 7761 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_14260 10793 8739 gene locus_tag LOCUS_14270 10793 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 11040 12473 gene locus_tag LOCUS_14280 11040 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 12482 13711 gene locus_tag LOCUS_14290 12482 13711 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_14290 15163 13766 gene locus_tag LOCUS_14300 gene fahA 15163 13766 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_14300 15237 15677 gene locus_tag LOCUS_14310 15237 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 15911 18052 gene locus_tag LOCUS_14320 15911 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 18166 19524 gene locus_tag LOCUS_14330 18166 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 19988 19521 gene locus_tag LOCUS_14340 19988 19521 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_14340 20148 20600 gene locus_tag LOCUS_14350 20148 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 20690 22186 gene locus_tag LOCUS_14360 20690 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 22202 22861 gene locus_tag LOCUS_14370 22202 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 24807 22828 gene locus_tag LOCUS_14380 24807 22828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 24691 24900 gene locus_tag LOCUS_14390 24691 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 24942 25610 gene locus_tag LOCUS_14400 24942 25610 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_14400 26426 25605 gene locus_tag LOCUS_14410 gene proC 26426 25605 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694358.1 protein_id gnl|my_center|LOCUS_14410 26543 27649 gene locus_tag LOCUS_14420 26543 27649 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_14420 27826 28980 gene locus_tag LOCUS_14430 27826 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence035 650 30 gene locus_tag LOCUS_14440 650 30 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_14440 748 2496 gene locus_tag LOCUS_14450 748 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2499 3071 gene locus_tag LOCUS_14460 2499 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3248 5977 gene locus_tag LOCUS_14470 3248 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6107 6697 gene locus_tag LOCUS_14480 gene recR 6107 6697 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_14480 6711 8219 gene locus_tag LOCUS_14490 gene rpoN 6711 8219 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_14490 10044 8221 gene locus_tag LOCUS_14500 10044 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 10342 11004 gene locus_tag LOCUS_14510 10342 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 13683 11119 gene locus_tag LOCUS_14520 13683 11119 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_14520 15169 14000 gene locus_tag LOCUS_14530 15169 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16223 15222 gene locus_tag LOCUS_14540 gene holA 16223 15222 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244058.1 protein_id gnl|my_center|LOCUS_14540 17414 16227 gene locus_tag LOCUS_14550 17414 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 17445 19139 gene locus_tag LOCUS_14560 17445 19139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 20771 19149 gene locus_tag LOCUS_14570 20771 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 21166 20768 gene locus_tag LOCUS_14580 21166 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 21596 21312 gene locus_tag LOCUS_14590 21596 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 23695 21602 gene locus_tag LOCUS_14600 23695 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 24665 23886 gene locus_tag LOCUS_14610 24665 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 24894 25337 gene locus_tag LOCUS_14620 24894 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 25882 25514 gene locus_tag LOCUS_14630 25882 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 26412 25879 gene locus_tag LOCUS_14640 26412 25879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 26543 27643 gene locus_tag LOCUS_14650 26543 27643 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence036 552 118 gene locus_tag LOCUS_14660 gene mntR 552 118 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_14660 851 552 gene locus_tag LOCUS_14670 851 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 939 1751 gene locus_tag LOCUS_14680 939 1751 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_14680 1854 3548 gene locus_tag LOCUS_14690 1854 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3569 4744 gene locus_tag LOCUS_14700 3569 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8842 4748 gene locus_tag LOCUS_14710 8842 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9509 8856 gene locus_tag LOCUS_14720 gene nusG 9509 8856 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_14720 10289 9615 gene locus_tag LOCUS_14730 10289 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10382 10308 gene locus_tag LOCUS_t00240 10382 10308 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10651 10472 gene locus_tag LOCUS_14740 10651 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11876 10677 gene locus_tag LOCUS_14750 gene tuf 11876 10677 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_14750 12161 12090 gene locus_tag LOCUS_t00250 12161 12090 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12431 14791 gene locus_tag LOCUS_14760 12431 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 14926 15543 gene locus_tag LOCUS_14770 14926 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 15582 15881 gene locus_tag LOCUS_14780 15582 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 15916 16326 gene locus_tag LOCUS_14790 15916 16326 CDS product DUF2335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225858.1 protein_id gnl|my_center|LOCUS_14790 16668 16372 gene locus_tag LOCUS_14800 16668 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16716 17738 gene locus_tag LOCUS_14810 16716 17738 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_14810 19351 17735 gene locus_tag LOCUS_14820 gene rimO 19351 17735 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_14820 20137 19361 gene locus_tag LOCUS_14830 20137 19361 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_14830 21950 20142 gene locus_tag LOCUS_14840 21950 20142 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_14840 22199 21966 gene locus_tag LOCUS_14850 22199 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 22975 22319 gene locus_tag LOCUS_14860 22975 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 23365 24627 gene locus_tag LOCUS_14870 23365 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <26185 24628 gene locus_tag LOCUS_14880 <26185 24628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228236.1:SpoVR family protein >Feature sequence037 1361 174 gene locus_tag LOCUS_14890 1361 174 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_14890 2398 1370 gene locus_tag LOCUS_14900 2398 1370 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_14900 2517 3251 gene locus_tag LOCUS_14910 2517 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3252 4052 gene locus_tag LOCUS_14920 3252 4052 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_14920 5246 3996 gene locus_tag LOCUS_14930 gene hemW 5246 3996 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_14930 5310 5786 gene locus_tag LOCUS_14940 5310 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5913 6671 gene locus_tag LOCUS_14950 5913 6671 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_14950 6721 8094 gene locus_tag LOCUS_14960 6721 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9122 8091 gene locus_tag LOCUS_14970 gene ruvB 9122 8091 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_14970 9209 10456 gene locus_tag LOCUS_14980 9209 10456 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_14980 11998 10478 gene locus_tag LOCUS_14990 11998 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 12821 12078 gene locus_tag LOCUS_15000 12821 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 12877 13296 gene locus_tag LOCUS_15010 gene fabZ 12877 13296 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870033.1 protein_id gnl|my_center|LOCUS_15010 13342 13734 gene locus_tag LOCUS_15020 13342 13734 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_15020 13734 14231 gene locus_tag LOCUS_15030 13734 14231 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_15030 14821 14279 gene locus_tag LOCUS_15040 14821 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 15254 14838 gene locus_tag LOCUS_15050 15254 14838 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_15050 16238 15333 gene locus_tag LOCUS_15060 16238 15333 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_15060 17261 16290 gene locus_tag LOCUS_15070 17261 16290 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_15070 17792 17283 gene locus_tag LOCUS_15080 17792 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 21362 17844 gene locus_tag LOCUS_15090 21362 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 21854 21429 gene locus_tag LOCUS_15100 21854 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 23193 21892 gene locus_tag LOCUS_15110 gene tgt 23193 21892 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227845.1 protein_id gnl|my_center|LOCUS_15110 24186 23200 gene locus_tag LOCUS_15120 24186 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25280 24252 gene locus_tag LOCUS_15130 25280 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 25861 25277 gene locus_tag LOCUS_15140 25861 25277 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence038 1969 587 gene locus_tag LOCUS_15150 1969 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3398 2046 gene locus_tag LOCUS_15160 3398 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4375 3395 gene locus_tag LOCUS_15170 4375 3395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250829.1 protein_id gnl|my_center|LOCUS_15170 5085 4402 gene locus_tag LOCUS_15180 5085 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8484 5182 gene locus_tag LOCUS_15190 gene mfd 8484 5182 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_15190 8886 8521 gene locus_tag LOCUS_15200 8886 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 10436 8856 gene locus_tag LOCUS_15210 10436 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10514 11482 gene locus_tag LOCUS_15220 10514 11482 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_15220 11774 11472 gene locus_tag LOCUS_15230 11774 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 11995 11774 gene locus_tag LOCUS_15240 11995 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 12884 12078 gene locus_tag LOCUS_15250 12884 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 12983 13675 gene locus_tag LOCUS_15260 gene aat 12983 13675 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_15260 14452 13667 gene locus_tag LOCUS_15270 14452 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 15249 14449 gene locus_tag LOCUS_15280 15249 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 15338 15263 gene locus_tag LOCUS_t00260 15338 15263 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15496 17088 gene locus_tag LOCUS_15290 gene pckA 15496 17088 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_15290 17383 17895 gene locus_tag LOCUS_15300 17383 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 17996 19648 gene locus_tag LOCUS_15310 17996 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 19690 20814 gene locus_tag LOCUS_15320 19690 20814 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256131.1 protein_id gnl|my_center|LOCUS_15320 22728 20866 gene locus_tag LOCUS_15330 22728 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 24691 22967 gene locus_tag LOCUS_15340 24691 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 24810 25580 gene locus_tag LOCUS_15350 gene tpiA 24810 25580 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence039 1853 423 gene locus_tag LOCUS_15360 gene purF 1853 423 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_15360 2133 2732 gene locus_tag LOCUS_15370 gene rpsD 2133 2732 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_15370 2800 4833 gene locus_tag LOCUS_15380 2800 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 6429 4837 gene locus_tag LOCUS_15390 6429 4837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_15390 7655 6498 gene locus_tag LOCUS_15400 7655 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9018 7756 gene locus_tag LOCUS_15410 9018 7756 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_15410 9115 10002 gene locus_tag LOCUS_15420 9115 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10514 10008 gene locus_tag LOCUS_15430 10514 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 11723 10566 gene locus_tag LOCUS_15440 11723 10566 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_15440 12214 11720 gene locus_tag LOCUS_15450 gene purE 12214 11720 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_15450 14090 12309 gene locus_tag LOCUS_15460 14090 12309 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_15460 14159 15400 gene locus_tag LOCUS_15470 14159 15400 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_15470 15425 16711 gene locus_tag LOCUS_15480 15425 16711 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_15480 17578 16784 gene locus_tag LOCUS_15490 17578 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 18586 17717 gene locus_tag LOCUS_15500 18586 17717 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_15500 18677 18988 gene locus_tag LOCUS_15510 18677 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18981 19664 gene locus_tag LOCUS_15520 18981 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 19661 20395 gene locus_tag LOCUS_15530 19661 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 20396 20821 gene locus_tag LOCUS_15540 20396 20821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 21399 20809 gene locus_tag LOCUS_15550 21399 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 22592 21396 gene locus_tag LOCUS_15560 gene carA 22592 21396 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_15560 22477 24945 gene locus_tag LOCUS_15570 gene priA 22477 24945 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence040 1112 1621 gene locus_tag LOCUS_15580 gene rnhA 1112 1621 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390802.1 protein_id gnl|my_center|LOCUS_15580 1793 2848 gene locus_tag LOCUS_15590 1793 2848 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938558.1 protein_id gnl|my_center|LOCUS_15590 2864 4087 gene locus_tag LOCUS_15600 2864 4087 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_15600 4117 4803 gene locus_tag LOCUS_15610 4117 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4884 7700 gene locus_tag LOCUS_15620 4884 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7700 8305 gene locus_tag LOCUS_15630 7700 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9322 8342 gene locus_tag LOCUS_15640 9322 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 10812 9322 gene locus_tag LOCUS_15650 10812 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10871 11659 gene locus_tag LOCUS_15660 10871 11659 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_15660 12995 11682 gene locus_tag LOCUS_15670 12995 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 13711 13091 gene locus_tag LOCUS_15680 13711 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 14402 13761 gene locus_tag LOCUS_15690 14402 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 16114 14612 gene locus_tag LOCUS_15700 16114 14612 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_15700 16361 17143 gene locus_tag LOCUS_15710 16361 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 17837 17238 gene locus_tag LOCUS_15720 17837 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 18353 18009 gene locus_tag LOCUS_15730 18353 18009 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_15730 18394 19302 gene locus_tag LOCUS_15740 18394 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 19317 21707 gene locus_tag LOCUS_15750 19317 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 22203 21958 gene locus_tag LOCUS_15760 22203 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 23625 22579 gene locus_tag LOCUS_15770 gene gap 23625 22579 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_15770 24825 23797 gene locus_tag LOCUS_15780 gene galE 24825 23797 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence041 1464 2015 gene locus_tag LOCUS_15790 1464 2015 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_15790 3652 2171 gene locus_tag LOCUS_15800 3652 2171 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_15800 4668 3751 gene locus_tag LOCUS_15810 4668 3751 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_15810 5868 4756 gene locus_tag LOCUS_15820 5868 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6879 5929 gene locus_tag LOCUS_15830 gene mdh 6879 5929 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_15830 7849 7019 gene locus_tag LOCUS_15840 7849 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7892 8548 gene locus_tag LOCUS_15850 7892 8548 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_15850 9199 8624 gene locus_tag LOCUS_15860 9199 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9317 9811 gene locus_tag LOCUS_15870 9317 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 11872 9818 gene locus_tag LOCUS_15880 11872 9818 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_15880 13062 11881 gene locus_tag LOCUS_15890 13062 11881 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_15890 13972 13052 gene locus_tag LOCUS_15900 13972 13052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 14971 14015 gene locus_tag LOCUS_15910 14971 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 15762 14968 gene locus_tag LOCUS_15920 15762 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 15761 16795 gene locus_tag LOCUS_15930 15761 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 17372 17151 gene locus_tag LOCUS_15940 17372 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 17313 20414 gene locus_tag LOCUS_15950 17313 20414 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921428.1 protein_id gnl|my_center|LOCUS_15950 20579 20938 gene locus_tag LOCUS_15960 20579 20938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 20983 21417 gene locus_tag LOCUS_15970 20983 21417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 21507 22745 gene locus_tag LOCUS_15980 21507 22745 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_15980 22764 23189 gene locus_tag LOCUS_15990 gene iscU 22764 23189 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_15990 23241 23612 gene locus_tag LOCUS_16000 23241 23612 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_16000 23779 24255 gene locus_tag LOCUS_16010 23779 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence042 2406 895 gene locus_tag LOCUS_16020 2406 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2589 3500 gene locus_tag LOCUS_16030 2589 3500 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 protein_id gnl|my_center|LOCUS_16030 3681 6842 gene locus_tag LOCUS_16040 3681 6842 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921950.1 protein_id gnl|my_center|LOCUS_16040 8124 6892 gene locus_tag LOCUS_16050 8124 6892 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_16050 10426 8135 gene locus_tag LOCUS_16060 10426 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 12394 10640 gene locus_tag LOCUS_16070 gene ptsP 12394 10640 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_16070 12619 13785 gene locus_tag LOCUS_16080 gene rho 12619 13785 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_16080 14697 13789 gene locus_tag LOCUS_16090 gene lpxC 14697 13789 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_16090 15746 14694 gene locus_tag LOCUS_16100 gene lpxD 15746 14694 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021676.1 protein_id gnl|my_center|LOCUS_16100 16373 15750 gene locus_tag LOCUS_16110 16373 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 18953 16491 gene locus_tag LOCUS_16120 18953 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 20285 19137 gene locus_tag LOCUS_16130 gene dnaN 20285 19137 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_16130 20527 22494 gene locus_tag LOCUS_16140 20527 22494 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_16140 22770 24311 gene locus_tag LOCUS_16150 gene lpdA 22770 24311 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830912.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence043 936 172 gene locus_tag LOCUS_16160 936 172 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_16160 1926 1600 gene locus_tag LOCUS_16170 1926 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2432 2220 gene locus_tag LOCUS_16180 2432 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5884 2588 gene locus_tag LOCUS_16190 5884 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6967 5903 gene locus_tag LOCUS_16200 6967 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257685.1 protein_id gnl|my_center|LOCUS_16200 7388 7313 gene locus_tag LOCUS_t00270 7388 7313 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7671 8975 gene locus_tag LOCUS_16210 gene purD 7671 8975 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880448.1 protein_id gnl|my_center|LOCUS_16210 10367 9000 gene locus_tag LOCUS_16220 10367 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 11315 10404 gene locus_tag LOCUS_16230 gene metF 11315 10404 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_16230 11525 12448 gene locus_tag LOCUS_16240 11525 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12684 14102 gene locus_tag LOCUS_16250 12684 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 15708 14182 gene locus_tag LOCUS_16260 gene ahcY 15708 14182 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_16260 16761 15802 gene locus_tag LOCUS_16270 16761 15802 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_16270 17477 16827 gene locus_tag LOCUS_16280 17477 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 17634 18035 gene locus_tag LOCUS_16290 17634 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 18105 18482 gene locus_tag LOCUS_16300 18105 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18654 20426 gene locus_tag LOCUS_16310 gene asnB 18654 20426 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115546.1 protein_id gnl|my_center|LOCUS_16310 21555 20350 gene locus_tag LOCUS_16320 21555 20350 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_16320 22685 21570 gene locus_tag LOCUS_16330 22685 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 23637 22765 gene locus_tag LOCUS_16340 gene panC 23637 22765 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973078.1 protein_id gnl|my_center|LOCUS_16340 24114 23695 gene locus_tag LOCUS_16350 24114 23695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence044 4355 2724 gene locus_tag LOCUS_16360 4355 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6053 4434 gene locus_tag LOCUS_16370 6053 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6424 6753 gene locus_tag LOCUS_16380 6424 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6778 8682 gene locus_tag LOCUS_16390 6778 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 8723 10918 gene locus_tag LOCUS_16400 8723 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 10933 12912 gene locus_tag LOCUS_16410 10933 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 12994 13995 gene locus_tag LOCUS_16420 12994 13995 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_16420 13992 14903 gene locus_tag LOCUS_16430 13992 14903 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_16430 14900 16003 gene locus_tag LOCUS_16440 14900 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 16000 17073 gene locus_tag LOCUS_16450 16000 17073 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_16450 17070 18098 gene locus_tag LOCUS_16460 17070 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 18095 19618 gene locus_tag LOCUS_16470 18095 19618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 19618 21441 gene locus_tag LOCUS_16480 19618 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21438 22238 gene locus_tag LOCUS_16490 21438 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 22314 22388 gene locus_tag LOCUS_t00280 22314 22388 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22966 22484 gene locus_tag LOCUS_16500 22966 22484 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_16500 23427 22963 gene locus_tag LOCUS_16510 23427 22963 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939253.1 protein_id gnl|my_center|LOCUS_16510 <24107 23608 gene locus_tag LOCUS_16520 <24107 23608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225822.1:3-oxoacyl-ACP reductase FabG >Feature sequence045 <1 649 gene locus_tag LOCUS_16530 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259298.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 658 2370 gene locus_tag LOCUS_16540 658 2370 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971803.1 protein_id gnl|my_center|LOCUS_16540 3731 2466 gene locus_tag LOCUS_16550 3731 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3971 4660 gene locus_tag LOCUS_16560 3971 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6754 4670 gene locus_tag LOCUS_16570 6754 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 6650 6913 gene locus_tag LOCUS_16580 6650 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 8415 7189 gene locus_tag LOCUS_16590 8415 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8603 9226 gene locus_tag LOCUS_16600 8603 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 9233 9985 gene locus_tag LOCUS_16610 9233 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10329 10033 gene locus_tag LOCUS_16620 10329 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11165 10461 gene locus_tag LOCUS_16630 11165 10461 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_16630 11629 11234 gene locus_tag LOCUS_16640 11629 11234 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_16640 12631 11633 gene locus_tag LOCUS_16650 12631 11633 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_16650 13030 12650 gene locus_tag LOCUS_16660 13030 12650 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_16660 14098 13079 gene locus_tag LOCUS_16670 14098 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 15132 14242 gene locus_tag LOCUS_16680 15132 14242 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_16680 15178 15960 gene locus_tag LOCUS_16690 15178 15960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_16690 16037 16534 gene locus_tag LOCUS_16700 16037 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 17906 16569 gene locus_tag LOCUS_16710 gene gdhA 17906 16569 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_16710 18108 18479 gene locus_tag LOCUS_16720 18108 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 18646 18461 gene locus_tag LOCUS_16730 18646 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 18693 20462 gene locus_tag LOCUS_16740 18693 20462 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_16740 20655 22649 gene locus_tag LOCUS_16750 20655 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence046 209 1030 gene locus_tag LOCUS_16760 209 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2319 1027 gene locus_tag LOCUS_16770 2319 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2466 3260 gene locus_tag LOCUS_16780 2466 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3656 3264 gene locus_tag LOCUS_16790 3656 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5869 3650 gene locus_tag LOCUS_16800 5869 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6147 6698 gene locus_tag LOCUS_16810 6147 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6989 9952 gene locus_tag LOCUS_16820 gene ileS 6989 9952 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880149.1 protein_id gnl|my_center|LOCUS_16820 10067 10786 gene locus_tag LOCUS_16830 10067 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 10783 12186 gene locus_tag LOCUS_16840 10783 12186 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_16840 13170 12187 gene locus_tag LOCUS_16850 13170 12187 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_16850 14379 13213 gene locus_tag LOCUS_16860 14379 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 15092 14376 gene locus_tag LOCUS_16870 15092 14376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_16870 16260 15100 gene locus_tag LOCUS_16880 16260 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 16153 16467 gene locus_tag LOCUS_16890 16153 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 16535 18484 gene locus_tag LOCUS_16900 16535 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 18591 19010 gene locus_tag LOCUS_16910 18591 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 19104 20147 gene locus_tag LOCUS_16920 gene arsB 19104 20147 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_16920 20274 20346 gene locus_tag LOCUS_t00290 20274 20346 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21415 20393 gene locus_tag LOCUS_16930 21415 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 <23328 21412 gene locus_tag LOCUS_16940 <23328 21412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403763.1:sulfotransferase >Feature sequence047 156 1649 gene locus_tag LOCUS_16950 156 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1615 3315 gene locus_tag LOCUS_16960 1615 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3340 5115 gene locus_tag LOCUS_16970 3340 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5235 7097 gene locus_tag LOCUS_16980 5235 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7138 7635 gene locus_tag LOCUS_16990 7138 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 7669 11142 gene locus_tag LOCUS_17000 7669 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11460 11200 gene locus_tag LOCUS_17010 11460 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 11357 11647 gene locus_tag LOCUS_17020 11357 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 11672 12601 gene locus_tag LOCUS_17030 11672 12601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12638 14041 gene locus_tag LOCUS_17040 12638 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 14066 14803 gene locus_tag LOCUS_17050 14066 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 14826 19448 gene locus_tag LOCUS_17060 14826 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 19500 23093 gene locus_tag LOCUS_17070 19500 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence048 213 2525 gene locus_tag LOCUS_17080 213 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2626 4455 gene locus_tag LOCUS_17090 2626 4455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667646.1 protein_id gnl|my_center|LOCUS_17090 4455 4799 gene locus_tag LOCUS_17100 4455 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5338 4787 gene locus_tag LOCUS_17110 5338 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8132 5355 gene locus_tag LOCUS_17120 8132 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8365 10173 gene locus_tag LOCUS_17130 8365 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10814 10170 gene locus_tag LOCUS_17140 10814 10170 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 protein_id gnl|my_center|LOCUS_17140 10850 12091 gene locus_tag LOCUS_17150 10850 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 13907 12078 gene locus_tag LOCUS_17160 gene glmS 13907 12078 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_17160 14244 15086 gene locus_tag LOCUS_17170 14244 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 15142 18669 gene locus_tag LOCUS_17180 gene carB 15142 18669 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805079.1 protein_id gnl|my_center|LOCUS_17180 19800 18679 gene locus_tag LOCUS_17190 19800 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 20802 19843 gene locus_tag LOCUS_17200 20802 19843 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259139.1 protein_id gnl|my_center|LOCUS_17200 21720 20830 gene locus_tag LOCUS_17210 21720 20830 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_17210 22105 21755 gene locus_tag LOCUS_17220 22105 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence049 213 3062 gene locus_tag LOCUS_17230 213 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3156 3082 gene locus_tag LOCUS_t00300 3156 3082 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3720 3316 gene locus_tag LOCUS_17240 3720 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 5309 3717 gene locus_tag LOCUS_17250 5309 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5878 5309 gene locus_tag LOCUS_17260 5878 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6484 5882 gene locus_tag LOCUS_17270 6484 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 7910 6600 gene locus_tag LOCUS_17280 7910 6600 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_17280 8014 8089 gene locus_tag LOCUS_t00310 8014 8089 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8687 8103 gene locus_tag LOCUS_17290 8687 8103 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_17290 8598 8828 gene locus_tag LOCUS_17300 8598 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9415 10611 gene locus_tag LOCUS_17310 9415 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 11348 10698 gene locus_tag LOCUS_17320 11348 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17320 12201 11551 gene locus_tag LOCUS_17330 12201 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 14290 12740 gene locus_tag LOCUS_17340 gene guaA 14290 12740 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_17340 14373 14702 gene locus_tag LOCUS_17350 14373 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14699 15163 gene locus_tag LOCUS_17360 14699 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15160 15501 gene locus_tag LOCUS_17370 15160 15501 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258220.1 protein_id gnl|my_center|LOCUS_17370 15505 16341 gene locus_tag LOCUS_17380 15505 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 16399 17664 gene locus_tag LOCUS_17390 16399 17664 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_17390 18423 17680 gene locus_tag LOCUS_17400 18423 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 18920 18393 gene locus_tag LOCUS_17410 18920 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 19494 18901 gene locus_tag LOCUS_17420 19494 18901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence050 440 757 gene locus_tag LOCUS_17430 440 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1115 816 gene locus_tag LOCUS_17440 1115 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1096 1977 gene locus_tag LOCUS_17450 gene lpxI 1096 1977 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_17450 2002 2607 gene locus_tag LOCUS_17460 2002 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3444 2608 gene locus_tag LOCUS_17470 3444 2608 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140112.1 protein_id gnl|my_center|LOCUS_17470 4742 3441 gene locus_tag LOCUS_17480 4742 3441 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_17480 4891 5082 gene locus_tag LOCUS_17490 4891 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5913 5077 gene locus_tag LOCUS_17500 5913 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 7381 5957 gene locus_tag LOCUS_17510 7381 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7766 8074 gene locus_tag LOCUS_17520 gene rpsJ 7766 8074 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_17520 8128 8802 gene locus_tag LOCUS_17530 gene rplC 8128 8802 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_17530 9056 9751 gene locus_tag LOCUS_17540 gene rplD 9056 9751 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_17540 9751 10029 gene locus_tag LOCUS_17550 gene rplW 9751 10029 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_17550 10103 10909 gene locus_tag LOCUS_17560 gene rplB 10103 10909 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_17560 10920 11204 gene locus_tag LOCUS_17570 gene rpsS 10920 11204 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_17570 11281 11778 gene locus_tag LOCUS_17580 11281 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11778 12473 gene locus_tag LOCUS_17590 gene rpsC 11778 12473 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814512.1 protein_id gnl|my_center|LOCUS_17590 12497 12922 gene locus_tag LOCUS_17600 gene rplP 12497 12922 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_17600 12948 13151 gene locus_tag LOCUS_17610 12948 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 13164 13451 gene locus_tag LOCUS_17620 13164 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 13490 13876 gene locus_tag LOCUS_17630 gene rplN 13490 13876 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403805.1 protein_id gnl|my_center|LOCUS_17630 13876 14208 gene locus_tag LOCUS_17640 gene rplX 13876 14208 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_17640 14242 14868 gene locus_tag LOCUS_17650 gene rplE 14242 14868 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467399.1 protein_id gnl|my_center|LOCUS_17650 14868 15053 gene locus_tag LOCUS_17660 14868 15053 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 protein_id gnl|my_center|LOCUS_17660 15106 15504 gene locus_tag LOCUS_17670 gene rpsH 15106 15504 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245504.1 protein_id gnl|my_center|LOCUS_17670 15533 16084 gene locus_tag LOCUS_17680 gene rplF 15533 16084 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_17680 16127 16489 gene locus_tag LOCUS_17690 gene rplR 16127 16489 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_17690 16521 17123 gene locus_tag LOCUS_17700 gene rpsE 16521 17123 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350334.1 protein_id gnl|my_center|LOCUS_17700 17162 17734 gene locus_tag LOCUS_17710 gene rplO 17162 17734 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence051 809 186 gene locus_tag LOCUS_17720 gene scpB 809 186 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_17720 894 1751 gene locus_tag LOCUS_17730 894 1751 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_17730 1870 2199 gene locus_tag LOCUS_17740 1870 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4710 2203 gene locus_tag LOCUS_17750 4710 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5379 4759 gene locus_tag LOCUS_17760 5379 4759 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324482.1 protein_id gnl|my_center|LOCUS_17760 6547 5453 gene locus_tag LOCUS_17770 6547 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 7735 6845 gene locus_tag LOCUS_17780 7735 6845 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947645.1 protein_id gnl|my_center|LOCUS_17780 7908 9848 gene locus_tag LOCUS_17790 7908 9848 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_17790 10258 9938 gene locus_tag LOCUS_17800 10258 9938 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_17800 10212 10433 gene locus_tag LOCUS_17810 10212 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 11282 10503 gene locus_tag LOCUS_17820 11282 10503 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 protein_id gnl|my_center|LOCUS_17820 11330 12286 gene locus_tag LOCUS_17830 11330 12286 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_17830 12709 12302 gene locus_tag LOCUS_17840 12709 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 12864 13205 gene locus_tag LOCUS_17850 12864 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13331 17446 gene locus_tag LOCUS_17860 13331 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence052 325 525 gene locus_tag LOCUS_17870 gene thiS 325 525 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_17870 544 1389 gene locus_tag LOCUS_17880 544 1389 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_17880 1748 2602 gene locus_tag LOCUS_17890 gene rpsB 1748 2602 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_17890 2659 3474 gene locus_tag LOCUS_17900 gene tsf 2659 3474 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693261.1 protein_id gnl|my_center|LOCUS_17900 3494 4084 gene locus_tag LOCUS_17910 3494 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4201 4962 gene locus_tag LOCUS_17920 4201 4962 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_17920 6285 5323 gene locus_tag LOCUS_17930 6285 5323 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_17930 7338 6289 gene locus_tag LOCUS_17940 7338 6289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_17940 8929 7358 gene locus_tag LOCUS_17950 8929 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9960 8956 gene locus_tag LOCUS_17960 9960 8956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_17960 11804 10017 gene locus_tag LOCUS_17970 11804 10017 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_17970 12054 12425 gene locus_tag LOCUS_17980 12054 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 12425 13441 gene locus_tag LOCUS_17990 12425 13441 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_17990 13532 14536 gene locus_tag LOCUS_18000 gene bioF 13532 14536 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_18000 15241 14633 gene locus_tag LOCUS_18010 15241 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 15344 16111 gene locus_tag LOCUS_18020 gene cobB 15344 16111 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_18020 16777 16142 gene locus_tag LOCUS_18030 gene kynB 16777 16142 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198883.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence053 1430 240 gene locus_tag LOCUS_18040 1430 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2323 1427 gene locus_tag LOCUS_18050 2323 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3183 2410 gene locus_tag LOCUS_18060 3183 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4180 3191 gene locus_tag LOCUS_18070 4180 3191 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_18070 5513 4257 gene locus_tag LOCUS_18080 5513 4257 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_18080 5905 5534 gene locus_tag LOCUS_18090 5905 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8138 6084 gene locus_tag LOCUS_18100 gene fusA 8138 6084 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_18100 9722 8304 gene locus_tag LOCUS_18110 gene hflX 9722 8304 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_18110 9836 11485 gene locus_tag LOCUS_18120 9836 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 11485 12531 gene locus_tag LOCUS_18130 gene tsaD 11485 12531 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_18130 13327 12554 gene locus_tag LOCUS_18140 13327 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 13557 14132 gene locus_tag LOCUS_18150 13557 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 15608 14148 gene locus_tag LOCUS_18160 15608 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 15963 16685 gene locus_tag LOCUS_18170 15963 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence054 2 763 gene locus_tag LOCUS_18180 2 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1030 2373 gene locus_tag LOCUS_18190 1030 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2444 3553 gene locus_tag LOCUS_18200 2444 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3646 4014 gene locus_tag LOCUS_18210 3646 4014 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_18210 4018 4344 gene locus_tag LOCUS_18220 4018 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6553 4361 gene locus_tag LOCUS_18230 6553 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 6687 6989 gene locus_tag LOCUS_18240 6687 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9036 7105 gene locus_tag LOCUS_18250 gene dnaK 9036 7105 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404052.1 protein_id gnl|my_center|LOCUS_18250 9663 9055 gene locus_tag LOCUS_18260 9663 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 11774 9675 gene locus_tag LOCUS_18270 11774 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11907 14006 gene locus_tag LOCUS_18280 gene pheT 11907 14006 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_18280 14168 15127 gene locus_tag LOCUS_18290 gene ilvE 14168 15127 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528161.1 protein_id gnl|my_center|LOCUS_18290 16301 15219 gene locus_tag LOCUS_18300 gene trpS 16301 15219 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769841.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence055 3 327 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttccgcgactcaacagtcgcggccccattgaagc 737 303 gene locus_tag LOCUS_18310 737 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 750 2711 gene locus_tag LOCUS_18320 750 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2711 4378 gene locus_tag LOCUS_18330 2711 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4645 5043 gene locus_tag LOCUS_18340 4645 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5163 5396 gene locus_tag LOCUS_18350 5163 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18350 6152 7630 gene locus_tag LOCUS_18360 6152 7630 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_18360 7735 9081 gene locus_tag LOCUS_18370 7735 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18370 9078 12404 gene locus_tag LOCUS_18380 9078 12404 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_18380 13859 12411 gene locus_tag LOCUS_18390 13859 12411 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_18390 14666 13956 gene locus_tag LOCUS_18400 14666 13956 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_18400 <16180 14707 gene locus_tag LOCUS_18410 <16180 14707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072047.1:gamma-glutamyltransferase >Feature sequence056 <1 1932 gene locus_tag LOCUS_18420 <1 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922184.1:DNA gyrase subunit A 1932 2273 gene locus_tag LOCUS_18430 1932 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2277 3005 gene locus_tag LOCUS_18440 2277 3005 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867618.1 protein_id gnl|my_center|LOCUS_18440 3002 3742 gene locus_tag LOCUS_18450 3002 3742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_18450 4575 3745 gene locus_tag LOCUS_18460 4575 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4657 5625 gene locus_tag LOCUS_18470 4657 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6558 5926 gene locus_tag LOCUS_18480 6558 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 6715 7050 gene locus_tag LOCUS_18490 6715 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7108 7986 gene locus_tag LOCUS_18500 7108 7986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385232.1 protein_id gnl|my_center|LOCUS_18500 8065 10254 gene locus_tag LOCUS_18510 8065 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 10387 10461 gene locus_tag LOCUS_t00320 10387 10461 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10649 11047 gene locus_tag LOCUS_18520 10649 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 11122 11853 gene locus_tag LOCUS_18530 11122 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 11964 13535 gene locus_tag LOCUS_18540 gene gspE 11964 13535 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_18540 13535 14752 gene locus_tag LOCUS_18550 13535 14752 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_18550 14749 15186 gene locus_tag LOCUS_18560 gene gspG 14749 15186 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_18560 15183 15767 gene locus_tag LOCUS_18570 15183 15767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence057 299 63 gene locus_tag LOCUS_18580 299 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 270 725 gene locus_tag LOCUS_18590 270 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1727 852 gene locus_tag LOCUS_18600 1727 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2553 1768 gene locus_tag LOCUS_18610 2553 1768 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_18610 3752 2553 gene locus_tag LOCUS_18620 3752 2553 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_18620 3818 6211 gene locus_tag LOCUS_18630 3818 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 7430 6213 gene locus_tag LOCUS_18640 7430 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8232 7558 gene locus_tag LOCUS_18650 gene pdxH 8232 7558 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383909.1 protein_id gnl|my_center|LOCUS_18650 8433 9986 gene locus_tag LOCUS_18660 gene dnaB 8433 9986 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173520.1 protein_id gnl|my_center|LOCUS_18660 10489 10007 gene locus_tag LOCUS_18670 10489 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 11608 10508 gene locus_tag LOCUS_18680 11608 10508 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_18680 12612 11605 gene locus_tag LOCUS_18690 12612 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 12666 13436 gene locus_tag LOCUS_18700 gene rsmE 12666 13436 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence058 2427 685 gene locus_tag LOCUS_18710 2427 685 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_18710 2759 2424 gene locus_tag LOCUS_18720 2759 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4617 2779 gene locus_tag LOCUS_18730 4617 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4784 4698 gene locus_tag LOCUS_t00330 4784 4698 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4869 5798 gene locus_tag LOCUS_18740 4869 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5798 8605 gene locus_tag LOCUS_18750 5798 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 8655 9299 gene locus_tag LOCUS_18760 gene tmk 8655 9299 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_18760 9303 9992 gene locus_tag LOCUS_18770 gene plsY 9303 9992 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_18770 10131 10352 gene locus_tag LOCUS_18780 10131 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11976 10321 gene locus_tag LOCUS_18790 11976 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 13484 11973 gene locus_tag LOCUS_18800 13484 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence059 1446 13 gene locus_tag LOCUS_18810 1446 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3334 1517 gene locus_tag LOCUS_18820 3334 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5487 3472 gene locus_tag LOCUS_18830 5487 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7673 5622 gene locus_tag LOCUS_18840 7673 5622 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_18840 7850 8842 gene locus_tag LOCUS_18850 7850 8842 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847058.1 protein_id gnl|my_center|LOCUS_18850 10533 8977 gene locus_tag LOCUS_18860 10533 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 11482 10748 gene locus_tag LOCUS_18870 gene bshB1 11482 10748 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_18870 11903 11499 gene locus_tag LOCUS_18880 11903 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 11979 13262 gene locus_tag LOCUS_18890 11979 13262 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_18890 13255 13842 gene locus_tag LOCUS_18900 13255 13842 CDS product DUF1572 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888534.1 protein_id gnl|my_center|LOCUS_18900 14064 13837 gene locus_tag LOCUS_18910 14064 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence060 19 1050 gene locus_tag LOCUS_18920 19 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2136 1054 gene locus_tag LOCUS_18930 2136 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3079 2255 gene locus_tag LOCUS_18940 gene ispD 3079 2255 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_18940 3284 3628 gene locus_tag LOCUS_tm00010 3284 3628 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4104 5408 gene locus_tag LOCUS_18950 4104 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5408 7207 gene locus_tag LOCUS_18960 5408 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 7204 10299 gene locus_tag LOCUS_18970 7204 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 11353 13164 gene locus_tag LOCUS_18980 gene cas1 11353 13164 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_18980 13183 13473 gene locus_tag LOCUS_18990 gene cas2 13183 13473 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940736.1 protein_id gnl|my_center|LOCUS_18990 13692 14012 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttccgcgactcaacagtcgcggccccattgaagc >Feature sequence061 811 32 gene locus_tag LOCUS_19000 811 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 919 1911 gene locus_tag LOCUS_19010 919 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1941 2960 gene locus_tag LOCUS_19020 1941 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5854 2963 gene locus_tag LOCUS_19030 gene polA 5854 2963 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945860.1 protein_id gnl|my_center|LOCUS_19030 7091 5877 gene locus_tag LOCUS_19040 7091 5877 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_19040 7676 7110 gene locus_tag LOCUS_19050 7676 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 8584 7673 gene locus_tag LOCUS_19060 8584 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9655 8606 gene locus_tag LOCUS_19070 9655 8606 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_19070 10814 9876 gene locus_tag LOCUS_19080 10814 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11082 11849 gene locus_tag LOCUS_19090 11082 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence062 4634 2592 gene locus_tag LOCUS_19100 4634 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6664 4700 gene locus_tag LOCUS_19110 6664 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 8840 6675 gene locus_tag LOCUS_19120 8840 6675 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_19120 10841 8874 gene locus_tag LOCUS_19130 10841 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 11774 10896 gene locus_tag LOCUS_19140 11774 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 11896 13071 gene locus_tag LOCUS_19150 11896 13071 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence063 272 1144 gene locus_tag LOCUS_19160 272 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1817 1149 gene locus_tag LOCUS_19170 1817 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1874 3175 gene locus_tag LOCUS_19180 gene hisS 1874 3175 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_19180 3244 3849 gene locus_tag LOCUS_19190 3244 3849 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931542.1 protein_id gnl|my_center|LOCUS_19190 4424 4122 gene locus_tag LOCUS_19200 4424 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5576 4488 gene locus_tag LOCUS_19210 5576 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6835 5816 gene locus_tag LOCUS_19220 6835 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 8138 6807 gene locus_tag LOCUS_19230 8138 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 9549 8323 gene locus_tag LOCUS_19240 9549 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 9820 9737 gene locus_tag LOCUS_t00340 9820 9737 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9942 10388 gene locus_tag LOCUS_19250 9942 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 10465 11889 gene locus_tag LOCUS_19260 10465 11889 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence064 <1 800 gene locus_tag LOCUS_19270 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232311.1:pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase 1696 821 gene locus_tag LOCUS_19280 1696 821 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_19280 1952 2911 gene locus_tag LOCUS_19290 1952 2911 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_19290 3020 3577 gene locus_tag LOCUS_19300 3020 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4716 3607 gene locus_tag LOCUS_19310 gene ald 4716 3607 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 protein_id gnl|my_center|LOCUS_19310 4827 6440 gene locus_tag LOCUS_19320 4827 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6523 7497 gene locus_tag LOCUS_19330 gene trxB 6523 7497 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_19330 11474 7581 gene locus_tag LOCUS_19340 gene hrpA 11474 7581 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139543.1 protein_id gnl|my_center|LOCUS_19340 <12417 11484 gene locus_tag LOCUS_19350 <12417 11484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922584.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence065 <1 1491 gene locus_tag LOCUS_19360 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117905.1:PSD1 and planctomycete cytochrome C domain-containing protein 1502 2944 gene locus_tag LOCUS_19370 1502 2944 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_19370 2961 3875 gene locus_tag LOCUS_19380 2961 3875 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_19380 4830 3895 gene locus_tag LOCUS_19390 4830 3895 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_19390 4901 6445 gene locus_tag LOCUS_19400 4901 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 7640 6489 gene locus_tag LOCUS_19410 7640 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 7828 8265 gene locus_tag LOCUS_19420 gene dtd 7828 8265 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_19420 8273 8884 gene locus_tag LOCUS_19430 8273 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 8881 9354 gene locus_tag LOCUS_19440 8881 9354 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_19440 9354 9836 gene locus_tag LOCUS_19450 9354 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 10689 9805 gene locus_tag LOCUS_19460 10689 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 12194 10686 gene locus_tag LOCUS_19470 12194 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence066 121 1530 gene locus_tag LOCUS_19480 121 1530 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_19480 1527 3539 gene locus_tag LOCUS_19490 1527 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3532 7311 gene locus_tag LOCUS_19500 3532 7311 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_19500 7402 9288 gene locus_tag LOCUS_19510 7402 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 9530 10489 gene locus_tag LOCUS_19520 9530 10489 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_19520 10635 10486 gene locus_tag LOCUS_19530 10635 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 10719 11156 gene locus_tag LOCUS_19540 10719 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 11156 11911 gene locus_tag LOCUS_19550 11156 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence067 414 1475 gene locus_tag LOCUS_19560 414 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1515 2933 gene locus_tag LOCUS_19570 gene folC 1515 2933 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_19570 4378 2930 gene locus_tag LOCUS_19580 4378 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 4585 7893 gene locus_tag LOCUS_19590 4585 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9060 7933 gene locus_tag LOCUS_19600 9060 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 9705 9070 gene locus_tag LOCUS_19610 9705 9070 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_19610 9815 10147 gene locus_tag LOCUS_19620 9815 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 10188 11759 gene locus_tag LOCUS_19630 gene purB 10188 11759 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence068 <1 5746 gene locus_tag LOCUS_19640 <1 5746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein 5873 6802 gene locus_tag LOCUS_19650 5873 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 6888 7541 gene locus_tag LOCUS_19660 6888 7541 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_19660 7688 9826 gene locus_tag LOCUS_19670 7688 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 9826 10764 gene locus_tag LOCUS_19680 9826 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10773 11699 gene locus_tag LOCUS_19690 gene deoC 10773 11699 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838655.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence069 2 274 gene locus_tag LOCUS_19700 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2758 455 gene locus_tag LOCUS_19710 2758 455 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_19710 3737 2748 gene locus_tag LOCUS_19720 3737 2748 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_19720 3942 4289 gene locus_tag LOCUS_19730 3942 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5557 4244 gene locus_tag LOCUS_19740 5557 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6303 5584 gene locus_tag LOCUS_19750 gene phoB 6303 5584 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_19750 6842 8137 gene locus_tag LOCUS_19760 6842 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8305 9477 gene locus_tag LOCUS_19770 8305 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11421 9571 gene locus_tag LOCUS_19780 gene argS 11421 9571 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence070 953 30 gene locus_tag LOCUS_19790 953 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1074 1859 gene locus_tag LOCUS_19800 1074 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1972 4029 gene locus_tag LOCUS_19810 1972 4029 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_19810 4981 4079 gene locus_tag LOCUS_19820 4981 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5499 4978 gene locus_tag LOCUS_19830 5499 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 7115 5496 gene locus_tag LOCUS_19840 7115 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 7543 7112 gene locus_tag LOCUS_19850 7543 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 8066 7608 gene locus_tag LOCUS_19860 8066 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8690 8157 gene locus_tag LOCUS_19870 8690 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9315 8749 gene locus_tag LOCUS_19880 9315 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9878 9312 gene locus_tag LOCUS_19890 9878 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 10888 9878 gene locus_tag LOCUS_19900 10888 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11355 10891 gene locus_tag LOCUS_19910 11355 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence071 31 1401 gene locus_tag LOCUS_19920 31 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1450 1923 gene locus_tag LOCUS_19930 1450 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1920 2306 gene locus_tag LOCUS_19940 gene rnpA 1920 2306 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_19940 2254 2619 gene locus_tag LOCUS_19950 2254 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2654 3304 gene locus_tag LOCUS_19960 2654 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3301 4425 gene locus_tag LOCUS_19970 gene nifS 3301 4425 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_19970 4436 5242 gene locus_tag LOCUS_19980 4436 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5257 6162 gene locus_tag LOCUS_19990 5257 6162 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_19990 6172 7485 gene locus_tag LOCUS_20000 6172 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 7506 8138 gene locus_tag LOCUS_20010 7506 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 8230 8421 gene locus_tag LOCUS_20020 8230 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 8497 8796 gene locus_tag LOCUS_20030 8497 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8793 9125 gene locus_tag LOCUS_20040 8793 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9292 10611 gene locus_tag LOCUS_20050 9292 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence072 956 162 gene locus_tag LOCUS_20060 956 162 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_20060 1065 1571 gene locus_tag LOCUS_20070 1065 1571 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_20070 1665 3305 gene locus_tag LOCUS_20080 gene gpmI 1665 3305 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_20080 3558 3313 gene locus_tag LOCUS_20090 3558 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3609 4229 gene locus_tag LOCUS_20100 3609 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 5200 4238 gene locus_tag LOCUS_20110 5200 4238 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_20110 5447 5220 gene locus_tag LOCUS_20120 5447 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5793 5719 gene locus_tag LOCUS_t00350 5793 5719 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6159 5857 gene locus_tag LOCUS_20130 6159 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6484 6906 gene locus_tag LOCUS_20140 6484 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6939 7430 gene locus_tag LOCUS_20150 6939 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20150 7623 7384 gene locus_tag LOCUS_20160 7623 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 8253 7903 gene locus_tag LOCUS_20170 8253 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 8954 8217 gene locus_tag LOCUS_20180 8954 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 9375 8992 gene locus_tag LOCUS_20190 9375 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20190 9830 9405 gene locus_tag LOCUS_20200 9830 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 10224 9772 gene locus_tag LOCUS_20210 10224 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 10456 10244 gene locus_tag LOCUS_20220 10456 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence073 423 2033 gene locus_tag LOCUS_20230 423 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2224 2021 gene locus_tag LOCUS_20240 2224 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3004 2234 gene locus_tag LOCUS_20250 gene lptB 3004 2234 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_20250 3421 3017 gene locus_tag LOCUS_20260 3421 3017 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_20260 4596 3475 gene locus_tag LOCUS_20270 4596 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 6180 4678 gene locus_tag LOCUS_20280 6180 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6910 6299 gene locus_tag LOCUS_20290 6910 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7116 8093 gene locus_tag LOCUS_20300 7116 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8145 9155 gene locus_tag LOCUS_20310 gene sucD 8145 9155 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_20310 9989 9198 gene locus_tag LOCUS_20320 9989 9198 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence074 1336 44 gene locus_tag LOCUS_20330 1336 44 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_20330 2670 1333 gene locus_tag LOCUS_20340 2670 1333 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_20340 3482 2670 gene locus_tag LOCUS_20350 3482 2670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_20350 4540 3479 gene locus_tag LOCUS_20360 4540 3479 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_20360 8299 4601 gene locus_tag LOCUS_20370 8299 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 <9996 8311 gene locus_tag LOCUS_20380 <9996 8311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938640.1:proline--tRNA ligase >Feature sequence075 564 872 gene locus_tag LOCUS_20390 564 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 869 3922 gene locus_tag LOCUS_20400 869 3922 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_20400 3919 4695 gene locus_tag LOCUS_20410 3919 4695 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_20410 4674 5672 gene locus_tag LOCUS_20420 4674 5672 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_20420 5766 6530 gene locus_tag LOCUS_20430 5766 6530 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 protein_id gnl|my_center|LOCUS_20430 6572 7702 gene locus_tag LOCUS_20440 6572 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 7699 8271 gene locus_tag LOCUS_20450 7699 8271 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence076 928 104 gene locus_tag LOCUS_20460 928 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1036 2391 gene locus_tag LOCUS_20470 1036 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2959 2531 gene locus_tag LOCUS_20480 2959 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3158 4189 gene locus_tag LOCUS_20490 3158 4189 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_20490 5264 4302 gene locus_tag LOCUS_20500 5264 4302 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928819.1 protein_id gnl|my_center|LOCUS_20500 5333 6094 gene locus_tag LOCUS_20510 gene ubiE 5333 6094 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_20510 6303 7016 gene locus_tag LOCUS_20520 6303 7016 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_20520 7185 7769 gene locus_tag LOCUS_20530 gene sigY 7185 7769 CDS product RNA polymerase sigma factor SigY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243678.1 protein_id gnl|my_center|LOCUS_20530 7766 8617 gene locus_tag LOCUS_20540 7766 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence077 2854 4269 gene locus_tag LOCUS_20550 gene sthA 2854 4269 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_20550 4303 5448 gene locus_tag LOCUS_20560 4303 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6365 5466 gene locus_tag LOCUS_20570 6365 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7108 6404 gene locus_tag LOCUS_20580 gene phoU 7108 6404 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461595.1 protein_id gnl|my_center|LOCUS_20580 7199 8503 gene locus_tag LOCUS_20590 gene eno 7199 8503 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123706.1 protein_id gnl|my_center|LOCUS_20590 8743 9264 gene locus_tag LOCUS_20600 8743 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence078 236 895 gene locus_tag LOCUS_20610 236 895 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339773.1 protein_id gnl|my_center|LOCUS_20610 980 1258 gene locus_tag LOCUS_20620 980 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2749 1379 gene locus_tag LOCUS_20630 gene tig 2749 1379 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_20630 2848 2931 gene locus_tag LOCUS_t00360 2848 2931 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3872 2937 gene locus_tag LOCUS_20640 3872 2937 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_20640 5995 3872 gene locus_tag LOCUS_20650 5995 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 7875 5992 gene locus_tag LOCUS_20660 7875 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8312 7896 gene locus_tag LOCUS_20670 8312 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 <9369 8340 gene locus_tag LOCUS_20680 <9369 8340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706294.1:retention module-containing protein >Feature sequence079 316 77 gene locus_tag LOCUS_20690 316 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 642 2306 gene locus_tag LOCUS_20700 642 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2303 2773 gene locus_tag LOCUS_20710 2303 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3423 2770 gene locus_tag LOCUS_20720 3423 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 5717 3420 gene locus_tag LOCUS_20730 5717 3420 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_20730 5931 6413 gene locus_tag LOCUS_20740 5931 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6415 6840 gene locus_tag LOCUS_20750 6415 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 8728 6860 gene locus_tag LOCUS_20760 gene typA 8728 6860 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence080 697 71 gene locus_tag LOCUS_20770 697 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1635 679 gene locus_tag LOCUS_20780 gene gluQRS 1635 679 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922628.1 protein_id gnl|my_center|LOCUS_20780 1704 1985 gene locus_tag LOCUS_20790 1704 1985 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141644.1 protein_id gnl|my_center|LOCUS_20790 2004 3983 gene locus_tag LOCUS_20800 2004 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3980 4573 gene locus_tag LOCUS_20810 3980 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5199 4549 gene locus_tag LOCUS_20820 5199 4549 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_20820 6952 5366 gene locus_tag LOCUS_20830 gene purH 6952 5366 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_20830 8107 6986 gene locus_tag LOCUS_20840 8107 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 8305 8910 gene locus_tag LOCUS_20850 8305 8910 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907796.1 protein_id gnl|my_center|LOCUS_20850 8907 9107 gene locus_tag LOCUS_20860 8907 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence081 265 339 gene locus_tag LOCUS_t00370 265 339 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 459 677 gene locus_tag LOCUS_20870 459 677 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_20870 2281 761 gene locus_tag LOCUS_20880 2281 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2470 3009 gene locus_tag LOCUS_20890 2470 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3123 5108 gene locus_tag LOCUS_20900 3123 5108 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_20900 5105 6445 gene locus_tag LOCUS_20910 5105 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6637 7338 gene locus_tag LOCUS_20920 6637 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 7373 7582 gene locus_tag LOCUS_20930 7373 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 7582 8505 gene locus_tag LOCUS_20940 7582 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence082 154 80 gene locus_tag LOCUS_t00380 154 80 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 449 745 gene locus_tag LOCUS_20950 449 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1794 748 gene locus_tag LOCUS_20960 gene waaF 1794 748 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_20960 2666 1791 gene locus_tag LOCUS_20970 2666 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3333 2686 gene locus_tag LOCUS_20980 3333 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3473 4321 gene locus_tag LOCUS_20990 3473 4321 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_20990 4463 6682 gene locus_tag LOCUS_21000 4463 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 7133 8172 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgcaccgggcgacgccgccctgatcaatggacac >Feature sequence083 364 1302 gene locus_tag LOCUS_21010 364 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1464 1712 gene locus_tag LOCUS_21020 1464 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1888 2289 gene locus_tag LOCUS_21030 1888 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2312 3196 gene locus_tag LOCUS_21040 2312 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3302 3628 gene locus_tag LOCUS_21050 3302 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3770 4447 gene locus_tag LOCUS_21060 3770 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4496 5113 gene locus_tag LOCUS_21070 gene atpH 4496 5113 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_21070 5154 6359 gene locus_tag LOCUS_21080 5154 6359 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_21080 6405 6479 gene locus_tag LOCUS_t00390 6405 6479 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7556 6411 gene locus_tag LOCUS_21090 7556 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 8020 7553 gene locus_tag LOCUS_21100 8020 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence084 3776 708 gene locus_tag LOCUS_21110 3776 708 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_21110 3906 3834 gene locus_tag LOCUS_t00400 3906 3834 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5230 3956 gene locus_tag LOCUS_21120 gene waaA 5230 3956 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_21120 5332 7671 gene locus_tag LOCUS_21130 5332 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 7749 7674 gene locus_tag LOCUS_t00410 7749 7674 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 367 1926 gene locus_tag LOCUS_21140 367 1926 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_21140 1923 2780 gene locus_tag LOCUS_21150 1923 2780 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_21150 2799 3617 gene locus_tag LOCUS_21160 2799 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4655 3630 gene locus_tag LOCUS_21170 gene pheS 4655 3630 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_21170 5476 4778 gene locus_tag LOCUS_21180 gene rplQ 5476 4778 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 protein_id gnl|my_center|LOCUS_21180 6494 5541 gene locus_tag LOCUS_21190 6494 5541 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_21190 7086 6709 gene locus_tag LOCUS_21200 gene rpsK 7086 6709 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_21200 7495 7118 gene locus_tag LOCUS_21210 gene rpsM 7495 7118 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088133.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence086 22 942 gene locus_tag LOCUS_21220 22 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1053 1841 gene locus_tag LOCUS_21230 gene folE2 1053 1841 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_21230 2595 1855 gene locus_tag LOCUS_21240 gene rsmG 2595 1855 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_21240 3806 2592 gene locus_tag LOCUS_21250 gene rodA 3806 2592 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_21250 6135 3796 gene locus_tag LOCUS_21260 6135 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence087 811 1002 gene locus_tag LOCUS_21270 811 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 999 1340 gene locus_tag LOCUS_21280 999 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1437 2594 gene locus_tag LOCUS_21290 1437 2594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_21290 3016 2558 gene locus_tag LOCUS_21300 3016 2558 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428151.1 protein_id gnl|my_center|LOCUS_21300 3072 4046 gene locus_tag LOCUS_21310 3072 4046 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_21310 4655 4494 gene locus_tag LOCUS_21320 4655 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 7109 4851 gene locus_tag LOCUS_21330 7109 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21330 >Feature sequence088 1 714 gene locus_tag LOCUS_21340 1 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 717 1808 gene locus_tag LOCUS_21350 717 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5391 1840 gene locus_tag LOCUS_21360 gene metH 5391 1840 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_21360 5693 5451 gene locus_tag LOCUS_21370 5693 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6179 6253 gene locus_tag LOCUS_t00420 6179 6253 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6686 6477 gene locus_tag LOCUS_21380 6686 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 6772 6993 gene locus_tag LOCUS_21390 6772 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence089 <1 1044 gene locus_tag LOCUS_21400 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259203.1:phosphoribosylformylglycinamidine synthase subunit PurL 1104 2063 gene locus_tag LOCUS_21410 1104 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_21410 4942 2066 gene locus_tag LOCUS_21420 4942 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5906 5400 gene locus_tag LOCUS_21430 5906 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6078 6004 gene locus_tag LOCUS_t00430 6078 6004 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7041 6205 gene locus_tag LOCUS_21440 7041 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence090 694 1293 gene locus_tag LOCUS_21450 694 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1329 2174 gene locus_tag LOCUS_21460 gene accD 1329 2174 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_21460 2192 3889 gene locus_tag LOCUS_21470 gene lnt 2192 3889 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_21470 3886 4968 gene locus_tag LOCUS_21480 3886 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5264 6094 gene locus_tag LOCUS_21490 5264 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6133 6333 gene locus_tag LOCUS_21500 6133 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 6630 6704 gene locus_tag LOCUS_t00440 6630 6704 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 226 768 gene locus_tag LOCUS_21510 226 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1708 761 gene locus_tag LOCUS_21520 gene cyoE 1708 761 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_21520 3028 1817 gene locus_tag LOCUS_21530 3028 1817 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838418.1 protein_id gnl|my_center|LOCUS_21530 5117 3627 gene locus_tag LOCUS_21540 5117 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5800 5210 gene locus_tag LOCUS_21550 5800 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 5970 6314 gene locus_tag LOCUS_21560 5970 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6660 6588 gene locus_tag LOCUS_t00450 6660 6588 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence092 1244 99 gene locus_tag LOCUS_21570 1244 99 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_21570 2266 1385 gene locus_tag LOCUS_21580 2266 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2348 4021 gene locus_tag LOCUS_21590 2348 4021 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_21590 4186 6231 gene locus_tag LOCUS_21600 4186 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 <7013 6299 gene locus_tag LOCUS_21610 <7013 6299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249477.1:alpha/beta hydrolase-fold protein >Feature sequence093 490 563 gene locus_tag LOCUS_t00460 490 563 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 579 1373 gene locus_tag LOCUS_21620 579 1373 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_21620 1370 2362 gene locus_tag LOCUS_21630 1370 2362 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_21630 2374 3018 gene locus_tag LOCUS_21640 2374 3018 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_21640 3024 3704 gene locus_tag LOCUS_21650 gene pth 3024 3704 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_21650 3701 4240 gene locus_tag LOCUS_21660 3701 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4262 4729 gene locus_tag LOCUS_21670 4262 4729 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_21670 5877 4810 gene locus_tag LOCUS_21680 5877 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 6748 6023 gene locus_tag LOCUS_21690 6748 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence094 1579 788 gene locus_tag LOCUS_21700 1579 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1794 4064 gene locus_tag LOCUS_21710 1794 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4269 6284 gene locus_tag LOCUS_21720 4269 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence095 232 510 gene locus_tag LOCUS_21730 232 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 519 1409 gene locus_tag LOCUS_21740 gene thiL 519 1409 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_21740 1415 2044 gene locus_tag LOCUS_21750 1415 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2065 2817 gene locus_tag LOCUS_21760 2065 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2822 3229 gene locus_tag LOCUS_21770 2822 3229 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_21770 3289 3666 gene locus_tag LOCUS_21780 3289 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3847 5127 gene locus_tag LOCUS_21790 3847 5127 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_21790 6582 5176 gene locus_tag LOCUS_21800 6582 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence096 1276 2259 gene locus_tag LOCUS_21810 1276 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2289 2780 gene locus_tag LOCUS_21820 2289 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3651 2806 gene locus_tag LOCUS_21830 3651 2806 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_21830 4394 3648 gene locus_tag LOCUS_21840 4394 3648 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_21840 4643 5770 gene locus_tag LOCUS_21850 4643 5770 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_21850 5822 6568 gene locus_tag LOCUS_21860 5822 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence097 174 3398 gene locus_tag LOCUS_21870 174 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_21870 4256 3495 gene locus_tag LOCUS_21880 4256 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 6263 4269 gene locus_tag LOCUS_21890 6263 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence098 59 1429 gene locus_tag LOCUS_21900 59 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1785 2480 gene locus_tag LOCUS_21910 1785 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3845 2484 gene locus_tag LOCUS_21920 3845 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3891 4559 gene locus_tag LOCUS_21930 3891 4559 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_21930 5086 4592 gene locus_tag LOCUS_21940 5086 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5334 5092 gene locus_tag LOCUS_21950 gene rpsR 5334 5092 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 protein_id gnl|my_center|LOCUS_21950 5997 5455 gene locus_tag LOCUS_21960 5997 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence099 1021 752 gene locus_tag LOCUS_21970 1021 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1240 1875 gene locus_tag LOCUS_21980 1240 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2709 1894 gene locus_tag LOCUS_21990 2709 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3097 2711 gene locus_tag LOCUS_22000 3097 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3611 3171 gene locus_tag LOCUS_22010 gene zntR 3611 3171 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 protein_id gnl|my_center|LOCUS_22010 4187 3696 gene locus_tag LOCUS_22020 4187 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 4507 4196 gene locus_tag LOCUS_22030 4507 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4899 4507 gene locus_tag LOCUS_22040 4899 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5301 4903 gene locus_tag LOCUS_22050 5301 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence100 1407 2957 gene locus_tag LOCUS_22060 1407 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3128 3553 gene locus_tag LOCUS_22070 3128 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3563 3970 gene locus_tag LOCUS_22080 3563 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3967 4695 gene locus_tag LOCUS_22090 3967 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 <5628 4789 gene locus_tag LOCUS_22100 <5628 4789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002204714.1:carbon-nitrogen family hydrolase >Feature sequence101 1406 237 gene locus_tag LOCUS_22110 1406 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1927 1469 gene locus_tag LOCUS_22120 1927 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 3420 1945 gene locus_tag LOCUS_22130 3420 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3908 3660 gene locus_tag LOCUS_22140 3908 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 3967 5052 gene locus_tag LOCUS_22150 gene lgt 3967 5052 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369928.1 protein_id gnl|my_center|LOCUS_22150 <5627 5054 gene locus_tag LOCUS_22160 <5627 5054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057642364.1:DUF368 domain-containing protein >Feature sequence102 337 1113 gene locus_tag LOCUS_22170 337 1113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_22170 1106 1789 gene locus_tag LOCUS_22180 1106 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1826 2761 gene locus_tag LOCUS_22190 1826 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3949 2855 gene locus_tag LOCUS_22200 3949 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4969 4088 gene locus_tag LOCUS_22210 4969 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence103 1045 1980 gene locus_tag LOCUS_22220 1045 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3615 2104 gene locus_tag LOCUS_22230 3615 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 4235 3606 gene locus_tag LOCUS_22240 gene purN 4235 3606 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_22240 4639 4232 gene locus_tag LOCUS_22250 4639 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4686 4982 gene locus_tag LOCUS_22260 4686 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence104 715 188 gene locus_tag LOCUS_22270 gene fabZ 715 188 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_22270 874 719 gene locus_tag LOCUS_22280 874 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2022 991 gene locus_tag LOCUS_22290 2022 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2923 2093 gene locus_tag LOCUS_22300 gene rsmA 2923 2093 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804943.1 protein_id gnl|my_center|LOCUS_22300 3843 2926 gene locus_tag LOCUS_22310 3843 2926 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_22310 5133 3859 gene locus_tag LOCUS_22320 5133 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5326 5123 gene locus_tag LOCUS_22330 5326 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence105 1456 551 gene locus_tag LOCUS_22340 1456 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2720 1689 gene locus_tag LOCUS_22350 2720 1689 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_22350 3739 2717 gene locus_tag LOCUS_22360 gene plsX 3739 2717 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_22360 4156 3764 gene locus_tag LOCUS_22370 4156 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4248 4321 gene locus_tag LOCUS_t00470 4248 4321 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <5325 4794 gene locus_tag LOCUS_22380 <5325 4794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:S8 family peptidase >Feature sequence106 950 75 gene locus_tag LOCUS_22390 950 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115940.1 protein_id gnl|my_center|LOCUS_22390 1037 2509 gene locus_tag LOCUS_22400 gene nrfD 1037 2509 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence107 115 369 gene locus_tag LOCUS_22410 115 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 435 1127 gene locus_tag LOCUS_22420 435 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1099 1764 gene locus_tag LOCUS_22430 1099 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1761 2366 gene locus_tag LOCUS_22440 1761 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2502 2651 gene locus_tag LOCUS_22450 2502 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3000 4403 gene locus_tag LOCUS_22460 3000 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 <5165 4459 gene locus_tag LOCUS_22470 <5165 4459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898036.1:metallophosphoesterase >Feature sequence108 1580 381 gene locus_tag LOCUS_22480 1580 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4046 1584 gene locus_tag LOCUS_22490 4046 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4483 4100 gene locus_tag LOCUS_22500 4483 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 5061 4477 gene locus_tag LOCUS_22510 5061 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence109 2169 1264 gene locus_tag LOCUS_22520 2169 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2552 2166 gene locus_tag LOCUS_22530 2552 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence110 1047 124 gene locus_tag LOCUS_22540 gene ftsY 1047 124 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_22540 1478 1047 gene locus_tag LOCUS_22550 gene nusB 1478 1047 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_22550 2017 1475 gene locus_tag LOCUS_22560 gene ribE 2017 1475 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864130.1 protein_id gnl|my_center|LOCUS_22560 2981 2073 gene locus_tag LOCUS_22570 gene pstB 2981 2073 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 protein_id gnl|my_center|LOCUS_22570 4859 2997 gene locus_tag LOCUS_22580 4859 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 >Feature sequence111 111 2039 gene locus_tag LOCUS_22590 111 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4448 2169 gene locus_tag LOCUS_22600 4448 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence112 139 1590 gene locus_tag LOCUS_22610 139 1590 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_22610 1587 2027 gene locus_tag LOCUS_22620 1587 2027 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_22620 2035 3111 gene locus_tag LOCUS_22630 2035 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 4384 3245 gene locus_tag LOCUS_22640 4384 3245 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870110.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence113 <1 1874 gene locus_tag LOCUS_22650 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403313.1:M1 family metallopeptidase 1938 3701 gene locus_tag LOCUS_22660 1938 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence114 <1 569 gene locus_tag LOCUS_22670 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228173.1:metal-dependent transcriptional regulator 1282 572 gene locus_tag LOCUS_22680 gene queC 1282 572 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_22680 1417 2232 gene locus_tag LOCUS_22690 1417 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2297 3265 gene locus_tag LOCUS_22700 2297 3265 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_22700 4507 3293 gene locus_tag LOCUS_22710 4507 3293 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence115 2287 1157 gene locus_tag LOCUS_22720 2287 1157 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_22720 2432 3325 gene locus_tag LOCUS_22730 2432 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3577 4218 gene locus_tag LOCUS_22740 3577 4218 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392851.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence116 518 679 gene locus_tag LOCUS_22750 518 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2110 710 gene locus_tag LOCUS_22760 2110 710 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_22760 4260 2173 gene locus_tag LOCUS_22770 gene thrS 4260 2173 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence117 48 200 gene locus_tag LOCUS_22780 48 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 216 2168 gene locus_tag LOCUS_22790 216 2168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_22790 2290 2217 gene locus_tag LOCUS_t00480 2290 2217 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2388 4172 gene locus_tag LOCUS_22800 2388 4172 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence118 150 1658 gene locus_tag LOCUS_22810 150 1658 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_22810 1713 2669 gene locus_tag LOCUS_22820 gene fabD 1713 2669 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_22820 2693 3778 gene locus_tag LOCUS_22830 2693 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence119 2827 32 gene locus_tag LOCUS_22840 2827 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3922 2951 gene locus_tag LOCUS_22850 gene pstS 3922 2951 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence120 2531 489 gene locus_tag LOCUS_22860 2531 489 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_22860 2732 3232 gene locus_tag LOCUS_22870 2732 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3273 3728 gene locus_tag LOCUS_22880 3273 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence121 642 4 gene locus_tag LOCUS_22890 642 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1996 695 gene locus_tag LOCUS_22900 1996 695 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_22900 2549 2019 gene locus_tag LOCUS_22910 2549 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3925 2576 gene locus_tag LOCUS_22920 3925 2576 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119514.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence122 3821 1062 gene locus_tag LOCUS_22930 3821 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence123 1254 67 gene locus_tag LOCUS_22940 1254 67 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_22940 1328 1978 gene locus_tag LOCUS_22950 1328 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2035 2964 gene locus_tag LOCUS_22960 2035 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 <3763 3031 gene locus_tag LOCUS_22970 <3763 3031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838741.1:MBL fold metallo-hydrolase >Feature sequence124 1911 568 gene locus_tag LOCUS_22980 1911 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2663 1908 gene locus_tag LOCUS_22990 2663 1908 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_22990 3256 2660 gene locus_tag LOCUS_23000 3256 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence125 <1 595 gene locus_tag LOCUS_23010 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941973.1:ATP-binding protein 1490 636 gene locus_tag LOCUS_23020 1490 636 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_23020 1789 1523 gene locus_tag LOCUS_23030 1789 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1965 2777 gene locus_tag LOCUS_23040 1965 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence126 859 1434 gene locus_tag LOCUS_23050 859 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2005 3057 gene locus_tag LOCUS_23060 gene trpD 2005 3057 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence127 135 959 gene locus_tag LOCUS_23070 135 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1559 1008 gene locus_tag LOCUS_23080 1559 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2514 1597 gene locus_tag LOCUS_23090 gene ubiA 2514 1597 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_23090 <3426 2526 gene locus_tag LOCUS_23100 <3426 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531362.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence128 <1 1102 gene locus_tag LOCUS_23110 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase C-terminal domain-containing protein 1198 2607 gene locus_tag LOCUS_23120 1198 2607 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080843.1 protein_id gnl|my_center|LOCUS_23120 <3289 2640 gene locus_tag LOCUS_23130 <3289 2640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002319708.1:DNA helicase PcrA >Feature sequence129 18 710 gene locus_tag LOCUS_23140 18 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 742 984 gene locus_tag LOCUS_23150 742 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 994 1905 gene locus_tag LOCUS_23160 994 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1916 2701 gene locus_tag LOCUS_23170 1916 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence130 2916 97 gene locus_tag LOCUS_23180 2916 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence131 51 1859 gene locus_tag LOCUS_23190 51 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2732 1935 gene locus_tag LOCUS_23200 2732 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence132 1826 1512 gene locus_tag LOCUS_23210 1826 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2315 1896 gene locus_tag LOCUS_23220 2315 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2765 2322 gene locus_tag LOCUS_23230 gene flgB 2765 2322 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence133 603 4 gene locus_tag LOCUS_23240 603 4 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_23240 602 808 gene locus_tag LOCUS_23250 602 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2329 1817 gene locus_tag LOCUS_23260 2329 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence134 >Feature sequence135 129 605 gene locus_tag LOCUS_23270 129 605 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_23270 697 1125 gene locus_tag LOCUS_23280 697 1125 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173534.1 protein_id gnl|my_center|LOCUS_23280 1248 2687 gene locus_tag LOCUS_23290 1248 2687 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence136 1337 3 gene locus_tag LOCUS_23300 1337 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2367 1552 gene locus_tag LOCUS_23310 gene trpC 2367 1552 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence137 362 159 gene locus_tag LOCUS_23320 362 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 546 355 gene locus_tag LOCUS_23330 546 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1716 628 gene locus_tag LOCUS_23340 1716 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence138 1355 1200 gene locus_tag LOCUS_23350 1355 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350